JP2003111591A - Dna region of swinepox virus and recombinant swinepox virus using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To newly provide a DNA region essential to proliferation of swinepox viruses. SOLUTION: Recombinant swinepox viruses having extraneous genes are prepared by combining a DNA fragment essential to proliferation of swinepox viruses derived from the swinepox virus genome having a base sequence expressed by arrangement number 1 or a DNA fragment comprising a base sequence in which one or several bases are defective, substituted or added.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION The present invention relates to swinepox virus (hereinafter
And a recombinant swinepox virus using the genomic region that is non-essential for the growth of SPV).

[0002]

2. Description of the Related Art Poxviruses such as vaccinia virus have been used since the 1980s as vectors for expressing foreign genes or as gene recombinant vaccines. Recombinant poxvirus production technology with foreign gene inserted: (1) constructing a plasmid vector in which a non-essential region for virus growth is cloned,
(2) Constructing a recombinant plasmid in which a foreign gene is inserted into the nonessential region, (3) introducing the recombinant plasmid into cells infected with the parental virus, and (4) the viral genomic DNA in the infected cells. By homologous recombination between non-essential regions of the recombinant plasmid, (5) the recombinant virus is separated from the mixed parent virus and purified (Piccini et al., Me).
thodsin Enzymology, 153, p5
45-563, 1987). Therefore, the cloned non-essential genomic region for virus growth is essential for recombinant virus production.

Swinepox virus (hereinafter abbreviated as SPV) is classified as Poxviridae or Chordpoxvirinae.
e), the genus Suipoxvirus
s) and has been expected to be used as a recombinant virus vector for pigs (Feller
et al, Virology, 183, p578-.
585, 1991). The genome size of this virus is about 175 kbp, and a restriction enzyme site map has also been reported (Massung et al., Virolo.
gy, 180, p347-54, 1991), a region that is non-essential for viral growth for producing recombinant SPV is TK gene (Vet. Rec. 134, p13-1).
8,1994, US Pat. No. 6,217,882) and Hind.
III-M fragment (US Pat. No. 5,869,312), Hin
dIII-N fragment (US Pat. No. 6,033,904), Hi
Part of the ndIII-C fragment (US Pat. No. 565197)
2) etc. are only slightly known.

[0004]

DISCLOSURE OF INVENTION Problems to be Solved by the Invention The present inventors have earnestly studied to obtain a stable recombinant SPV in which a foreign gene is not lost even by subculturing, and as a result, in the SPV genome,
The present inventors have completed the present invention by identifying a genomic region that is non-essential for virus growth, and finding that a recombinant SPV that stably expresses a target gene can be produced by inserting a foreign gene into this genomic region.

[0005]

Thus, according to the present invention, a DNA fragment that is non-essential for the growth of swinepox virus derived from the swinepox virus genome having the nucleotide sequence shown in SEQ ID NO: 1, or in the nucleotide sequence Of the present invention, wherein a DNA fragment comprising a nucleotide sequence in which one or more bases of the above is deleted, substituted or added, and a cloning vector into which the DNA fragment is inserted, and a foreign gene are inserted. Recombinant swinepox virus having a nonessential region of

[0006]

BEST MODE FOR CARRYING OUT THE INVENTION (1) DNA fragment not essential for the growth of swinepox virus The DNA fragment of the present invention is a swinepox virus derived from the swinepox virus genome having the nucleotide sequence shown in SEQ ID NO: 1. Is a non-essential DNA fragment or a DNA fragment consisting of a base sequence in which one or more bases in the base sequence are deleted, substituted or added (hereinafter, may be collectively referred to as a non-essential region). Non-essential to the growth of the virus, mutant SPV in which the region is deleted, or recombinant SPV in which a foreign gene has been inserted in the region is the same as the virus before the mutation or recombination (parental virus),
It is a region capable of maintaining a stable genomic structure even after being propagated and subcultured for mutant SPV or recombinant SPV (that is, excellent in genomic stability).

The non-essential region of the present invention is a region capable of causing homologous recombination with the SPV genome.
DN required for homologous recombination with SPV genome
The A region has a high homology with the nucleotide sequence in the genome (usually 95
% Or more, preferably 98% or more), and usually 200b
It is composed of at least p, preferably at least 300 bp. The homology here is a value calculated by the DNA sequence analysis software “DNASIS” (sold by Takara Shuzo). Therefore, as long as the above conditions are satisfied, the non-essential region of the present invention is a DNA fragment having the base sequence shown in SEQ ID NO: 1 or a deletion of one or more bases of the base sequence shown in SEQ ID NO: 1. It may be a DNA fragment added or replaced. The DNA fragment shown in SEQ ID NO: 2 is the 6th nucleotide in the nucleotide sequence shown in SEQ ID NO: 1.
This corresponds to the 73rd to 2130th areas. And this DN
The A fragment corresponds to a DNA fragment lacking a plurality of bases in the base sequence shown in SEQ ID NO: 1. This sequence number 2
The DNA region shown in 1 is a DNA fragment capable of providing a particularly stable recombinant SPV. Of course, the DNA fragment shown in SEQ ID NO: 2 may also have one or more bases deleted, substituted or added.

The DNA fragment shown in SEQ ID NO: 1 of the present invention can be obtained from the SPV genome as in the following (a) to (c). (A) SPV genomic DNA is cleaved with restriction enzyme EcoRI and cloned into a vector to obtain a plurality of clones. (B) 3 to 6 kb among them
The SPV genomic DNA fragment of p clone is selected, and the restriction enzyme map of the clone is prepared. (C) Select the restriction enzyme map shown in FIG. The DNA fragment shown in SEQ ID NO: 1 has the restriction map shown in FIG. In the non-essential region of the present invention, the site into which the foreign gene is inserted is not particularly limited, but recombinant sites can be easily constructed as long as the site is cleavable by a restriction enzyme. Specific examples of such an insertion site include a restriction enzyme ClaI cleavage site at the 1787th position in SEQ ID NO: 1 and a restriction enzyme HindIII cleavage site at the 1897th position, which are insertion sites of foreign genes having excellent genomic stability. Is illustrated as. Recombinant SPV in which a foreign gene is inserted into these sites has a high expression level and is excellent in genome stability.

