JP2003088271A - Nonhuman animal having higher-order brain functional disorder and method for producing the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a nonhuman animal having a higher-order brain functional disorder, deficient in a TAG-1 gene and suitably used for clarifying pathophysiological phenomena in the brain nervous system and diseases thereof, and to provide a method for producing the same. SOLUTION: This nonhuman animal having the higher-order brain functional disorder is deficient in a function of the TAG-1 gene on a chromosome. The nonhuman animal is produced as follows: the TAG-1 gene is isolated by screening genomic DNA libraries of the nonhuman animal; a transgene is built by using a homogeneous recombination vector the translation initiation region of which is substituted with a medicament selecting marker gene; the built transgene is introduced into an embryonic stem (ES) cell of the nonhuman animal by an electroporation technique; the ES cell in which the homogeneous recombination is caused by the medicament is selected by polymerase chain reaction and Southern blot techniques; a fertilized egg and the homogeneous recombination-caused ES cell are together mixed by an aggregation chimera technique so as to obtain a chimeric nonhuman animal; and such a reproductive chimeric nonhuman animal that the ES cell in a chimeric nonhuman animal individual is differentiated and formed into a reproductive cell is obtained.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a model animal useful in each research field of basic medicine and clinical medicine, and in particular, it is suitable for elucidating pathophysiology and diseases in the cranial nervous system.
The present invention relates to a non-human animal in which the function of AG-1 gene is deficient on the chromosome and causes a higher-order functional disorder in the brain, and a method for producing the same.

[0002]

BACKGROUND OF THE INVENTION Cell adhesion molecules in the nervous system, especially TA
Expression of the immunoglobulin superfamily represented by G-1 plays an important role in the processes of brain development and differentiation. Here, TAG-1 is a nerve recognition molecule belonging to the immunoglobulin gene (Ig) superfamily.

The TAG-1 structure is a C2 class 6 in the external domain.
Three Ig-like domains and four fibronectin types III
Is composed of repeats and is bound to the plasma membrane by a glycosylphosphatidylinositol lipid anchor
(Furley, AJ, Morton, SB, Manalo, D., Karagogeos, D., D
odd, J., and Jessell, TMCell 61,157-170 (1990)). Axonin-1 glycoprotein is a chicken homologue of TAG-1
(Giger, RJ, Bogt, L., Zuellig, RA, Rader, C., Henehan-
Beatty, A., Wolfer, DP, and Sonderegger, P.Eur.J.Bioc
hem.227,617-628 (1995)). TAG-1 has 95% homology between human and rat homologues at the amino acid sequence level. Furthermore, 75% homology exists between rat TAG-1 and chicken taxonin-1 (Kozolov, SV, Gig).
er, RJ, Hasler, T., Korvatska, E., Schorderet, DF, and
Sonderegger, P. Genomics 30, 141-148 (1995), Zuellig, R.
A., Rader, C., Schroeder, A., Kalousek, MB, von Bohlen
und Halbach, F., Osterwalder, T., Inan, C., Stoeckli, E.
T., Affolter, HU, Fritz, A., Hafen, E., and Sondereger,
P. Eur. J. Biochem. 204, 453-463 (1992)). TAG-1 is contactin (also called F3 or F11), BIG-1, BIG-2, NB-
It is a member of the contactin subgroup including 2 and NB-3 (Ogawa, J., Kaneko, H., Masuda, T., Nagata, S., Hosoy
a, H., and Watanabe, K.Neurosci.Lett.218,173-176 (199
6)). Each of these molecules exhibits a prominent spatiotemporal expression pattern (Yoshihara, Y., Kawasaki, M., Tamada,
A., Nagata, S., Kagamiyama, H., and Mori, KJ Neurobiol.
28, 51-69 (1995)).

In addition to homophilic interactions, TAG-1 is a member of the Ig superfamily Ng-CAM / L1 and Nr-.
Heterophilic interactions with several extracellular matrix molecules such as CAM, neural tissue-specific chondroitin sulfate proteoglycans, and tenascin-C and -R. Through these interactions, TAG-1 is believed to play a functionally important role in interactions between early stages of axonal growth and developing neurons. These heterophilic interactions may cause TAG-1 to induce cell-to-cell signaling or affect cell-to-cell signaling (Felsenfeld, DP, Hyne, MA, S.
koler, KM, Furley, AJ, and Jessel, TMNeuron12,675
-690 (1994), Milev, P., Maurel, P., Haring, M., Margolis,
RK, and Margolis, RUJViol.Chem.271,157216-15723
3 (1996), Malhotra, JD, Tsiotra, P., Karagogeos, D., and
Hortsch, MJ Biol. Chem. 273, 33354-33359 (1998)).

