JP2003171275A - Ppar delta agonist - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a PPARδ agonist that is effective for treatment of hyperlipemia or atherosclerosis. <P>SOLUTION: The PPARδ agonist has the following chemical formula (1) (wherein R<SP>1</SP>is H, a halogen, an alkyl or an alkoxy; R<SP>2</SP>is H or an alkyl; R<SP>3</SP>and R<SP>4</SP>are each a halogen, an alkyl, an alkoxy, a cycloalkyl or carbamoyl; or R<SP>3</SP>and R<SP>4</SP>may incorporate to form a 5-7-membered ring including 0-2 oxygens; X<SP>1</SP>is a single bond or an oxygen or sulfur atom; X<SP>2</SP>is a single bond or an oxygen; Y is a carboxyl or a group that is hydrolyzed in vivo to regenerate a carboxyl group; W<SP>1</SP>and W<SP>2</SP>are each a single bond or an alkylene chain and W<SP>3</SP>is a single bond, a carbonyl group or an alkylene group). <P>COPYRIGHT: (C)2003,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a PPARδ agonist. More specifically, the present invention relates to a blood lipid lowering agent containing a PPARδ agonist as an active ingredient.

[0002]

2. Description of the Related Art A peroxisome proliferator responsive receptor which is one of retinoid-related receptors (herein, PPA
Δ is a subtype of peroxisome proliferator-activated receptor (PPAR),
Tissue specificity is not observed at the expression site, and it is universally expressed. PPARδ is also sometimes referred to as PPARβ or, in the case of humans, NUC1. PPA
Regarding the functional study of Rδ, the identification of the function was delayed compared with other types (α, γ). However, recently, PPARδ-deficient mice were created, and phenotypes have been reported, and it has become clear that they are involved in lipid metabolism, development / differentiation, or tumor formation. Further, a PPARδ agonist is effective in increasing the amount of HDL in plasma and in treating / preventing atherosclerotic coronary sclerosis,
It has been reported that the combined use with an HMG-CoA reductase inhibitor is effective in treating / preventing atherosclerotic coronary arteriosclerosis (WO97 / 28149), and is expected as a drug. However, there are few reports of a ligand that significantly activated the PPARδ receptor and a biological activity involving the PPARδ receptor. So far, as the biological activity of PPARδ, in WO96 / 01430, h
NUC1B (PP that differs from human NUC1 by one amino acid
It has been shown that (AR subtype) can suppress the transcriptional activity of human PPARα and thyroid hormone receptor.
In addition, recently, in WO 97/28149, it has a high affinity for the PPARδ protein,
A compound (agonist) that significantly activates
Furthermore, those compounds increase the amount of HDL (high density lipoprotein) in plasma, are effective in treating and preventing atherosclerotic coronary arteriosclerosis, and are used in combination with an HMG-CoA reductase inhibitor. Have been reported to be effective in treating / preventing atherosclerotic coronary arteriosclerosis. Therefore, an agonist capable of activating PPARδ includes HD
L-cholesterol elevation action, inhibition of arteriosclerosis development by it, its treatment, and application as lipid lowering agent and hypoglycemic agent are expected. However, it is not known that it has sufficient activity and is clinically applied. Further, it has not been known so far about the pyrrole derivative of the present invention that it activates PPARδ or has a blood lipid lowering action.

[0003]

In the present invention, PPARδ
The purpose is to develop a pharmaceutical composition having an agonistic effect. Specifically, the present invention aims to develop a blood lipid lowering agent containing a PPARδ agonist as an active ingredient.

[0004]

Means for Solving the Problems The inventors of the present invention have conducted extensive studies to solve the above-mentioned problems, and as a result, found that the pyrrole derivative has a PPARδ agonistic effect, and further studied to further improve the present invention. It came to completion.

[0005] That is, the present invention is: (1) Formula (1)

[Chemical 7] (In the formula, R ¹ represents a hydrogen atom, a halogen atom, an alkyl group having 1 to 4 carbon atoms or an alkoxy group having 1 to 4 carbon atoms, and R ² represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms. , R ³ is a halogen atom, an unsubstituted or substituted alkyl group having 1 to 4 carbon atoms, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, or an alkyl group having 5 to 7 carbon atoms. Represents a cycloalkyl group or a carbamoyl group, R ⁴ represents a hydrogen atom, a halogen atom, an unsubstituted or substituted C 1 to C ⁴ alkyl group, or an unsubstituted or substituted C 1 4 represents an alkoxy group, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, or R
³ , R ⁴ may together form an unsubstituted or optionally substituted oxygen atom to form a 5- to 7-membered ring containing 0 to 2, X ¹ is a single bond, an oxygen atom or a sulfur atom. , X ² represents a single bond or an oxygen atom, Y represents a carboxyl group or a group which is hydrolyzed in vivo to regenerate the carboxyl group, W ¹ is a single bond or an unsubstituted or substituted carbon atom. Represents an alkylene chain of the number 1 to 4, W ² is an unsubstituted or optionally substituted carbon number 1
Represents an alkylene chain or an optionally substituted alkenylene chain having a carbon number of 3 to 4 of 4, W ³ is a single bond,
A carbonyl group and an alkylene group having 1 to 4 carbon atoms are represented. ) A PPARδ agonist represented by

(2) The PPARδ agonist according to claim 1, wherein W ³ is a carbonyl group. (3) P according to claim 1, wherein Y is a carboxyl group.
PARδ agonist.

(4) Formula (2)

[Chemical 8] (In the formula, R ¹ represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an alkoxy group having 1 to 4 carbon atoms, which is located at the 2 or 3 position, and R ³ is a halogen atom, unsubstituted or substituted. Optionally represents an alkyl group having 1 to 4 carbon atoms, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, and R ⁴ is Hydrogen atom, halogen atom, unsubstituted or optionally substituted alkyl group having 1 to 4 carbon atoms, unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, cycloalkyl having 5 to 7 carbon atoms Represents a group or a carbamoyl group, or R
³ , R ⁴ may together form an unsubstituted or optionally substituted oxygen atom to form a 5- to 7-membered ring containing 0 to 2, X ¹ is a single bond, an oxygen atom or a sulfur atom. In the formula, X ² represents a single bond or an oxygen atom, W ¹ represents a single bond or is unsubstituted or may have 1 to 4 carbon atoms which may be substituted.
The alkylene chain, W ² represents an unsubstituted or optionally substituted from a good 1 -C 4 alkylene chain or an optionally substituted alkenylene chain having a carbon number of 3 to 4. ) A PPARδ agonist represented by

[0008] Equation (3)

[Chemical 9] (In the formula, X ¹ and X ^{2 each} represent a single bond or an oxygen atom, W ¹ represents an alkylene chain having 1 to 4 carbon atoms, R ³ represents a halogen atom, unsubstituted or optionally substituted 1 carbon atom 4 represents an alkyl group, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, and R ⁴ represents
Hydrogen atom, halogen atom, unsubstituted or optionally substituted alkyl group having 1 to 4 carbon atoms, unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms,
It represents a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, or R ³ and R ⁴ are taken together to form a 5 to 7 membered ring containing 0 to 2 unsubstituted or optionally substituted oxygen atoms. W ² may represent an alkylene chain having 1 to 4 carbon atoms which may be unsubstituted or substituted, or an alkenylene chain having 3 to 4 carbon atoms which may be substituted. ) A PPARδ agonist represented by

(6) Formula (4)

[Chemical 10] (In the formula, W ² represents an alkenylene chain having 3 to 4 carbon atoms, R ³ represents a halogen atom, an unsubstituted or optionally substituted alkyl group having 1 to 4 carbon atoms, unsubstituted or substituted. Which represents an alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms, or a carbamoyl group).

(7) Formula (5)

[Chemical 11] (In the formula, W ² represents an alkenylene chain having 3 to 4 carbon atoms, R ³ represents a halogen atom, an unsubstituted or optionally substituted alkyl group having 1 to 4 carbon atoms, unsubstituted or substituted. Which represents an alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group).

(8) Formula (6)

[Chemical 12] (In the formula, R ¹ represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an alkoxy group having 1 to 4 carbon atoms, which is located at the 2 or 3 position, and R ³ is a halogen atom, unsubstituted or substituted. Optionally represents an alkyl group having 1 to 4 carbon atoms, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, and X ¹ is a single group. Represents a bond, an oxygen atom or a sulfur atom, and W ¹ represents a single bond or an unsubstituted or optionally substituted alkylene chain having 1 to 4 carbon atoms). (9) A blood lipid lowering agent comprising the PPARδ agonist according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof as an active ingredient. (10) PPARδ according to any one of claims 1 to 8.
A therapeutic or prophylactic agent for atherosclerotic coronary sclerosis, which comprises an agonist or a pharmaceutically acceptable salt thereof as an active ingredient.

The functional groups in formulas (1) to (7) are as described below. Examples of the alkyl having 1 to 4 carbon atoms include methyl, ethyl, propyl, 2-propyl, butyl, 2-butyl and 2-methylpropyl. As the alkoxy having 1 to 4 carbon atoms, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, 2-butoxy, 2-
Methyl propoxy is mentioned. Examples of the cycloalkyl group having 5 to 7 carbon atoms include cyclopentyl, cyclohexyl and cycloheptyl. 0 to 2 oxygen atoms
Examples of the 5- to 7-membered ring include cyclopentane, cyclohexane, cycloheptane, tetrahydrofuran, tetrahydropyran, 1,3-dioxolane, dioxacyclohexane and dioxacycloheptane. Examples of the halogen atom include a fluorine atom, a chlorine atom, a bromine atom and an iodine atom.

[0013] Examples of the alkylene chain having 1 to 4 carbon atoms include methylene, ethylene, propylene, 1-methylethylene, butylene, 1-methylpropylene and 2-methylpropylene. Examples of the alkenylene chain having 3 to 4 carbon atoms include propenylene, 1-butenylene, 2-butenylene,
Methyl propenylene is mentioned. Includes an optionally substituted alkyl group having 1 to 4 carbon atoms, an optionally substituted alkoxy group having 1 to 4 carbon atoms, and an optionally substituted oxygen atom having 1 to 4 carbon atoms, including 0 to 2 A 5- to 7-membered ring, an optionally substituted alkylene chain having 1 to 4 carbon atoms, and an optionally substituted alkenylene chain having 3 to 4 carbon atoms include a halogen atom and a C 1 to 4 carbon atom. Examples thereof include an alkyl group and an alkoxy group having 1 to 4 carbon atoms. The substitution position is not limited as long as it is a chemically feasible position, and substitution at a single location or a plurality of locations is possible. The group that is hydrolyzed in vivo to regenerate a carboxyl group is represented by the formula (7):

[Chemical 13] [In the formula, R ⁶ and R ⁷ represent a hydrogen atom or an alkyl group having 1 to 4 carbon atoms. n represents 0 or 1. ] Or
Formula (8):

[Chemical 14] [In the formula, R ⁸ represents an alkyl group having 1 to 4 carbon atoms. ]
Represents

The heterocyclic compound which is the active ingredient of the medicament of the present invention can be converted into a pharmaceutically acceptable salt. Examples of the pharmaceutically acceptable salt include an acid addition salt and a base addition salt. As the acid addition salt, for example, hydrochloride, hydrobromide,
Inorganic acid salts such as sulfate, organic acid salts such as citrate, oxalate, malate, tartrate, fumarate, maleate and the like can be mentioned. Examples of the base addition salt include sodium. Alkali metal salts such as salts and potassium salts, alkaline earth metal salts such as calcium salts and magnesium salts, inorganic metal salts such as zinc salts, and organic base salts such as triethylamine, triethanolamine, and trishydroxymethylaminomethane salt. To be The present invention also includes solvates such as hydrates of pyrrole derivatives or pharmaceutically acceptable salts thereof.

[0015] The pyrrole derivative represented by the formula (1) or a pharmaceutically acceptable salt thereof can be produced by the following method or a method analogous thereto.

[0016] A pyrrole derivative represented by the formula (1) or a pharmaceutically acceptable salt thereof, which may cause asymmetry or which may have a substituent having an asymmetric carbon. Exists as an optical isomer. The compound of the present invention includes a mixture of each of these isomers and an isolated one. Examples of a method for obtaining such optical isomers purely include optical resolution.

As the optical resolution method, a pyrrole derivative or an intermediate thereof is used in an inert solvent (for example, methanol or ethanol).
Alcohol, solvent such as 2-propanol, ether solvent such as diethyl ether, ester solvent such as ethyl acetate, aromatic hydrocarbon solvent such as toluene, acetonitrile and the like, and mixtures thereof. Solvent), optically active acid (eg, mandelic acid, N-benzyloxyalanine, monocarboxylic acids such as lactic acid, tartaric acid, o-diisopropylidene tartaric acid, dicarboxylic acids such as malic acid, camphor sulfonic acid, bromocamphor It is also possible to form a salt with a sulfonic acid such as sulfonic acid). When the pyrrole derivative or an intermediate thereof has an acidic substituent such as a carboxyl group, an optically active amine (for example, α
-Phenethylamine, quinine, quinidine, cinchonidine, cinchonine, organic amines such as strychnine), and salts can also be formed.

[0018] Examples of the temperature for forming the salt include a range of room temperature to the boiling point of the solvent. In order to improve the optical purity, it is desirable to once raise the temperature to around the boiling point of the solvent. The precipitated salt can be cooled, if necessary, before being collected by filtration to improve the yield. The amount of the optically active acid or amine used is appropriately in the range of about 0.5 to about 2.0 equivalents, preferably about 1 equivalent, relative to the substrate.
If necessary, the crystals are placed in an inert solvent (for example, alcohol solvent such as methanol, ethanol and 2-propanol, ether solvent such as diethyl ether, ester solvent such as ethyl acetate). , An aromatic hydrocarbon solvent such as toluene, acetonitrile or a mixed solvent thereof)
It is also possible to obtain a highly pure optically active salt. If desired, the obtained salt can be treated with an acid or a base by a conventional method to obtain a free form.

[0019] The PPARδ agonist of the present invention can be administered orally or parenterally. When administered orally, it can be administered in a commonly used dosage form.
Parenterally, it can be administered in the form of a topical agent, injection, transdermal agent, nasal agent and the like. The above-mentioned dosage forms are prepared by a conventional method together with pharmaceutically acceptable excipients and additives. As pharmaceutically acceptable excipients and additives, carriers, binders, perfumes, buffers, thickeners, colorants, stabilizers,
Examples thereof include emulsifiers, dispersants, suspending agents and preservatives.

[0020] Examples of the pharmaceutically acceptable carrier include magnesium carbonate, magnesium stearate, talc,
Examples thereof include sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, low-melting wax and cocoa butter. Capsules can be prepared by incorporating a compound of the invention with a pharmaceutically acceptable carrier. The pyrrole derivative of the present invention or a salt thereof can be mixed with a pharmaceutically acceptable excipient or encapsulated without an excipient. The cachet can be manufactured in the same manner.

[0021] Examples of the injectable solution include solutions, suspensions and emulsions. For example, aqueous solution, water-propylene glycol-
Solution and the like. The liquid preparation may contain water, and may be polyethylene glycol or / and propylene glycol.
It is also possible to produce it in the form of a solution. A solution suitable for oral administration can be produced by adding the compound of the present invention to water, and optionally adding a colorant, a flavor, a stabilizer, a sweetener, a solubilizer, a thickener, and the like. In addition, a liquid formulation suitable for oral administration is
It can also be produced by adding a pyrrole derivative represented by the formula (1) or a pharmaceutically acceptable salt thereof to water together with a dispersant to make the mixture viscous. Examples of the thickener include pharmaceutically acceptable natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and known suspending agents.

