JP2003088380A - Method for decomposing biphenyl or its derivative and microorganism applied therefor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a microorganism having improved decomposition activity for biphenyl and its derivative, and to provide a method for decomposing biphenyl and its derivative. SOLUTION: This microorganism has decomposition ability for biphenyl and improved decomposition activity for biphenyl and its derivative by promoter mutation of enzyme gene concerning with decomposition of biphenyl, and to provide a method for decomposing biphenyl and its derivative using the microorganism.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for degrading biphenyl or a derivative thereof, and further relates to a recombinant microorganism used therein and a promoter-replacement DNA used for producing the microorganism.

[0002]

2. Description of the Related Art Biphenyl derivatives such as polychlorinated biphenyl (PCB) and dibenzofuran are mentioned as serious environmental pollutants as persistent compounds. Development of a method for safely and effectively decomposing these pollutants is desired, and a prominent method among them is decomposition by microorganisms.

PCB degradation by microorganisms is carried out by a group of enzymes involved in biphenyl degradation. For example, Pseudomonas spp.
It is known that the Eudomonas sp.) KKS102 strain and the Pseudomonas bacterium KKS103 strain are degraded by the pathway shown in FIG. In this pathway, biphenyl or PCB is first added with two hydroxyl groups (OH) by biphenyl dioxygenase (BphA enzyme). The BphA enzyme has four subunits (BphA
A1, BphA2, BphA3, BphA4). Then, dihydrodiol dihydrogenase (BphB enzyme) removes two hydrogens from the product of BphA, and 2,3-dihydroxybiphenyl dioxygenase (BphC enzyme) adds one molecule of oxygen to the BphB product, resulting in HOPDA ( Inducible substrate of BphD) is produced. Then, 2-hydroxyl-6-
Oxo-6-phenylhexa-2,4-dienoic acid hydrolase (BphD enzyme) converts HOPDA into benzoic acid and 2
-Decomposes with hydroxypenta-2,4-dienoate. And 2-hydroxypenta-2,4-dienoate hydratase (BphE enzyme), 4-hydroxy-2
-It is considered to be converted into acetyl CoA and pyruvate by oxovalerate aldolase (BphF enzyme) and acetaldehyde dehydrogenase (BphG enzyme).

Conventionally, many microorganisms having a PCB decomposing ability have been isolated.
It is considered that the decomposition efficiency can be increased, and thus the cost can be reduced, by using it after applying appropriate improvement instead of using it in the B treatment.

[0005]

The expression of the degrading enzyme of biphenyl or its derivative (eg PCB) is regulated by a regulatory protein, and it is expressed only when biphenyl or its derivative (eg PCB) is present. for that reason,
Before performing PCB decomposition using a microorganism that decomposes biphenyl or its derivatives (eg PCB),
It is necessary to give biphenyl to a degrading microorganism and induce the expression of biphenyl or its derivative (eg PCB) degrading enzyme. Further, if there is a substance serving as a nutrient source in addition to biphenyl or its derivative, there is a problem that induction of degrading enzyme of biphenyl or its derivative is hindered.

[0006] On the other hand, conventionally, a plasmid carrying a DNA fragment containing a gene group involved in the decomposition of a hardly decomposable substance was prepared, and a microorganism was made to hold the plasmid by a method of transformation or transduction to express a degrading enzyme. The method of making it known is known. The following points are listed as disadvantages of these methods.

1) In many cases, plasmids are not stably retained in microorganisms in the absence of selective pressure, and plasmid-deficient plasmids may be the preferred species. The emergence of such priority species is an obstacle to efficient PCB decomposition.

2) Most of the plasmids have zygosity, and it is known that genetic information spreads across species.
If a plasmid-carrying microorganism leaks into the environment,
There is concern that genes may be diffused into the environment by horizontal transmission. Many of the plasmids carry a drug resistance gene as a selectable marker, and the use of plasmids having such properties is not desirable from the viewpoint of human health care.

3) A DNA fragment containing a gene group involved in the decomposition of a certain chemical substance is very long in many cases. It is considered that preparation of a plasmid containing all such DNA fragments is laborious, and that such a plasmid is unlikely to be stably retained in a microorganism.

4) The expression of genes is almost always regulated by other genes. That is, it has a mechanism in which a gene is expressed and functions only under a specific condition (mostly, when an inducing substrate which is a small molecule organic compound is present). Therefore, gene expression does not occur unless specific conditions are met. Therefore, PCB lysis does not occur simply by ligating the degradation gene of biphenyl or its derivative to the plasmid, and improvement of the gene is necessary for efficient degradation.

5) When a gene is ligated to a plasmid and introduced into a microorganism, a plasmid specific to the microorganism is required. There is no plasmid available for any microorganism, and whether a plasmid can be introduced to make a gene function depends on the presence or absence of the host vector system.

[0012] Therefore, a method of modifying the expression control itself of the degrading enzyme of biphenyl or its derivative without using a plasmid vector is desired.