There are several reports suggesting that TAG-1 plays a role in establishing specific axonal connections in the developing central nervous system (CNS). In particular, TAG-1 immunoreactivity has a cerebellar molecular layer,
High levels have been detected at the cross-projection sites of the corpus callosum, hippocampal commissure and spinal cord (Wolfer, DP, Henehan-Beatty, A., Sto
eckl, ET, Sonderegger, P., and Lipp, HPJComp.Neuro
l.345,1-32 (1994), Wolfer, DP, Giger, RJ, Stagliar,
M., Sonderegger, P., andLipp, HPAnat.Enbryol.197,177
-185 (1998)).

Regarding TAG-1, such notable features are as follows. First, TAG-1
Is a molecule that is specifically expressed in the nervous system and is considered to be involved in the guidance of nerve axons. Second, although it is an adhesion molecule that originally forms a homophilic bond, it is presumed that it interacts with various molecules regarding the elongation of nerve fibers. Third, it binds to extracellular matrix molecule tenascin and functions as a growth cone inhibitory receptor. Fourth, by utilizing the property that TAG-1 itself does not have an intracellular domain and is bound to the cell membrane by a GPI anchor, it plays a delicate regulation in gene expression by skillfully using different pathways in signal transduction. It is possible.

However, although TAG-1 has been reported to bind to other adhesion molecules, extracellular matrix molecules, growth factors, etc., its signal transduction function has not been clarified yet. The previously obtained research results on the function of TAG-1 are analysis at the culture cell level, and there are many unclear points regarding the physiological function at the solid level. TAG-1 is particularly strongly expressed in cerebral cortex, dentate granule cells of hippocampus and nerve fibers in CA1 region during the embryonic period, and has an expression pattern that decreases with age after birth, and particularly in hippocampus. Since it is related to developmental maturation of nerves, a close relationship with memory and learning has been suggested.

[0008]

Therefore, the present inventors
As a result of extensive studies to advance the more detailed research on the function of the TAG-1 gene, it was found that a non-human animal deficient in the TAG-1 gene can be prepared as a model animal, and the pathophysiology of the cranial nervous system using the same. Moreover, they have found that it is possible to elucidate the disease, and arrived at the present invention. Therefore, a first object of the present invention is to provide a non-human animal deficient in the TAG-1 gene, which can be used for elucidation of pathophysiology and diseases in the cranial nervous system. A second object of the present invention is to provide a method for producing a non-human animal lacking the TAG-1 gene.

[0009]

[Means for Solving the Problems] The above-mentioned objects of the present invention include a non-human animal having a higher brain dysfunction characterized by a deficient TAG-1 gene function on a chromosome, and
The non-human animal genomic DNA library was screened to isolate the TAG-1 gene, and the transgene was constructed using a homologous recombination vector in which the translation initiation region was replaced with a drug selection marker gene. Were introduced into non-human animal embryonic stem cells (ES cells) by electroporation, ES cells that had undergone homologous recombination with a drug were selected by PCR and Southern blotting, and then fertilized eggs of non-human animals were selected. ES that has undergone homologous recombination
The TAG-1 gene function is characterized in that a chimeric non-human animal is obtained by mixing cells by an assembly chimera method, and a reproductive chimeric non-human animal in which ES cells are differentiated into germ cells in a chimeric non-human animal solid is obtained. This has been achieved by a method for producing a non-human animal having a higher brain dysfunction characterized by a deletion on the chromosome.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, the non-human animal in which the TAG-1 gene function is deficient on the chromosome is TAG-1.
A non-human animal in which the endogenous gene of a non-human animal that encodes is inactivated by a substitution defect and loses the function of expressing TAG-1. As a non-human animal, rodents such as mouse and rat Can be specifically mentioned,
It is not limited to these. For example, TAG-1
When producing a knockout mouse, first screen the genomic DNA library of the mouse and
Isolate the -1 gene. A transgene was constructed using a homologous recombination vector in which the translation initiation region was replaced with a drug selection marker gene, and the mouse embryonic stem cell (E
S cells). Next, ES cells that have undergone homologous recombination with a drug are selected by the PCR method and Southern blot, and mouse fertilized eggs and ES cells that have undergone homologous recombination are mixed by the assembly chimera method to obtain chimeric mice. Finally, a TAG-1 gene knockout mouse is produced from a germ chimeric mouse in which ES cells have differentiated into germ cells in a solid.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited thereto.
Example. Genomic DNA containing exons II to VI of the TAG-1 gene
Clone the gene DNA library of 129 / SvJ mouse
(Stratagene, La Jolla, Calif.) Was isolated by screening with a rat 5 ′ cDNA probe and partially sequenced prior to constructing the targeting vector. 5 kb DN of TAG-1 gene between HincII site of exon II and EcoRI site of exon V
The targeting vector was designed to replace the A fragment with the neomycin resistance gene (Neo) cassette.

