JP2003092937A - Method for reducing pollen fertility by using gene of pollen specific zinc finger transcription factor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a gene engineering method useful for transforming a plant represented by male sterile by utilizing a specific gene in a pollen. SOLUTION: This method for producing the transformed plant is provided by utilizing a plant expression cassette containing a promoter containing any one of (a') a DNA having a first to 2624th of a base sequence expressed by the sequence number 7 in the specification, (a'') a DNA having a first to 3631st of a base sequence expressed by the sequence number 8 in the specification, or having a part of the sequence of the (a') or (a'') and exhibiting the specific promoter activity of a microspore and optionally a dehiscent tissue of the anther, and a xenogenic gene bonded with the promoter operably. Further, the promoter and the plant expression cassette containing the promoter and xenogenic gene and useful for imparting the male sterile property to the plant are provided.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a gene specifically expressed in pollen-forming tissues of stamens and its use. The present invention is particularly directed to a petunia-derived zinc finger transcription factor group (ZPT2) that is specifically expressed in microspores.
-5, ZPT3-1 and ZPT4-1) genes and their uses.

[0002]

BACKGROUND ART Fertility of pollen is a problem in various aspects in agriculture and horticulture. For example, when mating in crossbreeding, in order to avoid self-pollination, the work of emasculation (removal of stamens) that requires much labor is performed. In the seed and seedling industry, a trait without pollen fertility is required from the standpoint of commercially protecting the excellent varieties obtained by cross breeding. From such a demand, a technology (pollination control) for controlling the fertility of pollen has been strongly demanded. Traditionally, in certain crops, cytoplasmic male sterile lines have been used for cross breeding with some success. However, in many cases, cytoplasmic sterility traits are accompanied by unfavorable side effects such as reduced disease resistance, and further, traits are unstable and mass production of seeds is difficult. Methods for reducing fertility by chemical treatment have also been studied, but safety evaluation and elucidation of action mechanism have been delayed, and they have not been put to practical use. Therefore,
There is a demand for an excellent male sterilization technique using genetic engineering.

Pollen is a male gametophyte in seed plants. The development of pollen that progresses in a state of being surrounded by anthers as a support tissue is in the tetrad phase, which is immediately after meiosis of microspore-forming cells (pollen mother cells), in the release phase of microspores from tetrads, in the pollen cell It is divided into a mononuclear stage characterized by expansion and vacuolization, a mitotic division stage in which mitosis causes differentiation into vegetative cells and germ cells, and a subsequent binucleate stage. Through these steps, the anther is finally cleaved and mature pollen grains are released. Therefore, it can be said that microspores are one of the most suitable target tissues for artificial control for inhibiting pollen development and losing pollen fertility.

As described above, great expectations are placed on the male sterilization technique by genetic engineering. In particular, if a gene that is specifically expressed in a direct precursor of pollen cells such as microspores can be used, it is highly possible that male sterility can be achieved without imparting an unfavorable trait to plants. To be Several examples of various stamen-tissue-specific promoters and gene constructs for male sterility containing them have been reported (Shivan).
na and Sawhney, Pollenbiot
technology for croproduc
motion and improvement (Cam
bridge UniversityPress) p
p. 237-257, 1997). However, there is a continuing need for new genes that are highly tissue- and time-specifically expressed and useful for controlling pollen fertility.

The present inventors have recently found that PEThyZPT2-5, PE are novel transcription factors derived from petunia.
ThyZPT3-1 and PEThyZPT4-1
The cDNA sequences of seven zinc finger (ZF) type transcription factors including (hereinafter, abbreviated as ZPT2-5, ZPT3-1 and ZPT4-1 respectively) were identified. Then, it was reported from Northern blot analysis that each transcription factor showed anther-specific, transient expression at different stages of anther development (Kobayashi et al., Pl.
ant J. , 13: 571, 1998). However, the physiological functions and actions of these transcription factors in plants, and the precise expression site of the gene encoding the transcription factor and its regulation mechanism have been unknown.

[0006]

SUMMARY OF THE INVENTION An object of the present invention is to provide a genetic engineering method utilizing a pollen-specific gene useful for modifying plant traits represented by male sterility.

[0007]

The present inventors have found that anther-specific transcription factor group (ZPT) previously isolated from petunia.
The genes encoding 2-5, ZPT3-1 and ZPT4-1) were reintroduced into petunia. As a result, it was found that the normal development of pollen was inhibited and the fertility of pollen was remarkably reduced (ZPT2-5 and ZPT4-1) or almost completely lost (ZPT3-1). Furthermore, the present inventors isolated the upstream regions from the ZPT3-1 and ZPT4-1 genomic genes, respectively, and examined the tissue specificity of their promoter activity. As a result, it was found that the promoter activity was expressed tissue- and time-specifically in the microspores from the mononuclear stage to the binucleate stage. The present invention has been completed based on these findings.

In a first aspect thereof, the present invention relates to a method for producing a male-sterile plant, which comprises the following steps: (i) No. 1 of the nucleotide sequence shown by SEQ ID NO: 1 A DNA having a sequence from the 1st position to the 777th position, (ii) a DNA encoding a transcription factor that hybridizes with the DNA having the nucleotide sequence of (i) under stringent conditions and controls pollen development, or (I
ii) providing a plant expression cassette comprising a nucleic acid that is either a DNA that is a fragment of (i) or (ii) and a promoter operably linked to said nucleic acid; controlling pollen development A step of providing a plant cell having an endogenous transcription factor, wherein the gene encoding the endogenous transcription factor hybridizes with the nucleic acid under stringent conditions; Introduction into a plant cell; regeneration of a plant cell into which an expression cassette has been introduced into a plant; and expression of an endogenous transcription factor in the regenerated plant by expressing the nucleic acid The step of selecting a plant body in which is suppressed.

In a second aspect thereof, the present invention relates to a method for producing a male-sterile plant, which comprises the following steps: (i ') of the nucleotide sequence represented by SEQ ID NO: 3 DNA having a sequence from the 1st position to the 1640th position, D having a base sequence of (ii ′) (i ′)
Hybridizes with NA under stringent conditions,
A nucleic acid that is a DNA encoding a transcription factor that controls pollen development or a DNA that is a fragment of (iii ') (i') or (ii '), and a promoter operably linked to the nucleic acid. And a step of providing a plant cell having an endogenous transcription factor that controls pollen development, wherein the gene encoding the endogenous transcription factor comprises: A step of hybridizing with the above nucleic acid under stringent conditions; a step of introducing the expression cassette into a plant cell; a step of regenerating a plant cell into which the expression cassette has been introduced into a plant; and a regenerated plant body. And a step of selecting a plant in which expression of an endogenous transcription factor is suppressed by expressing the nucleic acid.

In a third aspect thereof, the present invention relates to a method for producing a male-sterile plant, which comprises the following steps: (i ") of the nucleotide sequence represented by SEQ ID NO: 5 DNA having a sequence from the 1st position to the 1948th position, D having a base sequence of (ii ") (i")
Hybridizes with NA under stringent conditions,
A nucleic acid that is a DNA encoding a transcription factor that controls pollen development or a DNA that is a fragment of (iii ") (i") or (ii "), and a promoter operably linked to the nucleic acid And a step of providing a plant cell having an endogenous transcription factor that controls pollen development, wherein the gene encoding the endogenous transcription factor comprises: A step of hybridizing with the above nucleic acid under stringent conditions; a step of introducing the expression cassette into a plant cell; a step of regenerating a plant cell into which the expression cassette has been introduced into a plant; and a regenerated plant body. And a step of selecting a plant in which expression of an endogenous transcription factor is suppressed by expressing the nucleic acid.

However, the DNAs of (ii), (ii ') and (ii ") are (iv) SEQ ID NO: 1 respectively.
3 does not contain a DNA that encodes a transcription factor that hybridizes with the DNA having the sequence from the 1st position to the 1886th position of the nucleotide sequence represented by 3 under stringent conditions and that controls the development of pollen. The nucleotide sequence represented by SEQ ID NO: 13 is a cDNA sequence encoding another transcription factor ZPT3-2 isolated from Petunia (K.
Obaashi et al., supra).

The method according to the first to third aspects of the present invention is a method for imparting male sterility to a plant,
Can be used.

In one embodiment of the first to third aspects, the nucleic acid is ligated in the forward direction to the promoter and can be transcribed in the sense direction in the cells of the plant.

In one embodiment of the first to third aspects, the nucleic acid is linked in the reverse direction to the promoter and can be transcribed in the cell in the plant in the antisense direction.

In one embodiment of the first to third aspects, the plant is a dicotyledon. The dicotyledonous plant is preferably a Solanaceae plant, more preferably a Petunia plant.

[0016] In one embodiment of the first to third aspects, the expression cassette is incorporated into a plant expression vector.

According to the first to third aspects of the present invention, there is also provided a male-sterile plant produced by any of the methods described above.

In a fourth aspect thereof, the present invention relates to a method for producing a plant whose trait has been modified, comprising the following steps: (a ') of the nucleotide sequence represented by SEQ ID NO: 7 DNA having a sequence from the 1st position to the 2nd position, or a part of the sequence of (b ') (a'), and DN showing microspore-specific promoter activity
Providing a plant expression cassette comprising a promoter containing any one of A and a heterologous gene operably linked to the promoter; introducing the expression cassette into plant cells; and introducing the expression cassette A step of regenerating plant cells into plants.

In a fifth aspect thereof, the present invention relates to a method for producing a plant whose trait has been modified, comprising the following steps: (a ″) of the nucleotide sequence represented by SEQ ID NO: 8 DNA having a sequence from the 1st position to the 3631st position, or a part of the sequence of (b ") (a") and having a specific promoter activity to microspores and optionally to anther cleavage tissue Providing a plant expression cassette, comprising a promoter containing any of the DNAs shown in claim 1 and a heterologous gene operably linked to the promoter; introducing the expression cassette into plant cells; and
A step of regenerating a plant cell into which the expression cassette has been introduced.

[0020] In one embodiment in the fourth and fifth aspects, the trait is fertile, and the plant having the altered trait is a male sterile plant. Therefore, the method of the present invention, as a method for imparting male sterility to plants,
Can be used.

[0021] In one embodiment of the above-mentioned fourth and fifth aspects, the trait is compatible and the trait-modified plant is a self-incompatible plant. Therefore, the above method of the present invention can also be used as a method for imparting self-incompatibility to plants.

In one embodiment of the fourth and fifth aspects, the plant is a dicotyledon. The dicotyledonous plant is preferably a Solanaceae plant, more preferably a Petunia plant.

In one embodiment of the fourth and fifth aspects, the expression cassette is incorporated in a plant expression vector.

According to the fourth and fifth aspects of the present invention, there is also provided a trait-modified plant produced by any one of the methods described above.

In a sixth aspect thereof, the present invention relates to a promoter containing the following DNA of (I ') or (II'): (I ') from the 1st position to the 1st position of the nucleotide sequence shown by SEQ ID NO: 7. DN having a sequence up to position 2624
A DNA having a partial sequence of A or (II ′) (I ′) and showing a promoter activity specific to microspores.

In a seventh aspect thereof, the present invention relates to a promoter containing the following DNA (I ") or (II"): (I ") from the 1st position to the 1st position of the nucleotide sequence shown by SEQ ID NO: 8. DN having a sequence up to position 3631
A, or a DNA having a partial sequence of (II ") (I") and exhibiting promoter activity specific to microspores and optionally to anther cleavage tissue.

The present invention in its eighth aspect includes any of the above microspore-specific promoters and a heterologous gene operably linked to the above promoters.
The present invention relates to a plant expression cassette useful for imparting male sterility to plants.

[0028]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be described in more detail below. (Transcription Factors Derived from ZPT3-2, ZPT3-1 and ZPT4-1 Genes) The nucleic acids useful in the method for producing a male-sterile plant, which are the first to third aspects of the present invention, include the following: Either: (i) a DNA having a sequence from the 1st position to the 777th position of the base sequence represented by SEQ ID NO: 1, (i ') a 1st position to the 164th position of the base sequence represented by SEQ ID NO: 3
A DNA having a sequence up to the 0th position, (i ″) a DNA having a sequence from the 1st position to the 1948th position of the nucleotide sequence represented by SEQ ID NO: 5, or any of (i) to (i ″) A DNA that hybridizes with a DNA having a nucleotide sequence under stringent conditions and encodes a transcription factor that controls pollen development (that is, (ii), (i
i ') or (ii ")), or any one of the above D
A DNA which is a fragment of NA (ie (iii), (iii ') or (iii ")).

The above-mentioned nucleic acid in the present invention is preferably DNA of (i), (i ') or (i "), that is,
It is a DNA encoding ZPT2-5, ZPT3-1 or ZPT4-1, or a fragment thereof, more preferably (i), (i ′) or (i ″) DNA.

As used herein, the term "transcription factor" refers to a protein that binds to DNA in the regulatory region of a gene and controls the synthesis of mRNA. Certain transcription factors have their DN
It is known that the A-binding domain has a highly conserved amino acid sequence called a zinc finger (ZF) motif. ZPT2-5 is a Cys2 / His2 type (E
It is a zinc finger (ZF) protein of the PF family), which is a transcription factor containing two ZF motifs within a full-length amino acid sequence of 176 amino acids and further including a hydrophobic region called DLNL sequence. ZPT3
Similarly, -1 is a ZF protein of the EPF family, which is a transcription factor containing three ZF motifs within the full-length amino acid sequence of 437 amino acids and further including a DLNL sequence. Similarly, ZPT4-1 is a ZF protein of the EPF family, which is a transcription factor containing four ZF motifs within the full-length amino acid sequence of 474 amino acids and further including a DLNL sequence. For both, see Kobayashi et al. (Supra). ZP
The cDNA sequences encoding T2-5, ZPT3-1 and ZPT4-1 (SEQ ID NOS: 1, 3 and 5), along with the corresponding deduced amino acid sequences (SEQ ID NOS: 2, 4 and 6), respectively, are shown in FIGS. 2A-2C and FIGS. 3A-
Shown in 3D.