[0013]

The first aspect of the present invention is as follows.
A method for degrading biphenyl or a derivative thereof using a microorganism capable of degrading biphenyl, wherein the microorganism has improved degradation activity of biphenyl or a derivative thereof due to promoter mutation of an enzyme gene involved in the degradation of biphenyl on the genome. The method is characterized in that The derivative of biphenyl can be polychlorinated biphenyl. The above-mentioned promoter mutation may be replaced with an Escherichia coli promoter by homologous recombination, or a binding site for a negative regulatory factor may be deleted. A second aspect of the present invention is a microorganism capable of degrading biphenyl, wherein the microorganism has improved degradation activity of biphenyl or its derivative due to promoter mutation of an enzyme gene involved in the degradation of biphenyl. It is a microorganism. The above-mentioned promoter mutation may be replaced with an Escherichia coli promoter by homologous recombination, or a binding site for a negative regulatory factor may be deleted. The microorganism of the present invention may be Pseudomonas bacterium KH952-04. A third aspect of the present invention is a promoter replacement containing a fragment having the sequence of SEQ ID NO: 7 or a partial fragment thereof, an integrated marker gene, a restriction enzyme site, and a fragment having the sequence of SEQ ID NO: 8 or a partial fragment thereof. It is a DNA fragment for use.

The advantages of the homologous recombination used in the present invention are as follows. 1) Since it is integrated into the genome of the host, it is expected that the genetic information will be maintained more stably than in the case of using a plasmid even in the absence of selective pressure. 2) It is considered that the risk of spreading genetic information is lower than when using a plasmid. 3) The DNA fragment required for causing homologous recombination is relatively short, and it is not necessary to handle a large group of genes involved in degradation. 4) Since the gene expression control mechanism is eliminated, nutrient sources other than the target substance do not affect the degradation of degrading enzyme expression. Further, since the degrading enzyme is highly expressed regardless of the target substrate concentration, the degrading enzyme expression level corresponding to the decrease in the substrate concentration does not decrease, and it can be expected that more complete degradation can be achieved. 5) The phenomenon of homologous recombination is a phenomenon common to many microorganisms, and this method can be applied without the presence of a plasmid specific to the microorganism.

[0015]

BEST MODE FOR CARRYING OUT THE INVENTION The type of microorganism used in the present invention may be any microorganism having a biphenyl-degrading (hereinafter also referred to as PCB-degrading) enzyme gene on the genome. It is found as a microorganism that can grow as a single carbon source. Examples of preferable microorganisms include, for example, Pseudomonas bacterium KK
S102 and KKS103 (Otsubo et al., Gene 256 (2000) p.
223-228), Comamonas testosteroni TK102 (Jou
rnal of Fermentation and Bioengineering, Vol. 81,
No. 6, pp.573-576. Complete degradation of polychl
orinated biphenyls by acombination of ultraviolet
and biological treatments. Shimura M. et al), Rhodococcus opacus TSP203 (Enzyme and Microbi
al Technology. Vol.23 p34-41 1998. Degradation of
polychlorinated biphenyl by cells of Rodococcus op
acus strain TSP203 immobilized in alginate and in
solution.), Rhodococcus RHA1 (Masai, E. et al., Ch
aracterization of biphenyl catabolic genes of gram
-positive polychlorinated biphenyl degrader Rhodoc
occus sp.RHA1. Appl. Environ. Microbiol. 1995. vol
61. p2079-2085), Burg Holderia LB400 and Pseudomonas pseudoalikarigenes KF707 (Gi
bson, DT et al., Oxidation of polychlorinated bipheny
ls by Pseudomonassp. strain LB400 and Pseudomonas
pseudoalcaligenes KF707. J. Bacteriol.vol175. p456
1-4564) and the like. Comamonas testosteroni TK102 and Rhodococcus opacus TSP
No. 203 has been deposited at the Institute of Biotechnology, Industrial Technology Institute, and the deposit number is Comamonas testosteroni TK1.
02 is FERM P-14591 and Rhodococcus opacus TSP203 is FERM P-15408.

Pseudomonas bacteria KKS102, Pseudomonas bacteria KKS103, Comamonas testosteroni TK102, Rhodococcus opacus TSP203,
Rhodococcus RHA1, Burg Holderia LB400 and Pseudomonas pseudoalikarigenes KF707
It is known that the biphenyl-degrading enzyme gene group forms a cluster in the strain. For example, in Pseudomonas bacteria KKS102 and KKS103 strains,
The biphenyl degrading enzyme gene group forms a cluster of about 11 kb starting from the bphE gene, and the expression from bphE to bphA4 is pE existing in the upstream of bphA.
This is done by the promoter (Fig. 2). Comamonas testosteroni TK102, Burgholderia LB400 and Pseudomonas pseudoalikarigenes KF707
Also has a gene group very similar to the structure shown in FIG. Regarding the gene group and the regulation thereof in these microorganisms, for example, for the KF707 strain, Versatile tr
anscription of biphenyl catabolic bph operon in Ps
eudomonas pseudoalcaligenes KF707. Watanabe T, Ino
ue R, Kimura N, Furukawa K. J Biol Chem 2000 Oct
6; 275 (40): 31016-23. Regarding the regulatory gene of the LB400 strain, Microbiology 2001 Aug; 147 (Pt.
8): 2169-82 Analysis of transcription of the bph lo
cus of Burkholderia sp. strain LB400 and evidence
that the ORF0 gene product acts as a regulator of
the bphA1 promoter. Beltrametti F, Reniero D, Back
haus S, Hofer B.