In the non-essential region of the present invention, the selection of the insertion site of the foreign gene excellent in genomic stability can be performed, for example, by the following (d)
The procedure from (g) to (g) may be followed. (D) The lacZ gene encoding β-galactosidase together with the promoter of vaccinia virus 7.5 kDa polypeptide (hereinafter referred to as 7.5 k promoter) at any restriction enzyme site present in the clone selected as described above. Is inserted according to a conventional method to construct a vector. (E) SP
Cells infected with V are transfected with each vector prepared in (d). (F) Purify each recombinant obtained. (G) After subculture of purified recombinant SPV in tissue culture cells derived from pig kidney for several passages, the stability of the genome and the expression of β-galactosidase are examined. When recombinant SPV in which the genome is stable and all plaques express β-galactosidase is obtained, the vicinity of the restriction enzyme site into which the lacZ gene is inserted is a nonessential region. The lacZ gene used here is Gene Bank Accession No. It is known as V00296.

(2) Recombinant SPV The recombinant SPV of the present invention is a recombinant SPV in which a DNA fragment having a foreign gene is inserted into the above-mentioned non-essential region of the present invention, and is produced, for example, as follows. In the non-essential region of the present invention cloned in a vector, together with a promoter that functions in the SPV genome,
An antigen gene of an enzyme or a pathogen is incorporated so as to be located under the control of the promoter. By introducing the vector into SPV-infected cells, homologous recombination is caused, and the resulting recombinant SPV is selected and purified.

(SPV) The SPV used in the present invention may be any virus strain as long as it is classified as a swinepox virus of the genus Supoxvirus of the subfamily Sponoxpoxvirus of the family Poxviridae. However, those having low toxicity are preferable. A specific example is the ATCC N stored in the depositary institution ATCC.
Umbr VR-363 and field isolates are exemplified.

(Vector for cloning non-essential region, cloning vector) The vector for cloning the non-essential region of the present invention is not particularly limited. For example, pBR322, pBR325, pUC7, pUC
8, pUC18 and other plasmids, pBluescript
Vectors such as phagemids such as tKII, phages such as M13 phage, and cosmids such as pHC79. The cloning vector of the present invention can be obtained by inserting the non-essential region of the present invention into the cloning site of this vector according to a conventional method.

(Enzyme Gene) The enzyme gene to be inserted into SPV in the present invention is not particularly limited. As a specific example, lacZ encoding β-galactosidase derived from Escherichia coli
Examples thereof include genes and luciferase genes.

(Antigen Gene) The antigen gene to be inserted into SPV in the present invention is not particularly limited. As a specific example, glycoprotein gp50 (Petr) of Aujeszky's disease virus
ovskis et al. J. Virol. , 59,
p216-223, 1986) and a gene encoding gp63 (Petrovskis et al., J. V.
irol. , 60, p185-193, 1986), a gene encoding the HA protein of swine influenza virus (Olsen et al., Am. J. Vet. R).
es. , 54, p1630-1636, 1993), a gene encoding a spike protein or a membrane protein of infectious gastroenteritis virus (Almazan et a).
l. , Proc. Natl. Acad. Sci. U.
S. A. , 97, p5516-5521, 2000) and the like, and genes encoding antigens involved in protection against infection are exemplified.

(Recombinant Vector) The recombinant vector used in the present invention is one in which a foreign gene and a promoter controlling it are inserted in a non-essential region.
The above-mentioned antigen gene and the promoter controlling it may be inserted into the nonessential region of the cloning vector of the present invention containing the above-mentioned nonessential region according to a conventional method.

(Promoter) The promoter used in the present invention is not particularly limited as long as it functions as a promoter in a recombinant SPV-infected host. For example,
Examples include the above-mentioned 7.5k promoter of vaccinia virus, promoters of genes encoding 11k polypeptides, thymidine kinase, and the like. As long as it functions as a promoter, it may be modified such as by deleting a part. It may be present or may be a synthetic one.

(Method for Producing Recombinant SPV Virus) The method for producing the recombinant SPV is not particularly limited and may be carried out according to a conventional method. That is, by introducing a recombinant vector into a cell previously infected with SPV by, for example, calcium phosphate or electroporation,
Homologous recombination takes place between the vector and the viral genomic DNA in the infected cell to construct the recombinant SPV.
The obtained recombinant SPV is used for infecting a host cell cultured in a medium such as Eagle MEM, and a hybridization method using the inserted foreign gene or a part thereof as a probe, a method for examining the expression of the inserted enzyme gene, and insertion. The desired recombinant virus candidate may be selected and purified by an immunoassay method using an antibody against the polypeptide encoded by the antigen gene. For example, in the case of recombinant SPV in which the lacZ gene is incorporated as an enzyme gene, β-galactosidase is expressed. Therefore, one of its substrates, Bluo-gal (GIBC
Since blue plaque is formed in the presence of O-BRL), it is possible to easily select and purify by utilizing its properties.

The host cell is not particularly limited as long as it can be infected with the SPV to be used and proliferate, and examples thereof include a tissue culture cell line derived from pig kidney, and specific examples thereof include ESK-4 cells ( ATCC number: CL-18
4) and PK-15 cells (ATCC number: CCL-33)
Etc.

[0019]