In the present specification, the term "fragment" of nucleic acid or DNA means a fragment capable of suppressing the expression of an endogenous transcription factor of the plant when introduced into a plant and expressed in an appropriate manner. Say. This fragment is (i) above,
(I '), (i "), (ii), (ii') or (i
i ”) DNA other than the region encoding the zinc finger motif, and at least about 40 base pairs or more, preferably about 50 base pairs or more, more preferably about 7 base pairs or more.
It has a length of 0 base pairs or more, more preferably about 100 base pairs or more.

As used herein, the term "stringent conditions" for hybridization means a specific nucleotide sequence (eg, ZPT2-5, ZP derived from petunia).
DNA encoding T3-1 or ZPT4-1),
To form an oligonucleotide double strand with another base sequence having high homology with this (for example, DNA existing in plants other than petunia and encoding a homolog of ZPT2-5, ZPT3-1 or ZPT4-1) Intended for sufficient conditions. Typical examples of the stringent conditions applied to the present invention include the following conditions: 1M
NaCl, 1% SDS, 10% dextran sulfate, ³² P
Labeled probe DNA (1 × 10 ⁷ cpm) and 50 μ
16 in a solution containing g / ml salmon sperm DNA at 60 ° C
After hybridizing for 2 hours, 2xSSC / 1% SDS
Repeat the washing at 60 ° C. for 30 minutes twice.

ZPT2-5 and ZPT3 in the present invention
-1 and ZPT4-1-encoding DNA, and hybridizing with them under stringent conditions,
To isolate DNA encoding a transcription factor that controls pollen development, a pair of degenerate primers corresponding to the conserved region of the amino acid sequence encoded by the gene of a known transcription factor can be used. Using this primer pair, PCR can be performed using plant cDNA or genomic DNA as a template, and then the obtained amplified DNA fragment can be used as a probe to screen a cDNA library or genomic library of the same plant. . As an example of such a primer pair, 5 '
-CARGCNYTNGGNGGNCAY-3 '(SEQ ID NO: 9) and 3'-RTGNCCNCNARNGCY
In combination with TG-5 '(SEQ ID NO: 10), where N is inosine, R is G or A, and Y is C or T. The above primer sequences respectively correspond to the amino acid sequence QALGGH contained in the zinc finger motif of the above ZPT transcription factors.

Therefore, the stringent hybridization conditions applied to the present invention can also be defined as PCR conditions, and in a typical example, the above-mentioned degenerate primers (SEQ ID NOs: 9 and 10) are used. Can be done. The PCR reaction conditions at this time are: denaturation at 94 ° C. for 5 minutes, then 94 ° C. for 30 seconds, 50 ° C. for 30 seconds,
Then, the condition may be such that 1 minute is repeated at 72 ° C. for 30 cycles, and finally incubation is performed at 72 ° C. for 7 minutes.

PCR can be performed based on the guidelines of the manufacturers of commercially available kits and devices, or by methods well known to those skilled in the art. A method for preparing a gene library, a method for cloning a gene, etc. are well known to those skilled in the art. For example, Sa
mbrook et al., Molecular Clonin
g: A Laboratory Manual, Second Edition (Cold Spring Harbor Labor)
atory, 1989). The nucleotide sequence of the obtained gene can be determined using a nucleotide sequence analysis method known in the art or a commercially available automatic sequencer.

[0036] As used herein, a transcription factor "regulates pollen development" typically means that when expression of this transcription factor is inhibited, a significant change in pollen morphology or function is observed. That means. The transcription factor in the present invention is typically pollen, preferably about 75% or more, more preferably about 90% or more, even more preferably about 95% or more, by inhibiting the expression of the gene encoding it. The cells are killed before they mature. Here, the expression of the transcription factor being inhibited means that the amount of mRNA is about 1/10 or less of that of the wild type control plant, as measured by Northern blotting.

Transcription factors encoded by the genes isolated and identified by the above-mentioned screening (ie, ZPT2-5, ZPT3-1 and ZPT).
4-1 and their homologs) regulate pollen development can be confirmed by producing transformed plants according to the disclosure herein and observing the characteristics of the pollen.

In the present invention, a DNA encoding a transcription factor that controls pollen development can be used to suppress the expression of an endogenous gene containing a nucleotide sequence identical or homologous to the DNA in plant cells. . The targeted endogenous gene is also a transcription factor that controls pollen development. According to the method of the present invention, preferably, by substantially suppressing only the expression of the endogenous transcription factor without substantially suppressing the expression of the endogenous transcription factor that controls the development of pollen, the plant Is given male sterility.

That is, the plant cell to which the expression suppressing technique of the present invention is applied is a plant cell having an endogenous transcription factor that controls pollen development, and the gene encoding this endogenous transcription factor is , ZPT2-5, ZP above
It is defined as one that hybridizes with the DNA of T3-1 or ZPT4-1, or a homolog thereof, under stringent conditions. Here, the definition of "stringent conditions" is the same as the conditions described above in connection with the identification of homologs of ZPT2-5, ZPT3-1 and ZPT4-1. Without intending to limit the scope of the present invention, plants capable of imparting male sterility by the above method,
It is desirable that the petunia in which the ZPT gene group is isolated, or the plant in which the gene encoding the ZPT homolog is isolated, is a plant closely related to evolutionary phylogeny. Here, with respect to evolutionary phylogeny, it is a plant that is typically classified in the same eye, preferably in the same family, more preferably in the same genus, and even more preferably in the same species. is there. However, considering the fact that the development of pollen is essential for the reproduction of seed plants, ZPT2-5, ZPT2
It is readily understood that transcription factors that perform the same or similar functions as 3-1 and ZPT4-1 may be widely present in other plants.

As a method for suppressing the expression of an endogenous gene, typically, cosuppression and antisense techniques can be used. Co-suppression means that when a recombinant gene is introduced into a plant cell, the expression of both the gene itself and an endogenous gene containing a sequence homologous to a part of the gene is suppressed. When co-suppression is used, the expression cassette of the present invention contains a DNA encoding a transcription factor or a fragment thereof in a form linked in a forward direction to a promoter. The DNA or a fragment thereof encoding a transcription factor can be introduced into a plant cell as an expression cassette and then transcribed in the sense direction under the control of a promoter. By the action of this introduced DNA, desired gene expression can be suppressed. Co-suppression is found in some individuals of transformed plants,
It often does not occur sufficiently in other individuals. for that reason,
Usually, individuals whose gene expression is suppressed as intended are selected according to conventional procedures.

Antisense is a transcription product (mRNA) of a transgene when a recombinant gene is introduced into plant cells.
Means that it hybridizes with the complementary sequence of the transcription product (mRNA) of the endogenous gene and inhibits the translation of the protein encoded by the endogenous gene. When antisense is used, the expression cassette of the present invention contains a DNA encoding a transcription factor or a fragment thereof in a form ligated in a reverse direction to a promoter. A DNA encoding a transcription factor or a fragment thereof can be introduced into a plant cell as an expression cassette and then transcribed in the antisense direction under the control of a promoter. The action of this antisense transcript makes it possible to suppress the desired gene expression.

(Promoters Derived from ZPT3-1 and ZPT4-1 Genes) The promoters useful in the method for producing a trait-modified plant, which are the fourth and fifth aspects of the present invention, have the (a ') sequence. DNA having the sequence from the 1st position to the 2624th position of the base sequence represented by No. 7, (a ″) DN having the sequence from the 1st position to the 3631st position of the base sequence represented by SEQ ID NO: 8
A, or a promoter containing a part of the sequence of (a ′) or (a ″) and containing DNA exhibiting a promoter activity specific to microspores. The above-mentioned promoter in the present invention is preferably Is (a ') or (a ")
Promoter, ie, ZPT3-1 or ZPT
4-1 gene promoter.

A sequence having a promoter activity specific to microspores, which is obtained by removing a sequence which is not essential for tissue-specific expression activity in the promoter region of ZPT3-1 and ZPT4-1 genes, has a structure of the present invention. Within range. Such a sequence can be obtained by carrying out a promoter deletion experiment according to a conventional method. Briefly, various deletion mutants of the promoter region of the ZPT3-1 or ZPT4-1 gene (for example, the promoter region of the ZPT3-1 or ZPT4-1 gene was deleted from the 5 ′ upstream side to various lengths). Mutant) and an appropriate reporter gene (for example, GUS gene) are used to measure the tissue-specific promoter activity of the deletion mutant to determine the region essential for that activity. Can be specified.

Once the region essential for promoter activity has been identified, it is possible to further modify the sequence or flanking sequences in that region to enhance the degree of promoter expression activity. The variants thus obtained are also within the scope of the present invention as long as they show a promoter activity specific to microspores.

In the present invention, "showing a promoter activity specific to microspores" means that the promoter is introduced into a plant in a natural plant or as an expression cassette linked to an arbitrary structural gene. , Means specifically in microspores the ability to direct gene expression by initiating transcription of DNA. Here, "specific" includes all other tissues of the same plant flower (tapeto layer, filament, style, flower head, petal, calyx, etc., except anther cleavage tissue) The expression activity of the promoter is higher than that of The specific promoter preferably has a higher expression activity of the promoter than all other tissues of the same plant flower and parts other than flowers (roots, leaves, stems, etc.), and more preferably the same plant. It is virtually inactive in all other tissues of the body and in non-flower parts. "Showing a promoter activity specific to the cleavage tissue of anther" is also defined as above.
The degree of expression activity can be evaluated by comparing the expression level of the promoter in microspores with the expression level of the same promoter in other tissues of the flower, according to a conventional method. The expression level of a promoter is usually determined by the amount of gene product expressed under the control of the promoter.

The method of the present invention utilizing the above-mentioned specific promoter is intended to modify a trait associated with plant reproduction. Here, "modification" means that at least a part of the reproductive organs in the transformed plant loses the function existing in the plant before transformation (wild species or horticultural variety), or It refers to the acquisition of a function that did not exist, or an increase or decrease in the degree of a specific function as compared with a plant before transformation. Such a trait modification is such that any heterologous gene operably linked to the promoter of the present invention is specifically expressed in microspores under the control of the promoter in a transgenic plant into which this gene has been introduced. It can result. Since it is well known that the tissue specificity of many tissue-specific promoters is conserved across species, it is easily understood that the promoter of the present invention is also applicable to a wide range of plant species. The degree of trait modification can be evaluated by comparing the trait of the plant after transformation with the trait of the plant before transformation. As a preferable trait to be modified,
Examples include, but are not limited to, female sterility and self-incompatibility.

The promoter of the present invention can be obtained, for example, by screening a genomic library of plants using a known cDNA as a probe, and isolating the upstream sequence of the coding region from the corresponding genomic clone. . As an example of cDNA, the above-mentioned transcription factors derived from petunia ZPT3-1 and Z
PT4-1 cDNA can be mentioned.

The promoter in the present invention is not limited to those isolated from nature, and may include synthetic polynucleotides. The synthetic polynucleotide can be obtained by, for example, synthesizing or modifying the sequence of the promoter sequenced as described above or the active region thereof by a method well known to those skilled in the art.

(Construction of Expression Cassette and Expression Vector) The DNA encoding the transcription factor in the present invention is a gene known as an expression cassette operably linked to an appropriate promoter using a method well known to those skilled in the art. It can be introduced into plant cells using recombinant techniques. Similarly,
The microspore-specific promoter in the present invention is an expression cassette operably linked to a desired heterologous gene,
It can be introduced into plant cells.

The "promoter" which can be linked to the above transcription factor means any promoter expressed in plants,
It can include both constitutive, tissue-specific, and inducible promoters.

"Constitutive promoter" refers to a promoter that allows a structural gene to be expressed at a certain level regardless of stimulation inside or outside plant cells. The use of constitutive promoters is convenient and preferred if the heterologous gene is expressed in other tissues or organs of the plant but does not impart the undesirable trait to the plant. Examples of constitutive promoters include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter (P35S), and the nopaline synthase promoter (Tnos).

In the present invention, the "tissue-specific promoter" refers to a promoter capable of specifically expressing a structural gene in at least microspores. Such tissue-specific promoters include ZPT3-1 in the present invention.
In addition to the promoter derived from ZPT4-1 gene, other known promoters exhibiting anther-specific expression activity are included. Thus, the native ZPT3-containing a microspore-specific promoter and a sequence encoding a transcription factor.
It is also within the scope of the invention to use the expression cassettes of the 1 and ZPT4-1 genes themselves, optionally in combination with other regulatory elements.

The "inducible promoter" refers to a promoter that causes a structural gene to be expressed when a specific stimulus such as a chemical agent or physical stress is applied, and does not show an expression activity in the absence of the stimulus. Examples of inducible promoters include the auxin inducible glutathione S-transferase (GST) promoter (van de).
r Kop, D.R. A. Et al., Plant Mol. Bi
ol. , 39: 979, 1999), but is not limited thereto.

As used herein, the term "expression cassette"
Alternatively, the term “plant expression cassette” means a nucleic acid sequence containing a DNA encoding the transcription factor of the present invention and a plant expression promoter operably linked to the DNA (that is, capable of controlling the expression of the DNA). , And a nucleic acid sequence containing the microspore-specific promoter of the present invention and a heterologous gene operably linked (that is, in frame) thereto.