These biphenyl-degrading enzyme gene groups are
Not only biphenyl but also biphenyl derivatives, especially PC
B and dibenzofuran are also substrates, and naphthalene and its derivatives are also substrates. Since the microorganism of the present invention is a microorganism in which the decomposition activity of biphenyl or its derivative is improved by the promoter mutation of the enzyme gene involved in the decomposition of biphenyl, it is effective in the decomposition of PCB and dibenzofuran known as environmental pollutants. .

The microorganism of the present invention is a microorganism in which the decomposition activity of biphenyl or its derivative is improved by the promoter mutation of the enzyme gene involved in the decomposition of biphenyl.
When used for PCB degradation, the microorganism is at least
From PCB, non-toxic benzoic acid and 2-hydroxyl-
BphA, BphB, BphC, involved in the decomposition to 6-oxo-6-phenylhexa-2,4-dienoic acid,
BphD enzyme gene, bphA, bphB, bph
Those in which the expression of C, bphD genes is enhanced, and
/ Or it is preferable that these genes are constitutively expressed. Here, the constitutive expression of biphenyl degrading enzyme means that the biphenyl degrading enzyme is expressed and / or is not subjected to catabolite repression even in the absence of biphenyl, and is also decomposed in the presence of another carbon source. It means that the expression of the enzyme remains high.

The promoter mutation includes substitution, deletion, insertion, and / or addition mutation introduction of the promoter region, and these methods are well known to those skilled in the art. Above all, it is preferable to use a method of homologous recombination as a method for specifically mutating the biphenyl-degrading enzyme promoter of the biphenyl-degrading microorganism.

It has been confirmed that the gene expression system of Escherichia coli functions in these microorganisms. Therefore, the expression level of the degrading enzyme can be increased by substituting the wild-type promoter of the degrading microorganism by the method of homologous recombination for the well-known promoter generally used in the gene recombination technique of the known promoter in E. coli. It can be increased and / or constitutively expressed.
The E. coli promoter that can be used in the present invention is not particularly limited, but E. coli promoters that have been functionally analyzed and are easily available include T7 promoter, T3 promoter, phoA promoter,
tet promoter, lac promoter, trp promoter, SP6 promoter, p10 promoter,
Examples thereof include CAG promoter, CMV promoter, PGK promoter and pol II promoter.

Alternatively, instead of replacing the promoter of Escherichia coli, a promoter sequence in which a binding site for a negative regulatory factor is deleted from a wild-type gene is artificially synthesized, and a homologous recombination technique is used to generate a genome sequence using this sequence. It is also possible to replace the promoter.

Homologous recombination is obtained by introducing a linear DNA into a microorganism and selecting a transformed microorganism. As a method for transforming a degrading microorganism and causing homologous recombination, a transformation method generally used for each microorganism, for example, calcium treatment using calcium chloride, transfection by the calcium phosphate method, electroporation, or lipofection is used. (Sambrook et al., Molecular Biology: A
Laboratory Manual, Cold Spring Harbor Press, Cold
Spring Harbor, New York 1989 etc.).

In the present invention, as a means for inserting a desired promoter upstream of the biphenyl degrading enzyme gene, bphE upstream (translation initiation site is +1) -12
A fragment having a sequence of 84 to -400 (SEQ ID NO: 7) or a partial fragment thereof, an integrated marker gene, a restriction enzyme site, and upstream of bphE (translation initiation site is +1)
DNA for promoter replacement containing a fragment having a sequence of -242 to +3 (SEQ ID NO: 8) or a partial fragment thereof
Fragments are also provided. By inserting a desired promoter in the forward direction at the restriction enzyme site of this promoter-replacement DNA fragment, the DNA fragment is introduced into a PCB-degrading bacterium, and a transformant strain is selected using the expression of the marker gene as an index.
It is possible to obtain a strain in which the promoter upstream of bphE is replaced with a desired promoter and the degradation activity of biphenyl and its derivatives is improved.

[0024]

Example In this example, a Pseudomonas sp. Strain KKS102 and a Pseudomonas strain KKS102 strain into which a nalidixic acid resistance gene was introduced were introduced into a PCB-degrading microorganism Pseudomonas sp.
Both strains of 3 strains were used. As a template for gene manipulation, a PCB degrading gene group extracted from Pseudomonas bacterium strain KKS103 was used. A DNA separation kit (Dneasy ™ Tissue System) manufactured by Qiagen was used for extraction, and DNA was extracted according to the attached procedure manual.
The PCB gene group starts from the bphE gene and is about 11
Expression of bphE to bphA4 forming a kb cluster is performed by the pE promoter existing upstream of bphA (FIG. 2).

A point to be noted in expressing the PCB degrading enzyme is that the stronger the promoter is, the better it is, and the strength that provides the maximum degrading efficiency exists. Therefore, we made the following four types of promoters and examined the resulting resolution.

The prepared promoters are tac promoter (SEQ ID NO: 1), rrnB promoter (SEQ ID NO: 2, rrnB are seven ribosomal RNs in E. coli).
One of the A operons) pEcoli promoter (SEQ ID NO: 3) prepared based on the consensus sequence of Escherichia coli, and a binding site for a negative regulatory factor of the pE promoter (promoter of PCB gene group of Pseudomonas strain KKS103 strain) Is a core promoter (pEcore promoter) not containing (SEQ ID NO: 4). These promoters have EcoRI and X at the ends.
It was prepared using synthetic DNA so that it had bal cohesive ends. The sequences of these promoters are shown in FIG. Figure 3
In, pE0 represents the wild-type promoter sequence (SEQ ID NO: 5). In FIG. 3, underlined parts indicate −35 box (GTGTTT) and −10 box (TATAAT).