Diphtheria venom A under the control of the MCI promoter
A fragment gene (DT) cassette was ligated at the 3'end of the vector for negative selection (Yagi, T., Nada, S., Wata.
nabe, N., Tamemoto, H., Kohmura, N., Ikawa, Y., and Aizaw
a, S. Anal. Biochem. 214, 77-86 (1993)) (Fig. 1A). This targeting vector DNA linearized with Sacll (50 μ
g) was transferred to RI embryonic stem (ES) cells by electroporation (500 μF, 250V; Jane Pulsar; Bio-Rad Laboratories, Calif.). The cells were selected by the residual method in the presence of G418 (250 μg / l; GIBCO BRL, Gaithersburg, MD), and the resistant colonies were screened using a nested PC.
Performed using R.

Outer primer (P1: 5'-ATGGTGCTCTAAGAC
GGACAGACT-3 '; Antisense, P2: 5'-CGTTCCACAGGCAG
GAGCTGTGGA-3 ') for the first round PCR (Polymerase Cha
inReaction: Polymerase chain reaction)
Inner primer (P3: 5'-TTGGGAAGACAATAGCAGGCATGC-
3 ', antisense, P4: 5'-CTCTATGGCTTCTGAGGCGGAAA
G-3 ') was used for the second round PCR (Fig. 1
A).

Chimeric mice were produced from target ES clones using the agglutination method first described by Nagy et al.
agy, A., Rossant, J., Nagy, R., Abramow-Newerly, W., and R
oder, JCProc.Natl.Acad.Sci.USA90,8424-8428 (199
3)). The contribution of ES cells to the germline of chimeric mice
This was confirmed by breeding in 57BL / 6 mice and screening the agouti offspring. Germline inheritance was confirmed by Southern blotting of tail DNA, and mouse heterozygotes for the mutation were mated with homozygotes,
Mice were maintained under specific pathogen-free conditions at the Laboratory Animal Research Facility, Institute of Medical Science, University of Tokyo. All experiments were performed according to the ethical standards of the Institute for animal experiments and the safety standards for genetic manipulation in Japan.

Southern and Western Blot Analysis Genomic DNA was extracted from mouse tails and cut with ScaI for Southern blot analysis. After agarose gel electrophoresis, the separated DNA was transferred to a nylon membrane and the intron I (0.
Hybridization was carried out using a probe corresponding to the 5 kb Scal-EcoRI fragment (Fig. 1A). Southern blot hybridization analysis was performed by standard methods. For Western blot analysis, SDS (sodium dodecyl sulfate) polyacrylamide gel electrophoresis is performed by the method of Laemmli (Laemmli, UKNature227,680-685 (1970)),
Detection was performed by ECL as described in the manufacturer's (Amersham Pharmacia Japan) manual.

Preparation of rabbit anti-TAG-1 antibody A cDNA fragment encoding rat TAG-1 Ig domain I-II (amino acids: 31-143) was amplified by PCR using the following primers: 5'-TCATATGCAGGGAACCCCAGCTACC.
TTTGG-3 'and 5'-TGAGGAGCCAGCGGTAGGACAAACC-3'.
Details are described by Kasahara et al. (Kasahara, K., Wat
anabe, K., Takeuchi, K., Kabeko, H., Oohira, A., Yamamoto,
T., and Sanai, YJBiol.Chem.275,34701-34709 (200
0)). Rabbit antiserum against the mouse TAG-1 peptide corresponding to the carboxyl terminus of amino acid positions 723-933 of rat TAG-1 was also PCR primers (5'-TTCATA
TGCAGACTGCCCGGGTGCCTGGCGCT-3 'and 5'-ATGGATCCCT
TAAGGCTGAGACTGGAGCT-3 ') as well as pET-15b expression vector (Novagen, Madison, WI).

Immunohistochemical analysis The cerebrum and TAG-1 spinal cord of postnatal day 2 (P2) and fetal day 15 (E15) knockout mice were examined histologically. Some sections were stained with 0.5% cresyl violet by the Nissl method, while others were immunohistochemically stained. The following antibodies were used for immunohistochemical staining: [1] Rabbit antiserum against neurofilament (1: 5000) (Fukuda, T., Kawano, H., Ohyama, K., Li, H.
P., Takeda, Y., Oohira, A., and Kawamura, KJComp.Neuro
l.382,141-152 (1997)) and rabbit antisera against [2] calbindin D-28k (1: 5000; Swant antibody, Bellinzona, Switzerland). Using a suitable peroxidase-conjugated secondary antibody to visualize the bound antibody, in 50 mM Tris buffer (pH 7.4) containing 0.01% diaminobenzidine tetrahydrochloride and 0.01% hydrogen peroxide. And incubated at 37 ° C for 5 to 15 minutes.