The above-mentioned "heterologous gene" which can be linked to the microspore-specific promoter means ZPT3-1 and ZPT.
Endogenous genes in petunia other than 4-1 gene,
Or an endogenous gene in plants other than petunia,
Alternatively, it refers to a gene that is foreign to a plant (for example, a gene derived from animals, insects, bacteria, and fungi) and whose gene product expression is desired in microspores. A preferred example of the heterologous gene in the present invention is a gene whose encoded gene product exhibits cytotoxicity and whose expression inhibits pollen development. As a specific example of such a gene, the barnase gene (Bea
Is, T .; P. And Goldberg, R .; B. , P
lant Cell, 9: 1527, 1997), but is not limited thereto.

"Plant expression vector" refers to a nucleic acid sequence in which, in addition to an expression cassette, various regulatory elements are operably linked in the cells of the host plant. Suitably, it may contain a terminator, a drug resistance gene, and an enhancer. It is well known to those skilled in the art that the type of plant expression vector and the type of regulatory element used can vary depending on the host cell.
The plant expression vector used in the present invention further comprises T-DNA.
May have regions. The T-DNA region enhances the efficiency of gene transfer, especially when a plant is transformed with Agrobacterium.

The "terminator" is located downstream of the protein-coding region of a gene, and DNA is mRNA.
It is a sequence involved in termination of transcription when it is transcribed into, and addition of a poly A sequence. Terminators are known to contribute to mRNA stability and affect gene expression. Examples of terminators include terminators of nopaline synthase genes (Tnos),
And cauliflower mosaic virus (CaMV) 35
Examples include, but are not limited to, S terminator.

It is desirable that the "drug resistance gene" facilitates selection of transformed plants. A neomycin phosphotransferase II (NPTII) gene for imparting kanamycin resistance, a hygromycin phosphotransferase gene for imparting hygromycin resistance, and the like can be preferably used,
It is not limited to these.

The plant expression vector in the present invention can be produced using a gene recombination technique well known to those skilled in the art. For constructing a plant expression vector, for example, a pBI-based vector or a pUC-based vector is preferably used, but the plant expression vector is not limited thereto.

(Production of Transformed Plant) The expression cassette constructed as described above, or the expression vector containing the same can be introduced into a desired plant cell using a known gene recombination technique. The introduced expression cassette exists by being integrated into DNA in plant cells. DNA in plant cells means not only chromosomes but also various organelles contained in plant cells (eg, mitochondria, chloroplasts).
It also includes DNA contained in.

As used herein, the term "plant" includes both monocotyledonous and dicotyledonous plants. Preferred plants are dicotyledonous plants. The dicotyledonous plant includes both the subfloor subclass and the subvenous subclass. A preferred subclass is the joint flower subclass. The Synovium subgenus includes any of the orders Gentian, Solanaceae, Lamiaceae, Dermatophagoidea, Psyllium, Dermatophagoidea, Scutellariae, Rubiaceae, Scutellaria and Asteraceae. The preferred order is Solanaceae. Solanaceae is a family of Solanaceae, Scorpionaceae, Hananobinoidea, Nenidae,
And Convolvulaceae are also included. A preferred family is Solanaceae. The family Solanaceae includes Petunia, Datura, Tobacco, Solanum, Tomato, Capsicum, Physalis, and Cucumber. Preferred genera are Petunia, Datura and Tobacco, more preferably Petunia. Petunia spp. hybrida sp., P. axillari
s species, P. inflata species, and P. violac
ea species etc. are included. A preferred species is P. hybrida
It is a seed. "Plant", unless otherwise indicated, means plants having flowers and seeds obtained from the plants.

Examples of “plant cells” include cells of each tissue in plant organs such as flowers, leaves, and roots, callus, and suspension culture cells.

For introducing the plant expression vector into the plant cell, a method well known to those skilled in the art, for example, a method mediated by Agrobacterium, or a method of directly introducing into the cell can be used. Examples of the method mediated by Agrobacterium include the method of Nagel et al. (FEMS Microbi
ol. Lett. , 67: 325 (1990)) can be used. This method involves first transforming Agrobacterium with a plant expression vector (eg, by electroporation), and then introducing the transformed Agrobacterium into plant cells by well-known methods such as the leaf disk method. Is the way. Examples of methods for directly introducing a plant expression vector into cells include electroporation, particle gun, calcium phosphate method, and polyethylene glycol method. These methods are well known in the art, and a method suitable for a plant to be transformed can be appropriately selected by those skilled in the art.

The cells introduced with the plant expression vector are selected on the basis of drug resistance such as kanamycin resistance. The selected cells can be regenerated into plants by a conventional method.

It can be confirmed that the introduced plant expression vector is functional in the regenerated plant body by using a method well known to those skilled in the art. For example, for the purpose of suppressing the expression of an endogenous gene, this confirmation can be performed by measuring the transcription level using Northern blot analysis. In this way, a desired transformed plant in which the expression of an endogenous transcription factor is suppressed can be selected. When the expression of a heterologous gene using a tissue-specific promoter is intended, the expression of the heterologous gene can be usually confirmed by Northern blot analysis using RNA extracted from the target tissue as a sample. The procedure of this analysis method is well known to those skilled in the art.

The fact that the expression of an endogenous transcription factor is suppressed and the fertility of pollen is decreased according to the method of the present invention means that, for example, a plant obtained by transformation with an expression vector containing a DNA encoding a transcription factor is obtained. The morphology of pollen can be confirmed by observing with a microscope after performing tissue chemical staining if necessary.

The fact that the promoter was specifically expressed in the microspores according to the method of the present invention means that, for example, a plant obtained by transforming with an expression vector in which a promoter and a GUS gene are operably linked. The distribution of GUS activity in flower tissues including anthers can be confirmed by performing tissue chemical staining by a conventional method.

[0068]

EXAMPLES The present invention will be described below based on examples. The scope of the invention is not limited to the examples only. The restriction enzymes, plasmids, etc. used in the examples are available from commercial sources.

Example 1 Construction of Plant Expression Vector Containing Polynucleotides Encoding ZPT Transcription Factors Anther-specific ZF gene (Kobayashi) reported previously.
Et al., Supra), PEThyZPT2-5 (ZPT2
-5), PEThyZPT3-1 (ZPT3-1), and PETyZPT4-1 (ZPT4-1) cDN
35A of cauliflower mosaic virus
A plant expression vector was constructed by connecting to the downstream of the S promoter. Specifically, it is as follows.

(Example 1-1) Plasmid pBI221
(CLONTECH Laboratories In
c. (Purchased from) Cauliflower mosaic virus 35
DNA fragment containing S promoter (HindIII-X
baI fragment) and a DNA containing a NOS terminator
The fragments (SacI-EcoRI fragment) are sequentially added to plasmid p
UCAP (van Engelen, FA et al., Tr
ansgenic Res. , 4: 288, 1995)
Inserted into the multicloning site of pUCAP35
S was produced. On the other hand, p containing ZPT2-5 cDNA
The Bluescript vector is cleaved at the KpnI site and the SacI site (both in the vector), and KpnI and SacI of the above pUCAP35S are cut.
Inserted between the sites. Further, this recombinant plasmid was digested with EcoRI and HindIII to obtain ZPT2.
The DNA fragment encoding -5 is a binary vector pB
INPLUS (van Engelen, FA).
Et al., Supra) at the EcoRI and HindIII sites. The constructed ZPT2-5 gene is shown in FIG.
As is clear from (a), the 35S promoter region (P35) of cauliflower mosaic virus (CaMV).
S; 0.9 kb), a polynucleotide encoding ZPT2-5 of the present invention (ZPT2-5; about 0.8 kb),
And the terminator region of nopaline synthase (Tno
s; 0.3 kb). Pno in Figure 4
s is a promoter region of nopaline synthase, NPTI
I indicates the neomycin phosphotransferase II gene.

Example 1-2 cDNA of ZPT3-1
Was cut at the KpnI site and the SacI site (both in the vector), and pUCAP35S KpnI and Sa were digested.
It was inserted between the cI sites. Further, this recombinant plasmid was digested with EcoRI and HindIII to give ZP
The DNA fragment encoding T3-1 was introduced into the EcoRI and HindIII sites of the binary vector pBINPLUS. The constructed ZPT3-1 gene has a 35S promoter region (P35) of cauliflower mosaic virus (CaMV), as is apparent from FIG. 4 (b).
S; 0.9 kb), a polynucleotide encoding ZPT3-1 of the present invention (ZPT3-1; about 1.7 kb), and a terminator region (Tno of nopaline synthase).
s; 0.3 kb).

(Example 1-3) cDNA of ZPT4-1
Was cut at the KpnI site and the SacI site (both in the vector) and inserted between the KpnI and SacI sites of pUCAP35S. Furthermore, this recombinant plasmid was cleaved with EcoRI and HindIII,
A DNA fragment encoding ZPT4-1 was ligated with EcoRI and HindII of binary vector pBINPLUS.
Introduced to I site. As is clear from FIG. 4 (c), the constructed ZPT4-1 gene includes a cauliflower mosaic virus (CaMV) 35S promoter region (P35S; 0.9 kb) and a polynucleotide encoding ZPT4-1 of the present invention ( ZPT4-1; about 2.0k
b), and the terminator region (Tnos; 0.3 kb) of nopaline synthase.

Example 2: ZPT3-1 and ZPT4
-1 promoter region isolation and ligation with GUS reporter gene) c of ZPT3-1 and ZPT4-1
A corresponding genomic clone was isolated from a genomic DNA library of petunia using DNA as a probe, and a DNA fragment (promoter region;
About 2.7 kb and about 3.6 kb) were subcloned. Each DNA fragment was ligated upstream of the GUS reporter gene and cloned into a binary vector. Specifically, it is as follows.

(Example 2-1) cDNA of ZPT3-1
In the usual random prime method (Sambrook et al.,
The above-mentioned) was used to label with [α32P] dCTP to prepare a radiolabeled probe, which was used to prepare a petunia (Petunia hybrida var. Mit) prepared in an EMBL3 vector (manufactured by Stratagene).
cell) was screened. About 2.7 kb genomic DNA fragment (PstI-SacI) containing the gene upstream region from the obtained clone
To PstI-S of pBluescript SK vector
Subcloned into the acI site (pBS-ZPT3
−1-PS), and the nucleotide sequence was determined (FIGS. 5A-5B).
Next, using this plasmid as a template, a primer containing a SalI recognition sequence (3′-TATGGAGCTCGTCG
ACAG TTGATGGTTTCATTTTTCTGG
PCR was performed using CTATTGTC-5 '; SEQ ID NO: 11) and a commercially available M13-20 primer, and ZPT
3-1 Immediately downstream from the translation initiation point (base number 26
61) introduced the SalI site. And PstI
And the DNA fragment obtained by digestion with SalI was digested with pUC
It was inserted upstream of the GUS coding region of APGUSNT (pUCAP-ZPT3-1-GUSNT). Thus, the region near the N-terminal of the ZPT3-1 gene coding region was connected to the GUS coding region in frame.
Furthermore, pUCAP-ZPT3-1-GUSNT is Asc
DNA fragment obtained by digestion with I and PacI (ZP
T3-1 promoter, GUS coding region and NOS
(Including terminator) was inserted into pBINPLUS vector to obtain pBIN-ZPT3-1-GUS (Fig. 7).
(A)).

(Example 2-2) With respect to ZPT4-1, genomic DNA was similarly isolated, and a DNA fragment of about 3.6 kb containing the upstream region of ZPT4-1 gene (EcoRI-E) was isolated.
(coRI) is the E of pBluescript SK vector.
subcloned into the coRI-EcoRI site (p
BS-ZPT4-1-EE), and the nucleotide sequence was determined (FIGS. 6A-6B). Using this plasmid as a template, BamHI
Recognition sequence (3'-CATGGATATAGAGATCT
PCR was performed using a primer containing ATATC-5 ′; SEQ ID NO: 12) and the M13-20 primer, and Z
A BamHI site was introduced immediately downstream of the translation initiation site of PT4-1 protein (base number 3641). And E
The DNA fragment obtained by digestion with coRI and BamHI was inserted upstream of the GUS coding region of pUCAPGUSNT (pUCAP-ZPT4-1-GUSNT).
Thus, the region near the N-terminal of the ZPT4-1 gene coding region was connected to the GUS coding region in frame. Furthermore, the DNA fragment (Asc
I-PacI) into the pBINPLUS vector,
pBIN-ZPT4-1-GUS was prepared (FIG. 7).
(B)).

(Example 3: Introduction of each fusion gene into petunia cells) Each of the above expression vectors was subjected to the following procedure.
Via Agrobacterium, Petunia
ia hybrida var. Mitchell)
Introduced.

(1) Agrobacterium tumefaciens LBA4404 strain (CLONTECH Labo
ratories Inc. Purchased from) 250 mg /
The cells were cultured at 28 ° C. in L medium containing ml streptomycin and 50 mg / ml rifampicin. Nagel
(1990) (supra), a cell suspension was prepared, and the plasmid vector constructed in Examples 1 and 2 was introduced into the above strain by electroporation.

(2) Polynucleotides encoding each fusion gene were introduced into petunia cells by the following method: The Agrobacterium tumefaciens LBA4404 strain obtained in (1) above was transformed into YEB medium (DN).
A Cloning Volume 2, p. 78, Glover
D. M. Shaking culture (28 ° C., 200 rpm) by IRL Press, 1985). The obtained culture solution was diluted 20 times with sterilized water, and petunia (Petun) was diluted.
ia hybrida var. Mitchell)
Co-cultured with leaf pieces. After 2-3 days, the above bacteria were removed in a medium containing antibiotics, subcultured every 2 weeks in a selective medium, and pBI introduced together with the above 5 kinds of fusion genes was used.
Transformed petunia cells were selected based on the presence or absence of kanamycin resistance due to the NPTII gene expression derived from NPLUS. The selected cells were redifferentiated into plants after inducing callus by a conventional method (Jorgense).
n R. A. Et al., Plant Mol. Biol. ，
31: 957, 1996).