[0022] As the topical administration agent, the above-mentioned liquid agent and clear
Examples thereof include aerosols, aerosols, sprays, powders, lotions and ointments. The above-mentioned topical administration agent can be produced by mixing the pyrrole derivative represented by the formula (1) or a pharmaceutically acceptable salt thereof with a pharmaceutically acceptable diluent and carrier that are commonly used. Ointments and creams can be obtained, for example, by formulating an aqueous or oily base with a thickening agent and / or a gelling agent. Examples of the base include water, liquid paraffin, vegetable oil (peanut oil, castor oil, etc.) and the like. Examples of the thickener include soft paraffin, aluminum stearate, cetostearyl alcohol, propylene glycol, polyethylene glycol.
And lanolin, hydrogenated lanolin, beeswax and the like. The lotion is prepared by adding one or more pharmaceutically acceptable stabilizers, suspending agents, emulsifiers, diffusing agents, thickeners, coloring agents, perfumes, etc. to an aqueous or oily base. You can

[0023] The powder is formulated with a pharmaceutically acceptable powder base. Examples of the base include talc, lactose, starch and the like. Drops can be formulated with an aqueous or non-aqueous base and one or more pharmaceutically acceptable diffusing agents, suspending agents, solubilizing agents and the like. The topical agent may optionally contain a preservative such as methyl hydroxybenzoate, propyl hydroxybenzoate, chlorocresol, benzalkonium chloride, and a bacterial growth inhibitor. A liquid spray, a powder, or a drop preparation containing the pyrrole derivative represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient can be administered intranasally. The dose and frequency of administration vary depending on symptoms, age, body weight, administration form, etc., but when administered orally, it is usually 1 for adults.
The range of about 1 to about 500 mg, preferably the range of about 5 to about 100 mg per day can be administered once or in several divided doses. When administered as an injection, it may be administered in the range of about 0.1 to about 300 mg, preferably in the range of about 1 to about 100 mg, once or several times.

[0024] Hereinafter, the manufacturing method of the present invention will be described in detail.

[0025] The pyrrole derivative of the present invention can be produced, for example, according to the following production method.

[Chemical 15]

[In the formula, ring Z is

[Chemical 16] Represents an optionally substituted pyrrole ring represented by: Ar ¹
Is

[Chemical 17] Represents a substituted benzene ring, and Ar ² is

[Chemical 18] Represents a substituted benzene ring. R ¹ , R ² , R ³ ,
R ⁴ , X ¹ , X ² , Y, W ¹ , W ² , and W ³ have the same meanings as described above. ]

[0027] Ar¹-X^Two-W^Two-Group and Ar^Two-W^Three
The group of-is attached to the ring Z to give the pyrrole of the present invention.
Derivatives can be prepared. Ar¹-X^Two-W^Two−
Group and Ar^Two-W^ThreeA reaction between the group of-and the ring Z
For example, the following reactions can be exemplified.
It (1) Freeder Crafts reaction (2) Carbon-carbon multiple bond compounds in the presence of palladium catalyst
Of organic or organometallic compounds with organic halides (3) Nucleophilic substitution reaction for the corresponding organic halide (4) Reaction of carbonyl compounds with organometallic compounds (5) Reaction of carboxylic acid derivative with organometallic compound (6) Wittig reaction, Horner-Emmons reaction These reactions are merely exemplary and are familiar to organic synthesis.
Other manufacturing methods as appropriate based on the knowledge of
You can also do it. Further, in this manufacturing method, W ^TwoOr
W^ThreeGroup is first bonded to ring Z, and later Ar¹Or Ar
^TwoIt is also possible to attach the groups of How to combine that
As the above, the same ones as those used for the reaction with ring Z above are used.
be able to.

[0028] In each of the above reactions, the functional group can be protected if necessary. For the protecting group and its protection and deprotection conditions, see Green et al. (TW Greene and P.
GM Wuts, "Protecting Groups in Organic Synthesi
s ", 1991, JOHN WILEY & SONS, INC.). The double bonds, hydroxyl groups, carbonyls, etc., produced by the above reactions may be hydrogenated, reduced,
It is also possible to carry out oxidation and the like. Also, after each of the above reactions,
It is also possible to convert a functional group into another functional group. The conversion reaction of these functional groups can be carried out with reference to, for example, the following papers. "Experimental Chemistry" Volume 19-26 (1992, Maruzen) "Precision Organic Synthesis" (1983, Nankodo) Compendium of Organic Synthetic Methods, Vol. 1-9
(John Wiley & Sons) Comprehensive Organic Synthesis, Vol. 1-9 (1991,
Pergamon Press) Comprehensive Organic Transformations (1989, VCH P
ublishers) Survey of Organic Syntheses, Vol. 1-2 (1970, 197)
(7, John Wiley & Sons)

[0029] For example, for the reduction of the hydroxyl group existing at the 1-position of the alkylene bonded to the ring Z, a complex reducing agent such as sodium borohydride / isopropanol or triethylsilane-trifluoroacetic acid can be used. It can be carried out. Examples of the reaction solvent include tetrahydrofuran (THF), dioxane, dichloromethane, chlorobenzene and the like, and the reaction can be carried out at a temperature in the range of about −20 ° C. to the boiling point of the solvent. Further, the reduction of carbonyl to methylene can be carried out by using, for example, a composite reducing agent such as sodium borohydride / isopropanol, hydrazine / potassium hydroxide or sodium hydroxide, zinc amalgam / hydrochloric acid and the like. it can. Examples of the reaction solvent include THF and dioxane, and
The reaction can be carried out at a temperature ranging from the degree to the boiling point of the solvent.

[0030] For example, as the oxidation of the hydroxyl group existing at the 1-position of the alkylene bonded to the ring Z, an oxidizing agent such as manganese dioxide, 4-methylmorpholine-4-oxide / tetra-n-propylammonium peroxide is used. It can be carried out by using a complex oxidizing agent such as ruthenate. Examples of the reaction solvent include THF, dioxane, dichloromethane, chlorobenzene, chloroform and the like, and the reaction can be carried out at a temperature in the range of about 0 degree to the boiling point of the solvent.

(1) Freeder-Crafts reaction

[Chemical 19] [In the formula, the ring Z has the same meaning as described above. Q represents an organic group.
X represents a chlorine atom, a bromine atom or the like. ] The Friedel-Crafts reaction is described in, for example, J. Org. Chem. 19
83 , 48, 3214-3219 and the like, and Q- can be introduced on the carbon atom of ring Z. In this reaction, preferable examples of Q-X include alkyl halides and acid halides. Specifically, aluminum chloride, trifluoroborane-ether complex, titanium tetrachloride, in the presence of a Lewis acid such as zinc chloride, dichloromethane, in an inert solvent such as dichloroethane, usually in the range of room temperature to the boiling point of the solvent It can be reacted at temperature.

[0032] It is preferable to protect the nitrogen atom at the 1-position of the pyrrole ring with phenylsulfonyl (or toluylsulfonyl, etc.) to carry out the Friedel-Crafts reaction. Protecting the 1-position with phenylsulfonyl can be carried out, for example, by reacting with phenylsulfonyl chloride in the presence of a base such as NaH. For example, in the case of a pyrrole ring protected with phenylsulfonyl, the reaction position can be controlled by the type of Lewis acid. For example, using AlCl ₃
It can react at the 3rd position (J. Org. Chem. 1983 , 48,
3214-3219) and BF ₃ · OEt ₂ can be used to react at the 2-position. After the Friedel-Crafts reaction, phenylsulfonyl can be deprotected by hydrolysis. For example, in the presence of a base such as sodium hydroxide or potassium hydroxide, a mixed solvent of methanol, ethanol and the like and water can be reacted at a temperature in the range of room temperature to the boiling point of the solvent.

(2) Reaction of carbon-carbon multiple bond compound or organometallic compound with organic halide in the presence of palladium catalyst

[Chemical 20] [In the formula, rings Z, Q and X have the same meanings as described above. M represents a substituted tin atom, a substituted boron atom, or the like. Q'represents the corresponding organic group. ]

[0034] This reaction is performed, for example, by Synth. Commun., 11, 513.
(1981), J. Am. Chem. Soc., 111, 314 (1989), J. Or.
g. Chem., 52, 422 (1987), J. Org. Chem., 37, 2320
(1972) and the like. In particular,
It can be carried out by reacting a carbon-carbon multiple bond compound or an organometallic compound with an organic halide in the presence of a palladium catalyst, a base or the like in an inert solvent. Examples of the palladium catalyst include divalent palladium catalysts such as Pd (OAc) _{2 and} PdCl ₂ (PPh ₃ ) ₂ and zero-valent palladium catalysts such as Pd (PPh ₃ ) ₄ and Pd (dba) ₂ . Examples of the base include inorganic bases such as NaHCO ₃ and K ₂ CO ₃ , N
Organic bases such as Et ₃ , iPr ₂ NEt, Et ₂ NH, and the like, phosphine ligands such as PPh ₃ , phase transfer catalysts such as BnEt ₃ NCl, CuI
The reaction is promoted by adding an inorganic salt or the like. As an inert solvent, N, N-dimethylformamide (DM
F), THF, dioxane, toluene and the like. The reaction temperature usually ranges from around room temperature to the boiling point of the solvent.

(3) Nucleophilic substitution reaction for the corresponding organic halide

[Chemical 21] [In the formula, rings Z, Q and X have the same meanings as described above. M represents an alkali metal atom, magnesium halide, zinc halide or the like. This reaction can be carried out according to, for example, J. Org. Chem., 26, 3202 (1961). The organometallic compound containing ring Z can be produced, for example, by a halogen-metal exchange reaction or by removing a hydrogen atom using a base, and Q-X can be reacted as it is with it. NaH, KH, potassium t-butoxy, ethylmagnesium bromide, butyllithium, lithium 2,2,
In the presence of a base such as 6,6-tetramethylpiperidine, TH
By reacting in an inert solvent such as F, ether or DMF, Q- can be introduced onto the nitrogen atom of the pyrrole ring. The reaction temperature can be selected from the range of about 0 to about 80 degrees.

(4) Reaction of carbonyl compound with organometallic compound

[Chemical 22] [In the formula, the rings Z, Q and X have the same meanings as described above. ] This reaction is described in, for example, Tetrahedron, 26, 2239 (1970), J.
Org. Chem., 55, 6317 (1990) and the like. The organometallic compound in this reaction can be produced in the same manner as the organometallic compound (3). this,
For example, it can be carried out by reacting with an aldehyde in an inert solvent such as THF, ether or toluene. The reaction temperature can be selected from the range of about −100 ° C. to room temperature.

(5) Reaction of carboxylic acid derivative with organometallic compound

[Chemical 23] [In the formula, rings Z, Q and M have the same meanings as described above. V represents a chlorine atom, alkanoyloxy, alkoxycarbonyloxy, alkoxy, dialkylamino, 2-pyridylthio and the like. This reaction can be carried out according to, for example, Org. Lett., 2, 1649 (2000). The organometallic compound in this reaction can be produced in the same manner as the organometallic compound in (3) and (4). This can be carried out, for example, by reacting with a compound having an activated carbonyl group in an inert solvent such as THF, ether or toluene. The reaction temperature can be selected from the range of about −100 ° C. to room temperature.

(6) Wittig reaction, Horner-Emmons reaction

[Chemical 24] [In the formula, rings Z and Q have the same meanings as described above. R "represents alkyl.] This reaction can be carried out, for example, according to Tetrahedron, 49, 1343 (1993), etc. Specifically, an organic phosphorus compound such as a phosphonium salt or a phosphoric acid ester is converted into Na
It can be carried out by treating with a base such as H, BuLi or KOtBu, and reacting with a carbonyl compound in an inert solvent such as THF, ether or dichloromethane. The reaction temperature may be in the range of about −100 ° C. to the boiling point of the solvent.

[0039] The following compound (8) can be preferably produced, for example, as follows.

[Chemical 25] [Wherein R ¹ , R ² , R ³ , R ⁴ , X ¹ , X ² , Y, W
¹ , W ² and W ³ have the same meaning as described above. R'represents phenyl or 4-toluyl. ]

According to J. Org. Chem. 1983, 48, 3214-3219, the compound (3) is produced by reacting the compound (1) with the compound (2) in the presence of a Lewis acid in an inert solvent. You can It is preferable to use BF ₃ .OEt ₂ , ZnCl ₂ , SnCl ₄ or the like as the Lewis acid because the compound (2) can be selectively reacted at the 2-position of the pyrrole ring. The inert solvent is preferably a halogenated hydrocarbon such as dichloromethane or dichloroethane, and the reaction temperature is in the range of about 0 to the boiling point of the solvent, and usually around room temperature is desirable. The compound (4) can be produced by hydrolyzing the compound (3) in the presence of a base. Examples of the base include NaOH, KOH, etc., and as the solvent, a mixed solvent of dioxane and water,
Examples thereof include a mixed solvent of methanol and water. The reaction temperature may be in the range of about 50 to about 90 degrees. Compound (5) can be produced by reacting compound (4) with an allyl halide in the presence of a base in an inert solvent. As the base, KOtBu or the like is preferable, and NaH or the like can be used. Examples of the inert solvent include THF and DMF, and the reaction temperature includes a range of 40 to 60 degrees.

The compound (6) in which R ² is methyl is obtained by converting the compound (5) into a Vilsmeier reagent (Org. Synth. Coll. Vol. IV, 831).
Etc.), followed by reduction in a halogenated hydrocarbon-based solvent. In the reduction reaction,
For example, triethylsilane-trifluoroacetic acid or the like can be used as a reducing agent, and the reaction can usually be carried out at a temperature in the range of about 0 degrees to around room temperature. The compound (6) in which R ⁴ is an alkyl other than methyl is a compound in the presence of a Lewis acid.
It can be produced by reacting (5) with an alkanoyl halide and then reducing it. Al as Lewis acid
Cl _{3 and the} like can be mentioned, and the reaction can usually be carried out at a temperature in the range of about 0 degrees to the boiling point of the solvent.

Compound in the presence of a palladium catalyst and a base
Compound (8) can be produced by reacting (6) with compound (7) in an inert solvent. Examples of the palladium catalyst include divalent palladium catalysts such as Pd (OAc) ₂ and 0% Pd (dba) _{2 and the} like.
Examples include valent palladium catalysts. As a base, NaHC
O ₃ , K ₂ CO ₃ , triethylamine and the like can be mentioned, and the reaction is promoted by adding a phosphine ligand such as PPh _{3 and} a phase transfer catalyst such as BnEt ₃ NCl. DM as an inert solvent
Examples of the reaction temperature include F, THF and toluene, and the reaction temperature is usually from room temperature to the boiling point of the solvent.

[0043] Specific examples of the compound having the general formula (1) obtained by the present invention include the compounds shown in Table 1 below.

[0044]

[Table 1]

[0045]

[Table 2]

[0046]

[Table 3]

[Examples] [0047] Hereinafter, the present invention will be described in more detail with reference to Examples, Reference Examples, and Test Examples, but the present invention is not limited thereto.

Reference Example 1 (1H-pyrrol-2-yl) (4-methylphenyl)
Ketone synthesis

[Chemical 26]

Reference Example 1-1 Synthesis of (1-benzenesulfonyl-1H-pyrrol-2-yl) (4-methylphenyl) ketone

[Chemical 27] Under a nitrogen stream, 1-benzenesulfonyl-1H-pyro-
Solution (284 g, 1.37 mol) in dichloromethane (1.0 L) was added p-toluoyl chloride (318 g, 2.06 mol) and boron trifluoride ether complex (350 g, 2.47 mol), and the mixture was stirred at room temperature. Leave for 7 days. The reaction solution was diluted with 1N hydrochloric acid (750 m
L) twice, a 1N aqueous sodium hydroxide solution (750 mL) and a saturated saline solution (100 mL) each washed once, dried and filtered. Concentrate the filtrate to half volume at atmospheric pressure and add hexane (500 m
L) was added. After further concentrating and distilling off dichloromethane, the mixture was cooled to 10 ° C. and the crystals were collected by filtration. This was washed with hexane and toluene and dried to obtain the title compound.
(315 g, 71%) ¹ H NMR (CDCl ₃ , 300 MHz) δ 8.12 (d, 2 H, J = 8.3 H
z), 7.75 − 7.78 (m, 1 H), 7.72 (brd, 2 H, J = 7.9
Hz), 7.65 (brt, 1 H, J = 7.9 Hz), 7.58 (brt, 2 H,
J = 7.9 Hz), 7.25 (d, 2 H, J = 8.3 Hz), 6.69 − 6.
72 (m, 1 H), 6.35 (dd, 1 H, J = 3.1 and 0.5 Hz), 2.
42 (s, 3 H).