Autoradiography of the adenosine A1 receptor
Examination by E. Decapitate and kill the mouse (P34-38) and quickly remove the brain-
Frozen in isopentane cooled to 45 ° C. Cryostat coronal sections (10 μm thick) were cut at −20 ° C. and thawed onto chrome gelatin coated glass slides. Using adenosine A1 receptor as a radioactive substrate,
Visualization was performed using [3H] cyclopentyl-1,3-dipropylxanthine (DPCPX), which is an antagonist showing a selective high affinity for the A1 adenosine receptor (Lohse, MJ, Klotz, K.
N., Lindenborn-Fotinos, J., Reddington, M., Schwabe, U.,
and Olsson, RANaunyn-Schmiedeberg's Arch.Pharmaco
l.336,204-210 (1987)).

Results Production of TAG-1 Mutant Mouse Targeting vector DNA was introduced into ES cells, and the transductants were subjected to positive (Neo) and negative (DT) selection. Isolated from surviving colonies
The DNA was used for screening for the desired homologous recombinants. A total of 624 dual-resistant colonies were selected and screened by the PCR method (see Materials and Methods section). The occurrence of homologous recombination was evaluated by Southern blot analysis. For the wild-type gene and the mutant gene, the predicted sizes of the ScaI-digested fragments are 5.2 kb and 8 kb, respectively (FIG. 1A). Southern blot analysis confirmed that four clones did carry the exact target TAG-1 allele.

Mice obtained from recombinant ES cells were tested to examine TAG-1 variants by Southern blotting (FIG. 1B). Western blot analysis of brain tissue revealed TAG-
It was confirmed that the 130Kd TAG-1 band was completely absent in 1 (-/-) mice (Fig. 1C). This observation was substantiated by two antisera produced on both N- and C-terminal peptides as described in the "Materials and Methods" section. The TAG-1 gene was deleted in exons II and V encoding the amino acid sequence from the translation initiation site to the first Ig-like domain in mutant mice. However, antisera directed against the III-like regions of the second and third fibronectin types showed no band in Western blot analysis. This is TA
It shows that the G-1 protein is not produced in TAG-1 (-/-) mice. Two lineages of germline hereditary mice were obtained, produced from mutants separately derived from the R1 ES cell clone, and used in the following experiments.

General appearance of mutant mice The genetic traits of offspring produced by TAG-1 (+/-) crosses are approximately 25.
% Was (-/-) mutant, 50% was (+/-) mutant, and 25% was (+ / +) wild type. These results correspond to Mendel's ratio,
It has been shown that homozygotes are not associated with intrauterine or near-natal mortality. Roughly speaking, mutant mice did not differ from wild-type mice in food and water intake, body weight and size and did not show any signs of ataxia.

Histological analysis of CNS Brain and spinal cord development of TAG-1 (+ / +) mice (left panel of FIGS. 2 and 3) and brain and spinal cord development of TAG-1 (-/-) mice. (Panels on the right side of Figures 2 and 3) were examined at P2 and E15. Nistle staining at P2 showed that TAG-1 (+ / +) mice
The size and structure of the CNS between the TAG-1 (-/-) mouse is the hippocampus
(FIGS. 2A-F), cerebellum (FIGS. 3A-D) and spinal cord (FIGS. 3E and 3F).
Were similar in. Cortical neurons that strongly express TAG-1 during development (Kawano, H., Fukuda, T., Kubo, K., Hor
ie, M., Uyemura, K., Osumi, N., Eto, K., and Kawamura, KJ
Comp.Neurol.408,147-160 (1999)) and cerebellar granule cells (Wol
fer, DP, Heneban-Beatty, A., Stoeckl, ET, Sonderegge
Neurons such as r, P., and Lipp, HPJ Comp. Neurol. 345, 1-32 (1994)) were also present in the brain of TAG-1 (-/-) mice. Certain hippocampal neurons (FIGS. 2E and 2F) and cerebellum (FIGS. 3C and 3D) were immunoreactive with calbindin.