Example 4 Phenotype of Transformed Petunia Introduced with ZPT Gene Group Using the transformant obtained by introducing the vector of Example 1, ZPT2-5 and ZPT were used.
By observing the morphological change of pollen associated with the regulation of the expression of 3-1 and ZPT4-1, the influence of these ZPT gene groups on the introduction of cDNA into plants was examined. Specifically, it is as follows.

(Example 4-1) cDNA of ZPT2-5
Individuals (3 individuals) in which the suppression of gene expression due to cosuppression occurred were selected by Northern blot analysis from the transformants (14 individuals) introduced under the control of the 35S promoter. (Note that the other 4 out of 14 individuals
In the individual, overexpression of the introduced ZPT2-5 gene was observed. ) Conditions for Northern blot analysis are as follows: 7% SDS, 50% formamide, 5xSSC, 2
% Blocking reagent (Boehringer Mann
Heim), 50 mM sodium phosphate buffer (pH 7.0), 0.1% sodium laurylsarcosine, 50 μg / ml yeast tRNA, and ³² P-labeled probe DNA (1 × 10 ⁷ cpm) in a solution containing 6
After hybridizing for 16 hours at 8 ° C., 2 × SSC /
Washing with 0.1% SDS at 68 ° C for 30 minutes.

The following phenotypes were observed in the three cosuppression transformants (FIG. 8).

In the process of meiosis that occurs just before the tetrad period, in normal (wild-type) petunia, following formation of a filamentous structure by condensation of chromatin (profilosis period of early I), homologous chromosomes paired. Match (joint thread period of the first term I). Next, when entering the metaphase I, the quartet chromosomes are aligned with the cell equatorial plane, and thereafter, the homologous chromosomes are evenly separated into both polarities of the cell by the spindle device. On the other hand, ZP
In the transformant in which the T2-5 gene was co-suppressed, in the metaphase I, the polar separation of chromosomes proceeded without the quartet chromosomes being correctly aligned in the cell equatorial plane. At this time, the distribution of chromosomes to both poles was significantly uneven.

In the normal process of meiosis, the first chromosomal segregation causes the second chromosomal segregation to form a group of four haploids, followed by cytoplasmic segregation. On the other hand, in the above-described co-suppressed transformant, cytoplasmic segregation and cell division occurred immediately after the first chromosome segregation. Also, this unequal cell division was not limited to once, but was repeated at least two more times to form up to 8 microspore cells. Due to uneven chromosome segregation, the number of chromosomes contained in these microspore cells was heterogeneous, and the cell size was remarkably uneven. As a result, in normal petunia, the number of microspores (up to 8) higher than normal was formed in these transformants at the time of the tetrad stage (FIG. 8 (f); bud size 6 mm). ZP
Photograph of pollen cells of T2-5 cosuppression transformant. Also, see FIG. 9 (b); a photograph of pollen cells of the transformant in the tetrad stage).

In the cosuppression transformants, some of the microspores (10-20%) continued to develop, but most of the microspore cells showed that the callose layer surrounding them was degraded. Ruptured. The microspores that survived without rupture at this stage showed abnormal morphology similar to hexahedron, clearly different from the tetrahedral morphology of normal microspores. The abnormally shaped microspores then binucleate by seemingly normal mitosis to form pollen grains. However, these pollen grains lost most of their fertility. That is, when pollen grains of these transformants were applied to normal petunia pistil, pollen from three lines showing co-suppression,
No seed formation or only slight seed formation (up to 10%, ie the number of seeds produced per petunia strain is about 1 flower of the control, on average of about 10 flowers). Was). In the pollen from the three transformant lines showing no cosuppression, normal seed formation was confirmed as in the case of the wild type control plant.

The above cosuppression transformants also showed abnormalities in female gametophyte formation, with female fertility reduced to 25-35% of normal individuals. That is, although the development of ovules (female gametophytes) was normal in appearance, when pollinated with wild-type pollen, the majority of ovules could not be fertilized, and those fertilized also showed abnormal development thereafter, and many died. (Ab
ort). In this case as well, in the transformant showing no cosuppression, normal female gametophyte formation was observed as in the case of the wild type control plant.

Example 4-2 ZPT3-1 cDNA
Was introduced under the control of the 35S promoter, ZPT2
The same trait change as in the case of introducing the −5 gene was observed in 3 of 15 individuals (FIG. 9). That is, in these transformants, the same abnormality as in the case of ZPT2-5 was observed in the process of meiosis. The number of cells that developed to the microspore stage was very small, and the surviving microspores showed abnormal morphology (hexahedral). In addition, mature pollen grains had lost fertility. However, unlike ZPT2-5, there was no effect on female fertility in these individuals.

As a result of gene expression analysis by Northern blotting under the same conditions as in Example 4-1, ZPT3-1 and ZPT4 were found in the ZPT3-1 gene-introduced individuals.
Suppression of expression of both -1 and -1 genes was observed. Both genes have high structural similarity. That is, the homology of the entire nucleotide sequence of the coding region is 37%, and
The third ZF region and the third ZF region of ZPT4-1, and the third ZF region of ZPT3-1 and the fourth ZF region of ZPT4-1 are adjacent to each other so that the homology value is maximized. The average homology of each sequence including the sequences is 86% when compared at the base sequence level (sequence comparison by the Clustal V program). Therefore, it is highly possible that the above expression suppression event is due to the suppression of expression of two genes (cosuppression) due to the introduction of one gene. This suggests that the functions of these two genes overlap, and is consistent with the common phenotypic changes seen with the introduction of each of the two genes.

(Example 4-3) cDNA of ZPT4-1
Was introduced under the control of the 35S promoter, ZPT2
The same trait change as in the case of introducing the −5 gene was observed in 2 of 13 individuals. That is, in these transformants, the same abnormality as in the case of ZPT2-5 was observed in the process of meiosis. The number of cells that developed to the microspore stage was very small, and the surviving microspores showed abnormal morphology (hexahedral). In addition, mature pollen grains lost most of their fertility. However, as with ZPT3-1,
There was no effect on female fertility in these individuals. For the above-mentioned reason, ZPT3-1 and ZP are also used in this embodiment.
It is highly possible that expression suppression (cosuppression) of both genes of T4-1 occurred.

As described above, ZPT2-5 and ZPT3-
1 or ZPT4-1-encoding gene can inhibit pollen development and lose fertility with extremely high efficiency (99% or more for ZPT3-1,
90% or more for ZPT2-5 and ZPT4-1). In addition, the introduction of these gene groups has the effect that pollen (ZP
In the case of T2-5, it is specific to pollen and female gametophyte and may be useful as a selective trait modification technique in that it does not affect other traits of plants.

Example 5: ZPT3-1 and ZPT4
-1 Tissue Specificity of Promoter Activity) The transformant obtained by introducing the vector of Example 2 was used to perform histochemical staining with GUS activity to show the tissue specific promoter activity of the above DNA fragment. Detected. Specifically, it is as follows.

(Example 5-1) Using a flower of a transformant obtained by introducing a fusion gene of the upstream region of ZPT3-1 gene and GUS, the distribution of GUS activity was analyzed using X-GUS as a substrate. Examined (Gallagher, SR edited, G
US protocols: using the GU
S gene as a reporter of g
ene expressin, Academic Pr
ess, Inc. , Pp. 103-114,199
2). As a result, GUS activity was specifically detected in mononuclear stage microspores (FIGS. 10 (a) to 10 (c)).

Example 5-2 Using the flowers of the transformant obtained by introducing the fusion gene of the upstream region of ZPT4-1 gene and GUS, the distribution of GUS activity was examined in the same manner as above. As a result, GUS activity was specifically observed in the microspore and anther cleavage tissues from the mononuclear stage to the dinuclear stage (Fig. 10 (d) to (f);
(E) and (f) are indicated by arrows).

As described above, ZPT3-1 and ZPT
The promoter of the 4-1 gene is microspores (ZP
T3-1) and microspores (ZPT4-1) from the mononuclear stage to the binucleate stage, respectively. ZP
The promoter of the T4-1 gene also shows specific activity in the anther cleavage tissue from the mononuclear stage to the binucleate stage.

Microspores are progenitor cells that subsequently mature to produce pollen grains. Therefore, these promoters are
It is useful as a tool for detailed studies related to pollen development. Furthermore, by using these promoters or active fragments thereof, a cytotoxic gene or the like can be specifically expressed in microspores to kill pollen cells or lose their functions, thereby directly and efficiently promoting pollen development. Controllable.

[0095]

EFFECT OF THE INVENTION ZPT2-5, ZPT3-1 and ZP
The method of the present invention utilizing a DNA encoding a transcription factor derived from the T4-1 gene and a promoter derived from the ZPT3-1 and ZPT4-1 genes is a technique for selectively modifying a plant trait by genetic engineering, In particular, it is useful as a technique for imparting a male sterility trait.

[0096]