EXAMPLES The present invention will be specifically described below with reference to examples. Incidentally,% in the text is based on weight unless otherwise specified. (Example 1) Preparation of plasmid into which SPV genomic DNA fragment was inserted PK cultured in 6 culture dishes with a diameter of 150 mm
-15 cells, 0.1 pfu / cell of swinepox virus VR363 strain (obtained from ATCC) (hereinafter, MOI =
In some cases, it may be abbreviated as 0.1)
0.03% L-glutamine and 10% fetal bovine serum (FB
S) in 20 ml of Eagle's MEM medium at 37 ° C,
After culturing for 7 days in a 5% CO ₂ incubator, the infected cells were scraped off from the dish with a scraper and collected in a 50 ml centrifuge tube. Phosphate buffer (pH 7.0;
After washing with PBS), the cells are suspended in 1.2 ml of PBS and 0.8 ml of solubilization buffer (1.25% T) is added.
RITONX-100, 250 mM 2-mercaptoethanol (2-ME), 50 mM EDTA-added PB
S) was added and the mixture was left standing at room temperature for 15 minutes to solubilize the cells.
Cell debris was removed by centrifugation at 3,000 rpm for 5 minutes, and the supernatant was transferred to an Eppendorf tube for 15.0
The virus particles were precipitated by centrifugation at 00 rpm for 20 minutes, and the virus particles were collected. The recovered virus particles were resuspended in 1 ml of 12.5 mM Tris buffer (pH 7.5) and the nuclease solution (0.25 mg / ml DN was added).
aseI, 0.25 mg / ml RNase A, 15
4 μl of 0 mM NaCl) was added and the mixture was allowed to stand at 37 ° C. for 30 minutes. Then, 25 μl of 500 mM EDTA, 10
% SDS 125 μl, distilled water 87 μl, 10 mg /
12.5 μl of ml Protease K and 0.5 μl of 2-ME were added, and the mixture was allowed to stand at 55 ° C. for 30 minutes. afterwards,
Phenol / chloroform / isoamyl alcohol (2
5: 24: 1) Extraction was performed twice. 5M Na in the upper layer liquid
16 μl of Cl was added, 2.5 times amount of ethanol was added, and the mixture was allowed to stand at −70 ° C. to precipitate DNA. 70%
The DNA was washed with ethanol and dried. In this way, 20 μg of SPV genomic DNA was obtained.

The obtained genomic DNA was added to TE buffer (10
mM Tris-Cl (pH 8.0), 1 mM EDT
Dissolve in A) to a concentration of 1 μg / μl, and add 1 μg
g was cleaved with restriction enzyme EcoRI, and a DNA fragment of 3 Kbp to 5 Kb was recovered by 0.8% agarose gel electrophoresis. Then, the recovered DNA was LambdaZAPII vector (STRAT
The cut product is commercially available from AGENE. Product code No. # 236211). Then, packaging was performed according to the manufacturer's instructions attached to the product, and the titer of lambda phage was measured. The result was 2 × 10 ⁶ .

About 100 of the phage solution was added per plate.
Dilute so that the plaque appears and let the plaque come out,
Ten plaques were randomly selected, and "in vivo excision" was performed using the attached E. coli and helper phage according to the manufacturer's instructions. Then, the solution was spread on LB agar medium containing ampicillin and cultured at 37 ° C. overnight, and the emerged colonies were cultured in LB liquid medium containing ampicillin to prepare a plasmid from the increased E. coli by a conventional method. The 10 types of plasmids thus prepared (each p
BS-SPVE # 01 to # 10) is used as a restriction enzyme E
It was cut with coRI and analyzed by 0.8% agarose gel electrophoresis. When an insert DNA (EcoRI fragment) having a length of 3 to 5 Kbp was selected, pBS-SPV was selected.
Three types, E # 5, # 8, and # 10, corresponded. The respective insert DNAs were derived from SPV and were named clone # 5, clone # 8 and clone # 10, respectively.

(Example 2) Analysis of cloned SPV genome (1) Creation of restriction enzyme map The three plasmids selected in Example 1 were treated with restriction enzyme C
laI, BamHI, EcoRV, HindIII, P
Each of stI, SpeI, SnaBI, and XbaI was double-cut with a single or two restriction enzymes and subjected to agarose gel electrophoresis, and the number and number of bands appearing after cutting were examined. By changing the combination of double cleavages, the cleavage sites of the above restriction enzymes were determined for the four insert DNAs. Clones # 5 and # 8 were the same. Restriction enzyme maps of clone # 5 and clone # 10 are shown in FIGS. 1 and 2, respectively.

(2) Base sequence analysis The base sequences of clones # 5 and # 10 were analyzed by the following procedure. First of all, plasmid pBS-SP
Using VE # 5 and pBS-SPV # 10 as templates, commercially available sequencing primers (T3 20mer and T722) from STRATAGENE.
Beckman Coulter's DTCS kit (P / N 608000) according to the instructions for the sequence reaction solution.
EQ2000), the nucleotide sequences of about 600 bp at the 5'end and the 3'end of each clone were decoded. Next, a DNA fragment subcloned on the basis of the information of the restriction enzyme map (FIGS. 1 and 2) and a synthetic primer designed on the basis of the decoded nucleotide sequence information were used to perform sequential sequencing in the same manner. The full-length nucleotide sequence of clone # 10 was decoded. The nucleotide sequence of clone # 5 is shown in SEQ ID NO: 1, and the nucleotide sequence of clone # 10 is shown in SEQ ID NO: 3.

An open reading frame (ORF) encoding a protein consisting of 150 or more amino acids deduced from the decoded total nucleotide sequence information is
Three clones each were found in clone # 5 and clone # 10 (FIGS. 1 and 2).

(Example 3) Preparation of a plasmid for recombination in which the lacZ gene was inserted into an SPV genomic DNA fragment together with a promoter The enzyme reaction for preparing the plasmid used here was carried out by using a buffer solution and reaction conditions recommended by the enzyme manufacturer. It is done using. (1) Construction of pNZSP5 (Fig. 3) The plasmid pBS-SPVE # 5 was double-cut with the restriction enzymes SplI and BstXI to obtain phenol / chloroform /
After treatment with isoamyl alcohol (25: 24: 1),
After ethanol precipitation, Escherichia coli TG1 was transformed with the plasmid obtained by blunting the cut ends with a blunting kit (Takara Shuzo) and ligation. After culturing the colonies appearing on the LB agar medium in the presence of ampicillin in the LB liquid medium in the presence of ampicillin, the method of Birnboim and Dolly (Nucleic Acid
Research, Vol. 7, p1513-, 197
The plasmid was extracted in 9), and the plasmid pBS-SPVE # 5.5 lacking 0.5 kb containing the EcoRI site 3'downstream of clone # 5 was selected. This plasmid was further double-digested with restriction enzymes BamHI and XhoI, treated with phenol / chloroform / isoamyl alcohol (25: 24: 1), treated with ethanol, and then blunted with a blunting kit (Takara Shuzo). Then, Escherichia coli TG1 was transformed with the plasmid obtained by ligation. LB in the presence of ampicillin
Colonies that appeared on the agar medium were transformed into L in the presence of ampicillin.
After culturing in the B liquid medium, the plasmid was extracted by the method of Billunboim and Dolly, and the plasmid in which the DNA region from the EcXhoI site in the multiple cloning site 5 ′ upstream of clone # 5 to the BamHI site of clone # 5 was deleted pNZSP5 was selected.