Reference Example 1-2 (1H-pyrrol-2-yl) (4-methylphenyl)
Ketone synthesis

[Chemical 28] The compound of Reference Example 1-1 (145 g, 446 mmol) was added to methanol.
(1.0 L), suspended in 5N aqueous sodium hydroxide (1.1 kg)
Was added and the mixture was heated under reflux for 30 minutes. The mixture became a homogeneous solution. The solution was cooled slowly to 0 ° C. and the resulting crystals were collected by filtration and dried to give the title compound. (80 g, 97
%) ¹ H NMR (CDCl ₃ , 300 MHz) δ 9.52 (brs, 1 H), 7.82
(d, 2 H, J = 8.3 Hz), 7.29 (d, 2 H, J = 8.3 Hz),
7.12 (brs, 1 H), 6.88 − 6.91 (m, 1 H), 6.32 − 6.3
6 (m, 1 H), 2.44 (s, 3 H).

Reference Example 2 {1-[(2E) -3- (3-hydroxyphenyl)-
2-propenyl] -1H-pyrrol-2-yl} (4-
Synthesis of (methylphenyl) methanone

[Chemical 29]

Reference Example 2-1 Synthesis of 1-iodo-3- (methoxymethoxy) benzene

[Chemical 30] A solution of m-iodophenol (3.00 g, 13.6 mmol) in acetone (30 ml) was added to potassium carbonate (2.30 g, 1 under ice cooling).
6.6 mmol), chloromethyl methyl ether (1.20 g, 1
4.9 mmol) was added, and the reaction solution was stirred at room temperature for 65 hours.
Potassium carbonate (0.600 g, 4.30 mmol) and chloromethyl methyl ether (0.300 g, 3.70 mmol) were added to the reaction solution, and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. After washing the organic layer with saturated saline,
The extract was dried over magnesium sulfate and the solvent was evaporated under reduced pressure to give the title compound (3.68 g, 102%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.40 − 7.42 (m, 1 H),
7.34 (dt, 1 H, J = 3.6 and 1.6 Hz), 6.99 − 7.02
(m, 2 H), 5.15 (s, 2 H), 3.47 (s, 3 H).

Reference Example 2-2 (2E) -3- [3- (methoxymethoxy) phenyl]
2-Synthesis of propanal

[Chemical 31] The compound of Reference Example 2-1 (3.68 g, 13.6 mmol), acrolein (1.6 g, 28.5 mmol), sodium hydrogen carbonate (2.
75 g, 32.7 mmol), benzyltriethylammonium chloride (3.1 g, 13.6 mmol), palladium acetate (60 mg,
A DMF (20 ml) mixed solution of 0.27 mmol) was stirred at 55 ° C. for 9 hours. The reaction solution was diluted with water, the insoluble material was filtered off, and the filtrate was extracted with toluene. The organic layer was washed with 5% aqueous sodium thiosulfate solution, water and saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (2.75
g, 102%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.70 (d, 1 H, J = 7.7 H
z), 7.45 (d, 1 H, J = 15.9 Hz), 7.35 (t, 1 H, J =
7.9 Hz), 7.25 (brt, 1 H, J = 2.4 Hz), 7.22 (brd, 1
H, J = 7.9 Hz), 7.13 (ddd, 1 H, J = 7.9, 2.4 and
0.8 Hz), 6.71 (dd, 1 H, J = 15.9 and 7.7 Hz), 5.21
(s, 2 H), 3.49 (s, 3 H).

Reference Example 2-3 (2E) -3- [3- (methoxymethoxy) phenyl]
Synthesis of 2-propen-1-ol

[Chemical 32] To a solution of the compound of Reference Example 2-2 (2.75 g, 13.6 mmol) in methanol (25 ml), sodium borohydride (0.50 g, 13.2 mmol) was added under ice cooling, and the mixture was allowed to stand at room temperature for 30 minutes at 0 ° C. hand
Stir for 30 minutes. Dilute hydrochloric acid and aqueous sodium hydrogencarbonate were sequentially added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue is subjected to silica gel column chromatography (hexane: ethyl acetate = 1: 1 → 1 :).
2) was separated and purified to give the title compound (2.33 g, 88
%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.24 (t, 1 H, J = 8.0 H
z), 7.08 (t, 1 H, J = 2.0 Hz), 7.04 (d, 1 H, J = 8.
0 Hz), 6.93 (ddd, 1 H, J = 8.0, 2.0 and 0.7 Hz),
6.59 (d, 1 H, J = 15.9 Hz), 6.37 (dt, 1 H, J = 15.
9 and 5.7 Hz), 5.18 (s, 2 H), 4.32 (dt, 2 H, J = 5.
7 and 1.4 Hz), 3.49 (s, 3 H), 1.46 (t, 1 H, J = 5.
7 Hz).

Reference Example 2-4 1-[(1E) -3-Bromo-1-propenyl] -3-
Synthesis of (methoxymethoxy) benzene

[Chemical 33] A solution of the compound of Reference Example 2-3 (1.31 g, 6.74 mmol) and triphenylphosphine (2.2 g, 8.46 mmol) in dichloromethane (15 ml) was cooled with ice under N-bromosuccinimide (1.5 g, 8.43 mmol). ) Is added at 0 degrees for 1 hour and at room temperature for 2
Stir for hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 8: 1 → 4: 1) to give the title compound (1.06 g, 61%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.24 (t, 1 H, J = 7.9 H
z), 7.07 (t, 1 H, J = 2.4 Hz), 7.03 (d, 1 H, J = 7.
9 Hz), 6.95 (ddd, 1 H, J = 7.9, 2.4 and 0.8 Hz),
6.61 (d, 1 H, J = 15.5 Hz), 6.39 (dt, 1 H, J = 15.
5 and 7.8 Hz), 5.18 (s, 2 H), 4.15 (dd, 2 H, J = 7.
8 and 0.8 Hz), 3.48 (s, 3 H).

Reference Example 2-5 (1-{(2E) -3- [3- (methoxymethoxy) phenyl] -2-propenyl} -1H-pyrrol-2-yl) (4-methylphenyl) methanone Synthesis of

[Chemical 34] Potassium t-butoxide (0.51 g, 4.55 mmol) in THF (5
ml) solution, the compound of Reference Example 1 (0.77 g, 4.16 mmol)
THF solution (5 ml) was added, and the mixture was stirred at room temperature for 5 minutes. The compound of Reference Example 2-4 (1.06 g, 4.12 mmo) was added to the reaction solution under ice cooling.
THF solution (5 ml) of (l) was added, and the mixture was stirred at room temperature for 16 hours. Aqueous sodium hydrogen carbonate was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was subjected to silica gel column chromatography (hexane: ethyl acetate = 4: 1), (toluene: ethyl acetate = 19 :).
The product was separated and purified in 1) to give the title compound (1.38 g, 92
%). ¹ H NMR (CDCl ₃ , 400 MHz) 7.73 (d, 2 H, J = 8.1 Hz),
7.25 (d, 2 H, J = 8.1 Hz), 7.20 (t, 1 H, J = 8.0
Hz), 7.05 (dd, 1 H, J = 2.5, 1.7 Hz), 6.99− 7.04
(m, 2 H), 6.91 (ddd, 1 H, J = 8.0, 2.4 and 0.8 H
z), 6.77 (dd, 1H, J = 4.0 and 1.7 Hz), 6.47 (d, 1
H, J = 15.8 Hz), 6.42 (dt, 1 H, J = 15.8 and 4.9 H
z), 6.21 (dd, 1 H, J = 4.0 and 2.5 Hz), 5.20 (d, 2
H, J = 4.9 Hz), 5.16 (s, 2 H), 3.47 (s, 3 H), 2.43
(s, 3 H).

Reference Example 2-6 {1-[(2E) -3- (3-hydroxyphenyl)-
2-propenyl] -1H-pyrrol-2-yl} (4-
Synthesis of (methylphenyl) methanone

[Chemical 35] Methanol of the compound of Reference Example 2-5 (4.53 g, 12.5 mmol)
Solution (15 ml) and dioxane (10 ml), 4N hydrochloric acid dioxane solution (10 ml) was added, and the mixture was stirred at room temperature for 30 minutes.
Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 4: 1) to give the title compound (3.71 g, 93%). ¹ H NMR (CDCl ₃ , 400 MHz) 7.73 (d, 2 H, J = 8.1 Hz),
7.25 (d, 2 H, J = 8.1 Hz), 7.15 (t, 1 H, J = 7.9
Hz), 7.04 (dd, 1 H, J = 2.4 and 1.7 Hz), 6.92 (br
d, 1 H, J = 7.9 Hz), 6.82 − 6.84 (m, 1 H), 6.77
(dd, 1 H, J = 4.0 and 1.7 Hz), 6.70 (ddd, 1 H, J =
7.9, 2.5 and 0.8 Hz), 6.44 (d, 1 H, J = 15.8 Hz),
6.39 (dt, 1 H, J = 15.8 and 4.8 Hz), 6.20 (dd, 1
H, J = 4.0and 2.4 Hz), 5.19 (d, 2 H, J = 4.8 Hz),
4.94 (s, 1 H), 2.42 (s, 3 H).

Example 1 (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 36]

Example 1-1 (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) t-butyl acetate synthesis

[Chemical 37] N, N of the compound of Reference Example 2-6 (3.50 g, 11.0 mmol)
In a dimethylformamide (30 ml) solution, potassium carbonate (2.25 g, 16.3 mmol) and t-butyl bromoacetate (2.4
5 g, 12.6 mmol) was added and the mixture was stirred at 50 ° C. for 2 hours and a half. Aqueous potassium hydrogen sulfate was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 5: 1 → 4: 1) to give the title compound (4.4 g, 92%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.73 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.20 (t, 1 H, J = 7.
8 Hz), 7.04 (dd, 1 H, J = 2.5 and 1.7 Hz), 6.98 (b
rd, 1 H, J = 7.8 Hz), 6.89 (brt, 1 H, J = 2.0 Hz),
6.76 − 6.79 (m, 1 H), 6.77 (dd, 1 H, J = 4.0 and
1.7 Hz), 6.46 (d, 1 H, J = 15.9 Hz), 6.40 (dt, 1
H, J = 15.9 and 5.0 Hz), 6.20 (dd, 1 H, J = 4.0 an
d 2.5 Hz), 5.19 (d, 2 H, J = 5.0 Hz), 4.49 (s, 2
H), 2.43 (s, 3 H), 1.47 (s, 9H).

Example 1-2 (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 38] A 1N aqueous solution of sodium hydroxide (20 ml) containing the compound of Example 1-1 (4.4 g, 10.2 mmol) and tetrahydrofuran (20 m
l) and a solution of methanol (20 ml) were stirred at room temperature for 1 hour and a half. The methanol and tetrahydrofuran in the reaction solution were distilled off, and the residue was diluted with water and washed with diethyl ether.
The aqueous layer was acidified by adding dilute hydrochloric acid and then extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (3.7 g,
96%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.72 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.21 (t, 1 H, J =
8.0 Hz), 7.03 (dd, 1 H, J = 2.5 and 1.7 Hz), 7.01
(brd, 1 H, J = 8.0 Hz), 6.90 − 6.92 (m, 1 H), 6.7
6 − 6.81 (m, 1 H), 6.77 (dd, 1 H, J = 4.0 and 1.7
Hz), 6.38 − 6.47 (m, 2 H), 6.20 (dd, 1H, J = 4.0
and 2.5 Hz), 5.17 − 5.20 (m, 2 H), 4.63 (s, 2
H), 2.42 (s, 3 H).

Example 2 4- (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Synthesis of (phenoxy) butyric acid

[Chemical 39]

Example 2-1 4- (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Synthesis of (phenoxy) ethyl butyrate

[Chemical 40] N, N of the compound of Reference Example 2-6 (180 mg, 0.567 mmol)
To the -dimethylformamide (3.0 ml) solution, potassium carbonate (100 mg, 0.724 mmol) and ethyl 4-bromo-n-butyrate (105 mg, 0.538 mmol) were added, and the mixture was stirred at 45 ° C for 2 hours.
Ethyl 4-bromo-n-butyrate (20.0 mg, 0.100 m
mol) was added, and the mixture was stirred at 50 ° C. for another 9 hours. Aqueous sodium hydrogen carbonate was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue is subjected to silica gel column chromatography (hexane: ethyl acetate).
= 4: 1) for separation and purification to give the title compound (199 mg,
81%). ¹ H NMR (CDCl ₃ , 400 MHz) δ7.73 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.19 (t, 1 H, J = 7.
9 Hz), 7.05 (dd, 1 H, J = 2.4 and 1.7 Hz), 6.94 (br
d, 1 H, J = 7.9 Hz), 6.87 − 6.89 (m, 1 H), 6.76
(dd, 1 H, J = 4.0 and 1.7 Hz), 6.74 − 6.77 (m, 1
H), 6.47 (d, 1 H, J = 15.8 Hz), 6.41 (dt, 1 H, J =
15.8 and 5.0 Hz), 6.20 (dd, 1 H, J = 4.0 and 2.4 H
z), 5.20 (d, 2 H, J = 5.0 Hz), 4.14 (q, 2 H, J =
7.1 Hz), 3.99 (t, 2 H, J = 6.1 Hz), 2.50 (t, 2 H, J
= 7.3 Hz), 2.43 (s, 3 H), 2.09 (tt, 2 H, J = 7.3
and 6.1 Hz), 1.25 (t, 3 H, J = 7.1 Hz).

Example 2-2 4- (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Synthesis of (phenoxy) butyric acid

[Chemical 41] The title compound was synthesized from the compound of Example 2-1 in the same manner as in Example 1-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ7.74 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.19 (t, 1 H, J = 8.
1 Hz), 7.05 (dd, 1 H, J = 2.5 and 1.6 Hz), 6.93 (br
d, 1 H, J = 8.1 Hz), 6.92 − 6.94 (m, 1 H), 6.77
(dd, 1 H, J = 4.0 and 1.6 Hz), 6.74 − 6.77 (m, 1
H), 6.48 (d, 1 H, J = 15.6 Hz), 6.44 (dt, 1 H, J =
15.6 and 4.0 Hz), 6.20 (dd, 1 H, J = 4.0 and 2.5 H
z), 5.17 − 5.19 (m, 2 H), 4.03 (t, 2 H, J = 6.2 H
z), 2.57 (t, 2 H, J = 7.1 Hz), 2.42 (s, 3 H), 2.07
− 2.14 (m, 2 H).

Reference Example 3 Synthesis of t-butyl {3-[(1E) -3-bromo-1-propenyl] phenoxy} acetate

[Chemical 42]

Reference Example 3-1 {3-[(1E) -3-hydroxy-1-propenyl]
Synthesis of t-butyl phenoxy} acetate

[Chemical 43] To a solution of the compound of Reference Example 2-2 (0.56 g, 2.91 mmol) in dioxane (5 ml) was added 4N hydrochloric acid in dioxane (4 ml), and the mixture was stirred at room temperature for 1 hour and a half. The reaction mixture was adjusted to pH 6 with saturated aqueous sodium hydrogen carbonate and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure (2E) -3- (3-
A hydroxyphenyl) -2-propenal mixture was obtained (0.42 g). To a solution of the above mixture (0.42 g) in N, N-dimethylformamide (5 ml), potassium carbonate (0.60 g,
4.34 mmol), t-butyl bromoacetate (0.68 g, 3.49 mm)
ol) was added and the mixture was stirred at 50 ° C. for 1 hour and a half. 5% Potassium hydrogensulfate water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine and dried over magnesium sulfate,
The solvent was distilled off under reduced pressure {3-[(1E) -3-oxo-1-
A mixture of t-butyl propenyl] phenoxy} acetate was obtained (0.81 g).

[0066] Sodium borohydride (100 mg, 2.64 mmol) was added to a methanol (10 ml) solution of the phenoxyacetic acid mixture (0.81 g) under ice cooling, and the mixture was stirred at 0 ° C for 20 minutes.
Dilute hydrochloric acid was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue is subjected to silica gel column chromatography (hexane: ethyl acetate =
Separation and purification by 2: 1 → 1: 1) gave the title compound (0.
65 g, 3 steps 87%). ¹ H NMR (CDCl ₃ , 400 MHz) δ7.23 (t, 1 H, J = 8.0 H
z), 7.02 (brd, 1 H, J = 8.0 Hz), 6.93 (t, 1 H, J =
2.0 Hz), 6.78 (dd, 1 H, J = 8.0 and 2.0 Hz), 6.58
(d, 1 H, J = 15.9 Hz), 6.35 (dt, 1 H, J = 15.9 and
5.8 Hz), 4.52 (s, 2 H), 4.33 (dt, 2 H, J = 1.4 and
5.8 Hz), 1.49 (s, 9 H), 1.43 (t, 1H, J = 5.8 Hz).