Next, in order to measure the strength of the prepared promoter, a plasmid having the lacZ gene inserted downstream of each promoter was prepared using pKLZ-A. pKLA-Z is a kanamycin resistance gene derived from transposon Tn5, a lacZ gene derived from plasmid pMC1403, and a multicloning site (EcoRI, Sm).
aI, BamHI). Various promoter regions were inserted into the multi-cloning site, and the Pseudomonas bacterium strain KKS103 was transformed with t
KLZ301 in which a plasmid expressing lacZ was introduced from the ac promoter (SEQ ID NO: 1), KLZ401 in which a plasmid expressing lacZ was introduced from the rrnB promoter (SEQ ID NO: 2), and lacZ was expressed from the pEcoli promoter (SEQ ID NO: 3) KLZ952-04 into which the plasmid was introduced, and pE
KLZ201, pE ₀ into which a plasmid expressing lacZ was introduced from the core promoter (SEQ ID NO: 4)
KLZ12 into which a plasmid expressing lacZ was introduced from the promoter was obtained. For these strains,
The β-galactosidase activity was measured and the promoter activity was evaluated.

On the other hand, in order to easily optimize the degradation efficiency, in order to construct a system in which various promoters can be easily integrated upstream of the biphenyl-degrading gene group, the key master plasmid ( pKH96
6) was produced. pKH966 is pKTY320 :: T
It is a plasmid prepared from n5 and has the following features (see FIG. 4 (1)). pKTY320 :: Tn5 is a paper
Nagata, Y., R. Imai, A.Sakai, M. Fukuda, K. Yano,
and M. Takagi. 1993, Isolation and characterizatio
n of Tn5-induced mutants of Pseudomonas paucimobil
is UT26 defectivein gamma-hexachlorocyclohexane de
hydrochlorinase (LinA). Biosci Biotechnol Biochem.
57 (5): 703-9.

It has a kanamycin resistance gene derived from transposon Tn5 as an integrated marker gene. The orientation is the opposite of the bphE gene when integration is performed. As this marker gene, another antibiotic resistance gene generally used as a marker gene can be used if necessary.

It has a multi-cloning site consisting of EcoRI, SpeI, EcoT221 and XbaI cleavage sites. To derive plasmids having various promoters from the master plasmid, a promoter sequence is ligated to this site so that transcription is carried out in the bphE direction. It has a transcription terminator between and. By eliminating the read-through of transcription from the upstream, it is possible to more strictly evaluate the incorporated promoter. The transcription terminator is a typical stem-loop (CGCGG
(CCGC and GCGGCCGCG form a stem, ATGCAA forms a loop)
And a sequence having a sequence of consecutive Ts (CGCG
GCCGCATGCAAGCGGCCGCGTTTTTTT, SEQ ID NO: 6) was prepared using synthetic DNA.

As a DNA fragment for integration, bphE
Upstream (translation start point is +1) -1284 to -4
It has a sequence of 00 (SEQ ID NO: 7). As a DNA fragment for integration, it has a sequence from -242 to +3 (SEQ ID NO: 8) upstream of bphE (translation initiation site is +1). The above DNA sequences are, in the order distant from bphE when integrated, the sequence of bphE upstream (translation initiation site is +1) -1284 to -400 (SEQ ID NO: 7),
The kanamycin resistance gene, the transcription terminator, the multi-cloning site, and the bphE upstream (with the translation start point as +1) are arranged so as to be the sequence from -242 to +3 (SEQ ID NO: 8).

This plasmid pKH966 was prepared by the following method using the bphE promoter region (-1284 to
-400 and -242 to +3), a Tn5-derived kanamycin resistance gene, a synthetic transcription terminator, and a multiple cloning site were incorporated into pHSG399 to prepare pKH966.

First, the promoter region of bphE (-1
284 to -400) was amplified by PCR (fragment 1). Here, PCR is performed at 94 ° C. for 5 minutes, and then 94
A cycle of 15 ° C. for 15 seconds, 60 ° C. for 30 seconds, and 74 ° C. for 30 seconds was repeated 30 times, and then treatment at 74 ° C. for 10 minutes was performed (hereinafter, PCR was performed under the same conditions).
As the enzyme, KOD polymerase (TOYOBO) was used. The primer used for amplification of fragment 1 was TTCAAG
CTTGTCGAGCACGGCGCCCATG (promA2, SEQ ID NO: 9)
And CCGGGCTGACACATTGATGC (promB, SEQ ID NO: 10).

Next, the kanamycin resistance gene derived from Tn5 was amplified by PCR (fragment 2). The primer sequences used at this time were GGGCGAAGAACTCCAGCATG (KmB: SEQ ID NO: 11) and CCCAGTCTAGACGTTGTAAAACG (KmD, SEQ ID NO: 12). Xb for KmD (SEQ ID NO: 12)
The aI (TCTAGA) site is incorporated.