(2) lacZ with 7.5k promoter
Modification of gene cassette (FIG. 4) pNZ76 having a 7.5k promoter and a lacZ gene under its control, described in Example 3 of JP-A-1-168279, was treated with restriction enzymes HindIII and S.
The lacZ gene fragment (about 3.7 kbp) with the 7.5 k promoter that had been double-cut with maI and cut out was pB.
luescript SK (-) (STRATAGEN
Ema's product, Code # 212206) SmaI and Hi
Plasmid pBS / lac inserted into ndIII site
Z (-/-L) was produced. Next, after annealing the synthetic DNAs shown in SEQ ID NO: 5 and SEQ ID NO: 6, SmaI / No
Ligation into pBS / lacZ (-/-L) plasmid double cleaved with tI gave pBS / lacZ (+ /
-) Was produced. Next, after annealing the synthetic DNAs shown in SEQ ID NO: 7 and SEQ ID NO: 8, HindIII / Sal
Ligation into pBS / lacZ (+/−) double cleaved with I created pBS / lacZ (+ / +).

(3) Recombinant plasmids pNZSP51R, pNZSP51L, pNZ in which the lacZ gene cassette with 7.5k promoter was inserted into clone # 5
Preparation of SP52-lacZ (Fig. 5) The plasmid pBS / lacZ (+ / prepared in (2)
3.7 kb obtained by digesting +) with the restriction enzyme SmaI
The p fragment was recovered from the agarose gel. This recovered D
The NA fragment is cleaved with the restriction enzymes HindIII or ClaI, respectively, and then the Klenow fragment (Takara Shuzo)
Escherichia coli TG1 was transformed with each of the obtained plasmids obtained by ligating the pNZSP5 plasmid with the blunt-ended cleavage ends using p. LB in the presence of ampicillin
Colonies that appeared on the agar medium were transformed into L in the presence of ampicillin.
After culturing in B liquid medium, the plasmid was extracted by the method of Billunboim and Dolly,
Recombinant plasmids pNZSP51L and pNZS in which the acZ gene was inserted into the respective restriction enzyme sites
P51R, pNZSP52L and pNZSP52R were obtained. FIG. 5 shows the procedure for producing four types of recombinant plasmids from pBSSP # 5 in this manner.

(4) Construction of pNZSP10 (FIG. 6) The plasmid pBS-SPVE # 10 was used as a restriction enzyme Hind.
Escherichia coli TG1 was transformed with the plasmid obtained by cutting with III and self-ligation. After culturing the colonies appearing on the LB agar medium in the presence of ampicillin in the LB liquid medium in the presence of ampicillin, the method of Billundboim and Dolly (Nucleic Acid Rese
arch, Vol. 7, p1513-, 1979) to extract the plasmid, and selected the plasmid pBS-SPVE # 10.1 lacking 0.4 kb containing the EcoRI site located 3'downstream of clone # 10. This plasmid was further double-digested with restriction enzymes EcoRI and BstXI, treated with phenol / chloroform / isoamyl alcohol (25: 24: 1), precipitated with ethanol, and blunted with a blunting kit (Takara Shuzo). Then, Escherichia coli TG1 was transformed with the plasmid obtained by ligation. L in the presence of ampicillin
After culturing the colonies appearing on the B agar medium in the LB liquid medium in the presence of ampicillin, the plasmid was extracted by the method of Birnboim and Dawley, and the EcoRI site in the 5'upstream multi-cloning site of clone # 10 was converted to the BstXI site. The plasmid pNZSP10 in which the 46 bases were deleted was selected.

(5) Construction of recombinant plasmids pNZSP11L and pNZSP11R in which the lacZ gene cassette with 7.5k promoter was inserted into clone # 10 (FIG. 7) Restriction from pBS / lacZ (+ / +) as in (3) A 3.7 kbp fragment obtained by cutting with the enzyme SmaI was recovered. Restriction enzyme Spe for pNZSP10 plasmid
Escherichia coli TG1 was transformed with the plasmid obtained by ligating the previously recovered 3.7 kbp DNA fragment to a plasmid which had been cleaved with I and which had its ends cleaved with Klenow fragment (Takara Shuzo). After culturing the colonies that appeared on the LB agar medium in the presence of ampicillin in the LB liquid medium in the presence of ampicillin, the plasmid was extracted by the method of Billunboim and Dolly, and the lacZ gene with 7.5k promoter was inserted into the target restriction enzyme site. Recombinant plasmids pNZSP11L and p
NZSP11R was obtained. The procedure for producing this recombinant plasmid is shown in FIG.

Example 4 Preparation and Purification of Recombinant SPV Expressing the lacZ Gene R monolayered with three 150 mm diameter culture dishes
K-15 cells were treated with the SPV VR363 strain M.P. O. I =
After infection with 0.1, 4 hours later, these cells were detached by trypsin treatment to obtain a cell suspension. The cells were separated by centrifugation and washed once with PBS, and then Saline G buffer (0.14M NaCl, 0.5 mM KC) was added.
1, 1.1 mM Na ₂ HPO ₄ , 0.5 mM MgC
2 × in the _{l 2 · 6H 2 0,0.011% glucose} )
The cells were suspended at a concentration of 10 ⁷ cells / ml and dispensed to the number of recombinant plasmids prepared in Example 3. 10 μg of each recombinant plasmid was added to each of the suspensions, and the mixture was added to Gene Pulser (Bio-
Rad) was used under the conditions of 3.0 KV / cm and 0.4 msec for electroporation. The plasmid-introduced cells were then cultured at 37 ° C. for 72 hours, and the cells were lysed by freeze-thawing three times. This solution contains the virus released from the lysed cells and is a mixed solution of the parent strain and the recombinant virus. Recombinants were selected from this mixed solution as follows. HAM 'without serum
s F-12K (KAIGHN modified type) medium (hereinafter, abbreviated as F12K medium) is serially diluted 10-fold, and the diluted solution is added to F12 containing 10% FBS in a culture dish having a diameter of 90 mm.
ESK-4 cells cultured in K medium (ATCC No. C
L-184) infected with F12K containing 10% FBS.
Was overlaid with agar medium containing.