Reference Example 3-2 Synthesis of t-butyl {3-[(1E) -3-bromo-1-propenyl] phenoxy} acetate

[Chemical 44] A solution of the compound of Reference Example 3-1 (320 mg, 1.21 mmol) and triphenylphosphine (385 mg, 1.47 mmol) in dichloromethane (5 ml) was cooled with ice to obtain N-bromosuccinimide (2
(60 mg, 1.46 mmol) was added, and the mixture was stirred at 0 ° C for 20 minutes. The reaction solution was concentrated under reduced pressure, and the resulting residue was subjected to silica gel column chromatography (hexane: ethyl acetate = 6: 1 →).
Separation and purification at 4: 1) gave the title compound (380 mg, 96
%). ¹ H NMR (CDCl ₃ , 400 MHz) 7.23 (t, 1 H, J = 8.0 Hz),
7.01 (d, 1 H, J = 8.0 Hz), 6.92 (t, 1 H, J = 2.1
Hz), 6.81 (dd, 1 H, J = 8.0 and 2.1 Hz), 6.60 (d,
1 H, J = 15.6 Hz), 6.37 (dt, 1 H, J = 15.6 and 7.8
Hz), 4.52 (s, 2 H), 4.15 (dd, 2 H, J = 7.8 and 0.8
Hz), 1.49 (s, 9 H).

Example 3 (3-{(1E) -3- [2- (4-methoxybenzoyl) -4-methyl-1H-pyrrol-1-yl] -1-
Synthesis of propenyl} phenoxy) acetic acid

[Chemical 45]

Example 3-1 Synthesis of (1-benzenesulfonyl-1H-pyrrol-2-yl) [4- (methoxy) phenyl] ketone

[Chemical 46] The title compound was obtained from 4-methoxybenzoyl chloride by the same procedure as in Reference Example 1-1. ¹ H NMR (CDCl ₃ , 400 MHz) δ 8.12 (dt, 2 H, J = 7.2
and 1.5 Hz), 7.84 (d, 2 H, J = 8.9 Hz), 7.73 (dd,
1 H, J = 1.7 and 3.2 Hz), 7.65 (tt, 1 H, J = 1.5 an
d 7.2 Hz), 7.58 (tt, 2 H, J = 1.5 and 7.2 Hz), 6.9
3 (d, 2 H, J = 8.9 Hz), 6.68 (dd, 1 H, J = 1.7 and
3.6 Hz), 6.34 (dd, 1 H, J = 3.2 and 3.6 Hz), 3.87
(s, 3 H).

Example 3-2 Synthesis of (1H-pyrrol-2-yl) [4- (methoxy) phenyl] ketone

[Chemical 47] The title compound was obtained from the compound of Example 3-1 by the same method as in Reference Example 1-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.54 (brs, 1 H), 7.94
(d, 2 H, J = 8.9 Hz), 7.12 (dt, 1 H, J = 1.3 and 2.
7 Hz), 6.93 (d, 2 H, J = 8.9 Hz), 6.89 (ddd, 1 H,
J = 3.8, 2.4 and 1.3 Hz), 6.34 (dt, 1 H, J = 3.8 a
nd 2.7 Hz), 3.89 (s, 3 H).

Example 3-3 Synthesis of (4-formyl-1H-pyrrol-2-yl) (4-methoxyphenyl) ketone

[Chemical 48] The compound of Example 3-2 (1.50 g, 7.45 mmol) was dissolved in nitromethane (8.0 g) and ethylene chloride (8.0 g) to give 10
Chilled and cooled with aluminum chloride (3.99 g, 29.8 mmo
l) was added. A solution of dichloromethylmethyl ether (1.88 g, 16.4 mmol) in ethylene chloride (3.0 g) was added dropwise to the mixture, and the mixture was stirred for 1 hour. Hydrochloric acid was added to the mixture, and the mixture was extracted with chloroform. The organic layer was treated with magnesium sulfate, activated carbon, filtered, and concentrated. The residue was repulped with toluene to give the title compound (1.2 g, 70%) ¹ H NMR (CDCl ₃ , 400 MHz) δ 10.20 (brs, 1 H), 9.90
(s, 1 H), 7.98 (d, 2H, J = 8.9 Hz), 7.72 (dd, 1 H,
J = 3.3 and 1.4 Hz), 7.33 (dd, 1 H, J = 2.3 and
1.4 Hz), 7.01 (d, 2 H, J = 8.9 Hz), 3.91 (s, 3 H).

Example 3-4 Synthesis of (4-methyl-1H-pyrrol-2-yl) (4-methoxyphenyl) ketone

[Chemical 49] 10% of the compound of Example 3-3 (230 mg, 1.00 mmol)
Palladium-carbon (230 mg) and tetrahydrofuran (3.0
(mL) under hydrogen atmosphere for 8 hours. The mixture was filtered, the filtrate was concentrated, and the residue was purified by silica gel column chromatography to give the title compound (130 mg, 60
%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.38 (brs, 1 H), 7.92
(d, 2 H, J = 8.9 Hz), 6.97 (d, 2 H, J = 8.9 Hz), 6.
89 − 6.90 (m, 1 H), 6.70 (dd, 1 H, J = 1.2, 2.0 H
z), 3.88 (s, 3 H), 2.15 (s, 3 H)

Example 3-5 (3-{(1E) -3- [2- (4-methoxybenzoyl) -4-methyl-1H-pyrrol-1-yl] -1-
Synthesis of propenyl} phenoxy) acetic acid

[Chemical 50] Potassium t-butoxide (50 mg, 0.44 mmol) in THF (2
ml) solution to the compound of Example 3-4 (80 mg, 0.37 mmo
(1 ml) in THF (1 ml) was added, and the mixture was stirred at room temperature for 5 minutes.
THF of the compound of Reference Example 3 (125 mg, 0.38 mmol) was added to the reaction solution.
(1 ml) solution was added, and the mixture was stirred at room temperature for 5 hours. 5% Potassium hydrogensulfate water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained coupling mixture (0.19 g) was dissolved in methanol (1 ml) and tetrahydrofuran (1 ml), 1N aqueous sodium hydroxide solution (1 ml) was added to this solution, and the mixture was stirred at room temperature for 3 hours. The reaction solution was diluted with water and washed with diethyl ether. The aqueous layer was acidified with diluted hydrochloric acid and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (137 mg, 91%). ¹ H NMR (CDCl ₃ , 400 MHz) δ7.83 (d, 2 H, J = 8.8 H
z), 7.23 (t, 1 H, J = 8.0 Hz), 7.04 (brd, 1 H, J =
8.0 Hz), 6.95 (d, 2 H, J = 8.8 Hz), 6.91− 6.95
(m, 1 H), 6.82 (brs, 1 H), 6.80 (dd, 1 H, J = 8.0
and 2.5 Hz), 6.57 (brs, 1 H), 6.38 − 6.48 (m, 2
H), 5.11-5.13 (m, 2 H), 4.66 (s, 2H), 3.88 (s,
3 H), 2.09 (3 H, s).

Example 4 (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Synthesis of (phenyl) acetic acid

[Chemical 51]

Example 4-1 {3-[(1E) -3-t-butoxy-3-oxo-1
-Propenyl] phenyl} acetic acid synthesis

[Chemical 52] m-Bromophenylacetic acid (4.0 g, 18.6 mmol), t-butyl acrylate (4.85 g, 37.8 mmol), triethylamine (3.8 g, 37.6 mmol), tri-o-tolylphosphine (310 mg, 1.02 mmol), acetic acid Palladium (130 mg, 0.58
A mixture of 0 mmol) of N, N-dimethylformamide (50 mL) was stirred at 50 degrees for 4 hours and at 90 degrees for 10 hours. The reaction solution was diluted with aqueous sodium hydrogen carbonate and washed with ethyl acetate. The aqueous layer was made acidic (around pH 3) and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound mixture (5.50 g). ¹ H NMR (CDCl ₃ , 400 MHz) δ7.56 (d, 1 H, J = 16.0 H
z), 7.41 − 7.45 (m, 2 H), 7.35 (t, 1 H, J = 7.9 H
z), 7.28 − 7.32 (m, 1 H), 6.37 (d, 1 H, J = 16.0 H
z), 3.67 (s, 2 H), 1.53 (s, 9 H).

Example 4-2 Synthesis of (2E) -3- [3- (2-methoxy-2-oxoethyl) phenyl] -2-propenoic acid

[Chemical 53] Acetone (60 mL) of the mixture of Example 4-1 (5.50 g)
Potassium carbonate (4.80 g, 34.7 mmol) and dimethyl sulfate (3.00 g, 23.8 mmol) were added to the solution, and the reaction solution was stirred at room temperature for 1 hour and a half. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure to give a methyl ester form. The obtained methyl ester product was made into a dichloromethane (30 mL) solution, and trifluoroacetic acid (30
(mL) was added and the mixture was stirred at room temperature for 1 hour and a half. The reaction solution was diluted with aqueous sodium hydrogen carbonate and washed with ethyl acetate. The aqueous layer was made acidic (around pH 3) and extracted with ethyl acetate.
The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (3.90 g, 3
Process yield 95%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.77 (d, 1 H, J = 16.0 H
z), 7.45 − 7.49 (m, 2 H), 7.38 (t, 1 H, J = 7.7 H
z), 7.32 − 7.36 (m, 1 H), 6.46 (d, 1 H, J = 16.0 H
z), 3.72 (s, 3 H), 3.66 (s, 2 H).

Example 4-3 {3-[(1E) -3-hydroxy-1-propenyl]
Synthesis of methyl phenyl} acetate

[Chemical 54] A solution of the compound of Example 4-2 (3.90 g, 17.7 mmol) and triethylamine (2.35 g, 23.2 mmol) in tetrahydrofuran (50 mL) was dissolved in ethyl chloroformate (2.50 g, 23.0 mmol) at 0 ° under a nitrogen stream. ) Was added and stirred for 1 hour. Triethylamine (0.700 g, 6.92 mmol) and ethyl chloroformate (0.750 g, 6.91 mmol) were added to the reaction solution, and the mixture was further stirred at 0 ° C. for 20 minutes. A solution of sodium borohydride (3.65 g, 96.5 mmol) in water (30 mL) was added dropwise to the reaction solution, and the mixture was stirred at 0 ° C for 20 minutes. Acidic (pH2-
3) and extracted with ethyl acetate. The extract was washed with saturated brine, dried and dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue is subjected to silica gel column chromatography (hexane: ethyl acetate = 3: 1 → 1: 1).
Were separated and purified by the above procedure to obtain the title compound. (3.00 g, 82%) ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.28 − 7.32 (m, 3 H),
7.15 − 7.18 (m, 1 H), 6.61 (dt, 1 H, J = 15.9 and
1.4 Hz), 6.38 (dt, 1 H, J = 15.9 and 5.8 Hz), 4.3
3 (dt, 2 H, J = 5.8 and 1.4 Hz), 3.70 (s, 3 H), 3.
62 (s, 2 H), 1.43 (t, 1 H, J = 5.8 Hz).

Example 4-4 Synthesis of methyl {3-[(1E) -3-bromo-1-propenyl] phenyl} acetate

[Chemical 55] The title compound was synthesized from the compound of Example 4-3 in the same manner as in Reference Example 2-4. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.29 − 7.32 (m, 3 H),
7.17 − 7.22 (m, 1 H), 6.63 (d, 1 H, J = 15.6 Hz),
6.40 (dt, 1 H, J = 15.6 and 7.8 Hz), 4.16 (dd, 2
H, J = 7.8 and 0.7 Hz), 3.70 (s, 3 H), 3.62 (s, 2
H).

Example 4-5 (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Synthesis of (phenyl) methyl acetate

[Chemical 56] The title compound was synthesized from the compound of Example 4-4 and the compound of Reference Example 1 in the same manner as in Reference Example 2-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ7.74 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.23 − 7.29 (m, 3
H), 7.13 − 7.17 (m, 1 H), 7.04 (dd, 1 H, J = 2.5 a
nd 1.6 Hz), 6.77 (dd, 1 H, J = 4.0 and 1.6 Hz), 6.
48 (d, 1 H, J = 15.8 Hz), 6.44 (dt, 1 H, J = 15.8 a
nd 4.9 Hz), 6.20 (dd, 1 H, J = 4.0and 2.5 Hz), 5.2
0 (d, 2 H, J = 4.9 Hz), 3.68 (s, 3 H), 3.59 (s, 2
H), 2.43 (s, 3 H).

Example 4-6 (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Synthesis of (phenyl) acetic acid

[Chemical 57] The title compound was synthesized from the compounds of Example 4-5 in the same manner as in Example 1-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ7.73 (d, 2 H, J = 8.1 H
z), 7.25 − 7.31 (m, 3 H), 7.25 (d, 2 H, J = 8.1 H
z), 7.14 − 7.18 (m, 1 H), 7.04 (dd, 1 H, J = 2.5 a
nd 1.7 Hz), 6.77 (dd, 1 H, J = 4.0 and 1.7 Hz), 6.
49 (d, 1 H, J = 15.6 Hz), 6.44 (dt, 1 H, J = 15.6 a
nd 4.8 Hz), 6.20 (dd, 1 H, J = 4.0and 2.5 Hz), 5.2
0 (d, 2 H, J = 4.8 Hz), 3.63 (s, 2 H), 2.43 (s, 3
H).

Example 5 Synthesis of 3-methoxy-5-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid

[Chemical 58]

Example 5-1 Synthesis of 3-hydroxy-5-methoxybenzaldehyde

[Chemical 59] 60% sodium hydride (2.77 g, 69.3 mmol) under 0 ° C
Ethanethiol (7 mL) was slowly added to the N, N-dimethylformamide (50 mL) solution of. After stirring at 0 ° C for 30 minutes, the mixture was heated under reflux for 1 hour. After returning to room temperature once, 3,5-dimethoxybenzaldehyde (3.84
g, 23.1 mmol) of N, N-dimethylformamide (90 m
L) solution was added and heated to reflux for 1 hour. After returning to room temperature, saturated saline (700 mL), 26% formalin aqueous solution (70
mL) and acetic acid (130 mL) were sequentially added and stirred. The mixture was extracted with ethyl acetate, the organic layer was washed with water and saturated brine, and then dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (hexane: ethyl acetate = 2: 1) to give the title compound. (2.68 g, 17.6%) ¹ H NMR (CDCl ₃ , 400 MHz) δ9.88 (s, 1 H), 7.00 (m,
1 H), 6.96 (m, 1 H), 6.68 (t, 1 H, J = 2.3 Hz), 3.8
4 (s, 3 H).

Example 5-2 Synthesis of ethyl (2E) -3- (3-hydroxy-5-methoxyphenyl) -2-propenoate

[Chemical 60] DMF of the compound of Example 5-1 (2.19 g, 14.4 mmol) (30
mL), THF (30 mL) solution, ethyl diethylphosphonoacetate (3.55 g, 15.8 mmol), sodium hydride (1.27
g, 12.5 mmol) was added and the mixture was stirred at 60 ° C. for 2 hours. The reaction was terminated by adding water, and ethyl acetate-toluene (3: 1)
It was extracted with. The extract was washed with water and saturated saline, and then dried over anhydrous magnesium sulfate. By distilling off the solvent under reduced pressure,
The title compound was obtained. (2.98 g, 93.1%) ¹ H NMR (CDCl ₃ , 400 MHz) δ7.58 (d, 1 H, J = 16.0 H
z), 6.65 − 6.61 (m, 2 H), 6.45 (t, 1 H, J = 2.2 H
z), 6.38 (d, 1 H, J = 16.0 Hz), 4.27 (q, 2H, J =
7.1 Hz), 3.80 (s, 3 H), 1.34 (t, 3 H, J = 7.1 Hz).