[Sequence list]                                SEQUENCE LISTING        <110> DIRECTOR GENERAL OF NATIONAL INSTITUTE OF AGROBIOLOGICAL RESOURCES , MINISTRY OF AGRICULTURE, FORESTRY AND FISHERIES <120> METHOD OF DECREASING POLLEN FERTILITY BY USE OF GENE OF       TRANSCRIPTION FACTOR SPECIFIC TO POLLEN <130> J199412586 <140> <141> <160> 14 <170> PatentIn Ver. 2.1 <210> 1 <211> 777 <212> DNA <213> Petunia hybrida <220> <221> CDS <222> (58) .. (588) <400> 1 atcaaaacca aaattccttt ttcacaccga agaacagcct tagtatttca agaaaac 57 atg gtg gct cta tca acg aag aga gaa aga gaa gaa gat aac ttt tac 105 Met Val Ala Leu Ser Thr Lys Arg Glu Arg Glu Glu Asp Asn Phe Tyr   1 5 10 15 agc ata aca acc atg gca aat tac ttg atg tta ctc tcg cgc caa gca 153 Ser Ile Thr Thr Met Ala Asn Tyr Leu Met Leu Leu Ser Arg Gln Ala              20 25 30 aat gaa cat ttt gac aag aaa atg aac aac tca agt act agt cga gtt 201 Asn Glu His Phe Asp Lys Lys Met Asn Asn Ser Ser Thr Ser Arg Val          35 40 45 ttc gag tgc aag act tgt aat cgc cag ttt tca tct ttt caa gca cta 249 Phe Glu Cys Lys Thr Cys Asn Arg Gln Phe Ser Ser Phe Gln Ala Leu      50 55 60 ggt ggc cat aga gca agt cac aag aag cca aga tta atg gga gaa ttg 297 Gly Gly His Arg Ala Ser His Lys Lys Pro Arg Leu Met Gly Glu Leu  65 70 75 80 cat aac ttg caa tta ttt cat gaa ttg cct aaa cgt aaa act cac gag 345 His Asn Leu Gln Leu Phe His Glu Leu Pro Lys Arg Lys Thr His Glu                  85 90 95 tgc tcc att tgt ggg ctt gag ttc gcc att ggg caa gct tta gga gga 393 Cys Ser Ile Cys Gly Leu Glu Phe Ala Ile Gly Gln Ala Leu Gly Gly             100 105 110 cat atg aga agg cat aga gct gtg ata aat gat aaa aat ctt caa gct 441 His Met Arg Arg His Arg Ala Val Ile Asn Asp Lys Asn Leu Gln Ala         115 120 125 cct gat gat caa cat gct cct gtc gtc aaa aaa gca aat ggt cgg aga 489 Pro Asp Asp Gln His Ala Pro Val Val Lys Lys Ala Asn Gly Arg Arg     130 135 140 att ttg tcc ttg gat ttg aac ttg acg cca ttg gaa aat gac tta gag 537 Ile Leu Ser Leu Asp Leu Asn Leu Thr Pro Leu Glu Asn Asp Leu Glu 145 150 155 160 ttt gat ttg cga aag agt aat act gct cct atg gtc gat tgc ttt tta 585 Phe Asp Leu Arg Lys Ser Asn Thr Ala Pro Met Val Asp Cys Phe Leu                 165 170 175 tga ttgaactttc cgtttcctta ttcttttctc ttcttctttt ggatattgta 638                                                            tttattcatt aattgtagga gggataggaa gtcttatctt gtgtattagt actacatttt 698 gcagattgta gaacgattag tttgtaactt atcatgatac ccgaaataca atactattta 758 tatgattatt atactacac 777 <210> 2 <211> 176 <212> PRT <213> Petunia hybrida <400> 2 Met Val Ala Leu Ser Thr Lys Arg Glu Arg Glu Glu Asp Asn Phe Tyr   1 5 10 15 Ser Ile Thr Thr Met Ala Asn Tyr Leu Met Leu Leu Ser Arg Gln Ala              20 25 30 Asn Glu His Phe Asp Lys Lys Met Asn Asn Ser Ser Thr Ser Arg Val          35 40 45 Phe Glu Cys Lys Thr Cys Asn Arg Gln Phe Ser Ser Phe Gln Ala Leu      50 55 60 Gly Gly His Arg Ala Ser His Lys Lys Pro Arg Leu Met Gly Glu Leu  65 70 75 80 His Asn Leu Gln Leu Phe His Glu Leu Pro Lys Arg Lys Thr His Glu                  85 90 95 Cys Ser Ile Cys Gly Leu Glu Phe Ala Ile Gly Gln Ala Leu Gly Gly             100 105 110 His Met Arg Arg His Arg Ala Val Ile Asn Asp Lys Asn Leu Gln Ala         115 120 125 Pro Asp Asp Gln His Ala Pro Val Val Lys Lys Ala Asn Gly Arg Arg     130 135 140 Ile Leu Ser Leu Asp Leu Asn Leu Thr Pro Leu Glu Asn Asp Leu Glu 145 150 155 160 Phe Asp Leu Arg Lys Ser Asn Thr Ala Pro Met Val Asp Cys Phe Leu                 165 170 175 <210> 3 <211> 1640 <212> DNA <213> Petunia hybrida <220> <221> CDS <222> (95) .. (1408) <400> 3 accggtccgg aattcccggg tcgacccacg cgtccggaaa ctttccttgt tgcactttaa 60 tttatgttct agtgagtata ttagagagtg agaa atg gtg gac aat agc cag aaa 115                                       Met Val Asp Asn Ser Gln Lys                                         1 5 aat gaa cca tca act gtt ata cac tat tgt aga gta tgt aaa agg gga 163 Asn Glu Pro Ser Thr Val Ile His Tyr Cys Arg Val Cys Lys Arg Gly          10 15 20 ttt aat agt gct gga gct ctt ggt ggg cac atg aga tct cat gga gtg 211 Phe Asn Ser Ala Gly Ala Leu Gly Gly His Met Arg Ser His Gly Val      25 30 35 gga gat cat aat aaa aac tat ggt gaa gat att aat gaa caa aga tat 259 Gly Asp His Asn Lys Asn Tyr Gly Glu Asp Ile Asn Glu Gln Arg Tyr  40 45 50 55 atg atc aac aac ttt aga aga gat aaa cca gag ggt caa aag cac tca 307 Met Ile Asn Asn Phe Arg Arg Asp Lys Pro Glu Gly Gln Lys His Ser                  60 65 70 tat aat ctt cgt gct aat act aat aga tta tta ggc aat cga gca agt 355 Tyr Asn Leu Arg Ala Asn Thr Asn Arg Leu Leu Gly Asn Arg Ala Ser              75 80 85 gaa gat cgt gac aag aag tcc tcg atg tgg cct ccc aat gat cgt ggg 403 Glu Asp Arg Asp Lys Lys Ser Ser Met Trp Pro Pro Asn Asp Arg Gly          90 95 100 aaa tat gcc cta gac gag act cta acc cta tca tca atg tcg tca cca 451 Lys Tyr Ala Leu Asp Glu Thr Leu Thr Leu Ser Ser Met Ser Ser Pro     105 110 115 gga tca tca gat ctt gaa aga agt act aag cca tat gat gca aaa gaa 499 Gly Ser Ser Asp Leu Glu Arg Ser Thr Lys Pro Tyr Asp Ala Lys Glu 120 125 130 135 gtg tat aat gga aat gat aag gac aaa tac gct tca aga gaa gaa gaa 547 Val Tyr Asn Gly Asn Asp Lys Asp Lys Tyr Ala Ser Arg Glu Glu Glu                 140 145 150 gaa gat cta gcg aat tgt ttg gtc atg ttg tcg aac aaa tct tat gtt 595 Glu Asp Leu Ala Asn Cys Leu Val Met Leu Ser Asn Lys Ser Tyr Val             155 160 165 ttg tcc gat aac aat gag gca aca tac aag gct gaa gaa gtg gaa aag 643 Leu Ser Asp Asn Asn Glu Ala Thr Tyr Lys Ala Glu Glu Val Glu Lys         170 175 180 ggc atg ttc caa tgt aaa gca tgc aag aaa gtt ttt agc tcc cac caa 691 Gly Met Phe Gln Cys Lys Ala Cys Lys Lys Val Phe Ser Ser His Gln     185 190 195 gct tta ggg gga cat aga gcg agt cat aag aaa gtt aaa ggg tgt tat 739 Ala Leu Gly Gly His Arg Ala Ser His Lys Lys Val Lys Gly Cys Tyr 200 205 210 215 gct gcc aag ata aaa gat gac aac gac ggc aac aac gac aac aac gac 787 Ala Ala Lys Ile Lys Asp Asp Asn Asp Gly Asn Asn Asp Asn Asn Asp                 220 225 230 aac aac aat aat gat aat gac atc gat gaa gac tcg atc tct cct agt 835 Asn Asn Asn Asn Asp Asn Asp Ile Asp Glu Asp Ser Ile Ser Pro Ser             235 240 245 gat tta att ttc cat caa gaa tct aac tcg ttt cag tct caa tct cca 883 Asp Leu Ile Phe His Gln Glu Ser Asn Ser Phe Gln Ser Gln Ser Pro         250 255 260 tca tca tcg agc tcg ttt tca agg aag aga tca agg gtt cat caa tgc 931 Ser Ser Ser Ser Ser Phe Ser Arg Lys Arg Ser Arg Val His Gln Cys     265 270 275 tcg att tgt cat cga gtt ttt tca tca gga caa gcc ttg ggt ggg cac 979 Ser Ile Cys His Arg Val Phe Ser Ser Gly Gln Ala Leu Gly Gly His 280 285 290 295 aaa agg tgt cac tgg cta tca tca agt ttg cca gag aat act ttt ata 1027 Lys Arg Cys His Trp Leu Ser Ser Ser Leu Pro Glu Asn Thr Phe Ile                 300 305 310 cca act ttt caa gaa atc caa tac cac acc caa gaa caa gga tta ttc 1075 Pro Thr Phe Gln Glu Ile Gln Tyr His Thr Gln Glu Gln Gly Leu Phe             315 320 325 aac aag cca atg ttt acc aac ttt gat caa cca tta gat cta aac ttc 1123 Asn Lys Pro Met Phe Thr Asn Phe Asp Gln Pro Leu Asp Leu Asn Phe         330 335 340 cca gca caa cta ggc aat cca gct gaa ttt gag ttg aaa cta cac aat 1171 Pro Ala Gln Leu Gly Asn Pro Ala Glu Phe Glu Leu Lys Leu His Asn     345 350 355 cca ttt gaa cat gaa ggc cca aga agc tat ctc cag cta tgg aca gac 1219 Pro Phe Glu His Glu Gly Pro Arg Ser Tyr Leu Gln Leu Trp Thr Asp 360 365 370 375 caa caa atc aat act aat tta cat caa aat gag aag tgc aaa gat tca 1267 Gln Gln Ile Asn Thr Asn Leu His Gln Asn Glu Lys Cys Lys Asp Ser                 380 385 390 acg gag gat ttg aga agg gaa gaa aat tac aag gac aag gaa gca aaa 1315 Thr Glu Asp Leu Arg Arg Glu Glu Asn Tyr Lys Asp Lys Glu Ala Lys             395 400 405 ttg agt aac ctt aaa gat gtg aac ttg gat gga ggc tct tct tgg tta 1363 Leu Ser Asn Leu Lys Asp Val Asn Leu Asp Gly Gly Ser Ser Trp Leu         410 415 420 caa gta ggg att ggt cca acc cca gat ata gta gca act ctg taa 1408 Gln Val Gly Ile Gly Pro Thr Pro Asp Ile Val Ala Thr Leu     425 430 435 ggttagtaac acagtgatcg ttatgtcagc tacaagtata gtaatatata taccaatgtc 1468 ccaacttata cataaactgt ttaacatatt tatactttcg tattattgtt gtatcgaact 1528 ttcactagtt acaatttgtg attcgtccaa tccctaatat agtagcaaca gacctgtaag 1588 attagtatta tgcgattgtt ttgtcattct acaaaataaa atcgtataat at 1640 <210> 4 <211> 437 <212> PRT <213> Petunia hybrida <400> 4 Met Val Asp Asn Ser Gln Lys Asn Glu Pro Ser Thr Val Ile His Tyr   1 5 10 15 Cys Arg Val Cys Lys Arg Gly Phe Asn Ser Ala Gly Ala Leu Gly Gly              20 25 30 His Met Arg Ser His Gly Val Gly Asp His Asn Lys Asn Tyr Gly Glu          35 40 45 Asp Ile Asn Glu Gln Arg Tyr Met Ile Asn Asn Phe Arg Arg Asp Lys      50 55 60 Pro Glu Gly Gln Lys His Ser Tyr Asn Leu Arg Ala Asn Thr Asn Arg  65 70 75 80 Leu Leu Gly Asn Arg Ala Ser Glu Asp Arg Asp Lys Lys Ser Ser Met                  85 90 95 Trp Pro Pro Asn Asp Arg Gly Lys Tyr Ala Leu Asp Glu Thr Leu Thr             100 105 110 Leu Ser Ser Met Ser Ser Pro Gly Ser Ser Asp Leu Glu Arg Ser Thr         115 120 125 Lys Pro Tyr Asp Ala Lys Glu Val Tyr Asn Gly Asn Asp Lys Asp Lys     130 135 140 Tyr Ala Ser Arg Glu Glu Glu Glu Asp Leu Ala Asn Cys Leu Val Met 145 150 155 160 Leu Ser Asn Lys Ser Tyr Val Leu Ser Asp Asn Asn Glu Ala Thr Tyr                 165 170 175 Lys Ala Glu Glu Val Glu Lys Gly Met Phe Gln Cys Lys Ala Cys Lys             180 185 190 Lys Val Phe Ser Ser His Gln Ala Leu Gly Gly His Arg Ala Ser His         195 200 205 Lys Lys Val Lys Gly Cys Tyr Ala Ala Lys Ile Lys Asp Asp Asn Asp     210 215 220 Gly Asn Asn Asp Asn Asn Asp Asn Asn Asn Asn Asp Asn Asp Ile Asp 225 230 235 240 Glu Asp Ser Ile Ser Pro Ser Asp Leu Ile Phe His Gln Glu Ser Asn                 245 250 255 Ser Phe Gln Ser Gln Ser Pro Ser Ser Ser Ser Ser Ser Phe Ser Arg Lys             260 265 270 Arg Ser Arg Val His Gln Cys Ser Ile Cys His Arg Val Phe Ser Ser         275 280 285 Gly Gln Ala Leu Gly Gly His Lys Arg Cys His Trp Leu Ser Ser Ser     290 295 300 Leu Pro Glu Asn Thr Phe Ile Pro Thr Phe Gln Glu Ile Gln Tyr His 305 310 315 320 Thr Gln Glu Gln Gly Leu Phe Asn Lys Pro Met Phe Thr Asn Phe Asp                 325 330 335 Gln Pro Leu Asp Leu Asn Phe Pro Ala Gln Leu Gly Asn Pro Ala Glu             340 345 350 Phe Glu Leu Lys Leu His Asn Pro Phe Glu His Glu Gly Pro Arg Ser         355 360 365 Tyr Leu Gln Leu Trp Thr Asp Gln Gln Ile Asn Thr Asn Leu His Gln     370 375 380 Asn Glu Lys Cys Lys Asp Ser Thr Glu Asp Leu Arg Arg Glu Glu Asn 385 390 395 400 Tyr Lys Asp Lys Glu Ala Lys Leu Ser Asn Leu Lys Asp Val Asn Leu                 405 410 415 Asp Gly Gly Ser Ser Trp Leu Gln Val Gly Ile Gly Pro Thr Pro Asp             420 425 430 Ile Val Ala Thr Leu         435 <210> 5 <211> 1948 <212> DNA <213> Petunia hybrida <220> <221> CDS <222> (130) .. (1554) <400> 5 cccccatgca atttttttag tctcttcatt ctctcaacta aaactagatt tgcttcttat 60 agtttcttgt ccatgtctct tctcattcat acttgaagta gtacaataac aagaaaataa 120 catttagcc atg gat tgt ata gat caa gaa caa caa caa caa caa cca gtt 171           Met Asp Cys Ile Asp Gln Glu Gln Gln Gln Gln Gln Pro Val             1 5 10 ttt aag cat tat tgt aga gtt tgc aag aaa ggt ttt gtg tgt ggg aga 219 Phe Lys His Tyr Cys Arg Val Cys Lys Lys Gly Phe Val Cys Gly Arg  15 20 25 30 gct cta ggt ggg cat atg aga gct cat gga att ggg gat gaa gtt gta 267 Ala Leu Gly Gly His Met Arg Ala His Gly Ile Gly Asp Glu Val Val                  35 40 45 act atg gat gat gat gat caa gca agt gat tgg gaa gat aag ttt gga 315 Thr Met Asp Asp Asp Asp Gln Ala Ser Asp Trp Glu Asp Lys Phe Gly              50 55 60 ggg agt gtt aag gaa ggt aat aaa agg atg tac caa tta aga aca aac 363 Gly Ser Val Lys Glu Gly Asn Lys Arg Met Tyr Gln Leu Arg Thr Asn          65 70 75 cct aat agg caa aaa agc aat aga gtt tgt gag aat