After solidifying the agar at room temperature, it was incubated at 37 ° C. until SPV plaques appeared. 8 days later, Blu
Another agar medium containing 600 μg / ml of o-gal was overlaid on each culture dish and further cultured at 37 ° C. for 16 hours. Remove the virus from the blue plaques in the culture dish with a Pasteur pipette, dilute with F12K without serum,
The ESK-4 cells cultivated in a new culture dish with a diameter of 90 mm were infected with the diluted solution again, and F1 containing 10% FBS was added.
An agar medium containing 2K was overlaid. And Bluo-
The operation of overlaying agar containing gal was repeated. This procedure was repeated until all the plaques that formed were stained blue with Blue-gal. This process usually ends in about 4 times. However, the outpatient (in this case lac
Z) When the site into which the gene has been inserted is an essential region for virus growth, the purity of the recombinant does not increase even if this purification operation is repeated, and a purified recombinant cannot be obtained. Five types of recombination plasmids obtained in Example 3 (pNZS
P51L, pNZSP51R, pNZSP52L, pN
Table 1 shows the results of transfection and purification using ZSP52R and pNZSP11L).

[0032]

[Table 1]

As can be seen from Table 1, among the five types of recombinant plasmids, pNZSP51L, pNZSP51R, pNZSP52 having a part of the sequence shown in SEQ ID NO: 1.
Only when 4 kinds of L and pNZSP52R were transfected, the recombinant virus which became a blue plaque was purified. Each purified recombinant virus is rSP
V51L, rSPV51R, rSPV52L, rSPV
It was named 52R.

Example 5 Stability Confirmation by Passage Test of Recombinant Virus Produced in Example 4 ESK-4 cells cultivated in a culture dish with a diameter of 90 mm were respectively cultivated with 4 kinds of recombinants purified in Example 4 and M ． O.
I. = 0.1 and infected with 10% FBS F12K
After adding 10 ml of the medium, the cells were cultured at 37 ° C. in a CO ₂ incubator for 1 week. The culture supernatant was collected, the floating cells were removed by centrifugation, and 0.1 ml of the supernatant was added to a new diameter of 9
10 ml of F12K medium containing 10% FBS as a growth medium was infected with ESK-4 cells cultured in a 0 mm culture dish.
Was added and cultured. The culture supernatant obtained by repeating this operation 5 times was serially diluted 10-fold to infect ESK-4 cells to form plaques and Bl as in Example 4.
The plaque was developed with uo-gal. As a result, 3
With all kinds of recombinant viruses, all the plaques that appeared were stained blue, so that it was confirmed that the inserted gene (lacZ) was stably maintained on the genome even after five subcultures, and that β-galactosidase was expressed. .

The purified 4 kinds of recombinant SPV viruses were transformed into ESK-4 cells cultured in two 150 mm culture dishes. O. I. = 0.1, 20 ml of F12K medium containing 10% FBS was added, and the cells were cultured at 37 ° C. in a CO ₂ incubator for 1 week. The infected cells were scraped off from the culture dish and centrifuged (1,500 rp).
Infected cells are collected, washed with PBS, and then washed with PBS.
Resuspend in 1.2 ml, Lysis Buffer
(1.25% Triton X-100, 250 mM2-
ME, 50 mM EDTA in PBS) 0.8 ml
The cells were solubilized by adding Vortex (30 ″). The cell debris was removed at 3,000 rpm for 5 min.
Transfer the supernatant to an Eppendorf tube for 15,000 r
The virus was dropped by centrifugation at pm for 20 min at 4 ° C. 12.5 mM Tris-Cl (pH 7.5)
Add ml and Nuclease mixture
(0.25 mg / ml DNase I, 0.25 mg
/ Ml RNase A, 150 mM sodium chloride)
4 μl was added and the mixture was allowed to stand at 37 ° C. for 30 minutes. afterwards,
500 mM EDTA 25 μl, 10% SDS 1
25 μl, H ₂ O 87 μl, 10 mg / ml Pro
tease K 12.5 μl, 2-Mercapte
0.5 μl of tanol was added, and the mixture was allowed to stand at 55 ° C. for 30 minutes. The solution was extracted twice with phenol / chloroform / isoamyl alcohol (25: 24: 1).

16 μl of 5M sodium chloride was added to the aqueous layer, and 2.5 times the amount of the aqueous layer (cooled at -20 ° C.) 10
The precipitate (DNA) precipitated by adding 0% ethanol and centrifuging was washed with 70% ethanol, then centrifuged again to precipitate and then dried, and the TE buffer solution (10
mM Tris-Cl (pH 8.0), 1 mM EDT
A) Dissolved in 50 μl. The viral DNA thus recovered was cleaved with the restriction enzyme SnaBI and subjected to 0.8% agarose gel electrophoresis, and the DNA fragment cleaved with the restriction enzyme was blotted on a nylon membrane for Southern hybridization. The probe is "PCR DIG
Probe Synthesis Kit "(ROC
HE DIAGNOSTICS, Cat. # 16360
90) were used to prepare DIG-labeled DNA probes P05-6 (SEQ ID NO: 4) and P05-7 (SEQ ID NO: 5). The DNA probe is the OR of clone # 5.
It is a probe in F2 (Fig. 1).

As a result of Southern hybridization using this probe, it was confirmed that the recombinant virus was a correct recombinant as designed.

Southern blotting was also performed on the recombinant virus obtained by subculturing the recombinant in ESK-4 cells for 10 passages, and it was confirmed that the recombinant virus after the 10th passage had the correct gene structure. Therefore, it was confirmed that the recombinant was a stable recombinant.