Example 5-3 3-[(1E) -3-hydroxy-1-propenyl]-
Synthesis of 5-methoxyphenol

[Chemical 61] THF (12) of the compound of Example 5-2 (2.85 g, 10.7 mmol)
0 mL) solution was cooled to −78 ° C. where diisobutylaluminum hydride (1.0 M hexane solution, 42.8 mL, 42.8 mL) was added.
mmol) was added dropwise. The mixture was stirred at −78 ° C. for 2 hours, 2N aqueous sodium hydroxide solution was added, and the mixture was stirred. After filtering off, the filtrate was extracted with ethyl acetate. The extract was washed with water and saturated saline, and then dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 2: 1 → 1: 3) to give the title compound. (1.35 g, 70.0%) ¹ H NMR (CDCl ₃ , 400 MHz) δ 6.54 − 6.47 (m, 3 H),
6.36 − 6.31 (m, 2 H), 4.92 (s, 1 H), 4.32 (d, 2
H, J = 5.6 Hz), 3.79 (s, 3 H).

Example 5-4 {3-[(1E) -3-hydroxy-1-propenyl]
Synthesis of methyl-5-methoxyphenoxy} acetate

[Chemical 62] The title compound was synthesized from the compound of Example 5-3 and methyl bromoacetate in the same manner as in Example 1-1. ¹ H NMR (CDCl ₃ , 400 MHz) δ6.59 − 6.52 (m, 3 H),
6.39 (dd, 1 H, J = 2.3 and 2.3 Hz), 6.33 (dt, 1 H,
J = 15.9 and 5.6 Hz), 4.62 (s, 2 H), 4.32 (brs, 2
H), 3.81 (s, 3 H), 3.79 (s, 3 H), 1.49 (brt, 1 H).

Example 5-5 {3-[(1E) -3-Brom-1-propenyl] -5
Synthesis of methyl-methoxyphenoxy} acetate

[Chemical 63] Carbon tetrabromide (207 mg, 0.623) was added to a solution of the compound of Example 5-4 (150 mg, 0.594 mmol) in dichloromethane (2 mL).
mmol), triphenylphosphine (163 mg, 0.623 mmol)
Was added and stirred at room temperature for 30 minutes. Ether was added to the reaction solution to generate a precipitate, which was separated by filtration. The filtrate was concentrated and purified by silica gel column chromatography (hexane: ethyl acetate = 2: 1) to give the title compound. (141
mg, 75.3%) ¹ H NMR (CDCl ₃ , 400 MHz) δ 6.58 − 6.52 (m, 3 H),
6.41 (dd, 1 H, J = 2.2 and 2.2 Hz), 6.36 (dt, 1 H,
J = 7.8 and 15.9 Hz), 4.63 (s, 2 H), 4.14 (d, 2 H,
J = 7.8 Hz), 3.82 (s, 3 H), 3.79 (s, 3 H).

Example 5-6 (3-Methoxy-5-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-
Synthesis of propenyl} phenoxy) methyl acetate

[Chemical 64] A solution of the compound of Example 5-5 (130 mg, 0.412 mmol) in tetrahydrofuran (5.0 mL) was stirred at 0 ° C., and the compound of Reference Example 1 (80.1 mg, 0.433 mmol) and potassium t-butoxide (50.9 mg, 0.454 mmol) was added, and the mixture was stirred at 40 ° C. for 3 hours. Ethyl acetate was added to the reaction solution, filtered and the filtrate was concentrated. Silica gel column chromatography of the residue
The title compound was obtained by purification with (53.4 mg,
30.9%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.73 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.04 (dd, 1 H, J =
1.6 and 2.6 Hz), 6.77 (dd, 1 H, J = 1.6 and 4.0 H
z), 6.55 (t, 1 H, J = 1.7 Hz), 6.49 (t, 1 H, J =
1.7 Hz), 6.41 −6.37 (m, 3 H), 6.21 (dd, 1 H, J =
2.6 and 4.0 Hz), 5.19 (dd, 2 H, J = 1.2, 2.7 Hz),
4.60 (s, 2 H), 3.80 (s, 3 H), 3.77 (s, 3 H), 2.43
(s, 3 H).

Example 5-7 (3-Methoxy-5-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-
Synthesis of propenyl} phenoxy) acetic acid

[Chemical 65] The title compound was obtained from the compounds of Examples 5-6. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.72 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.04 (dd, 1 H, J =
1.6 and 2.5 Hz), 6.77 (dd, 1 H, J = 1.6 and 4.0 H
z), 6.56 (dd, 1 H, J = 1.7 and 1.7 Hz), 6.50 (dd,
1 H, J = 1.7 and 1.7 Hz), 6.43 − 6.34 (m, 3 H),
6.21 (dd, 1 H, J = 2.5 and 4.0 Hz), 5.18 (dd, 2 H,
J = 1.2 and 2.7 Hz), 4.62 (s, 2 H), 3.75 (s, 3
H), 2.42 (s, 3 H).

Example 6 Synthesis of (4-chloro-3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid

[Chemical 66]

Example 6-1 Synthesis of 1-chloro-2-iodo-4-methoxybenzene

[Chemical 67] The above compound can be synthesized by performing a Sandmeyer reaction using 1-chloro-4-methoxy-2-nitrobenzene as a starting material.

Example 6-2 Synthesis of 4-chloro-3-iodophenol

[Chemical 68] 1-chloro-2-iodo-4-methoxybenzene (2.68
g, 10.0 mmol) in dichloromethane (20 ml), and under ice cooling, 0.91 M boron tribromide dichloromethane solution (13.0 ml,
(12.0 mmol) was added dropwise, and the mixture was reacted under ice cooling for 1 hour and at room temperature for 1 day. The reaction mixture was quenched with saturated aqueous sodium hydrogen carbonate, acidified with concentrated hydrochloric acid and extracted with ethyl acetate. The organic layer was washed with saturated saline and dried over sodium sulfate. After the solvent was distilled off, 4-chloro-3-iodophenol (2.61 g, quan
t.) was obtained as light brown crystals. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.35 (d, 1 H, J = 2.9 H
z), 7.27 (d, 1 H, J = 8.7 Hz), 6.78 (dd, 1 H, J =
8.7 and 2.9 Hz), 5.30 (br, 1 H)

Example 6-3 Synthesis of t-butyl (4-chloro-3-iodophenoxy) acetate

[Chemical 69] 4-Chloro-3-iodophenol (509 mg, 2.00 mmo
l) was dissolved in dimethylformamide (4.0 ml), potassium carbonate (415 mg, 3.00 mmol), t-butyl bromoacetate (0.44)
(0 ml, 3.00 mmol) was added, and the mixture was stirred at room temperature for 1 hour. Water was added to the reaction solution and the mixture was extracted with ethyl acetate. The organic layer was washed with 10% citric acid, water, saturated aqueous sodium hydrogen carbonate and saturated brine, and dried over sodium sulfate. After distilling off the solvent, column purification was performed with hexane: ethyl acetate (10: 1) to obtain t-butyl (4-chloro-3-iodophenoxy) acetate (448 mg, 61%) as a colorless oil. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.36 (d, 1 H, J = 2.9 H
z), 7.32 (d, 1 H, J = 8.8 Hz), 6.85 (dd, 1 H, J =
8.8 and 2.9 Hz), 4.47 (s, 2 H), 1.49 (s, 9H)

Example 6-4 Synthesis of t-butyl {4-chloro-3-[(1E) -3-oxo-1-propenyl] phenoxy} acetate

[Chemical 70] Under a nitrogen stream, t-butyl (4-chloro-3-iodophenoxy) acetate (448 mg, 1.22 mmol) was dissolved in dimethylformamide (2.0 ml), and acrolein (0.170 ml, 2.50 mm).
ol), sodium hydrogen carbonate (210 mg, 2.50 mmol), benzyltriethylammonium chloride (342 mg, 1.50 mmol),
Add palladium acetate (5.00 mg, 20.0 μmol) and add 2 at 60 ° C.
Reacted for hours. The reaction was cooled, quenched with sodium thiosulfate and extracted with ethyl acetate. The organic layer was washed with sodium thiosulfate, 10% citric acid, water, saturated aqueous sodium hydrogen carbonate and saturated brine, and dried over sodium sulfate. After the solvent was distilled off, {{4-chloro-3-[(1E) -3-oxo-1
-Propenyl] phenoxy} t-butyl acetate (399 mg, q
uant.) was obtained as yellow crystals. ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.77 (d, 1 H, J = 7.7 H
z), 7.88 (d, 1 H, J = 15.9 Hz), 7.37 (d, 1 H, J =
8.8 Hz), 7.15 (d, 1 H, J = 3.0 Hz), 6.93 (dd, 1 H,
J = 8.8 and 3.0 Hz), 6.64 (dd, 1 H, J = 15.9 and
7.7 Hz), 4.54 (s, 2 H), 1.49 (s, 9 H)

Example 6-5 {4-chloro-3-[(1E) -3-hydroxy-1-
Synthesis of t-butyl propenyl] phenoxy} acetate

[Chemical 71] {{4-Chloro-3-[(1E) -3-oxo-1-propenyl] phenoxy} t-butyl acetate (399 mg, 1.22
Tetrahydrofuran (3.0 ml), methanol (1.5 mmol)
ml) and stirred under ice cooling. An aqueous solution of sodium borohydride (27.0 mg, 0.700 mmol) (200 μl) was added dropwise thereto little by little, and the mixture was reacted for 1 hour under ice cooling. The reaction was quenched with 10% citric acid and extracted with ethyl acetate. The organic layer was washed with water, saturated aqueous sodium hydrogen carbonate and saturated brine, and dried over sodium sulfate. After distilling off the solvent, {4-chloro-3-[(1
E) -3-Hydroxy-1-propenyl] phenoxy}
T-Butyl acetate (384 mg, quant.) Was obtained as a colorless oil. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.25 (d, 1 H, J = 8.8 H
z), 7.06 (d, 1 H, J = 3.0 Hz), 6.95 (dt, 1 H, J = 1
5.9 and 1.6 Hz), 6.74 (dd, 1 H, J = 8.8 and 3.0 H
z), 6.30 (dt, 1 H, J = 15.9 and 5.5 Hz), 4.51 (s,
2 H), 4.36 (d, 2 H, J = 5.5 Hz), 1.59 (br, 1 H), 1.
49 (s, 9 H)

Example 6-6 (4-chloro-3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid Synthesis of

[Chemical 72] {4-chloro-3-[(1E) -3-hydroxy-1-
Propenyl] phenoxy} t-butyl acetate (384 mg, 1.2
(2 mmol) was dissolved in tetrahydrofuran (5.0 ml), triethylamine (0.270 ml, 1.94 mmol) and methanesulfonyl chloride (0.110 ml, 1.42 mmol) were sequentially added under ice cooling, and the mixture was reacted under ice cooling for 1 hour. The reaction was quenched with cold 10% citric acid and extracted with ethyl acetate. The organic layer is 10% cold
It was washed with citric acid and cold saturated aqueous sodium hydrogen carbonate, and dried over sodium sulfate. After distilling off the solvent, the residue was treated with tetrahydrofuran (2,0
ml), lithium bromide (261 mg, 3.00 mmol) was added, and the mixture was reacted for 3 hours. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated saline and dried over sodium sulfate. After the solvent was distilled off, the residue was dissolved in tetrahydrofuran (2.0 ml), and the compound (1
85 mg, 1.00 mmol), potassium t-butoxy (112 mg, 1.
(00 mmol) and tetrahydrofuran (2.0 ml) were added dropwise to the prepared solution. After reacting for 5 hours under ice cooling, methanol
(2.0 ml) and 1N aqueous sodium hydroxide solution (2.0 ml) were added, and the mixture was reacted at room temperature for 2 hours. The reaction solution was washed with hexane and ether, acidified with potassium hydrogen sulfate and extracted with chloroform. The organic layer was washed with saturated saline and dried over sodium sulfate. After distilling off the solvent, column purification was carried out with chloroform: methanol (10: 1), and (4-chloro-3-
{(1E) -3- [2- (4-methylbenzoyl) -1
H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid (177 mg, 29%) was obtained as a light brown amorphous. ¹ H NMR (DMSO-d ₆ , 400 MHz) δ 7.66 (d, 2 H, J = 7.9
Hz), 7.28 − 7.38 (m, 3 H), 7.23 (m, 1 H), 7.09
(d, 1 H, J = 8.8 Hz), 6.76 (dd, 1 H, J = 8.8 and
2.6 Hz), 6.71 (brd, 1 H, J = 3.4 Hz), 6.44 − 6.58
(m, 2 H), 6.23− 6.25 (m, 1 H), 5.23 (d, 2 H, J =
4.3 Hz), 4.43 (s, 2 H), 2.39 (s, 3 H)

Reference Example 4 (1- (3-butenyl) -1H-pyrrol-2-yl)
Synthesis of (4-methylphenyl) methanone

[Chemical 73]

[0097] To a solution of the compound of Reference Example 1 (0.95 g, 5.13 mmol) in tetrahydrofuran (10 ml) was added 60% sodium hydride (240 mg, 6.00 mmol), and the mixture was stirred at room temperature for 10 minutes. 4-Bromo-1-butene (1.0 g, 7.41
mmol) was added and the mixture was stirred at 50 ° C. for 8 hours. In the reaction solution, 4-
Bromo-1-butene (0.2 g, 1.48 mmol), 60% sodium hydride (100 mg, 2.50 mmol) and N, N-dimethylformamide (10 ml) were added, and the mixture was further stirred at 80 ° C. for 8 hours. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate / toluene (1/1). The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 5: 1) to give the title compound (0.98 g, 80%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.71 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 6.95 (dd, 1 H, J =
2.4, 1.7 Hz), 6.72 (dd, 1 H, J = 4.0, 1.7 Hz), 6.1
4 (dd, 1 H, J = 4.0, 2.4 Hz), 5.79 (ddt, 1 H, J =
17.1, 10.2, 6.9Hz), 5.00 − 5.09 (m, 2 H), 4.46
(t, 2 H, J = 7.1 Hz), 2.57 (brq, 2 H, J = 7.1 Hz),
2.43 (s, 3 H).

Example 7 Synthesis of (3-{(1E) -4- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-butenyl} phenoxy) acetic acid

[Chemical 74]

Example 7-1 Synthesis of t-butyl (3-iodophenoxy) acetate

[Chemical 75] N-N of m-iodophenol (1.22 g, 5.55 mmol)
In a dimethylformamide (15 ml) solution, potassium carbonate (1.40 g, 10.1 mmol) and t-butyl bromoacetate (1.22
g, 6.25 mmol) was added, and the mixture was stirred at 50 ° C. for 3 hours. 5% Potassium hydrogensulfate water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 4: 1) to give the title compound (1.85
g, 100%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.32 (ddd, 1 H, J = 7.8,
1.5, 0.9 Hz), 7.24 (dd, 1 H, J = 2.5, 1.5 Hz), 7.
00 (dd, 1 H, J = 8.3, 7.8 Hz), 6.87 (ddd, 1H, J =
8.3, 2.5, 0.9 Hz), 4.49 (s, 2 H), 1.49 (s, 9 H).

Example 7-2 of t-butyl (3-{(1E) -4- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-butenyl} phenoxy) acetate Synthesis

[Chemical 76] The title compound was synthesized from the compound of Example 7-1 and the compound of Reference Example 4 under the same conditions as in Reference Example 2-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.69 (d, 2 H, J = 8.0 H
z), 7.23 (d, 2 H, J = 8.0 Hz), 7.18 (t, 1 H, J = 7.
9 Hz), 6.96 (dd, 1 H, J = 2.5, 1.7 Hz), 6.91 (brd,
1 H, J = 7.9 Hz), 6.82 (brt, 1 H, J = 2.0 Hz), 6.
72 − 6.76 (m, 1 H), 6.72 (dd, 1 H, J = 4.0, 1.7 H
z), 6.32 (d, 1 H, J = 15.8 Hz), 6.15 (dt, 1 H, J =
15.8, 7.2 Hz), 6.14 (dd, 1 H, J = 4.0, 2.5 Hz), 4.
51 (t, 2 H, J = 7.0 Hz), 4.47 (s, 2 H), 2.68 −2.73
(m, 2 H), 2.42 (s, 3 H), 1.49 (s, 9 H).