Then, the promoter region of bphE (-
242 to +3) was amplified by PCR (fragment 3).
The primer sequence at this time is GGCTCTAGACGCTTCGGTGCTC
ATCCATG (promC, SEQ ID NO: 13) and CGGGGATCCAT
TCGAGATTTCTCC (promD2, SEQ ID NO: 14) was used.

The linkage of fragments 1, 2 and 3 is as described by Nikawa, J.
and Kawabata, M .: PCR- and ligation-mediated synt
hesis of marker cassettes with long flanking homol
ogyregions for gene disruption in Saccharomyces ce
Nucleic Acids Res. 26 (1998) 860-1. The method described in revisiae. By using this method, it is possible to easily obtain only those in which the two fragments are linked in the proper orientation.

First, fragments 1 and 2 were ligated with each other by ligase,
Using the bound DNA fragment as a template, the primer promA2
PC using (SEQ ID NO: 9) and KmD (SEQ ID NO: 12)
Amplified by R. In the amplified DNA fragment (referred to as fragment 4), the promoter region (-1284 to -40
0) and the kanamycin resistance gene were arranged as shown in FIG.

Next, fragments 2 and 3 were ligated with ligase, and the ligated fragment was used as a template for primer KmB (SEQ ID NO: 1
Amplified by PCR using 1) and promD2 (SEQ ID NO: 14). As a result, a fragment in which the kanamycin resistance gene and the promoter region (−242 to +3) were arranged as shown in FIG. 4 was amplified (referred to as fragment 5).

The fragments 4 and 5 thus obtained were mixed, and the mixture was kept at 96 ° C. for 10 minutes and then cooled to 40 ° C. over 30 minutes to anneal the fragments 4 and 5 to DN.
The DNA fragment was extended by the action of A polymerase.
After extension, promA2 (SEQ ID NO: 9) and promD2
Using (SEQ ID NO: 14) as a primer
CR amplification was performed to obtain a fragment in which fragments 1, 2, and 3 were ligated (designated as fragment 6). In the fragment 6, the promoter region (-1284 to -400), the kanamycin resistance gene, and the promoter region (-242 to +3) are arranged as shown in FIG.

This fragment 6 was incorporated into the plasmid pHSG399 at an appropriate site. That is, after digestion with BglII, which is slightly upstream of ATG of the kanamycin resistance gene, and XbaI in the cloning site, a synthetic terminator K
A promoter for m and a promoter cloning site (EcoRI, SpeI, EcoT221, XbaI) were incorporated to obtain a plasmid pKH966.

FIG. 4 (2) shows a plasmid in which the above promoter is inserted into the EcoRI and XbaI sites of the master plasmid pK966.

Then, the HindIII and BamHI sites of the vector were used to cut at the HindIII and BamHI sites to obtain bphE.
Upstream (translation start point is +1) -1284 to -4
A fragment containing the sequence 00, the kanamycin resistance gene, the transcription terminator, the cloned promoter, and the sequence bphE upstream (with the translation start site as +1) -242 to +3 was obtained.

In order to cause homologous recombination in Pseudomonas strain KKS103 strain, the integrative plasmid was cleaved with restriction enzymes HindIII and BamHI, and the obtained linear linear DNA containing the promoter region was electrocloned. The Pseudomonas bacterium strain KKS103 was transformed using the poration method. Specifically, first, the strain was cultured in an appropriate medium to OD ₆₅₀ = 0.5 to collect the bacterial cells. This was suspended in 1 ml of autoclaved water (0 ° C.) and transferred to an Eppendorf tube. After further washing with 1.5 ml of water (0 ° C.) five times or more, about 40 μl of the bacterial cell suspension was mixed with the DNA solution (cooled). This solution was transferred to a chilled electroporation cuvette (having a distance between the electrodes of 0.1 cm). In this state, electroporation was performed at 200Ω, 25μF,
It was performed under the condition of 1.8 kV.

Immediately thereafter, 500 μl of SOC medium was added, and after incubation for an appropriate time, the medium was plated with an appropriate antibiotic.

Since linear DNA is used in this method,
Only those that undergo homologous recombination upstream and downstream of the promoter region are expected to become kanamycin resistant. Therefore, as shown in FIG. 4 (3), the selected strains have the original promoter region (bp
The hE upstream (region from translation start point to +1) from -1284 to +30 is replaced with the above-mentioned artificially produced promoter region.

(Result) The strength of the introduced promoter was set to 1
When the acZ was evaluated as a reporter, the tac promoter showed the strongest activity (about 9 times that of the pE ₀ promoter). The rrnB promoter is the second strongest (p
E ₀ about 5.6 times of the promoter), in turn about 4.3 times the pEcore promoter (pE ₀ promoter), pE
coli promoter (about 1.6 of pE ₀ promoter)
Fold) (Fig. 5).

The promoter prepared by homologous recombination was incorporated into Pseudomonas strain KKS103 strain,
Recombinant KH968 strain (tac promoter), KH
967 strain (rmB promoter), KH952-04 strain (pEcoli), and KH981 strain (pEcor).
e) was obtained. The PCB degrading activity of each strain was evaluated using the BphD activity as an index (FIG. 6).
BphD activity assay was performed using HOP prepared as follows.
Performed using DA.