[0023] Immunohistochemical analysis using anti-neurofilamentary antibody revealed the appearance of axonal pathways in the brain including TAG-1 positive axons such as optic nerve crossing, lateral olfactory tract, corpus callosum and hippocampal commissure. No significant differences were seen (Figures 2C and 2D). Inhibition of the function of axonin-1 (the TAG-1 homologue of avian) has been reported to cause an abnormal trajectory in commissural axons of fetal chickens (Stoeckli, ET, and L
andmesser, LTNeuron 14,1165-1179 (1995)), the appearance of neurofilament-positive crossover fibers in the ventral midline of the spinal cord was the same between wild type and TAG-1 deficient mice (Figures E and 3F). . Immunostaining with anti-TAG-1 antibody decreased TAG-1 immunoreactivity in wild-type mice compared to prenatal in P2, but TAG-1 (-/-) mice at P2 and E15. No TAG-1-positive neurons were detected in the axon tract of human brain (Wolfer, DP, Heneban-Beatty, A., Stoeckl, ET, So.
nderegger, P., and Lipp, HPJComp.Neurol.345,1-32 (1
994)).

Increased A1 adenosine receptors and neuronal excitability
In addition, the behavior of most TAG-1-deficient mice was normal, but some mice also showed sudden epileptic seizures. Therefore, we decided to test the concentration of adenosine receptors in the brain. The autoradiographic distribution of [3H] DPCPX binding sites in the brain of TAG-1 (+ / +) mice is shown in Figure 4A. TAG-1
The highest concentration of binding sites in (+ / +) mice was found to be the dentate gyrus molecular layer, the antral region, the polymorphic layer of Ammon's angle and the molecular layer, and the hippocampus. In the brain of TAG-1 (-/-) mice, the concentration of [3H] DPCPX binding site was increased by 40% in the entire hippocampal region compared to TAG-1 (+ / +) mice (Figs. 4B and 4).
C). No statistically significant differences were observed in other areas of the brain. In contrast, the concentrations of dopamine D1 and D2 receptors evaluated using [3H] SCH23390 (0.5nM) and [3H] spiperone (0.5nM), respectively, were TAG-1 (-/-) and (+/-).
+) Was substantially the same.

In order to evaluate the substantial degree of nerve excitability in mutant mice, the mice (P34 to 38) were intraperitoneally treated with a convulsion drug (pentylenetetrazole (PTZ) and kainic acid) only once. did. Doses that did not cause convulsions in TAG-1 (+ / +) mice (30 mg of PTZ
52% TAG-1 when evaluated by Student's t test
(-/-) Mice caused clonic-tonic seizures (Fig.
4D). On the other hand, mice injected with kainic acid (20 mg / kg) crossed their forelimbs in the early stage and separated their hindlimbs to spread and crouch, body tremors, occasional limb convulsive movements and striking postures. TAG-1 characteristic changes in behavior
Most animals in both (+ / +) and TAG-1 (-/-) groups showed.

Frequent muscle clonic spasms, confined to the head, face and one or two forelimbs, develop into a general clonic-tonic seizure involving the entire body. TAG-1
In (+ / +) mice, seizures subsided 2 hours post injection and appeared to be physically resolved 24 hours later. However, in TAG-1 (-/-) mice, the time to systemic seizure was significantly shorter than in TAG-1 (+ / +) mice (Table 1).
In -1 (-/-) mice, the convulsive state often persists for several hours while standing up on the hind legs, falling to one side, or blowing bubbles from the mouth. The mortality rate from convulsions caused by kainic acid is
Greater than 75% in TAG-1 (-/-) mice and less than 10% in TAG-1 (+ / +) mice within 24 hours after drug administration.

[0027]

[Table 1] (Time to cause generalized convulsion by kainic acid in TAG-1 (+ / +) and (-/-) mice) (Footnote) TAG-1 (-/-) mice have extremely short time to induce generalized convulsions with kainic acid (20 mg / kg) compared to TAG (+ / +) mice. Values are mean ± standard error. The numbers in parentheses show experimental values. A single asterisk indicates p <0.01 (Student's t-test).

Discussion TAG-1 is highly expressed in the cerebellum, spinal cord and hippocampus of newborn mice. In this study, we investigated its role by disabling the expression of the TAG-1 gene. The following findings were obtained by analysis of TAG-1-deficient mice. First, TAG-1 is commonly expressed in the deep outer granular layer of postnatal cerebellar granule cells. TAG-1 shows a complementary expression pattern to calbindin, a useful cell-specific marker for Purkinje cells in the developing cerebellar cortex (Wolfer, DP, Heneban-Beatt.
y, A., Stoeckl, ET, Sonderegger, P., and Lipp, HPJCo
mp.Neurol.345,1-32 (1994), Stottmann, RW, and Riva
S., RJJ Comp. Neurol 395, 121-135 (1998)). Purkinje cell dendrites form synapses with parallel fibers of granule cells. However, when the cerebellum was analyzed histologically in TAG-1-deficient mice (P2 and E15 time points), both the granular cell layer and the Purkinje cell layer were normal in thickness and concentration. These findings are truly amazing, given that contactin-deficient mice, a member of a subgroup of the Ig superfamily, show dramatic changes in both granulocyte axons and Purkinje cells (Berglund, E. et al.
O., Murai, KK, Fredette, B., Sekerkova, G., Marturano,
B., Weber, L., Mugnaini, E., and Ranscht, B.Neuron24,739
-750 (1999)).