Example 7-3 Synthesis of (3-{(1E) -4- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-butenyl} phenoxy) acetic acid

[Chemical 77] The title compound was synthesized from the compound of Example 7-2 in the same manner as in Example 1-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.68 (d, 2 H, J = 8.0 H
z), 7.22 (d, 2 H, J = 8.0 Hz), 7.21 (t, 1 H, J = 8.
1 Hz), 6.97 (dd, 1 H, J = 2.5, 1.6 Hz), 6.95 (brd,
1 H, J = 8.1 Hz), 6.84 (brt, 1 H, J = 2.2 Hz), 6.
77 (dd, 1 H, J = 8.1 2.2 Hz), 6.72 (dd, 1 H, J = 4.
0, 1.6 Hz), 6.33 (d, 1 H, J = 15.8Hz), 6.17 (dt, 1
H, J = 15.8, 7.1 Hz), 6.15 (dd, 1 H, J = 4.0, 2.5
Hz), 4.62 (s, 2 H), 4.55 (t, 2 H, J = 7.0 Hz), 2.68
− 2.74 (m, 2 H), 2.42 (s, 3 H).

Example 8 Synthesis of (3-{(1E) -4- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-butenyl} phenyl) acetic acid

[Chemical 78]

Example 8-1 Synthesis of methyl 3-((1E) -4- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-butenyl} phenyl) acetate

[Chemical 79] From 3-bromophenylacetic acid and the compound of Reference Example 4 in the same manner as in Example 4-1, (3-{(1E) -4-
[2- (4-methoxybenzoyl) -1H-pyrrol-
The crude product of 1-yl] -1-butenyl} phenyl) acetic acid was obtained and methyl esterified with methanol and thionyl chloride to give the title compound. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.69 (d, 2 H, J = 8.1 H
z), 7.23 (d, 2 H, J = 8.1 Hz), 7.18 − 7.25 (m, 3
H), 7.12 (brd, 1 H, J = 7.1 Hz), 6.97 (dd, 1 H, J =
2.5, 1.7 Hz), 6.73 (dd, 1 H, J = 4.0, 1.7 Hz), 6.
37 (d, 1 H, J = 15.8 Hz), 6.18 (dt, 1 H, J = 15.8,
7.2 Hz), 6.15 (dd, 1 H, J = 4.0, 2.5 Hz), 4.53 (t,
2 H, J = 7.1 Hz), 3.69 (s, 3 H), 3.58 (s, 2 H), 2.7
1 (brq, 2 H, J = 7.0 Hz), 2.42 (s, 3 H).

Example 8-2 Synthesis Example of (3-{(1E) -4- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-butenyl} phenyl) acetic acid The title compound was synthesized from the compound of 8-1 in the same manner as in Example 1-2.

[Chemical 80] ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.68 (d, 2 H, J = 8.1 H
z), 7.22 (d, 2 H, J = 8.1 Hz), 7.19 − 7.25 (m, 3
H), 7.13 (brd, 1 H, J = 7.0 Hz), 6.96 (dd, 1 H, J =
2.5, 1.7 Hz), 6.72 (dd, 1 H, J = 4.0, 1.7 Hz), 6.
36 (d, 1 H, J = 15.9 Hz), 6.18 (dt, 1 H, J = 15.9,
7.1 Hz), 6.14 (dd, 1 H, J = 4.0, 2.5 Hz), 4.53 (t,
2 H, J = 7.0 Hz), 3.61 (s, 2 H), 2.71 (brq, 2 H, J
= 7.0 Hz), 2.42 (s, 3 H).

Reference Example 5 Synthesis of (1-allyl-1H-pyrrol-2-yl) (4-methylphenyl) methanone

[Chemical 81] Potassium t-butoxy (1.05 g, 9.36 mmol) was dissolved in tetrahydrofuran (10 mL), and the compound of Reference Example 1 (1.65 g, 8.91 mmol) was added. After stirring at room temperature for 30 minutes, allyl bromide (1.62 g, 13.4 mmol) was added. The mixture was stirred for 2 hours, water was added, and the mixture was extracted with ethyl acetate. The organic layer was concentrated and purified by silica gel column chromatography,
The title compound was synthesized (1.61 g, 80%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.71 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 6.98 (dd, 1 H, J =
1.6 and 2.5 Hz), 6.74 (dd, 1 H, J = 1.6 and4.0 H
z), 6.19 (dd, 1 H, J = 2.5 and 4.0 Hz), 6.07 (ddt,
1 H, J = 10.3,16.7 and 5.6 Hz), 5.16 (dq, 1 H, J
= 10.3 and 1.3 Hz), 5.07 (dq, 1 H, J = 16.7 and 1.3
Hz), 5.05 (dt, 2 H, J = 5.6 and 1.3 Hz), 2.42 (br
s, 3 H).

Example 9 3-{(1E) -3- [2- (4-methylbenzoyl)
Synthesis of -1H-pyrrol-1-yl] -1-propenyl} benzoic acid

[Chemical 82]

Example 9-1 3-{(1E) -3- [2- (4-methylbenzoyl)
Synthesis of ethyl 1H-pyrrol-1-yl] -1-propenyl} benzoate

[Chemical 83] From ethyl 3-iodobenzoate and the compound of Reference Example 5,
The title compound was synthesized under the same conditions as in Reference Example 2-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ8.02 (t, 1 H, J = 1.4 H
z), 7.90 (dt, 1 H, J = 7.8 and 1.4 Hz), 7.74 (brd,
2 H, J = 8.1 Hz), 7.54 (dt, 1 H, J = 7.8 and1.4 H
z), 7.36 (t, 1 H, J = 7.8 Hz), 7.25 (brd, 2 H, J =
8.1 Hz), 7.05 (dd, 1 H, J = 2.6 and 1.6 Hz), 6.78
(dd, 1 H, J = 4.0 and 1.6 Hz), 6.46− 6.57 (m, 2
H), 6.23 (dd, 1 H, J = 4.0 and 2.6 Hz), 5.21 − 5.
25 (m, 2H), 4.37 (q, 2 H, J = 7.1 Hz), 2.43 (brs,
3 H), 1.39 (t, 3 H, J = 7.1 Hz).

Example 9-2 3-{(1E) -3- [2- (4-methylbenzoyl)
Synthesis of -1H-pyrrol-1-yl] -1-propenyl} benzoic acid

[Chemical 84] The title compound was synthesized from the compound of Example 9-1.
(Yield 100%) ¹ H NMR (CD ₃ OD, 400 MHz) δ8.03 (t, 1 H, J = 1.4 H
z), 7.91 (dt, 1 H, J = 7.8 and 1.4 Hz), 7.72 (brd,
2 H, J = 8.1 Hz), 7.63 (dt, 1 H, J = 7.8 and1.4 H
z), 7.43 (t, 1 H, J = 7.8 Hz), 7.35 (brd, 2 H, J =
8.1 Hz), 7.30 (dd, 1 H, J = 2.6 and 1.6 Hz), 6.82
(dd, 1 H, J = 4.0 and 1.6 Hz), 6.58 (dt, 1 H, J =
15.6 and 7.7 Hz), 6.53 (brd, 1 H, J = 15.6 Hz),
6.30 (dd, 1H, J = 4.0 and 2.6 Hz), 5.26 (brd, 2 H,
J = 7.7 Hz), 2.46 (brs, 3 H).

Example 10 Synthesis of 3- (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenyl) propionic acid

[Chemical 85]

Example 10-1 Synthesis of methyl 3- (3-iodophenyl) propionate

[Chemical 86] M-nitrocinnamic acid (10.5 g, 54.4 mmol) was added to methanol (200 ml) in the presence of 10% palladium-carbon (6.0 g).
The mixture was stirred in a hydrogen atmosphere for 2 hours. The mixture is filtered,
The filtrate was concentrated to give a 3- (3-aminophenyl) propionic acid mixture (9.8 g). Sodium nitrite (4.0 g, 5
8.0 mmol) was added little by little to concentrated sulfuric acid (30 ml) under ice-cooling and dissolved, and the above mixture (9.8 g) was added to this solution under ice-cooling.
Of acetic acid (30 ml) and concentrated hydrochloric acid (10 ml) were added, and the reaction solution was stirred at 0 ° C. for 1 hour and a half. This reaction liquid was added dropwise to a solution of potassium iodide (12.0 g, 72.3 mmol) in water (100 ml), and the mixture was stirred at 40 ° C. for 1 hour. Dilute the reaction with water,
It was extracted with toluene: ethyl acetate (2: 1). The organic layer was washed with aqueous sodium thiosulfate, water and saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure to give a 3- (3-iodophenyl) propionic acid mixture (12.0 g).
The above mixture (12.0 g) was dissolved in methanol (200 ml), thionyl chloride (11.0 g, 92.5 mmol) was added to this solution, and the reaction solution was stirred at 40 ° C. for 30 minutes. Saturated aqueous sodium hydrogen carbonate was added to the reaction solution, and the mixture was extracted with toluene: ethyl acetate (1: 1). The organic layer was washed with water and saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure.
The obtained residue is subjected to silica gel column chromatography
Purify with (hexane: ethyl acetate = 5: 1 → 4: 1),
The title compound was obtained (9.66 g, 3 steps 61%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.53 − 7.58 (m, 2 H),
7.18 (brd, 1 H, J = 7.7 Hz), 7.02 (t, 1 H, J = 7.7
Hz), 3.68 (s, 3 H), 2.89 (t, 2 H, J = 7.8 Hz), 2.61
(t, 2 H, J = 7.8 Hz).

Example 10-2 Methyl 3- (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenyl) propionate Synthesis of

[Chemical 87] The title compound was synthesized from the compound of Example 10-1 and the compound of Reference Example 5 under the same conditions as in Reference Example 2-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.74 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.18 − 7.22 (m, 3
H), 7.05 − 7.08 (m, 1 H), 7.05 (dd, 1 H, J = 2.5 a
nd 1.7 Hz), 6.77 (dd, 1 H, J = 4.0 and 1.7 Hz), 6.
48 (d, 1 H, J = 15.8 Hz), 6.42 (dt, 1 H, J = 15.8 a
nd 5.0 Hz), 6.20 (dd, 1 H, J = 4.0and 2.5 Hz), 5.2
0 (d, 2 H, J = 5.0 Hz), 3.66 (s, 3 H), 2.92 (t, 2
H, J = 7.8 Hz), 2.61 (t, 2 H, J = 7.8 Hz), 2.43 (s,
3 H).

Example 10-3 3- (3-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenyl) propionic acid Synthesis

[Chemical 88] The title compound was synthesized from the compound of Example 10-2 in the same manner as in Example 1-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.73 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.20 − 7.23 (m, 3
H), 7.06 − 7.10 (m, 1 H), 7.05 (dd, 1 H, J = 2.5 a
nd 1.7 Hz), 6.77 (dd, 1 H, J = 4.0 and 1.7 Hz), 6.
48 (d, 1 H, J = 15.8 Hz), 6.43 (dt, 1 H, J = 15.8 a
nd 5.0 Hz), 6.20 (dd, 1 H, J = 4.0and 2.5 Hz), 5.2
0 (d, 2 H, J = 5.0 Hz), 2.93 (t, 2 H, J = 7.8 Hz),
2.66 (t, 2 H, J = 7.8 Hz), 2.42 (s, 3 H).

Example 11 Synthesis of (2-methyl-5-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid

[Chemical 89]

Example 11-1 Synthesis of 4-iodo-2-methoxy-1-methylbenzene

[Chemical 90] Concentrated sulfuric acid (27.3 g) was added to sodium nitrite (1.
After adding 52 g, 22.0 mmol), a solution of 3-methoxy-4-methylaniline (2.74 g, 20.0 mmol) in acetic acid (40 mL) was added dropwise under ice-cooling stirring. After finishing the dropping, let the reaction solution stand at room temperature.
The mixture was stirred for 1 hour. A solution of potassium iodide (4.98 g) in water (40 mL) was added dropwise to the reaction solution under ice cooling, and after the addition was complete,
The reaction solution was stirred at room temperature for 8 hours. The reaction mixture was diluted with water, extracted with toluene, and washed with water, saturated aqueous sodium hydrogen carbonate solution, 10% aqueous sodium thiosulfate solution, and saturated brine. After drying over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure. Silica gel chromatography of the residue
Purification with (hexane / chloroform = 5/1) gave the title compound (2.13 g, 43%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.19 (dd, 1 H, J = 1.6 a
nd 7.8 Hz), 7.10 (d, 1 H, J = 1.6 Hz), 6.85 (d, 1
H, J = 7.8 Hz), 3.80 (s, 3 H), 2.15 (s, 3H).

Example 11-2 Synthesis of 5-iodo-2-methylphenol

[Chemical 91] A dichloromethane solution (0.91 M, 15 ml, 13.7 mmol) of boron tribromide was added dropwise to a dichloromethane (15 ml) solution of the compound of Example 11-1 (2.6 g, 10.5 mmol), and the reaction solution was allowed to stand at room temperature. Stir for 1 hour. The reaction mixture was poured into aqueous sodium hydrogen carbonate to stop the reaction, weakly acidified with 5% aqueous potassium hydrogen sulfate, and extracted with ethyl acetate. Water organic layer,
The extract was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 4: 1) to give the title compound (2.55 g, 103%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.17 (dd, 1 H, J = 1.6 a
nd 7.8 Hz), 7.12 (d, 1 H, J = 1.6 Hz), 6.84 (d, 1
H, J = 7.8 Hz), 4.78 (s, 1 H), 2.19 (s, 3H).

Example 11-3 Synthesis of t-butyl (5-iodo-2-methylphenoxy) acetate

[Chemical 92] The title compound was synthesized from the compound of Example 11-2 in the same manner as in Example 7-1. ¹ H NMR (CDCl ₃ , 400 MHz) δ7.21 (dd, 1 H, J = 7.7 a
nd 1.5 Hz), 6.96 (d, 1 H, J = 1.5 Hz), 6.87 (d, 1
H, J = 7.7 Hz), 4.50 (s, 2 H), 2.23 (s, 3H), 1.49
(s, 9 H).

Example 11-4 (2-Methyl-5-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid Synthesis of t-butyl

[Chemical 93] The title compound was synthesized from the compound of Example 11-3 and the compound of Reference Example 5 under the same conditions as in Reference Example 2-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.73 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.06 (d, 1 H, J = 7.
7 Hz), 7.04 (dd, 1 H, J = 2.5 and 1.7 Hz), 6.88 (d
d, 1 H, J = 7.7 and 1.3 Hz), 6.76 (dd, 1 H, J = 4.
0 and 1.7 Hz), 6.69 (d, 1 H, J = 1.3 Hz), 6.45 (d,
1 H, J = 15.8 Hz), 6.34 (dt, 1 H, J = 15.8 and 6.0
Hz), 6.20 (dd, 1 H, J = 4.0 and 2.5 Hz), 5.18 (d,
2 H, J = 6.0 Hz), 4.51 (s, 2 H), 2.42 (s, 3 H), 2.
26 (s, 3 H), 1.46 (s, 9 H).

Example 11-5 (2-Methyl-5-{(1E) -3- [2- (4-methylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid Synthesis of

[Chemical 94] The title compound was synthesized from the compound of Example 11-4 in the same manner as in Example 1-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.72 (d, 2 H, J = 8.1 H
z), 7.25 (d, 2 H, J = 8.1 Hz), 7.08 (d, 1 H, J = 7.
7 Hz), 7.05 (dd, 1 H, J = 2.5 and 1.7 Hz), 6.93 (d
d, 1 H, J = 7.7 and 1.3 Hz), 6.77 (dd, 1 H, J = 4.
0 and 1.7 Hz), 6.74 (d, 1 H, J = 1.3 Hz), 6.45 (d,
1 H, J = 15.8 Hz), 6.37 (dt, 1 H, J = 15.8 and 5.6
Hz), 6.21 (dd, 1 H, J = 4.0 and 2.5 Hz), 5.17 (d,
2 H, J = 5.6 Hz), 4.66 (s, 2 H), 2.42 (s, 3 H), 2.
26 (s, 3 H). Example 12 Synthesis of (3-{[2- (4-methylbenzoyl) -1H-pyrrol-1-yl] methyl} phenoxy) acetic acid

[Chemical 95]

Example 12-1 [1- (3-methoxybenzyl) -1H-pyrrole-2
-Yl] (4-methylphenyl) methanone synthesis

[Chemical 96] A solution of potassium t-butoxide (0.67 g, 5.97 mmol) in tetrahydrofuran (5 ml) was added to the compound of Reference Example 1 (0.69 g).
g, 3.73 mmol) in tetrahydrofuran (8 ml) was added, and the mixture was stirred at room temperature for 5 minutes. Under ice-cooling, m-methoxybenzyl chloride (0.59 g, 3.77 mmol) was added to the reaction solution, and the mixture was stirred at room temperature for 6 hours and at 50 ° C for 8 hours. Potassium t-butoxide (0.2 g, 1.78 mmol) and m-methoxybenzyl chloride (0.17 g, 1.09 mmol) were added to the reaction solution, and the mixture was heated under reflux for 6 hours. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. After washing the organic layer with water and saturated saline,
It was dried over magnesium sulfate and the solvent was distilled off under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 5: 1 → 4: 1) to give the title compound (1.07 g, 92%). ¹ H NMR (CDCl ₃ , 400 MHz) 7.70 (d, 2 H, J = 8.0 Hz),
7.23 (d, 2 H, J = 8.0Hz), 7.21 (t, 1 H, J = 7.9 H
z), 6.99 (dd, 1 H, J = 2.4, 1.7 Hz), 6.74 ~ 6.80
(m, 2 H), 6.77 (dd, 1 H, J = 4.0, 1.7 Hz), 6.69 ~
6.71 (m, 1 H), 6.20 (dd, 1 H, J = 4.0, 2.4 Hz), 5.
64 (s, 2 H), 3.75 (s, 3 H), 2.41 (s, 3H).