(Purification of HOPDA) Since HOPDA is not commercially available, commercially available 2,3-DHBP is used as B.
A system was established in which E. coli expressing phC was converted to HOPDA and then purified. First, Escherichia coli was transformed with pUC119 + bphC, which is a plasmid carrying bphC, and was cultured in LB medium containing ampicillin.
When D ₆₆₀ reaches about 1, IPTG is added to a final concentration of 1 mM, and the mixture is further cultured for 3 hours. Then collect the bacteria,
Wash once with 50 mM potassium phosphate buffer (pH 7.4). Resuspend in the same buffer again, divide this suspension in two, and add 2,3-DHBP to one. Let stand for 30 minutes with vigorous stirring. The supernatant is taken by centrifugation, and in order to react unreacted 2,3-DHBP, the remaining suspension which has been divided in two is added, and the mixture is left for 30 minutes while stirring. Then, it is centrifuged to obtain a supernatant. A sodium hydroxide solution is added thereto to adjust the pH to 12 or more, and ethyl acetate is added. At this pH, HOPDA remains in the aqueous phase. After removing the ethyl acetate phase, hydrochloric acid is added to the aqueous phase to adjust the pH to 2 or less.
Here again ethyl acetate is added. HOP at this pH
Since DA moves to the ethyl acetate phase, the ethyl acetate phase is taken out and the ethyl acetate is volatilized under reduced pressure. The obtained solid matter was subjected to HPLC buffer (HPLC buffer: 40% acetonitrile, 0.1% trifluoroacetic acid, 59.9%).
Dissolve in water, reverse phase column (GL Science ODS)
-2 column). The maximum absorption wavelength of 342 nm under the acidic condition of HOPDA is continuously measured.
Flow at a flow rate of 1 ml / min and collect the fractions that elute after approximately 8.5 minutes. This fraction has a yellow color under alkaline conditions. The obtained fraction is extracted with ethyl acetate, and then ethyl acetate is volatilized under reduced pressure to obtain HOPDA. HOPD
Storage of A is performed at -80 ° C. The concentration of HOPDA was calculated using a molar extinction coefficient of 19800.

(Assay for BphD activity) In order to measure BphD activity, first, cells were washed once with a sample buffer (50 mM potassium phosphate buffer (pH 8.0) containing 10% glycerin) and added to 1 ml of the same buffer. Resuspended. The cells are disrupted by ultrasonic waves, centrifuged at 15,000 rpm for 10 minutes,
The supernatant (crude extract) was assayed for BphD activity.
For BphD activity assay, HOPDA a substrate for BphD diluted in sample buffer to OD _{43 4} is 1.5 to 0.5. HODPA was prepared as follows according to the method described in Otsubo et al., Gene 256 (2000) p.223-228. Was added a crude extract in advance to HOPDA solution warmed to 30 ° C., and measuring the decrease in OD _{43 4} 3 minutes, the rate of decrease of OD ₄₃₄ which is proportional to the time Bp
It was used for hD activity calculation. 1 U of BphD activity was defined as the activity required to convert 1 nmol of 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoic acid in 1 minute. To calculate the activity, 2-hydroxy-6-oxo-6-phenylhexa-2,4-
For dienoic acid, molar extinction coefficient 19
800 was used. The protein amount of the crude extract was measured using a protein assay kit (Bio-Rad, Heercules, Calif.).

As a result, the KH981 strain (pEcore promoter) showed the strongest activity. The activity of the KH981 strain was 3.6 times that of the original strain Pseudomonas strain KKS103. KH952-04 strain (pEcol
i promoter) is a Pseudomonas bacterium KKS103
It was found to have 1.8 times the activity of the strain. KH
968 strain (tac promoter) and KH967 strain (rr
nB promoter), Pseudomonas sp. KKS
It was found that the degradation activity was lower than that of the 103 strain. It is considered that in these two strains, the transcription of the PCB gene group was excessively performed, so that the activity was rather decreased. This result indicates that in order to breed bacteria with good decomposition efficiency, it is essential to investigate the effects of various promoter sequences of various strengths and optimize them, rather than simply using strong promoters. Specifically, the promoter strength of the mutant (substitution) promoter evaluated using lacZ as an index is preferably higher than that of the wild type and about 5 times or less. K that meets this requirement
The H981 strain and the KH952-04 strain are PCB-decomposing bacteria preferably used in the present invention. In general, the degree of expression induced by the presence of biphenyl (KKS10
It is considered that the amplification degree is preferably such that about 3 times is performed constitutively in 3 strains).

(Biphenyl decomposition test) Next, KH981
Strain, KH952-04 strain, and KKS103 strain
The nyl decomposition activity was measured by the following method. First,
Each strain is grown in nutrient medium, harvested and buffered.
Suspended in OD ₆₅₀Was adjusted to 1.0. 1 ml of bacterial liquid
Dispense into a test tube with a cap and add biphenyl to it.
Added Take 3 bottles at regular intervals, 1 ml of hexa
Was added to extract the biphenyl. Biphenyl is GCM
It quantified by S and the decomposition rate was calculated | required.

The obtained results are shown in FIG. As a result, K
In the H952-04 strain (pEcoli) and the KH981 strain (pEcore), 4-fold higher degradation activity (processing time 30 minutes) was observed as compared to the original strain Pseudomonas strain KKS103.