TAG-1 and contactin are highly expressed in axons of cerebellar granule cells during the first week after birth. It has been previously suggested that these molecules are important for neurite outgrowth and nerve fasciculation and / or deconcentration during cerebellar development (Brummendorf, T., and Rathjen, F. Curr. O.
pin.Neurobiol. 6,584-592 (1996)). Furthermore, the inhibitory effect of contantine on the neurite outgrowth of cerebellar neurons is completely blocked by the addition of TAG-1, but Butiglione et al. (Buttiglione, M., Revest, JM, P
avlou, O., Karagogeos, D., Furley, A., Rougon, G., and Fai
vre-Sarrailh, CJ Neurosci. 18, 6853-6870 (1998)). Nevertheless, in our study TAG-
The absence of apparent changes in the cerebellum of 1 (-/-) mice strongly suggests that there is a mechanism to compensate for the TAG-1 gene deficiency.

Second, TAG-1 promotes neurite outgrowth of commissural neurons in the spinal cord and dorsal root ganglion neurons (Wol
fer, DP, Heneban-Beatty, A., Stoeckl, ET, Sonderegge
r, P., and Lipp, HPJ Comp. Neurol. 345, 1-32 (1994)).
After the commissural axon passes through the floor plate, the orbit of the commissural axon changes rapidly, and the commissural axon begins to form fiber bundles and express L1. Floor plate cells secrete diffusible elements that cause the growth of commissural axons from the dorsal horn toward the floor plate. Immunohistochemical analysis with anti-neurofilament antibody revealed that no significant changes in spinal commissural axon pathways occurred in mutant mice (FIGS. 3E and 3F).

Third, although no overt phenotype was observed in the hippocampus of TAG-1 (-/-) mice, some epileptic seizures were observed in TAG-1 (-/-) mice. From what I showed, [3H] DPCPX
Was used to examine adenosine A1 autoradiography of adult mice (P34-38). Adenosine is an adenosine receptor named A1, A2, and A3 (Fredholm, B.
B., Abbracchio, MP, Burnstock, G., Dubyak, GR, Harde
n, TK, Jacobson, KA, Schwabe, U., and Williams, M.Tre
nds.Pharmacol.Sci.18, 79-82 (1997)) is a purine nucleoside that has many effects on the CNS.

The A1 adenosine receptor is expressed at a high level in the hippocampus, and it is conventionally assumed that it plays an important role in the hippocampus. It has been confirmed by the examination of autoradiography using a radioactive substrate that Al adenosine receptors of the dentate gyrus are mainly present on axons. Adenosine analogs block experimentally induced epileptic seizures in animals, but adenosine may act as an endogenous anticonvulsant drug in humans (During, MJ, and Spenc
er, DDAnn. Neurol. 32, 618-624 (1992)). Here TAG-
A significant increase in hippocampal A1 adenosine receptors in 1 (-/-) mice and in TAG-1 (-/-) mice against PTZ and kainic acid in the absence of histological abnormalities in the hippocampus We report an increased susceptibility to epileptic seizures (ie epileptic seizure severity and higher mortality) (E15, P2 and P34).

Considering these results together, the increase in adenosine A1 receptor is due to the post-synaptic compensation mechanism for the decrease in adenosine A1 receptor function, and the neuroexcitability (ie, more than PTZ and kainic acid). The lower threshold) is due to the reduced function of adenosine caused by TAG-1 deficiency during brain development. In this regard, the TAG-1 (-/-) mouse represents a valuable model animal for elucidating the likely mechanism of epileptic seizures.

The basic mechanism underlying the relationship between adenosine transmission and TAG-1 function has not yet been elucidated.
Interestingly, injection of 5,7-dihydroxytryptamine into the raphe nucleus suppressed serotonin synthesis,
It has been reported that highly polysialylated neural cell adhesion molecules are reduced, and conversely, the immunoreactivity of tenascin-C in brain regions is increased (Brezun, JM, and Daszuta, A.
J. Neurosci. Res. 55, 54-70 (1999)). In addition, tenascin
-C mutant mice show an abnormal response to dopamine agonists, suggesting that tenascin signals in the dopamine transduction system (Fukamauchi, F., Wang, YJ, Mataga,
N., and Kusakabe, M. Eur. J. Pharmacol. 338, 7-10 (199
7)). These findings suggest that Ig superfamily adhesion molecules in the CNS and extracellular substrates may regulate brain neurotransmission. In this respect, mice lacking Ig superfamily molecules are considered to be a powerful tool for elucidating the neurotransmission mechanism.