Example 12-2 [1- (3-hydroxybenzyl) -1H-pyrrol-
Synthesis of 2-yl] (4-methylphenyl) methanone

[Chemical 97] The title compound was obtained from the compound of Example 12-1 in the same manner as in Example 11-2. ¹ H NMR (CDCl ₃ , 400 MHz) 7.69 (d, 2 H, J = 8.0 Hz),
7.23 (d, 2 H, J = 8.0Hz), 7.17 (t, 1 H, J = 7.9 H
z), 7.00 (dd, 1 H, J = 2.4, 1.7 Hz), 6.77 (dd, 1
H, J = 4.0, 1.7 Hz), 6.75 (brd, 1 H, J = 7.9 Hz),
6.71 (dd, 1 H, J = 7.9, 2.3 Hz), 6.62 ~ 6.65 (br, 1
H), 6.21 (dd, 1 H, J = 4.0, 2.4 Hz), 5.60 (s, 2
H), 4.78 (s, 1 H), 2.42 (s, 3 H).

Example 12-3 Synthesis of t-butyl (3-{[2- (4-methylbenzoyl) -1H-pyrrol-1-yl] methyl} phenoxy) acetate

[Chemical 98] The title compound was obtained from the compound of Example 12-2 in the same manner as in Example 7-1. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.70 (d, 2 H, J = 8.0 H
z), 7.25 (d, 2 H, J = 8.0 Hz), 7.21 (t, 1 H, J =
7.9 Hz), 6.97 (dd, 1 H, J = 2.4, 1.7 Hz), 6.81 (br
d, 1 H, J = 7.9 Hz), 6.76 (dd, 1 H, J = 4.0, 1.7 H
z), 6.74 ~ 6.78 (m, 1 H), 6.69 ~ 6.72 (br, 1 H),
6.20 (dd, 1 H, J = 4.0, 2.4 Hz), 5.62 (s, 2 H), 4.4
5 (s, 2 H), 2.41 (s, 3 H), 1.46 (s, 9 H).

Example 12-4 Synthesis of (3-{[2- (4-methylbenzoyl) -1H-pyrrol-1-yl] methyl} phenoxy) acetic acid

[Chemical 99] The title compound was obtained from the compound of Example 12-3 in the same manner as in Example 1-2. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.68 (d, 2 H, J = 8.1 H
z), 7.24 (t, 1 H, J = 7.6 Hz), 7.23 (d, 2 H, J =
8.1 Hz), 7.00 (dd, 1 H, J = 2.5, 1.7 Hz), 6.83 (br
d, 1 H, J = 7.6 Hz), 6.78 ~ 6.81 (m, 1 H), 6.78 (d
d, 1 H, J = 4.0, 1.7 Hz), 6.73 ~ 6.75 (br, 1 H),
6.22 (dd, 1 H, J = 4.0, 2.5 Hz), 5.62 (s, 2 H), 4.6
0 (s, 2 H), 2.41 (s, 3 H).

Example 13 (3-{(1E) -3- [2- (3-chlorobenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 100]

Example 13-1 (3-chlorophenyl) (1H-pyrrol-2-yl)
Synthesis of methanone

[Chemical 101] The title compound was obtained from 1-benzenesulfonyl-1H-pyrrol and 3-chlorobenzoyl chloride in the same manner as in Reference Example 1. ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.59 (brs, 1 H), 7.87 (d
d, 1 H, J = 1.1, 1.4Hz), 7.77 (ddd, 1 H, J = 1.3,
1.4, 7.7 Hz), 7.54 (ddd, 1 H, J = 1.1, 1.3, 8.1 H
z), 7.43 (dd, 1 H, J = 7.7, 8.1 Hz), 7.18−7.16
(m, 1 H), 6.90−6.88 (m, 1 H), 6.38−6.35 (m, 1
H).

Example 13-2 (3-{(1E) -3- [2- (3-chlorobenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 102] The title compound was obtained from the compound of Example 13-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.77 (s, 1 H), 7.67 (d,
1 H, J = 7.7 Hz), 7.50 (d, 1 H, J = 7.9 Hz), 7.38
(dd, 1 H, J = 7.7, 7.9 Hz), 7.23 (dd, 1 H, J = 7.8,
8.1 Hz), 7.09−7.08 (m, 1 H), 7.02 (d, 1 H, J =
7.8 Hz), 6.93−6.92 (m, 1 H), 6.80 (d, 1 H, J = 8.
1 Hz), 6.78−6.75 (m, 1 H), 6.48−6.36 (m, 2 H),
6.24−6.22 (m, 1 H), 5.19 (d, 2 H, J = 4.7 Hz), 4.
66 (s, 2H).

Example 14 (3-{(1E) -3- [2- (4-chlorobenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 103]

Example 14-1 (4-chlorophenyl) (1H-pyrrol-2-yl)
Synthesis of methanone

[Chemical 104] The title compound was obtained from 1-benzenesulfonyl-1H-pyrrol and 4-chlorobenzoyl chloride in the same manner as in Reference Example 1. ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.59 (brs, 1 H), 7.85
(d, 2 H, J = 8.6 Hz), 7.47 (d, 2 H, J = 8.6 Hz), 7.
17−7.15 (m, 1 H), 6.87−6.86 (m, 1 H), 6.37−6.35
(m, 1 H).

Example 14-2 (3-{(1E) -3- [2- (4-chlorobenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 105] The title compound was obtained from the compound of Example 14-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.75 (d, 2 H, J = 8.5 H
z), 7.42 (d, 2 H, J = 8.5 Hz), 7.22 (dd, 1 H, J =
7.8, 8.1 Hz), 7.08−7.07 (m, 1 H), 7.01 (d, 1 H, J
= 7.8 Hz), 6.92 (s, 1 H), 6.79 (d, 1H, J = 8.1 H
z), 6.76−6.74 (m, 1 H), 6.48−6.37 (m, 2 H), 6.23
−6.22 (m, 1 H), 5.19 (d, 2 H, J = 4.6Hz), 4.65
(s, 2 H).

Example 15 [3-((1E) -3- {2- [4- (trifluoromethoxy) benzoyl] -1H-pyrrol-1-yl}-
Synthesis of 1-propenyl) phenoxy] acetic acid

[Chemical 106]

Example 15-1 Synthesis of 1H-pyrrol-2-yl [4- (trifluoromethoxy) phenyl] methanone

[Chemical 107] The title compound was obtained from 1-benzenesulfonyl-1H-pyrrol and 4- (trifluoromethoxy) benzoyl chloride in the same manner as in Reference Example 1. ¹ H NMR (CDCl ₃ , 400 MHz) 9.75 (brs, 1 H), 7.95 (d,
2 H, J = 8.8 Hz), 7.32 (d, 2 H, J = 8.8 Hz), 7.18
−7.16 (m, 1 H), 6.89−6.87 (m, 1 H), 6.37−6.36
(m, 1 H).

Example 15-2 [3-((1E) -3- {2- [4- (trifluoromethoxy) benzoyl] -1H-pyrrol-1-yl}-
Synthesis of 1-propenyl) phenoxy] acetic acid

[Chemical 108] The title compound was obtained from the compound of Example 15-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.85 (d, 2 H, J = 8.8 H
z), 7.28 (d, 2 H, J = 8.8 Hz), 7.21 (dd, 1 H, J =
7.8, 8.0 Hz), 7.09−7.08 (m, 1 H), 7.01 (dd, 1 H,
J = 2.0, 7.8 Hz), 6.92 (dd, 1 H, J = 2.0, 2.0 Hz),
6.78 (dd, 1 H, J = 2.0, 8.0 Hz), 6.78−6.76 (m, 1
H), 6.48−6.38 (m, 2 H), 6.24−6.22 (m, 1 H), 5.19
(d, 2 H, J = 4.6 Hz), 4.65 (s, 2 H).

Example 16 (3-{(1E) -3- [2- (1,3-benzodioxo-l-5-ylcarbonyl) -1H-pyrrol-1-
[Ill] -1-propenyl} phenoxy) acetic acid

[Chemical 109]

Example 16-1 1,3-Benzodioxo-5-yl (1H-pyro-
Synthesis of ru-2-yl) methanone

[Chemical 110] 1-benzenesulfonyl-1H-pyrrole and 3,4-
The title compound was obtained from (methylenedioxy) benzoyl chloride in the same manner as in Reference Example 1. ^{_{1 H NMR (CDCl 3,,}} 400 MHz) δ 9.50 (brs, 1 H), 7.55
(dd, 1 H, J = 8.1 and1.7 Hz), 7.48 (d, 1 H, J = 1.
7 Hz), 7.12 (dt, 1 H, J = 1.3 and 2.7 Hz), 6.89 (d,
1 H, J = 8.1 Hz), 6.88 (ddd, 1 H, J = 3.8, 2.4 an
d 1.3 Hz), 6.34 (dt, 1 H, J = 3.8 and 2.7 Hz), 6.0
6 (s, 2 H).

Example 16-2 (3-{(1E) -3- [2- (1,3-benzodioxo-5-ylcarbonyl) -1H-pyrrol-1-
[Ill] -1-propenyl} phenoxy) acetic acid

[Chemical 111] The title compound was obtained from the compound of Example 16-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ7.43 (dd, 1 H, J = 1.6,
8.1 Hz), 7.33 (d, 1 H, J = 1.6 Hz), 7.19 (dd, 1 H,
J = 7.7, 8.2 Hz), 7.03−7.02 (m, 1 H), 6.99 (d, 1
H, J = 7.7 Hz), 6.90 (s, 1 H), 6.84 (d, 1 H, J =
8.1 Hz), 6.78−6.76 (m, 2 H), 6.45−6.36 (m, 2 H),
6.21-6.19 (m, 1 H), 6.03 (s, 2 H), 5.14 (d, 2 H,
J = 4.2 Hz), 4.62 (s, 2 H).

Example 17 Synthesis of (3-{(1E) -3- [2- (4-isopropylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid

[Chemical 112]

Example 17-1 (4-isopropylphenyl) (1H-pyrrole-2-
Il) Methanone synthesis

[Chemical 113] The title compound was obtained from 1-benzenesulfonyl-1H-pyrrol and 4-isopropylbenzoyl chloride in the same manner as in Reference Example 1. ¹ H NMR (CDCl ₃ , 400 MHz) 9.64 (brs, 1 H), 7.85 (d,
2 H, J = 8.3 Hz), 7.34 (d, 2 H, J = 8.3 Hz), 7.14
−7.12 (m, 1 H), 6.92−6.90 (m, 1 H), 6.35−6.33
(m, 1 H), 2.99 (sept, 1 H, J = 6.9, 6.9 Hz), 1.29
(d, 6 H, J = 6.9 Hz).

Example 17-2 Synthesis of (3-{(1E) -3- [2- (4-isopropylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid

[Chemical 114] The title compound was obtained from the compound of Example 17-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.76 (d, 2 H, J = 8.2 H
z), 7.30 (d, 2 H, J = 8.2 Hz), 7.20 (dd, 1 H, J =
7.8, 7.8 Hz), 7.06−7.04 (m, 1 H), 7.00 (dd, 1 H,
J = 2.3, 7.8 Hz), 6.92 (dd, 1 H, J = 2.3, 2.3 Hz),
6.81−6.79 (m, 1 H), 6.75 (dd, 1 H, J = 2.3, 7.8
Hz), 6.48−6.39 (m, 2 H), 6.22−6.20 (m, 1 H), 5.18
(d, 2 H, J = 4.7 Hz), 4.65 (s, 2 H), 2.97 (sept,
1 H, J = 6.9 Hz), 1.28 (d, 6 H, J = 6.9 Hz).

Example 18 Synthesis of (3-{(1E) -3- [2- (4-cyclohexylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid

[Chemical 115]

Example 18-1 (4-Cyclohexylphenyl) (1H-pyrrole-2
-Yl) Synthesis of methanone

[Chemical 116] The title compound was obtained from 1-benzenesulfonyl-1H-pyrrol and 4-cyclohexylbenzoyl chloride in the same manner as in Reference Example 1. ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.66 (brs, 1 H), 7.84
(d, 2 H, J = 8.3 Hz), 7.31 (d, 2 H, J = 8.3 Hz), 7.
14-7.12 (m, 1 H), 6.92-6.90 (m, 1 H), 6.35-6.33
(m, 1 H), 2.59−2.58 (m, 1 H), 2.05−1.75 (m, 4
H), 1.48-1.26 (m, 6 H).

Example 18-2 Synthesis of (3-{(1E) -3- [2- (4-cyclohexylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl} phenoxy) acetic acid

[Chemical 117] The title compound was obtained from the compound of Example 18-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.75 (d, 2 H, J = 8.3 H
z), 7.28 (d, 2 H, J = 8.3 Hz), 7.22 (dd, 1 H, J =
7.8, 7.8 Hz), 7.05−7.03 (m, 1 H), 7.02 (dd, 1 H,
J = 2.3, 7.8 Hz), 6.92 (dd, 1 H, J = 2.3, 2.3 Hz),
6.81−6.78 (m, 2 H), 6.45−6.43 (m, 2 H), 6.22−6.
20 (m, 1 H), 5.19 (d, 2 H, J = 4.6 Hz), 4.66 (s, 2
H), 2.57−2.56 (m, 1 H), 1.91−1.75 (m, 4 H), 1.4
7-1.25 (m, 6 H).

Example 19 (3-{(1E) -3- [2- (4-ethylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 118]

Example 19-1 (4-ethylphenyl) (1H-pyrrol-2-yl)
Synthesis of methanone

[Chemical 119] The title compound was obtained from 1-benzenesulfonyl-1H-pyrrol and 4-ethylbenzoyl chloride in the same manner as in Reference Example 1. ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.72 (brs, 1 H), 7.85
(d, 2 H, J = 8.3 Hz), 7.31 (d, 2 H, J = 8.3 Hz), 7.
14-7.13 (m, 1 H), 6.92-6.90 (m, 1 H), 6.35-6.34
(m, 1 H), 2.74 (q, 2 H, J = 7.6 Hz), 1.29 (t, 3
H, J = 7.6 Hz).

Example 19-2 (3-{(1E) -3- [2- (4-ethylbenzoyl) -1H-pyrrol-1-yl] -1-propenyl}
Phenoxy) acetic acid synthesis

[Chemical 120] The title compound was obtained from the compound of Example 19-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.75 (d, 2 H, J = 8.2 H
z), 7.27 (d, 2 H, J = 8.2 Hz), 7.22 (dd, 1 H, J =
7.9, 7.9 Hz), 7.05−7.04 (m, 1 H), 7.01 (dd, 1 H,
J = 2.2, 7.9 Hz), 6.92 (dd, 1 H, J = 2.2, 2.0 Hz),
6.80−6.78 (m, 2 H), 6.45−6.43 (m, 2 H), 6.22−
6.20 (m, 1 H), 5.19 (d, 2 H, J = 4.6Hz), 4.65 (s,
2 H), 2.72 (q, 2 H, J = 7.6 Hz), 1.27 (t, 3 H, J =
7.6 Hz).