tgt ggg aaa gaa 411 Pro Asn Arg Gln Lys Ser Asn Arg Val Cys Glu Asn Cys Gly Lys Glu      80 85 90 ttc tct tct tgg aaa tct ttt ctt gaa cat gga aaa tgt agc tca gaa 459 Phe Ser Ser Trp Lys Ser Phe Leu Glu His Gly Lys Cys Ser Ser Glu  95 100 105 110 gat gca gaa gag tct tta gta tcc tcg ccc ggt tca gag ggc gag gat 507 Asp Ala Glu Glu Ser Leu Val Ser Ser Pro Gly Ser Glu Gly Glu Asp                 115 120 125 tac att tat gat gga aga aaa gaa aaa gga tac gga tgg tct aaa aga 555 Tyr Ile Tyr Asp Gly Arg Lys Glu Lys Gly Tyr Gly Trp Ser Lys Arg             130 135 140 aag agg tca tta aga aca aaa gta gga ggc ctt agt act tca act tat 603 Lys Arg Ser Leu Arg Thr Lys Val Gly Gly Leu Ser Thr Ser Thr Tyr         145 150 155 caa tca agt gag gaa gaa gat ctt ctc ctt gca aaa tgc ctt ata gat 651 Gln Ser Ser Glu Glu Glu Asp Leu Leu Leu Ala Lys Cys Leu Ile Asp     160 165 170 tta gcc aat gca agg gtt gat aca tca ttg gtt gag cca gaa gag tct 699 Leu Ala Asn Ala Arg Val Asp Thr Ser Leu Val Glu Pro Glu Glu Ser 175 180 185 190 tgt gcc tca gcc agt agg gag gag gaa cgg gcg gca cgg aac tcg atg 747 Cys Ala Ser Ala Ser Arg Glu Glu Glu Arg Ala Ala Arg Asn Ser Met                 195 200 205 gcc tac ggc ttc acc cca tta gtg agt act cgt gta ccc ttt gac aac 795 Ala Tyr Gly Phe Thr Pro Leu Val Ser Thr Arg Val Pro Phe Asp Asn             210 215 220 aag gct aaa ggg gcg tct agt aaa ggg ttg ttt gaa tgt aaa gct tgc 843 Lys Ala Lys Gly Ala Ser Ser Lys Gly Leu Phe Glu Cys Lys Ala Cys         225 230 235 aag aaa gtc ttc aat tcc cac caa gcc cta ggt gga cat agg gca agt 891 Lys Lys Val Phe Asn Ser His Gln Ala Leu Gly Gly His Arg Ala Ser     240 245 250 cac aag aaa gtt aag ggg tgt tat gca gcg aag caa gat caa ctc gat 939 His Lys Lys Val Lys Gly Cys Tyr Ala Ala Lys Gln Asp Gln Leu Asp 255 260 265 270 gat atc tta att gat gat caa gat gtg aat atc aca cat gat caa gaa 987 Asp Ile Leu Ile Asp Asp Gln Asp Val Asn Ile Thr His Asp Gln Glu                 275 280 285 ttc ctg caa agt tca aaa tcc atg agg aag tca aaa atc cat gaa tgc 1035 Phe Leu Gln Ser Ser Lys Ser Met Arg Lys Ser Lys Ile His Glu Cys             290 295 300 tca ata tgc cat aga gtt ttc tcg aca gga caa gct tta ggt ggt cac 1083 Ser Ile Cys His Arg Val Phe Ser Thr Gly Gln Ala Leu Gly Gly His         305 310 315 aag agg tgc cac tgg atc acc tcc aat tcc ccc gat tct tcg aaa ttt 1131 Lys Arg Cys His Trp Ile Thr Ser Asn Ser Pro Asp Ser Ser Lys Phe     320 325 330 cat ttc aat ggt cat gtg gag caa att aat cta aga tca aac atg cat 1179 His Phe Asn Gly His Val Glu Gln Ile Asn Leu Arg Ser Asn Met His 335 340 345 350 aaa tca gat gca tta gat ctt aat aac ctt ccg aca cat gaa gac atg 1227 Lys Ser Asp Ala Leu Asp Leu Asn Asn Leu Pro Thr His Glu Asp Met                 355 360 365 tcg cga att aga cga gac ccc ttt aat cca tta agc ttc gag gtg tca 1275 Ser Arg Ile Arg Arg Asp Pro Phe Asn Pro Leu Ser Phe Glu Val Ser             370 375 380 aca gat ata cac ttg caa tat cca tgg agt tgt gct cca aaa aat gat 1323 Thr Asp Ile His Leu Gln Tyr Pro Trp Ser Cys Ala Pro Lys Asn Asp         385 390 395 gat aat gac aat tac tac ctt gaa gaa att aaa atc gat agt aat gcc 1371 Asp Asn Asp Asn Tyr Tyr Leu Glu Glu Ile Lys Ile Asp Ser Asn Ala     400 405 410 aac aac ggt aag tac aat att aat aat ggt gca aca caa aat gta gaa 1419 Asn Asn Gly Lys Tyr Asn Ile Asn Asn Gly Ala Thr Gln Asn Val Glu 415 420 425 430 gat gat gaa gca gat agt aaa ttg aag tta gct aag cta agt gac cta 1467 Asp Asp Glu Ala Asp Ser Lys Leu Lys Leu Ala Lys Leu Ser Asp Leu                 435 440 445 aag gat atg aat acc aac tct gat aat ccc gcc cat tgg tta caa gtt 1515 Lys Asp Met Asn Thr Asn Ser Asp Asn Pro Ala His Trp Leu Gln Val             450 455 460 ggg att ggt tca act aca gaa gta ggg gct gat tca taa gtaactatat 1564 Gly Ile Gly Ser Thr Thr Glu Val Gly Ala Asp Ser         465 470 475 gcagttattc ctttgcttaa tttctttttt ttctgtcacc cgagtatata tttatatgca 1624 aatattgtaa ttataacttc accaaacaga tagtaactgt ttggtgatgc aaatactgtt 1684 aatatttgta ctcccttttt ttttgtcctt ttcttgtaat tgatacacaa tcttgtaatt 1744 ttttgtactt tcaatttctt gagctgtaat tttcagtgta atacagaact cagaatatgt 1804 tattcttgca atatgaagtt tagtatgcaa cagtcaaaca cgattagtag aagtggtctg 1864 taatccctcc cactagttac aagttgggat tgattcaccc acagtagttg gggctgactt 1924 tgaagtaaac atatgcagtt attc 1948 <210> 6 <211> 474 <212> PRT <213> Petunia hybrida <400> 6 Met Asp Cys Ile Asp Gln Glu Gln Gln Gln Gln Gln Pro Val Phe Lys   1 5 10 15 His Tyr Cys Arg Val Cys Lys Lys Gly Phe Val Cys Gly Arg Ala Leu              20 25 30 Gly Gly His Met Arg Ala His Gly Ile Gly Asp Glu Val Val Thr Met          35 40 45 Asp Asp Asp Asp Gln Ala Ser Asp Trp Glu Asp Lys Phe Gly Gly Ser      50 55 60 Val Lys Glu Gly Asn Lys Arg Met Tyr Gln Leu Arg Thr Asn Pro Asn  65 70 75 80 Arg Gln Lys Ser Asn Arg Val Cys Glu Asn Cys Gly Lys Glu Phe Ser                  85 90 95 Ser Trp Lys Ser Phe Leu Glu His Gly Lys Cys Ser Ser Glu Asp Ala             100 105 110 Glu Glu Ser Leu Val Ser Ser Pro Gly Ser Glu Gly Glu Asp Tyr Ile         115 120 125 Tyr Asp Gly Arg Lys Glu Lys Gly Tyr Gly Trp Ser Lys Arg Lys Arg     130 135 140 Ser Leu Arg Thr Lys Val Gly Gly Leu Ser Thr Ser Thr Tyr Gln Ser 145 150 155 160 Ser Glu Glu Glu Asp Leu Leu Leu Ala Lys Cys Leu Ile Asp Leu Ala                 165 170 175 Asn Ala Arg Val Asp Thr Ser Leu Val Glu Pro Glu Glu Ser Cys Ala             180 185 190 Ser Ala Ser Arg Glu Glu Glu Arg Ala Ala Arg Asn Ser Met Ala Tyr         195 200 205 Gly Phe Thr Pro Leu Val Ser Thr Arg Val Pro Phe Asp Asn Lys Ala     210 215 220 Lys Gly Ala Ser Ser Lys Gly Leu Phe Glu Cys Lys Ala Cys Lys Lys 225 230 235 240 Val Phe Asn Ser His Gln Ala Leu Gly Gly His Arg Ala Ser His Lys                 245 250 255 Lys Val Lys Gly Cys Tyr Ala Ala Lys Gln Asp Gln Leu Asp Asp Ile             260 265 270 Leu Ile Asp Asp Gln Asp Val Asn Ile Thr His Asp Gln Glu Phe Leu         275 280 285 Gln Ser Ser Lys Ser Met Arg Lys Ser Lys Ile His Glu Cys Ser Ile     290 295 300 Cys His Arg Val Phe Ser Thr Gly Gln Ala Leu Gly Gly His Lys Arg 305 310 315 320 Cys His Trp Ile Thr Ser Asn Ser Pro Asp Ser Ser Lys Phe His Phe                 325 330 335 Asn Gly His Val Glu Gln Ile Asn Leu Arg Ser Asn Met His Lys Ser             340 345 350 Asp Ala Leu Asp Leu Asn Asn Leu Pro Thr His Glu Asp Met Ser Arg         355 360 365 Ile Arg Arg Asp Pro Phe Asn Pro Leu Ser Phe Glu Val Ser Thr Asp     370 375 380 Ile His Leu Gln Tyr Pro Trp Ser Cys Ala Pro Lys Asn Asp Asp Asn 385 390 395 400 Asp Asn Tyr Tyr Leu Glu Glu Ile Lys Ile Asp Ser Asn Ala Asn Asn                 405 410 415 Gly Lys Tyr Asn Ile Asn Asn Gly Ala Thr Gln Asn Val Glu Asp Asp             420 425 430 Glu Ala Asp Ser Lys Leu Lys Leu Ala Lys Leu Ser Asp Leu Lys Asp         435 440 445 Met Asn Thr Asn Ser Asp Asn Pro Ala His Trp Leu Gln Val Gly Ile     450 455 460 Gly Ser Thr Thr Glu Val Gly Ala Asp Ser 465 470 <210> 7 <211> 2712 <212> DNA <213> Petunia hybrida <220> <221> promoter <222> (1) .. (2624) <400> 7 ctgcaggcag caacattagg agattttcca gcaccaatct ccctatgtgc tataacttca 60 cttataggca tggtattgac tggaattgta caattgatac aacaagggtc gttggagatt 120 ggattgcccc tgttaagcat ccgtgactta ataggctact cgttattggt aattcatcaa 180 atatccctga aattctcaca ttaattatgt taatacagaa attctgagtt agatttgact 240 tacatacgtt gatagcctaa ataatttgta tgatactaac gtttttttaa cctgatactt 300 tatattaact ttgaggtttg tctaattttt tgtggttatc ataggcaggt atagttagtg 360 gagcatgtgt aagtttcaat aattgggcaa tgaagaaaag agggccagtc ttagtttccg 420 tatttagtcc tgttggaact gtgataactg tcgtactttc tgctatcacc ttgaagtaca 480 caattactat gggaaggtaa aaccttatcc attttcactt ggatctagct tatatacagt 540 gtaaagaaat ttttacaata ttttccaagt aacttttaaa gacgattatc aataatcatg 600 ttttacttaa cctgatagtg taaatatatt ttttcacact tacaattact ttagttcttt 660 ttcagttgca tcaaaattca aacttcaaat gacttaactt ctttttgcag ccttggtggt 720 atgtttctca tgtttacggg tctgtatttc gtgttatggg ctaaaaggaa cgaaggattt 780 ctaaataata ccaactcctc agaaagtgag tacgatgttg agaagcctct tttgcattaa 840 atttcttttt attctcaatt gtaatatgta gttagtttgt atatacaact agaatccaac 900 atagagaaga gagagggaga gcttgtttgt accaaataga taacatgtat gttgatttaa 960 gtatcccata ttggtactgg aagtanactg ttaatgttgc ctgcgattca attgtccagt 1020 ccttggtgta gtgagacagt gttaaatatc ccacatggta taaaaaatgg attgctgtct 1080 ccttatatgg tatttgacaa tcctcacatt ttgagctaaa atttgggttg agttaatgca 1140 attgtccatt tcttatcaat gtatttaatc taggcttgga gctaaaaata caaagcaaaa 1200 gagaagagag aaaaagaaca aagaaagact attatgatag ttgatatttg aaaaaatgca 1260 agttccaatc ctagtaatat cttttatttt gcagtagcat gacggaatat gggaatcaac 1320 atgtagctgc ttttctggct ctatctaagc ccctcttctt ttaccatagt tttgtttttc 1380 attcactttt ggaagcagca agggtagatt tagaccacaa atatgcaaat gttttttttt 1440 tttttttttt tgtaaagtct tagacctata tggagtataa cctttgggaa aggggattga 1500 atcaatgatc ataatgtcac aatcatgtag tactacattt tttgttcttc aatttgagct 1560 actagtttga catttcccaa gtaaattatg cttcaacact aggattctct tgtttatatt 1620 atctcattga agctatgctt taactctctt ccttgagtgg attaacttga aaaagtaggc 1680 aaagaaattt atgagagttc tgatatcgat atcatagagg acacaaaatt aagaaaatgc 1740 gaaaagactt atacccaaca aagaaaatat gaacactagt atcgatcacc acccagattt 1800 acaatttaat gtactggtgt tcaattttgt gcttgcatcg actatttcac cgaatattta 1860 ttcttattta taaaaatatc gaataactat gaccatcaaa gtttagccaa ataaaatata 1920 aaaaagtatc tatatcacta tagtaaactt tgtatttatt ggaattgaac tcacacttct 1980 tccattacta ggtcaaatcc cagaaggcat attataagtt tttgtttcaa agcctccaaa 2040 ccaagtacac tcattttctt tttgaagaaa gcgagttcat ttgtaggcta cgtgaatata 2100 actactttaa aatattgctt tgtttcgaat ttgccatgag ttactacatt cacacaaaat 2160 tcttaatgcg actcagagtg tgtgttttaa ttttctttta gagtgtttgt acttctatat 2220 gagggtcact agtaaagtag tccactaata ttacaaattc ttacattacg tacaatgtga 2280 ttttatgtca gtagatttga ctgaatgcta taactacgag agttagaaat agtctttgcc 2340 aaccacatta taaactgacc ctccacttgt cataacaaac tctcttgttc tcatccacaa 2400 ctaactttaa ctagaaacta ggacttccct cacttatgct acaaaaatcc ttataactac 2460 accacaacct ttagtactgt tcactaacta attctttatt tataccaacc ctggcttgga 2520 gtgtagcaaa aaaatgtaca ctactccaaa gtaaacacta ttctttgaaa ctttccttgt 2580 tgcactttaa tttatgttct agtgagtata ttagagagtg agaaatggtg gacaatagcc 2640 agaaaaatga accatcaact gttatacact attgtagagt atgtaaaagg ggatttaata 2700 ngtntggagc tc 2712 <210> 8 <211> 4002 <212> DNA <213> Petunia hybrida <220> <221> promoter <222> (1) .. (3631) <400> 8 gaattcacca ccacgagtac ttattttgat gagcatggca ttatttttca aacttcttgt 60 gctggaacac cacagcagaa cgggaaagtt gagcgaaaac ataaacatat tttgaatgtt 120 gctcgagcac ttaggtttca agcgcatttc ccaattgagt tttggggtga gtgtgttttg 180 atggcgtgct atttgatcaa gcgaaccctc tcatcggtct tacacagaaa aaaatgccat 240 atgatgtctt ttttggtgta acaccgaact acgagcattt gaaagtgttt ggatctctat 300 gctatggtca caagcatggg tgcttgggag ataagtttga aagtaggagt cgtctgtgtgg 360 tttttattgg atacccatat gggaagaaat catggaagtt atatgatttg gacaccaaaa 420 aatattttgt gtcgcgggca cctagcaccg aagcactaag catccgaacc caacgttatt 480 tcagcctatg agagtgattg aagatgacta tggtattgaa gtgagggggt agtgacactg 540 ttttgacaca aaaaccgaac aaggagagga tacagctcga ggacgtgata attgacactc 600 caagtttggc tacagagact aatgtcatgg aagtagaaaa cccggtcacc ggtgtcatgt 660 ccgatcaatt gaangctgaa gctgtgggag aagagttggg tcgagaaaac taattaggaa 720 ggagaatgtc tccttcgtga tttttcactg gtctgtcgaa aggttagtca ccaggtttca 780 acctgtgtcc acatgtctga tttctcaccc gtgacacaac gagcctcagg tacgccttat 840 cctcttacac actatgttaa ttgtgaccgt ttttcttcga agcatgtgag ttttcttgca 900 gctattacgg agggtcgtga atcgacctct ttctgtgtgggg ccataaagaa tgaaaaatgg 960 agaaagacta tgcaatagga gtttcaagca ttggaagata ataaaacatc tatggttggt 1020 tacttgccac ctgggaagaa agcgctcgga tgtcggtggg tgtataagat caaatataat 1080 tccgatggat cagtggtacg atacaaggca cgtttggtta gttttggaaa tcatcaggtc 1140 aaaggcattg attatacgta gacatttgct ccagtcgcta aaatagtgac tttgaggaca 1200 tttcttgcag