Epilepsy is an extremely frequent disease that accounts for 0.3 to 0.5% of the general population, but the causes and seizure symptoms underlying epilepsy are diverse, and its biochemical pathology is seizure preparation. There is a difference in the state, the state of transition to seizure, the state during seizure, the state after seizure, etc., and the present state is not yet understood. According to WHO, "epilepsy is a chronic disease mainly composed of recurrent and spontaneous seizures (epileptic seizures), and the pathological mechanism of excessive firing of cerebral nerve cells constitutes the essence of the disease. There is no. " As described here, epilepsy is a chronic cerebral disease that repeats seizures resulting from excessive discharge of cerebral nerve cells, and it is clear that there is a high prevalence in the family, and at least part of it Inheritance is involved.

[0036] Pathological biochemical studies directly targeting the brain of epilepsy patients have large ethical constraints. Conventional studies on epilepsy use a kindling animal modeled on partial seizures of epilepsy and secondary generalized seizures. The main research was However, the pathophysiology of these animal epilepsy models was essentially different from the major seizures-type epilepsy in humans. The TAG-1 knockout mouse produced by the present inventors has a lower convulsion threshold than the wild-type mouse, and causes spontaneous spontaneous seizures. In addition, since the pathological condition is inherited by the offspring with a genetic background of TAG-1 gene deficiency, it closely resembles the onset mechanism of epilepsy in humans.

Furthermore, the present inventors confirmed that the pathological condition of adenosine receptor abnormality in the hippocampus, which had been conventionally pointed out in the imaging of the brain of epilepsy patients, is just expressed in the brain of TAG-1 knockout mice. did. The TAG-1 knockout mouse makes a great contribution to elucidation of the mechanism of epilepsy in humans, establishment of a new therapeutic method, and prevention of disease onset.

Further, since it has been reported that the adenosine receptors of the central nervous system are strongly involved in symptoms such as anxiety and pain, when attention is paid to the abnormality of adenosine receptors in the brain of TAG-1 knockout mice, It is strongly suggested that the anxiety attack in panic syndrome or the characteristic symptom of "increased pain threshold" in senile dementia and depression is closely related to these socially interesting diseases. Can be expected.

[0039]

INDUSTRIAL APPLICABILITY By using the TAG-1 knockout mouse of the present invention, TAG- which has been unknown until now.
One function can be traced at a solid level to obtain useful information throughout the development, development, growth and aging of a solid. In addition, it is possible to analyze higher-order nerve functions such as emotion, behavior, memory, and learning by making the most of the characteristics of individuals. Furthermore T
From the analysis of convulsive seizures exhibited by AG-1 knockout mice, it can be expected to elucidate the mechanism of epilepsy and develop a more effective therapeutic method for diseases.

[ Sequence Listing ] SEQUENCE LISTING <110> JAPAN SCIENCE AND TECHNOLOGY CORPORATION <120> Animals other than human being <160> 8 <210> 1 <211> 24 <212> DNA <213> Rodent <400> 1 ATGGTGCTCTAAGACGGACAG ACT 1 5 10 15 20 <210> 2 <211> 24 <212> DNA <213> Rodent <400> 2 CGTTCCACAGGCAGGAGCTGT GGA 1 5 10 15 20 <210> 3 <211> 24 <212> DNA <213> Rodent <400> 3 TTGGGAAGACAATAGCAGGCA TGC 1 5 10 15 20 <210> 4 <211> 24 <212> DNA <213> Rodent <400> 4 CTCTATGGCTTCTGAGGCGGA AAG 1 5 10 15 20 <210> 5 <211> 30 <212> DNA <213> Rodent <400> 5 TCATATGCAGGGAACCCCAGC TACCTTTGG 1 5 10 15 20 25 30 <210> 6 <211> 25 <212> DNA <213> Rodent <400> 6 TGAGGAGCCAGCGGTAGGACA AACC 1 5 10 15 20 25 <210> 7 <211> 32 <212> DNA <213> Rodent <400> 7 TTCATATGCAGACTGCCCGGG TGCCTGGCGCT 1 5 10 15 20 25 30 <210> 8 <211> 29 <212> DNA <213> Rodent <400> 8 ATGGATCCCTTAAGGCTGAGA CTGGAGCT 1 5 10 15 20 25

[Brief description of drawings]