Example 20 [3-((1E) -3- {2- [4- (trifluoromethyl) benzoyl] -1H-pyrrol-1-yl} -1
-Propenyl) phenoxy] acetic acid synthesis

[Chemical 121]

Example 20-1 Synthesis of 1H-pyrrol-2-yl [4- (trifluoromethyl) phenyl] methanone

[Chemical 122] 2,2,6,6-Tetramethylpiperidine (3.75 g, 26.6 mmo
l) in 100 mL of THF and stirring at -70 degrees,
n-Butyllithium (17.3 m as a 1.6M hexane solution)
L, 27.8 mmol) was added dropwise. After stirring as it is for 1 hour, N- (benzenesulfonyl) pyrrole (5.00 g, 2
A solution of 4.1 mmol) in THF (100 mL) was added dropwise. In addition, 1
After stirring for an hour, a solution of 4- (trifluoromethyl) benzaldehyde (4.63 g, 26.6 mmol) in THF (50 mL) was added dropwise. The temperature was raised to room temperature over 1 hour, and 2N ammonium chloride aqueous solution was added to terminate the reaction. The mixture was extracted with ethyl acetate, the organic layer was washed with water and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure,
The residue was dissolved in 200 mL of chloroform, manganese dioxide (55 g) was added, and the mixture was stirred at room temperature for 2 hours. Filter it off,
The filtrate was concentrated and the residue was mixed with THF (50 mL) -methanol (50 m).
It was dissolved in L), 4N sodium hydroxide (100 mL) was added, and the mixture was stirred at 60 ° C. for 2 hr. Water was added and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated saline and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (hexane: ethyl acetate = 10: 1 → 5: 1) to give the title compound. (2.85 g, 44.8%) ¹ H NMR (CDCl ₃ , 400 MHz) δ 9.66 (brs, 1 H), 7.98
(d, 2 H, J = 8.0 Hz), 7.75 (d, 2 H, J = 8.0 Hz), 7.
20−7.18 (m, 1 H), 6.88−6.86 (m, 1 H), 6.38−6.36
(m, 1 H).

Example 20-2 [3-((1E) -3- {2- [4- (trifluoromethyl) benzoyl] -1H-pyrrol-1-yl} -1
-Propenyl) phenoxy] acetic acid synthesis

[Chemical 123] The title compound was obtained from the compound of Example 20-1 and the compound of Reference Example 3 in the same manner as in Example 3-5. ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.88 (d, 2 H, J = 8.0 H
z), 7.71 (d, 2 H, J = 8.0 Hz), 7.23 (d, 1 H, J = 7.
8, 8.0 Hz), 7.11−7.10 (m, 1 H), 7.02 (dd, 1 H, J
= 2.2, 7.8 Hz), 6.93 (dd, 1 H, J = 2.2, 2.2 Hz),
6.80 (dd, 1 H, J = 2.2, 8.0 Hz), 6.75−6.74 (m, 1
H), 6.49-6.39 (m, 2 H), 6.25-6.23 (m, 1 H), 5.21
(d, 2 H, J = 4.7 Hz), 4.66 (s, 2 H).

Example 21 (3- {2- [2- (4-methylbenzoyl) -1H-
Synthesis of pyrrol-1-yl] ethoxy} phenoxy) acetic acid

[Chemical 124]

Example 21-1 [3- (2-hydroxyethoxy) phenoxy] acetic acid t
-Butyl synthesis

[Chemical 125] 3-acetoxyphenol (3.04 g, 20 mmol) N, N
− In a dimethylformamide (80 ml) solution, calcium carbonate (2.76 g, 20 mmol) and ethyl bromoacetate (2.2 ml,
(20 mmol) was added and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution to stop the reaction, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, 10% aqueous citric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 10: 1) to obtain ethyl [3- (acetyloxy) phenoxy] acetate (3.30 g, 69%).

[0149] Lithium aluminum hydride (455 mg, 12 mmo
l) in tetrahydrofuran (12 ml),
(Acetyloxy) phenoxy] ethyl acetate (1.19 g,
A tetrahydrofuran (20 ml) solution of 5 mmol) was added dropwise at room temperature, and the reaction solution was stirred at room temperature for 2 hours. 10 in the reaction solution
% Hydrochloric acid water was added to stop the reaction, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, 10% aqueous hydrochloric acid, saturated aqueous sodium hydrogencarbonate and saturated brine, dried over sodium sulfate, and the solvent was evaporated under reduced pressure to give 3- (2-hydroxyethoxy) phenol. (864 mg, quant.). In a solution of the above 3- (2-hydroxyethoxy) phenol (864 mg, 5 mmol) in tetrahydrofuran (20 ml), potassium carbonate (967 m
g, 7 mmol), t-butyl bromoacetate (0.89 ml, 6 mmo
l) was added and the mixture was stirred at room temperature for 2 hours. The reaction was stopped by adding 10% aqueous citric acid to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, 10% aqueous citric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 3: 1) to give the title compound (3.30 g, 69%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.18 (t, 1 H, J = 8.1
Hz), 6.56 (dd, 1 H, J = 8.1 Hz, 1.7 Hz), 6.46 −
6.52 (m, 2 H), 4.49 (s, 2H), 4.06 (t, 2 H, J = 4.5
Hz), 3.92 − 3.97 (m, 2 H), 2.04 (t, 2 H, J = 6.2
Hz), 1.49 (s, 9H)

Example 21-2 (3- {2- [2- (4-methylbenzoyl) -1H-
Synthesis of pyrrol-1-yl] ethoxy} phenoxy) acetic acid

[Chemical 126] [3- (2-hydroxyethoxy) phenoxy] acetic acid t
-Butyl (268 mg, 1 mmol), triethylamine (0.21
ml, 1.5 mmol) in tetrahydrofuran (4 ml) solution,
Methanesulfonyl chloride (0.093 ml, 1.2 mmol)
The mixture was added dropwise at 0 ° C, and the reaction solution was stirred at 0 ° C for 1 hour. The reaction was stopped by adding 10% aqueous citric acid to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 10% aqueous citric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and the solvent was evaporated under reduced pressure to give a mesyl mixture.

[0151] To a solution of the compound of Reference Example 1 (222 mg, 1.2 mmol) in tetrahydrofuran (2 ml), potassium t-butoxide (135 mg, 1.2 mmol) was added at 0 ° C, and the reaction solution was stirred for 10 minutes. A tetrahydrofuran (1 ml) solution of the above mesyl derivative mixture was added to this reaction solution, and the mixture was stirred at 0 ° C. for 5 hours. The reaction was stopped by adding 10% aqueous citric acid to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 10% aqueous citric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (hexane: ethyl acetate = 4: 1) to obtain a coupling body. The above coupling body is treated with 10% aqueous sodium hydroxide (1
ml) and methanol (4 ml) and the reaction mixture at room temperature.
Stir for 1 hour. After washing the reaction solution with hexane, the aqueous layer was acidified with aqueous potassium hydrogen sulfate and extracted with chloroform. The organic layer was washed with saturated brine, dried over sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was dried under reduced pressure to give the title compound (56 mg, 15%). ¹ H NMR (CDCl ₃ , 400 MHz) δ 7.70 (d, 2 H, J = 8.1
Hz), 7.25 (d, 2 H, J = 8.1 Hz), 7.16 (t, 1 H, J =
8.3 Hz), 7.10 (dd, 1 H, J = 2.4 Hz, 1.9 Hz), 6.77
(dd, 1 H, J = 4.0 Hz, 1.7 Hz), 6.48 − 6.56 (m, 3
H), 6.17 (dd, 1H, J = 4.0 Hz, 2.5 Hz), 4.76 (t, 2
H, J = 5.0 Hz), 4.63 (s, 2 H), 4.34 (t, 2 H, J = 5.
0 Hz), 2.42 (s, 3 H)

Example 22 Evaluation of PPARδ agonist activity

Example 22-1 Experimental Material Using a human brain cDNA library as a template, two types of primers (forward primer: 5'-GGCGGA
TCCGTATGTCACACAACGCTATCC-
3 ', reverser primer: 5'-CGGGGATCC
TTAGTACATGTCCCTTGTAGATCTCC
-3 ') was subjected to PCR reaction to obtain a gene fragment coding for the ligand binding region of human PPARδ (including amino acid residues 138-441). The obtained gene fragment was inserted into the multi-cloning site of the expression vector pM (Clontech) containing the DNA binding region of yeast GAL4 protein, and the GAL4 protein DNA binding region and human PP were inserted.
Vector expressing fusion protein of ARδ ligand binding region
A plasmid was obtained. As the reporter plasmid, a pGL3-basic vector (Promega) containing the firefly luciferase gene into which the GAL4 protein responsive element UAS and the rabbit β-globin promoter were inserted was used.
To correct the transformation efficiency, a plasmid pβgal control (Clontech) containing the lacZ gene was used.

Example 22-2 Luciferase Assay COS-1 cells were prepared by using Dulbecco's Modified Eagle Medium (DMEM) (Gibco) without phenol red containing 5% charcoal-dextran-treated fetal bovine serum (Gibco). ,
The cells were cultured at 37 ° C in the presence of 5% carbon dioxide. COS-1
The cells were seeded on a 24-well plate at a density of 5 × 10 ⁴ cells / well and cultured overnight. The medium was replaced with a medium containing 5% activated carbon / dextran-free fetal bovine serum, and 5 ng of GAL4-PPARδ expression plasmid was added per well.
Reporter plasmid 50 ng, pβgal con
350 ng of trol DNA was transfected with Lipofectamine plus reagent (Gibco). After culturing for 4 hours, the medium was replaced with a medium containing 5% activated carbon / dextran-treated fetal bovine serum, and the compound of the present invention was added so that the final concentration was 1 μM or 10 μM. 24
After culturing for a period of time, the cells were lysed using the cell lysate attached to the luciferase assay system (Promega), and the luciferase activity was measured with a luminometer using the luciferase assay reagent attached to the cell lysate. . The β-galactosidase activity was measured using a β-galactosidase enzyme measuring system (Promega) to correct the transformation efficiency. PP
ARδ agonist activity was measured using solvent (DMSO) as a control.
The luciferase activity of the well to which was added was shown as a relative activity with the luciferase activity being 1.

[Table 4]

INDUSTRIAL APPLICABILITY The present invention provides a PPARδ agonist containing a pyrrole derivative as an active ingredient. In particular, the compound of the present invention is useful as a blood lipid lowering agent due to its PPARδ agonist activity, and further, the compound of the present invention is used as an active ingredient as a therapeutic or prophylactic agent for atherosclerotic coronary sclerosis. be able to.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C07D 405/06 C07D 405/06 (72) Inventor Ryu Nagata 3-chome 1-98 Kasuga, Konohana-ku, Osaka Issue Sumitomo Pharmaceutical Co., Ltd. F-term (reference) 4C063 AA01 BB04 CC81 DD04 EE01 4C069 AC07 BA02 BB22 4C086 AA01 AA02 AA03 BC05 GA02 GA07 MA01 MA04 NA14 ZA45 ZC33

Claims (10)

[Claims] 1. The formula (1): (In the formula, R ¹ represents a hydrogen atom, a halogen atom, an alkyl group having 1 to 4 carbon atoms or an alkoxy group having 1 to 4 carbon atoms, and R ² represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms. R ³ is a halogen atom, an unsubstituted or substituted alkyl group having 1 to 4 carbon atoms, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, or an alkyl group having 5 to 7 carbon atoms. Represents a cycloalkyl group or a carbamoyl group, and R ⁴ represents a hydrogen atom, a halogen atom, an unsubstituted or substituted C 1 to C ⁴ alkyl group, an unsubstituted or substituted C 1 4 represents an alkoxy group, a cycloalkyl group having 5 to 7 carbon atoms, or a carbamoyl group, or R ³ and R ⁴ together are an unsubstituted or optionally substituted oxygen source. A child may form a 5- to 7-membered ring including 0 to 2, X ¹ represents a single bond, an oxygen atom or a sulfur atom, X ² represents a single bond, an oxygen atom, and Y represents a carboxyl group or a raw group. W ¹ represents a group which is hydrolyzed in the body to regenerate a carboxyl group, W ¹ represents a single bond or an unsubstituted or optionally substituted alkylene chain having 1 to 4 carbon atoms, and W ² is unsubstituted or substituted Optionally represents an alkylene chain having 1 to 4 carbon atoms or an alkenylene chain having 3 to 4 carbon atoms which may be substituted, and W ³ represents a single bond, a carbonyl group or an alkylene group having 1 to 4 carbon atoms.) A PPARδ agonist represented by: 2. The PPARδ agonist according to claim 1, wherein W ³ is a carbonyl group. 3. The PPARδ agonist according to claim 1, wherein Y is a carboxyl group. 4. Formula (2): (In the formula, R ¹ is located at the 2 or 3 position and represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an alkoxy group having 1 to 4 carbon atoms, and R ³ is a halogen atom, unsubstituted or substituted. Optionally represents an alkyl group having 1 to 4 carbon atoms, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, and R ⁴ is Hydrogen atom, halogen atom, unsubstituted or optionally substituted alkyl group having 1 to 4 carbon atoms, unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, cycloalkyl having 5 to 7 carbon atoms represents a group or a carbamoyl group, or R ^3, R ⁴ may combine to form a 5 to 7-membered ring containing 2 from 0 together unsubstituted or optionally substituted oxygen atom, ¹ is a single bond, an oxygen atom or a sulfur atom, X ² represents a single bond, an oxygen atom, W ¹ represents a single bond or an unsubstituted or substituted by carbon atoms 1 even if 4 alkylene chain, W ² represents an unsubstituted or substituted alkylene chain having 1 to 4 carbon atoms or an optionally substituted alkenylene chain having 3 to 4 carbon atoms).
Rδ agonist. 5. The formula (3): (In the formula, X ¹ and X ^{2 each} represent a single bond or an oxygen atom, W ¹ represents an alkylene chain having 1 to 4 carbon atoms, and R ³ represents a halogen atom, unsubstituted or optionally substituted 1 carbon atom. 4 represents an alkyl group, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, and R ⁴ represents a hydrogen atom, a halogen atom, or an unsubstituted group. Or represents an optionally substituted alkyl group having 1 to 4 carbon atoms, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, or R ³ and R ⁴ may together form an unsubstituted or optionally substituted oxygen atom to form a 5 to 7-membered ring containing 0 to 2, W ² is unsubstituted or substituted Represents an alkylene chain having 1 to 4 carbon atoms which may be present or an alkenylene chain having 3 to 4 carbon atoms which may be substituted).
Rδ agonist. 6. A formula (4): (In the formula, W ² represents an alkenylene chain having 3 to 4 carbon atoms, R ³ represents a halogen atom, an unsubstituted or optionally substituted alkyl group having 1 to 4 carbon atoms, unsubstituted or substituted. Which represents an alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms, or a carbamoyl group). 7. The formula (5): (In the formula, W ² represents an alkenylene chain having 3 to 4 carbon atoms, R ³ represents a halogen atom, an unsubstituted or optionally substituted alkyl group having 1 to 4 carbon atoms, unsubstituted or substituted. Which represents an alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms, or a carbamoyl group). 8. A formula (6): (In the formula, R ¹ is located at the 2 or 3 position and represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an alkoxy group having 1 to 4 carbon atoms, and R ³ is a halogen atom, unsubstituted or substituted. Optionally represents an alkyl group having 1 to 4 carbon atoms, an unsubstituted or optionally substituted alkoxy group having 1 to 4 carbon atoms, a cycloalkyl group having 5 to 7 carbon atoms or a carbamoyl group, and X ¹ is a single group. Represents a bond, an oxygen atom or a sulfur atom, and W ¹ represents a single bond or an unsubstituted or optionally substituted alkylene chain having 1 to 4 carbon atoms). 9. The PP according to any one of claims 1 to 8.
A blood lipid lowering agent comprising an ARδ agonist or a pharmaceutically acceptable salt thereof as an active ingredient. 10. The PP according to any one of claims 1 to 8.
A therapeutic or prophylactic agent for atherosclerotic coronary atherosclerosis, which comprises an ARδ agonist or a pharmaceutically acceptable salt thereof as an active ingredient.