Example 6 Comparison of Protein Expression Levels of Recombinant Viruses Produced in Example 4 ESK-4 cells cultivated in eight 90 mm diameter culture dishes were treated with the parent strain SPV and the recombinant SPV purified in Example 4. Two M. O. I. Infection was carried out by appropriately diluting so that = 1. F12K medium containing 10% FBS was added as a growth medium and cultured at 37 ° C., and after 96 hours, 1
After 20 hours, one infected cell was collected from each culture dish, the cells were washed with PBS, suspended in 0.5 ml of PBS, and this sample was frozen at -20 ° C. After the sample was planned has everything, to melt the sample, after addition of chloroform 2 drops, the 10μl enzyme reaction solution _{(60mM Na 2 HPO 4 · 7H} 2 O, 40mM
NaH ₂ PO ₄ · H ₂ O, 10 mM KCl, 1 mM
_{MgSO 4 · 7H 2 O, 50mM} 2-ME) 990
μl. This reaction solution was incubated at 28 ° C, and the substrate O was dissolved in the enzyme reaction solution at a concentration of 4 mg / ml.
0.2 ml of NPG (o-nitrophenyl-β-D-galactopyranoside; Sigma product number N1127) was added to start the enzymatic reaction, and the enzymatic reaction was stopped with 1 M K ₂ CO ₃ at an appropriate time, and 420 nm. The absorbance of was measured. still,
For quantification, β-galactosidase (product number G6512) commercially available from Sigma was used as an enzyme preparation.
Using the absorbance of the parent strain SPV sample as the background, the absorbance of each sample was subtracted and converted into a unit calculated from the absorbance of the enzyme preparation. The results are shown in Table 2, and it was found that rSPV51R expresses most β-galactosidase. Since the lacZ gene and its promoter inserted into the recombinant virus are the same, it is considered that this difference in the expression level is due to the insertion site.

[0040]

[Table 2]

Thus, rSPV51R and rSPV5
Insertion site used for 1L, ie, 1,897 of SEQ ID NO: 1
At the second restriction enzyme HindIII cleavage site, the inserted gene is highly expressed and a stable recombinant virus is obtained.
It was found to be a very suitable site for inserting a foreign gene. Since this site exists in ORF2 in clone # 5 as shown in FIG. 1, this OR
The F2 region (SEQ ID NO: 2) was determined to be a non-essential genomic region for virus growth.

[0042]

According to the present invention, a swinepox virus genomic region containing a non-essential genomic region for virus growth and a recombinant SPV using the same can be obtained. This recombinant SPV is stable and has a target gene. Since it is highly expressed,
It can be used for expression vectors, vaccines and the like.