(PCB decomposition test) Next, KH952-04
The PCB degrading activity of the strain and the KKS103 strain was measured by the following method. First, each strain was grown in a nutrient medium for 1 day, collected by centrifugation and suspended in a phosphate buffer to adjust OD ₆₅₀ to 1.0. Dispense 2 ml of the bacterial solution into test tubes with caps (3 test tubes for each strain), and add PCB (2,6-dichlorobiphenyl, 2,3,6-) to the test tubes.
A mixed solution of trichlorobiphenyl and 2,5,4′-trichlorobiphenyl) was added to the test tube, and the mixture was incubated at 30 ° C. for 24 hours. The PCB concentration was adjusted to 2.5 uM for each isomer. After the incubation was completed, 1 ml of hexane was added to the test tube and the mixture was stirred for 1 minute with a vortex mixer. After centrifuging at 3,500 rpm for 10 minutes, the hexane layer was collected and analyzed by GCMS. The amount of residual PCB was calculated and compared between each strain. The results are shown in Table 1.

[0054]

[Table 1]

As shown in Table 1, it was confirmed that the Pseudomonas bacterium strain KH952-04 had higher decomposition efficiency in all isomers than the original strain, Pseudomonas strain KKS103.

As described above, a process of producing a series of strains having an increased expression level by incorporating promoters of various strengths upstream of the PCB gene group by using homologous recombination, and selecting a strain having the optimum strength It was shown that PCB / biphenyl highly degrading bacteria can be obtained through

Pseudomonas bacteria KH952-
The 04 shares have been deposited by the applicant at the Patent Organism Depositary Center, National Institute of Advanced Industrial Science and Technology on August 28, 2001, and the deposit number is FERM P-18484.
Is.

[0058]

EFFECT OF THE INVENTION The microorganism of the present invention is a microorganism in which the promoter region of the biphenyl-degrading enzyme gene on the genome is mutated to improve the degrading activity of biphenyl or its derivative. Since the microorganism of the present invention is mutated in the wild-type gene expression control mechanism, it is not affected by nutrient sources other than the target substance, such as reduced expression of degrading enzymes. Further, since the degrading enzyme is highly expressed regardless of the target substrate concentration, the degrading enzyme expression level corresponding to the decrease in the substrate concentration does not decrease, and it can be expected that more complete degradation can be achieved. Therefore, by using such a microorganism, biphenyl or a derivative thereof can be decomposed with high efficiency, and particularly, persistent environmental pollutants such as PCB and dibenzofuran can be decomposed with high efficiency, which is useful. Is. In the present invention, by using homologous recombination, it is possible to reliably make a mutation specifically in a regulatory protein gene on the genome. The phenomenon of homologous recombination is a phenomenon that is common to many microorganisms, and this method can be applied without the presence of a microorganism-specific plasmid. The DNA fragment required for homologous recombination is relatively short, and it is not necessary to handle a large group of genes involved in degradation.

The promoter replacement DNA of the present invention contains a fragment having SEQ ID NO: 7 or a partial fragment thereof, an integrated marker gene, a restriction enzyme cleavage site, and a fragment having SEQ ID NO: 8 or a partial fragment thereof. , It is possible to insert any cloned plasmid into the restriction enzyme cleavage site, select a homologous recombinant strain using the expression of the marker gene as an index, and insert a desired promoter upstream of the biphenyl degrading enzyme gene. it can.

[0060]