FIG. 1 (A) is a schematic diagram of the strategy used for the target TAG-1 gene for inactivation of the TAG-1 gene by homologous recombination. Figure (B) shows the DNA of the tail of litters from interbreeding.
Genome Southern blot analysis diagram. (C) The figure shows a Western blot analysis of the TAG-1 protein. (A) The black box in the figure represents the exon of the TAG-1 gene. The translation initiation codon ATG is contained in exon II. TAG
A part of the -1 gene (exons II to V) was replaced with the neomycin resistance gene (Neo). The diphtheria venom A fragment gene (DT) fragment was ligated at the 3'end of the vector for negative selection. Neo and DT were inserted in the opposite orientation to the TAG-1 gene. Blue scripts (blue letters) KS (+) in the targeting vector are indicated by hatched bars. The 5.2 kb and 8 kb DNA fragments obtained by ScaI digestion of wild-type DNA and mutant gene DNA are indicated by arrows, respectively. Arrowheads are nested PCR primers (P
1, P2, P3 and P4) positions are shown. The shaded boxes are probes for Southern blot analysis (A, Apa I; E, Eco RI;
H, Hinc II; S, Sca I). B 0.6 kb Scal-E shown in Fig. 1A (bottom)
The coRI fragment was used as a probe for hybridization. This probe hybridized to the 5.2 kb and 8 kb fragments of the wild type and mutant genes, respectively. Wild type (+ / +), heterozygous (+/-) and cognate (-/-) genes are shown. In Figure C, the brain extract is T
Prepared from AG-1 (+ / +), (+/-) and (-/-) mice. Two extracts from each genotype were used for SDS PAGE.
130 Kd using rabbit antiserum as described in the text
TAG-1 protein was detected in (+ / +) and (+/-). T
Band intensity from AG-1 (+/-) mice was almost half that from wild-type mice. In contrast, no band could be detected at 130 Kd in TAG-1 (-/-) mice.

Figure 2. Histological analysis of TAG-1 (+ / +) and (-/-) mice. TAG-1 (+ / +) (left side of panel) and (-/-) on P2
(Panel right) Coronal section of hippocampus from mouse. Stain with the Nissl method (A and B), and then add the neurofilament (C
And D) and calbindin (E and F). The hippocampus of TAG-1 (-/-) mice appears to develop normally. Anatomical regions were abbreviated as follows: CC, cerebral cortex; CO, corpus callosum; H, hippocampus; DG, dentate gyrus; HB, bridle. Scale bar = 200 μm.

[Figure 3] TAG-1 (+ / +) in P2 (left side of panel) and
(-/-) (Right panel) Coronal sections of cerebellum (A-D) and lumbar spinal cord (E and F) from mice. It was stained with the Nissl method (A and B) and further immunostained with calbindin (C and D) and neurofilament (E and F). The arrow indicates the crossed fibers of the spinal cord that have been magnified at high magnification. Anatomical regions were abbreviated as follows: EGL, outer granule cell layer; PCL, Purkinje cell layer; CN, cerebellar nucleus. Scale bar in A to D = 100μ
m; scale bar in E and F = 50 μm.

FIG. 4: Representative autoradiograms of [3H] DPCPX bound to the hippocampus of brains of (A) TAG-1 (+ / +) and (B) TAG-1 (-/-) mice. (C) Percentage of mice with epileptic seizures due to autoradiogram densitometry and (D) 30 mg / kg PTZ. The data in (C) was calibrated by internal fine scale. Statistical differences between (+ / +) (n = 25) and (-/-) (n = 20) were clarified using Student's t-test, and values were averaged ± standard error (** p < It was expressed as 0.01).

   ─────────────────────────────────────────────────── ─── Continued front page    (72) Inventor Yoichiro Iwakura             1-30-14-1605 Ebisu, Shibuya-ku, Tokyo F term (reference) 4B024 AA01 CA01 DA02 GA25 HA20

Claims (4)

[Claims] 1. A non-human animal having higher cerebral dysfunction, which is characterized in that the TAG-1 gene function is deleted on the chromosome. 2. The non-human animal having higher brain dysfunction according to claim 1, characterized in that the non-human animal is a rodent. 3. The non-human animal having a higher brain disorder according to claim 2, wherein the rodent is a mouse. 4. A non-human animal genomic DNA library is screened to isolate the TAG-1 gene, and then a transgene is constructed using a homologous recombination vector in which the translation initiation region is replaced with a drug selection marker gene, After introducing the obtained transgene into embryonic stem cells (ES cells) of a non-human animal by electroporation, ES cells that have undergone homologous recombination with a drug are selected by the PCR method and Southern blot, and then the non-human Fertilized eggs of animals and ES cells that have undergone homologous recombination are mixed by an assembly chimera method to obtain a chimeric non-human animal, and a reproductive chimeric non-human animal in which ES cells are differentiated into germ cells in a chimeric non-human animal solid is obtained. A method for producing a non-human animal having a higher brain dysfunction, which is characterized in that the TAG-1 gene function is deleted on the chromosome.