[Sequence list] SEQUENCE LISTING <160> 5 <170> PatentIn Ver. 2.1 <210> 1 <211> 3552 <212> DNA <213> Swinepox virus <400> 1 gaattcggag acacgtgtat tactatagct gtgtacaatg aaaataagta tttccttaat 60 tctacactta ggtgtcatcc taatatatct atgcttaaag ccagttttaa ttattttata 120 aataaagatt tagactcccg cataaagaat aaaatgatag aagattgtat acgttacgta 180 tttacattgg atcctgatac atatctagat tatccatata tatgcacaaa ttttactagt 240 gttatagagg agtgtaaaaa agatattatc agaatgaaaa atactcattt acgtaatgtg 300 tccgtttatg atttagtatt caacaacaac aatactatga atatacgtta tgtatataca 360 gaagaagtta atatgttcgt atcgtctaaa ttgtatggta ataaagtgag aagaaccata 420 atcaattcta ttgagaaata tgataatata aaatatttat tattaaaaat taataatata 480 tgtacaaaca ctatttggaa tatattgcct acatatgttc atgaaaaaat attagactgt 540 atgacactaa atgacataaa aatgttatat tcgttattta ataggacatc cgtaaaatct 600 ttatcgtgat attgtttgta ttttttttat aatattattg aaaaagtaaa tagaatattt 660 aaccaaacca acatggtttc gttatacgag tatatatcgt atgcggatca tatagaacca 720 aatgttatac gtacactatt gacgtatgga tatgatatta acgaagaacg acgtggaagt 780 atagcactaa ctaaatattt aaaacgaaat tttataaaaa caaaaatact taaattactt 840 atacaatatg gttctaacgt aaattataga ggatatatag aaaccccatt atgttgtata 900 ttacgaaata cttatataag tagttcaaaa attaaaaaaa ttgttaagat attagtagaa 960 aacggtgcgg atataaacat gaaaacactt aatggtgtcg cgccaattat gtgttttatt 1020 tataatacta atataaacaa tgtggatatg ttaagatttc ttatacttaa cggtgtcgat 1080 atgagtgtaa aaagcacaag aggatttaac ttattacata tgtatctaca atcattcaat 1140 acaaatacac atgtagtaaa gatattaata gaatatggtg tcaatttatt ggaatcgaat 1200 acagaatatt atagaatcac tccgatgaat atatatctta gaaatgatgc atcgtttata 1260 tctataaagt taataaaata tcttatgtct aaaggtgcgt ctatgtcgga taatgatcaa 1320 catgaatctg tattagaatc gtttttagat aataacaaga ttattatgta taataatgat 1380 attaagatac ttaattttat actaaaatat ataaaagtta atcataagaa tagtatgggt 1440 tttactccta tattgatatc tgcaaaagtt gataattata gtgcctttaa ttattttctg 1500 atgttgggag atagtattta taatgcatcc aatgatggtg atactgttct tacatacgca 1560 gtacgtaatg gaaatcatcg catggtagat aaaatattag aattaaaacc cggtaaacat 1620 cttataagaa aaacgttcac atacttctcg gaacatggca tttcagatat cttctttaac 1680 gagaaaaaaa tgtttaccat gcttatgttg atgcattatt cgtttatgat atatccaata 1740 ttttataaaa actgtattga acttaaatta atgtttccac acgtcatcga tagatatgaa 1800 atggatttat cgaaaatgaa gaatgaacga ttacataata gtacattatc tatttatgat 1860 attatattca atagggagga ttgtatagta cctatcaagc ttctcaatta tgataatttt 1920 ttaagattaa aaaatttagt aatgtatgga tcacatatag aaaatattat caaaaataca 1980 tatatgtatt attctaacat tgataaagcg atttatgtaa ttatgaagca ctgcaagaaa 2040 catagttact ggatgaggat tcctatagaa atacaacgat atatattatt acatttaaca 2100 atgaaggact tatcaataat acttaagtaa taatgtcata atattgaaaa aaaatttttt 2160 ttctagtaat gtggctatta ttagtagccc atgaatacat tttggttatc gtttaaatag 2220 tttgtaagaa ggaaatggat aatataagaa gaataatatc aaatataaaa caggatgata 2280 atatagccac tgatatgtta gctacatttt taagttcatc gttgcacgta tttaaattaa 2340 aagagttgaa agaaattgta ttattactgc ttaataaagg tgctaattta aatgggatat 2400 ctatatatga taaaacacca tttcattgtt attttacatt taatacgaat gttacaatta 2460 aagtaataaa gtttcttatt tatcatggtg gtgacattaa cagtgtacat agatgtggag 2520 acaccatatt gcataaatac cttggtaatg agaatataga ttataaagtt gttgagtttt 2580 taataagaaa aggatttgat gtatgtaaac taaataatag tctgaagaat cctattcata 2640 tatttacaat tagacacatc aataacatta atttaaatat attgaatttg ctttgttcgc 2700 atataaaaca tgaatataat aaaaatgatg aaatgatgtc gatattaaac acgatgttaa 2760 actattgtca cgacgattat acatgttttt cggctatcaa atatattata gatatcacaa 2820 ccataaacta tagagataaa ttaggatatt ctcctgttgt gtatgcatct accacggata 2880 aaactatctt ggtggattat cttattaaat taggagcaaa catgaacata acaacgaacg 2940 atggtaatac atgtggttcg tttgctgtaa tgaattgtaa cagggatatt aatagactat 3000 ttcttaatca aaatccaaat atagaaacta tatataatac attgaagata ttatcggaga 3060 atatagtatt catagacgga tgtgatgtac gtacgaatat ggttaaaaaa atactaatgt 3120 acggatttac tttagatcca ctattttaca agaaccacga tatcattgtt gaatattttt 3180 caagtagtat taaaaagtat aataagatta ttttacaaat gattgatgag aaaattggga 3240 atagatccgt atacgatatt atatttacta aatcaaatac aggtatggat gttagatatg 3300 tatgtaatga tatcattata aaatatgcaa gtgttaaata ttatggatct ttaataaaac 3360 gtttgatata tcattctaag aaaaggaagc gaaatatatt aaaagctata catgcgatgg 3420 agaataacac aaccttgtgg aattacctac cattggaagt aaaaatgtat attatggatt 3480 tcttacccga tactgatata actaacattc tttttatgaa aaaatgaaaa tatatacata 3540 agacaggaat tc 3552 <210> 2 <211> 1458 <212> DNA <213> Swinepox virus <400> 2 atggtttcgt tatacgagta tatatcgtat gcggatcata tagaaccaaa tgttatacgt 60 acactattga cgtatggata tgatattaac gaagaacgac gtggaagtat agcactaact 120 aaatatttaa aacgaaattt tataaaaaca aaaatactta aattacttat acaatatggt 180 tctaacgtaa attatagagg atatatagaa accccattat gttgtatatt acgaaatact 240 tatataagta gttcaaaaat taaaaaaatt gttaagatat tagtagaaaa cggtgcggat 300 ataaacatga aaacacttaa tggtgtcgcg ccaattatgt gttttattta taatactaat 360 ataaacaatg tggatatgtt aagatttctt atacttaacg gtgtcgatat gagtgtaaaa 420 agcacaagag gatttaactt attacatatg tatctacaat cattcaatac aaatacacat 480 gtagtaaaga tattaataga atatggtgtc aatttattgg aatcgaatac agaatattat 540 agaatcactc cgatgaatat atatcttaga aatgatgcat cgtttatatc tataaagtta 600 ataaaatatc ttatgtctaa aggtgcgtct atgtcggata atgatcaaca tgaatctgta 660 ttagaatcgt ttttagataa taacaagatt attatgtata ataatgatat taagatactt 720 aattttatac taaaatatat aaaagttaat cataagaata gtatgggttt tactcctata 780 ttgatatctg caaaagttga taattatagt gcctttaatt attttctgat gttgggagat 840 agtatttata atgcatccaa tgatggtgat actgttctta catacgcagt acgtaatgga 900 aatcatcgca tggtagataa aatattagaa ttaaaacccg gtaaacatct tataagaaaa 960 acgttcacat acttctcgga acatggcatt tcagatatct tctttaacga gaaaaaaatg 1020 tttaccatgc ttatgttgat gcattattcg tttatgatat atccaatatt ttataaaaac 1080 tgtattgaac ttaaattaat gtttccacac gtcatcgata gatatgaaat ggatttatcg 1140 aaaatgaaga atgaacgatt acataatagt acattatcta tttatgatat tatattcaat 1200 agggaggatt gtatagtacc tatcaagctt ctcaattatg ataatttttt aagattaaaa 1260 aatttagtaa tgtatggatc acatatagaa aatattatca aaaatacata tatgtattat 1320 tctaacattg ataaagcgat ttatgtaatt atgaagcact gcaagaaaca tagttactgg 1380 atgaggattc ctatagaaat acaacgatat atattattac atttaacaat gaaggactta 1440 tcaataatac ttaagtaa 1458 <210> 3 <211> 3280 <212> DNA <213> Swinepox virus <400> 3 gaattcatat cactactata tcctatacaa ttatgttcaa aatatactta caaaaatgat 60 attgatcacg atacgatgtt cattcatgat attatatttt ttaataatac atgggtaaga 120 atattattta tagaatttct cggtataata gataaacaat atgagacatg tataatcaat 180 ccatacttag taaaagataa ttacaaaata tttaaaaata tattattgggg atctattatt 240 aataatatca tatttgataa aaattctact ttaattgaat tgataaataa attatatact 300 agatatcata tagataaata tataatgaca tgtatcgtca aatataatga ttataataat 360 ataaaattaa tttatcactg ttataataga aataagttta atgcgtacat atatgcatgg 420 ttccgttccc agataacatg tgattcgata gaagaaaatg aaaaggtaga aagaatgttt 480 aataatatat ctaaacgaat atgaaaacga tacgtgttca ttacgatcca tttataattg 540 aatatcatga ggattgggat catattatgg atcagatagc tgaaatgtat aacgaggttg 600 ctgaatggat attacgagat aatacatctc catcacctaa taatttcttt aaacaattaa 660 gagtaccttt gaaaaataag cgagtctgtg tttgtggtat agatccatac cctaatgatg 720 caacaggtat tccctttgaa tcacctaatt tttcaaagaa aacaattaaa gcaatcgctt 780 tatctatttc aaaaataaca ggtattgtga attataaagg atataatttg aatcatgttg 840 atggtgtgat accatggaac tattatttaa gttgtaaagt aggagaaaca aaaagtcacg 900 cattacattg gaaaaaaata tctaaaatat gtttacaaca tattacaaaa tatgtaaata 960 tattatactg tctaggcaaa accgatttct cgaacataaa atcaatatta gatactccta 1020 taactacaat agttggatat catccagctg ctagagataa acagttcgat aaagatagag 1080 catttgaggt gataaatgta ttattggaaa ttaatgataa acttcctata aattgggaac 1140 agggattcta ttgagtttag tgaaatttta acttgtgtcttaaatggcag ggtctctagt 1200 aaataatgag catatattcg tattaaagaa gataggtgtt ccttcatcgc ttagacagaa 1260 cgaagatcct agattcgtag atatatttac ttgcgatgaa ttagagaatt atatacataa 1320 taatccaacg tgtacactgt ttgaaacgtt gcgtgatgaa gaagcatact ctatagttcg 1380 tgtattcttg gatgtagatt tagatactat tttagacgaa atagatttta cagcagcatt 1440 ggaggatttt atattagaag ttactaaatt tgtatcattg tttgcaagta aagagtgtaa 1500 ttcggatatg aatcatatat tgaagtgcat gagatcaaat ttttcactta caaagtccac 1560 cgatattaat cgaactagtt ttcatatgat tttcccagat acatatacca cgatgaatac 1620 attaatagct atgaaaaaac cattactaga gttctcacga gcgtccgata atcctcttat 1680 aaggtctatt gatacagcag tttatcgtag aaaggcaacc ttacgtatag taggcactcg 1740 aaaatcacca acaaatgata agatacatat aaaacaacca cctcatgata atatatcaga 1800 ttatctattt acatatgtaa gcatgcatac gtgtagttgt tatttctatc taacacaacg 1860 actagaagat acaatgccta gtatattgtg ggaacctagt tatattcatt ttaaggatgc 1920 gatgaaaaag gtatctaaaa tcatcgtaaa tgaaataatt aattttaaag atttgacgga 1980 aaataacttt acaacgatac cattgataat agattatgtg atgccttgtt cgttatgtaa 2040 gaagaaacat cacaaacatc atcatcagtt atcgttggga aacggtatgt taaaaatata 2100 taaagctgga aatccacata gttgcaaagt aaaagcgatt acattagaag gaaataaatt 2160 attcactatt tctcaactta taatggattc taatgttatt cacttaacgg atagaggtga 2220 tcacatagta tggataaaaa atacttggaa gttcagtaca gaggaatcat taattacaaa 2280 attaatacta agtatgaagg aacaattacc tagtgaatat atacctgaca tattatgtcc 2340 tagaaaacgt aaagcgatag agaataatct aaaagatatg ttagtagata atattgaaac 2400 cgatacatat cctaatatgt taccttttaa aaatggtata ttaaacataa gtaccggaga 2460 attttataca ggtgttgaat ccaaggactt tatttgtacc gtatctacag gatttgaact 2520 ggatatggaa aaattttctg atacagaatc tacagaaatg aaagaattgg aaactattct 2580 aaacgatata caaccactta ctgatgagaa tagatgcaat agagaactat ttgaaaaaat 2640 actttctagt tgtttacatg gatccacaaa acagtgcatt acattcttct ttggtgaaac 2700 agcaactggg aaatcaacaa caaagaagtt attaagatcg tctataggtg acttatttat 2760 agaaaccggg caaacaatat taacggaagt aatggataaa ggaccaaatc catttatatc 2820 taatatgcat cttaaacgtt ctgtgttctg tagcgaatta ccagattttg catgtagtgg 2880 aagtaaaaag attagagcgg ataatattaa aaagcttaca gagacatgta tagtgggaag 2940 ggcatgcttc tcaaataaga taaataacag aaatcatgct actattataa tagatacaaa 3000 ttataagcct atttttgata gagtagataa cgcattaatg cgtagaattt ctttagtaaa 3060 gtttagaaca cattttacac agccttctag taatatatca actagaaaca gcacagcgta 3120 tgatgaaata aagccgctag atgaaactct agatttaaaa atacagagaa ataattatcg 3180 ttatccattc ttacatttgt tagtaaaatg gtatagaaaa tatcatttac ctacaatggt 3240 attgtatcct acacctgaag ccgttccaga ttttgaattc 3280 <210> 4 <211> 18 <212> DNA <213> Swinepox virus <400> 4 ctgatgtttg ggagatag 18 <210> 5 <211> 20 <212> DNA <213> Swinepox virus <400> 5 gtagctaaca tatcagtggc 20