tcgctgcagc taaaaattgg gaattgcatc aaatggatgt tcataatgca 1260 tttgtacagg tgatcttcat gaaaaagtct atatgaagct gccaccaagg tatcagacta 1320 atggttacgg taatgtgtgt cgcctatgaa agtttttgta tggtttgaag caggcgtcga 1380 gatgttggtt cacgaagtta ttggccgatt tgaaaactta tgcttttana caatcttatt 1440 cggattattg cctttttaca cttcgtaaag ggtccgtcac cttaagtgtg ttggtgtacg 1500 tggatgattt gattattggg gcaataattc ggaagctatt cgtctcttta agttgtatct 1560 ctccacttgc tttcttatga aagatttggg catactaaat tttttgggag atgaagtggc 1620 tagaggacct aaaggtattt tcctatgtca atggaaatat gccttggata taattggatt 1680 attaggagct cgactggttg gaacttctat ggagcagaat catcgtttgg ctttggcaag 1740 tggccgatat attgatgatc tacatagata tatttgattg atgattctag tgcttaatta 1800 aagactgatc aattgtactg ttattaatta atctttgttt aggaggagca tgtgggctgg 1860 aaaatgatgt agcaaacttt ccatacaatg ccatgattac tgcaggaaat gaagtcctat 1920 ttaaacatgg ctttggctgt ggtgcatgct accaggtgca cttgaaattt gttttataaa 1980 aagagaaaca catgcatgaa ttttgagttt cacttcgcaa aataaatgaa atctttattt 2040 atattaatgc aatcgatttt caggtgttgt gcttacagaa tcaaaatcaa tactgctcag 2100 gaaatccaat aatagtaact nttacagatg agtgcccagg ggcatgcaat aatgatcctg 2160 ttcattttga ttttagtgga actgcttttg gagccttggc aaaacctggc caagctgaac 2220 aattgcgtaa tgaaggaaga atccaaatta attacagaag gtgagttacg ttccacatga 2280 caaatagaga aatcaataca aaatttccat ttacttagta acactctttc cttgttagta 2340 tgcctaaaaa agagtagtac acaacacaat taatgcacaa ttttgctaaa ccatgatatt 2400 gaatcgtgca gagtggcatg cagttacaag gcaaatatac aatttaaggt agacaaaggc 2460 tccaatcctg atttcttggc agttgcagct gaggcagtta atggagatgg tgatctttct 2520 tttgtagaaa ttaaagcatc caattcgaat caatggcttc ccatgcaaca aatgtttggg 2580 gcaacttgga gcgttggcat caagccagac acacagaaac ctcctttctc acttagactt 2640 actacagaat ttaagcaaac agtcattgcc caaaatgtca taccagtggg ttggcaacca 2700 agagcaattt acaaatcaaa tgtcaatttc ccacccaagc tttagtttaa tctttttacc 2760 cacaatagtg taaaaataat tataaggact acaaattaaa tactctatgt tcaacagtgc 2820 tatttaatta taataaggat tacaaattaa agtgaggatt cttctcaatg ataatgtcaa 2880 aagtttggga tgtcaaatct atttgtattt tttttcacat caatgatcaa tgaaagttat 2940 gcttttagta ttttttaatt attaataatt tgttttcatg tatttcaata ataatattat 3000 ctcaaaagta aataaatcaa tattcaaaac tgacatgaaa attttcattc tcactatatt 3060 tatgttcttt tttcagtctc aaacgcccaa attttgtacg aaaaaattgt tcggataagc 3120 gagaaacact cataactgat aaaaacagaa tagtgaataa agaaaactaa atatatttac 3180 tcttgatgag tccatgatgt gtaagtatta tcttctgccg tccaatttgg ttgtttgaca 3240 ccactagtgt tattaataaa aagtttgtga aaaaataagc tcttcactcc cttaggcctt 3300 actctctcct tccacttgtc atactcactc ttcacttcca ctcacactcc tatttttctc 3360 tttacctcta aactctcctc cacaaaccac tacttcaact aaaaactagg actaattttt 3420 ttctcaccgt acaagtccac aacaacttct agtacaagaa caaacaaact ctcgttgtgc 3480 ccctcgctcc catgcatgca cacccccatg caattttttt agtctcttca ttctctcaac 3540 taaaactaga tttgcttctt atagtttctt gtccatgtct cttctcattc atacttgaag 3600 tagtacaata acaagaaaat aacatttagc catggattgt atagatcaag aacaacaaca 3660 acaacaacca gtttttaagc attattgtag agtttgcaag aaaggttttg tgtgtgggag 3720 agctctaggt gggcatatga gagctcatgg aattggggat gaagttgtaa ctatggatga 3780 tgatgatcaa gcaagtgatt gggaagataa gtttggaggg agtgttaagg aaggtaataa 3840 aaggatgtac caattaagaa caaaccctaa taggcaaaaa agcaatagag tttgtgagaa 3900 ttgtgggaaa gaattcctgc agcccggggg atccactagt tctagagcng ngcgcaccgc 3960 ggtggagctc cagcttttgt tccctttacg tgagggttaa tt 4002 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (6) <223> i <220> <221> modified_base <222> (9) <223> i <220> <221> modified_base <222> (12) <223> i <220> <221> modified_base <222> (15) <223> i <220> <223> Description of Artificial Sequence: primer <400> 9 cargcnytng gnggncay 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (6) <223> i <220> <221> modified_base <222> (9) <223> i <220> <221> modified_base <222> (12) <223> i <220> <221> modified_base <222> (15) <223> i <220> <223> Description of Artificial Sequence: primer <400> 10 gtycgnranc cnccngtr 18 <210> 11 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 11 ctgttatcgg tctttttact tggtagttga cagctgctcg aggtat 46 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 12 ctatatccta ggatataggt ac 22 <210> 13 <211> 1886 <212> DNA <213> Petunia hybrida <220> <221> CDS <222> (283) .. (1617) <400> 13 cccacgcgtc cgcatgtgca gagataaata taaaccaaca tgacctacca ttaagatgag 60 acgatgatca tctaaaattt tggagctcag atgattttat tcgacaaatt tcctattttc 120 tcgctatggg tttccttttc agctaagcta cctccctcct tcttcttgat ttgattttct 180 tgggtttctt gtttcttctt gttttagggt ttttgataca catatatagt tgcttagtta 240 cgtagctaag taaggtgggt tatttcattt cttgaacttt ca atg gtt gat tat 294                                                Met Val Asp Tyr                                                  1 caa gat ctt caa gtt ggg atg agc gga aca ctg tgg ata caa ctc aag 342 Gln Asp Leu Gln Val Gly Met Ser Gly Thr Leu Trp Ile Gln Leu Lys   5 10 15 20 att gaa gac aaa caa gtt caa gaa ttg gat cat agt caa gat att atg 390 Ile Glu Asp Lys Gln Val Gln Glu Leu Asp His Ser Gln Asp Ile Met                  25 30 35 gac tat gag gtt cca aaa aat aat gat cat act agg att tgt gag gtg 438 Asp Tyr Glu Val Pro Lys Asn Asn Asp His Thr Arg Ile Cys Glu Val              40 45 50 tgt aac aaa ggg ttt agc tca ggt aaa gca ctt ggg ggt cac atg aga 486 Cys Asn Lys Gly Phe Ser Ser Gly Lys Ala Leu Gly Gly His Met Arg          55 60 65 att cac gtt cag gct gcc aaa aag ctc tta tct gtt ggt aaa aag tgc 534 Ile His Val Gln Ala Ala Lys Lys Leu Leu Ser Val Gly Lys Lys Cys      70 75 80 aaa aag ctg aac cca ttc ggt tcc agg tat tac aag aaa cga ata tta 582 Lys Lys Leu Asn Pro Phe Gly Ser Arg Tyr Tyr Lys Lys Arg Ile Leu  85 90 95 100 tta caa caa gat gat cat caa gat aat tac aac aat gac atc aag aat 630 Leu Gln Gln Asp Asp His Gln Asp Asn Tyr Asn Asn Asp Ile Lys Asn                 105 110 115 cag ttg gca cca att tgt tca gtt tgt ggt aag aat ttt cca tca atg 678 Gln Leu Ala Pro Ile Cys Ser Val Cys Gly Lys Asn Phe Pro Ser Met             120 125 130 aaa tca ttg ttt ggg cat atg aga tct cat cct gaa agg gcc tgg aga 726 Lys Ser Leu Phe Gly His Met Arg Ser His Pro Glu Arg Ala Trp Arg         135 140 145 gga att caa cct cca gct cct aat aaa aac agt tgt ttg tca tca gct 774 Gly Ile Gln Pro Pro Ala Pro Asn Lys Asn Ser Cys Leu Ser Ser Ala     150 155 160 tcc aat gaa att gct gct act act aag tcg ggg gat tta tcg gtg cct 822 Ser Asn Glu Ile Ala Ala Thr Thr Lys Ser Gly Asp Leu Ser Val Pro 165 170 175 180 ggt tgg tct gtt aag gct aag cga ggc cga aag ggt act att gct gaa 870 Gly Trp Ser Val Lys Ala Lys Arg Gly Arg Lys Gly Thr Ile Ala Glu                 185 190 195 gca tca tct aac tcg agt ctt ggt tct aga agt ttc tct ttt gat caa 918 Ala Ser Ser Asn Ser Ser Leu Gly Ser Arg Ser Phe Ser Phe Asp Gln             200 205 210 gaa aag gat gac gag gag cac gaa tta cac gat gct gtt ggt cat ctt 966 Glu Lys Asp Asp Glu Glu His Glu Leu His Asp Ala Val Gly His Leu         215 220 225 atg ttg tta gcc aat gga aat aag act agt gca gat caa gaa ttg gaa 1014 Met Leu Leu Ala Asn Gly Asn Lys Thr Ser Ala Asp Gln Glu Leu Glu     230 235 240 ata acc aac agt aat tcg ctt act tcc aaa gct gaa act gaa caa gtc 1062 Ile Thr Asn Ser Asn Ser Leu Thr Ser Lys Ala Glu Thr Glu Gln Val 245 250 255 260 gat gag aac aag aag aaa aag aag aag ata aag tta agg cgt ttg ggt 1110 Asp Glu Asn Lys Lys Lys Lys Lys Lys Ile Lys Leu Arg Arg Leu Gly                 265 270 275 tct gta caa gac ctt gtt agt cca gtt tca gtt cat cat gac caa aaa 1158 Ser Val Gln Asp Leu Val Ser Pro Val Ser Val His His Asp Gln Lys             280 285 290 cta gtc atg gat acg cct gaa aaa tac aaa tgt aac act tgt gaa aag 1206 Leu Val Met Asp Thr Pro Glu Lys Tyr Lys Cys Asn Thr Cys Glu Lys         295 300 305 agc ttt gca act cat caa gca ctg gga gga cat agg tca agc cac aac 1254 Ser Phe Ala Thr His Gln Ala Leu Gly Gly His Arg Ser Ser His Asn     310 315 320 aag ttt aga atg gtc att caa aat tca gtt gaa gat gat gta gtt act 1302 Lys Phe Arg Met Val Ile Gln Asn Ser Val Glu Asp Asp Val Val Thr 325 330 335 340 aat gta gca act agt agc ata att ggc cca gtg gaa gaa cgt gaa gaa 1350 Asn Val Ala Thr Ser Ser Ile Ile Gly Pro Val Glu Glu Arg Glu Glu                 345 350 355 gca gct gct agc acc tca aaa ttg ttg gtg gac cat aac aag aat gcc 1398 Ala Ala Ala Ser Thr Ser Lys Leu Leu Val Asp His Asn Lys Asn Ala             360 365 370 tca gca agt cag gta ctt ggg gtt cag aat agg tgc caa tgg gga agt 1446 Ser Ala Ser Gln Val Leu Gly Val Gln Asn Arg Cys Gln Trp Gly Ser         375 380 385 cca att gat cat caa gct ggt cca tca aca agt caa ttg act tca cca 1494 Pro Ile Asp His Gln Ala Gly Pro Ser Thr Ser Gln Leu Thr Ser Pro     390 395 400 ggt gaa gtt agc cat tca att ggt cga caa att ctg gat ttt gat ctc 1542 Gly Glu Val Ser His Ser Ile Gly Arg Gln Ile Leu Asp Phe Asp Leu 405 410 415 420 aat gaa tta ccc cct caa gaa gat gaa att gct ggt ggc cgt gat cat 1590 Asn Glu Leu Pro Pro Gln Glu Asp Glu Ile Ala Gly Gly Arg Asp His                 425 430 435 cag tat ttt aca ttt ttt cca att taa ctactcctag gtagtgtttg 1637 Gln Tyr Phe Thr Phe Phe Pro Ile             440 445 tttagtctac agcttttaac tcttagctgg ttaggaatta acagctacta cttcatcatc 1697 agtgagaaag gccagtcatg taagttttgg catgttaatg atccatttac tagtagtgca 1757 aattgtggat aatagcgaac catcttggtt atttccattt ttttgctagt tttccataac 1817 aatgtggcat tttgaagaaa gggctgttga actttttttt cttatatctt catggaaagt 1877 acgatgttt 1886 <210> 14 <211> 444 <212> PRT <213> Petunia hybrida <400> 14 Met Val Asp Tyr Gln Asp Leu Gln Val Gly Met Ser Gly Thr Leu Trp   1 5 10 15 Ile Gln Leu Lys Ile Glu Asp Lys Gln Val Gln Glu Leu Asp His Ser              20 25 30 Gln Asp Ile Met Asp Tyr Glu Val Pro Lys Asn Asn Asp His Thr Arg          35 40 45 Ile Cys Glu Val Cys Asn Lys Gly Phe Ser Ser Gly Lys Ala Leu Gly      50 55 60 Gly His Met Arg Ile His Val Gln Ala Ala Lys Lys Leu Leu Ser Val  65 70 75 80 Gly Lys Lys Cys Lys Lys Leu Asn Pro Phe Gly Ser Arg Tyr Tyr Lys                  85 90 95 Lys Arg Ile Leu Leu Gln Gln Asp Asp His Gln Asp Asn Tyr Asn Asn             100 105 110 Asp Ile Lys Asn Gln Leu Ala Pro Ile Cys Ser Val Cys Gly Lys Asn         115 120 125 Phe Pro Ser Met Lys Ser Leu Phe Gly His Met Arg Ser His Pro Glu     130 135 140 Arg Ala Trp Arg Gly Ile Gln Pro Pro Ala Pro Asn Lys Asn Ser Cys 145 150 155 160 Leu Ser Ser Ala Ser Asn Glu Ile Ala Ala Thr Thr Lys Ser Gly Asp                 165 170 175 Leu Ser Val Pro Gly Trp Ser Val Lys Ala Lys Arg Gly Arg Lys Gly             180 185 190 Thr Ile Ala Glu Ala Ser Ser Asn Ser Ser Leu Gly Ser Arg Ser Phe         195 200 205 Ser Phe Asp Gln Glu Lys Asp Asp Glu Glu His Glu Leu His Asp Ala     210 215 220 Val Gly His Leu Met Leu Leu Ala Asn Gly Asn Lys Thr Ser Ala Asp 225 230 235 240 Gln Glu Leu Glu Ile Thr Asn Ser Asn Ser Leu Thr Ser Lys Ala Glu                 245 250 255 Thr Glu Gln Val Asp Glu Asn Lys Lys Lys Lys Lys Lys Ile Lys Leu             260 265 270 Arg Arg Leu Gly Ser Val Gln Asp Leu Val Ser Pro Val Ser Val His         275 280 285 His Asp Gln Lys Leu Val Met Asp Thr Pro Glu Lys Tyr Lys Cys Asn     290 295 300 Thr Cys Glu Lys Ser Phe Ala Thr His Gln Ala Leu Gly Gly His Arg 305 310 315 320 Ser Ser His Asn Lys Phe Arg Met Val Ile Gln Asn Ser Val Glu Asp                 325 330 335 Asp Val Val Thr Asn Val Ala Thr Ser Ser Ile Ile Gly Pro Val Glu             340 345 350 Glu Arg Glu Glu Ala Ala Ala Ser Thr Ser Lys Leu Leu Val Asp His         355 360 365 Asn Lys Asn Ala Ser Ala Ser Gln Val Leu Gly Val Gln Asn Arg Cys     370 375 380 Gln Trp Gly Ser Pro Ile Asp His Gln Ala Gly Pro Ser Thr Ser Gln 385 390 395 400 Leu Thr Ser Pro Gly Glu Val Ser His Ser Ile Gly Arg Gln Ile Leu                 405 410 415 Asp Phe Asp Leu Asn Glu Leu Pro Pro Gln Glu Asp Glu Ile Ala Gly             420 425 430 Gly Arg Asp His Gln Tyr Phe Thr Phe Phe Pro Ile         435 440