[Sequence list] SEQUENCE LISTING <110> Railway Technical Research Institute <120> Degradation Method for Biphenyls or their Derivatives and Microorg anism therefor <140> J90766A1 <160> 8 <210> 1 <211> 90 <212> DNA <213> Artificial Sequence <400> 1 gaattcggat ccaatattct gaaatgactg ttgacaatta atcatcggct cgtataatgt gtggaattgt gtcgacagat ctggtctaga 90 <210> 2 <211> 92 <212> DNA <213> Artificial Sequence <400> 2 gaattcggat ccaaaatttt ttttcaaaag tacttgtcag gccggaataa ctccctataa tgcgccacca ctgtcgacag atctggtcta ga 92 <210> 3 <211> 67 <212> DNA <213> Artificial Sequence <400> 3 gaattcggct cgaaaatttt ttttcaaaac tagttgacaa aaaattatga tgcatatata atctaga 67 <210> 4 <211> 97 <212> DNA <213> Artificial Sequence <400> 4 gaattcggat ccgagtgaag tgagtgaaac atagggtttt cacgagtgtt taaaaattat ggcatgcata taatctagtc gacagatctg gtctaga 97 <210> 5 <211> 177 <212> DNA <213> Artificial Sequence <400> 5 gaattcggat ccgagtgaag tgagtgaaac atagggtttt cacgagtgtt taaaaattat ggcatgcata taatctattt tatataaaaa taacgttatt taaaatcaat ggcaacaata tgttcaaaaa aagattgttc gcgcaggggc aatcatggtc gacagatctg gtctaga 177 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <400> 6 cgcggccgca tgcaagcggc cgcgtttttt t 31 <210> 7 <211> 885 <212> DNA <213> Artificial Sequence <400> 7 gtcgagcacg gcgcccatgg gactgttctt gtccatcgcg cggcgcttgc ccggacgcat ggccacatgc cagttggcat cgatgccttg gacttcttcg cgcttggtca cgccctggta gccggcgtca gcgaacacat ccgtttcttc gccatggacc aacgcactgg cctgtgtcac gtcgttgacg ttggctgctg taccgaccac ggtgtgcacc agtcccgagt cagcgtccac gccgatgtgc gctttcatgc cgaaatgcca ctggttgccc ttcttggtct ggtgcatctc gggatcacgc ttgccatcct ggttcttggt cgaactgggc gcagcaatca aggtggcgtc caccaccgtg ccttgtctga gcatcaagcc tttgtcggcc agggtggcgt tgaccacggc cagcatctgc ggggccaact ggtgttcttc gagcaggtgg cgaaagcgca ggatgctgac ccggtcaggg atgcgctcgg cgctggagag tcccgcgaac tcgcggtaca gcgtggtctc gaacagggct tcttccatgg ccaggtcact caggccgaac cactgttgca agaaatgaat gcgcaacatc gtcaccagct caaacggcgg gcgtccggtc ttggcgcgag gtacatgcgg cgcaatcaac gacagcaact ccgtccacgg caccaccagg ttcatctcgt cgaggaacac ggttttgcga gtacgccgcg tgctcaggtt caggccgagg tcttgttggg tcatgacgcc attgttcgtg tcgtaactcg ctcacgccat ccgggcttga ccggagtttt gaacaccatc cctaacgcgg tcgtcgttga gaggtgcatc aatgtgtcag cccgg 885 <210> 8 <211> 245 <212> DNA <213> Artificial Sequence <400> 8 cgcttcggtg ctcatccatg caatcacttg gcggtgttcg gcaacagtcc cttttccctg atgcggtcgt gcgcaacgac cgcatcagta tctggggaca caagtttttg ggtgcctgca tgagcgatca gccaagcagg ggccaggctg accttcgctt gcacacgcat atgcatgcga tcacaaccga cgggcagtgc gcacggaaat cgcagaaacc atgaaccaag gagaaatctc gaatg 245 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <400> 9 ttcaagcttg tcgagcacgg cgcccatg 28 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 ccgggctgac acattgatgc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 gggcgaagaa ctccagcatg 20 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <400> 12 cccagtctag acgttgtaaa acg 23 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <400> 13 ggctctagac gcttcggtgc tcatccatg 29 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <400> 14 cggggatcca ttcgagattt ctcc 24

[Brief description of drawings]

FIG. 1 is a diagram showing a degradation pathway of biphenyl in microorganisms and enzymes involved in the degradation pathway.

FIG. 2 Pseudomonas bacteria KKS102 and KK
It is a figure which shows the structure of the cluster of the biphenyl degradation gene group of S103 strain.

FIG. 3 is a diagram showing the sequence of the prepared promoter in the examples.

FIG. 4 is a schematic diagram illustrating replacement of a promoter in an example.

FIG. 5 shows the strength of the promoter used in the examples.
It is a graph which shows LacZ activity as an index.

FIG. 6: From the promoter used in the examples,
It is a graph which shows the intensity | strength of expression of a biphenyl degrading enzyme using BphD activity as an index.

FIG. 7 is a graph showing PCB degradation using the promoter mutant strain obtained in the example.

   ─────────────────────────────────────────────────── ─── Continued front page    (72) Inventor Yuji Nagata             Kawauchi, Aoba Ward, Sendai City, Miyagi Prefecture             Home 7-201 (72) Inventor Yoshiyuki Otsubo             2-22-8 Kodai, Miyamae-ku, Kawasaki-shi, Kanagawa (72) Inventor Derawari Mina             3-19-5 Fuchinobehonmachi, Sagamihara City, Kanagawa Prefecture F-term (reference) 4B024 AA03 DA09 FA02                 4B065 AA26Y AA41X AB01 BA01                       CA56

Claims (9)

[Claims] 1. A method for degrading biphenyl or a derivative thereof using a microorganism capable of degrading biphenyl or a derivative thereof, wherein the microorganism is biphenyl or its derivative due to a promoter mutation of an enzyme gene involved in the degradation of biphenyl on the genome. A method characterized by being a microorganism having an improved decomposition activity of a derivative. 2. The method according to claim 1, wherein the biphenyl derivative is polychlorinated biphenyl. 3. The method according to claim 1 or 2, wherein the promoter mutation is replaced with an Escherichia coli promoter by homologous recombination. 4. The method according to claim 1 or 2, wherein the promoter mutation is a deletion of a binding site for a negative regulatory factor by homologous recombination. 5. A microorganism capable of degrading biphenyl, wherein the microorganism has improved degradation activity of biphenyl or a derivative thereof due to a promoter mutation of an enzyme gene involved in the degradation of biphenyl. 6. The microorganism according to claim 5, wherein the promoter mutation is substitution with an Escherichia coli promoter. 7. The microorganism according to claim 5, wherein the promoter mutation is a deletion of a binding site for a negative regulatory factor. 8. A fragment having the sequence of SEQ ID NO: 7 or a partial fragment thereof, an incorporated marker gene, a restriction enzyme site,
And a DNA fragment for replacing a promoter, which comprises a fragment having the sequence of SEQ ID NO: 8 or a partial fragment thereof. 9. A Pseudomonas bacterium KH952-04 having a degradability of biphenyl or a derivative thereof.