[Brief description of drawings]

FIG. 1 is an explanatory diagram showing the restriction enzyme map of clone # 5 and the positions of probes used in ORF and Southern hybridization.

FIG. 2 Restriction map of clone # 10 and ORF
It is explanatory drawing which showed the position of.

FIG. 3 is an explanatory diagram illustrating a method for producing pNZSP5 from pBS-SPVE # 5.

FIG. 4 is an explanatory diagram illustrating a method for producing pBS / lacZ (+ / +).

FIG. 5: Recombination plasmids pNZSP51L and pNZSP51 in which the lacZ gene is inserted from pNZSP5
It is explanatory drawing which illustrated the method of producing R, pNZSP52L, and pNZSP52R.

FIG. 6 is an explanatory view illustrating a method for producing pNZSP10 from pBS-SPVE # 10.

FIG. 7: Recombination plasmids pNZSP11L and pNZSP1 in which the lacZ gene was inserted from pNZSP10
It is explanatory drawing which illustrated the method of producing 1R.

Claims (5)

[Claims] 1. A DNA fragment that is non-essential for the growth of swinepox virus derived from the swinepox virus genome having the base sequence shown in SEQ ID NO: 1, or one or more bases in the base sequence are deleted. A DNA fragment consisting of a substituted or added base sequence. 2. A DNA fragment that is non-essential for the growth of swinepox virus derived from the swinepox virus genome having the nucleotide sequence shown in SEQ ID NO: 2, or one or more bases in the nucleotide sequence are deleted. A DNA fragment consisting of a substituted or added base sequence. 3. A cloning vector into which the DNA fragment according to claim 1 or 2 is inserted. 4. DN which is non-essential for the growth of swinepox virus according to any one of claims 1 and 2, which contains a foreign gene.
A recombinant swinepox virus in which the A fragment is inserted. 5. The recombinant swinepox virus according to claim 4, wherein the foreign gene is a gene encoding an enzyme or an antigen protein of a pathogen.