[Brief description of drawings]

FIG. 1A is a cDNA of a gene encoding ZPT2-5 (also referred to simply as “ZPT2-5 gene” in the present specification).
It is a figure which shows A sequence and a corresponding amino acid sequence.
The two zinc finger motifs and the DLNL sequence (amino acids 145-155) are underlined.

FIG. 1B is a continuation of FIG. 1A.

FIG. 2A is a cDNA of a gene encoding ZPT3-1 (also referred to herein simply as “ZPT3-1 gene”).
It is a figure which shows A sequence and a corresponding amino acid sequence.
The three zinc finger motifs and the DLNL sequence (amino acids 408-417) are underlined.

FIG. 2B is a continuation of FIG. 2A.

FIG. 2C is a continuation of FIG. 2B.

FIG. 3A is a cDNA of a gene encoding ZPT4-1 (also referred to simply as “ZPT4-1 gene” in the present specification).
It is a figure which shows A sequence and a corresponding amino acid sequence.
The four zinc finger motifs and the DLNL sequence (amino acids 438-449) are underlined.

FIG. 3B is a continuation of FIG. 3A.

FIG. 3C is a continuation of FIG. 3B.

FIG. 3D is a continuation of FIG. 3C.

FIG. 4 ZPT2-5, ZPT3-1 and ZPT4
-1 plant expression vector for expressing each cDNA sequence (pBIN-35S-ZPT2-5, pBIN-35
S-ZPT3-1 and pBIN-35S-ZPT4-
It is a schematic diagram showing composition of 1).

FIG. 5A shows the upstream sequence of the coding region of ZPT3-1 gene. The transcription start point (position 2567) is indicated by a thick arrow, and the translation initiation codon (ATG) is indicated by underlined bold type.

FIG. 5B is a continuation of FIG. 5A.

FIG. 6A shows the upstream sequence of the coding region of ZPT4-1 gene. The transcription start point (position 3503) is indicated by a thick arrow, and the translation initiation codon (ATG) is indicated by an underlined bold type.

FIG. 6B is a continuation of FIG. 6A.

FIG. 7: Plant expression vector (pBI) for analyzing promoters of ZPT3-1 and ZPT4-1 genes
N-ZPT3-1-GUS and pBIN-ZPT3-
1-GUS) is a schematic view showing a configuration of (1-GUS).

FIG. 8: Wild-type petunia pollen and pBIN-3
It is the photograph which showed the morphology of the organism which image | photographed the pollen of the petunia (transformant which caused co-suppression) which introduce | transduced 5S-ZPT2-5 (magnification is 400 times). Figure 8
(A)-(d) are wild-type petunias, and FIG. 8 (e).
(H) shows pollen of cosuppression-transformed petunia at different bud development stages. All pollen is DAPI (4 ', 6
-Diamidino-2-phenylindole
dihydrochlorinated n-hydrat
stained with e).

FIG. 9: Pollen of wild type petunia and pBIN-3
It is the photograph which took the pollen of the petunia which introduce | transduced 5S-ZPT3-1, and shows the form of an organism.
Times). 9 (a) and 9 (c) show pollens of wild-type petunia, and FIGS. 9 (b) and 9 (d) show pollen at the tetrad stage and microspore stage, respectively, for transformed petunia. The quaternary pollen was dyed with DAPI and the microspore pollen with safranin, respectively. In addition, pB
Even in the pollen of petunia introduced with IN-35S-ZPT4-1, a morphology exactly the same as that in FIGS. 9B and 9D was observed.

FIG. 10: pBIN-ZPT3-1-GUS and p
It is the photograph which showed the morphology of the organism which imaged the GUS dyeing flower organ of the petunia which introduced BIN-ZPT4-1-GUS. All of them are flowers whose anthers are in the mononuclear stage (buds)
Was taken as a shooting target. FIGS. 10 (a) and 10 (d) are actual-size appearances of the buds, and FIGS. 10 (b) and 10 (e) are cross-sectional views of the anther at low magnification (40 times), and FIGS. (F) shows a high-magnification cross-sectional view of microspores (Fig. 6 (c); magnification is 700 times) or around an anther cleavage tissue (Fig. 6 (f); magnification is 200 times).

   ─────────────────────────────────────────────────── ─── Continued front page    (72) Inventor Akira Kobayashi             5-1-1 Higashi 2-jo Minami, Memuro-cho, Kasai-gun, Hokkaido               Agricultural Experiment Station Dormitory D Building No. 204 (72) Inventor Hiroshi Takatsuji             2-1-2 Kannondai, Tsukuba City, Ibaraki Prefecture             Ministry of Agriculture, Agricultural and Biological Resources Institute F-term (reference) 2B030 AA00 AB03 CA07 CA15 CA17                       CA19                 4B024 AA08 CA04 DA01 EA04 GA14                 4B065 AA11X AA88X AA88Y AB01                       AC20 BA03 CA53

Claims (14)

[Claims] 1. A method for producing a plant whose trait has been modified: (a ′) a DNA having a sequence from the 1st position to the 2624th position of the nucleotide sequence represented by SEQ ID NO: 7, or (b ′) (A) A plant expression comprising a promoter having a partial sequence of (a ′) and containing any DNA exhibiting promoter activity specific to microspores, and a heterologous gene operably linked to the promoter A method comprising the steps of providing a cassette, introducing the expression cassette into a plant cell, and regenerating a plant cell into which the expression cassette has been introduced into a plant. 2. A method for producing a plant whose trait has been modified: (a ″) a DNA having a sequence from the 1st position to the 3631st position of the nucleotide sequence represented by SEQ ID NO: 8, or (b ″) ) (A ″) and a promoter containing any of the DNAs having a partial promoter activity and specific to microspores and optionally to anther cleavage tissue, and operably linked to the promoter A method of providing a plant expression cassette containing the heterologous gene, a step of introducing the expression cassette into a plant cell, and a step of regenerating the plant cell into which the expression cassette has been introduced into a plant. . 3. The method according to claim 1, wherein the trait is fertile, and the plant whose trait has been modified is a male sterile plant. 4. The trait is compatible, and the plant whose trait has been modified is a self-incompatible plant.
The method described in. 5. The plant according to claim 1, which is a dicotyledon.
Or the method described in 2. 6. The plant according to claim 5, wherein the plant is a solanaceous plant.
The method described in. 7. The method according to claim 6, wherein the plant is a petunia plant. 8. The method according to claim 1, wherein the expression cassette is incorporated into a plant expression vector. 9. A trait-modified plant produced by the method according to any one of claims 1 to 8. 10. A method for imparting male sterility to a plant, comprising: (a ') a DNA having a sequence from the 1st position to the 2624th position of the base sequence represented by SEQ ID NO: 7, or (b') (A) A plant expression comprising a promoter having a partial sequence of (a ′) and containing any DNA exhibiting promoter activity specific to microspores, and a heterologous gene operably linked to the promoter A method comprising the steps of providing a cassette, introducing the expression cassette into a plant cell, and regenerating a plant cell into which the expression cassette has been introduced into a plant. 11. A method for imparting male sterility to a plant, comprising: (a ″) a DNA having a sequence from the 1st position to the 3631st position of the nucleotide sequence represented by SEQ ID NO: 8, or (b ″) ) (A ″) and a promoter containing any of the DNAs having a partial promoter activity and specific to microspores and optionally to anther cleavage tissue, and operably linked to the promoter A method of providing a plant expression cassette containing the heterologous gene, a step of introducing the expression cassette into a plant cell, and a step of regenerating the plant cell into which the expression cassette has been introduced into a plant. . 12. D of the following (I ′) or (II ′)
A promoter containing NA: (I ′) a DNA having a sequence from the 1st position to the 2624th position of the base sequence represented by SEQ ID NO: 7, or a partial sequence of (II ′) (I ′), A DNA showing a promoter activity specific to microspores. 13. The following D of (I ″) or (II ″)
A promoter containing NA: (I ″) having a DNA having a sequence from the 1st position to the 3631st position of the nucleotide sequence represented by SEQ ID NO: 8 or having a partial sequence of (II ″) (I ″), A DNA showing promoter activity specific to microspores and optionally to anther cleavage tissue. 14. A plant expression cassette useful for imparting male sterility to a plant, which comprises the promoter according to claim 12 or 13 and a heterologous gene operably linked to the promoter.