JP2003063993A - Pharmaceutical composition - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an agent for preventing and treating pains, or an agent for inhibiting activation of osteoclast or (and) an agent for inhibiting formation of osteoclast. SOLUTION: The agent for preventing and treating pains, or the agent for inhibiting activation of osteoclast or (and) the agent for inhibiting formation of osteoclast which contains a p38 MAP kinase inhibitor or (and) TNF-α production inhibitor.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a prophylactic / therapeutic agent for pain or an osteoclast activation inhibitor or formation inhibitor comprising a p38MAP kinase inhibitor or / and a TNF-α production inhibitor.

[0002]

2. Description of the Related Art TNF-α (tumor necrosis factor-α) and IL
-1 (interleukin-1) and other cytokines,
A biological substance produced by various cells such as monocytes or macrophages in response to infection or other cellular stress (Koj, A., Biochim. Bioph.
ys. Acta, 1317, 84-94 (199
6)). Although these cytokines play an important role in the immune response when present in appropriate amounts,
Excessive production is believed to be involved in many inflammatory diseases (Dinarello, CA, Curr.
Opin. Immunol. , 3,941-948 (1
991)). P38MAP kinase cloned as a homologue of MAP kinase is involved in the control of production of these cytokines and the signal transduction system coupled to the receptor, and inhibition of p38MAP kinase may be a therapeutic drug for inflammatory diseases. Yes (Stein,
B. Anderson, D .; , Annual Rep
ort in Medicinal Chemistr
y, Bristol, J .; A. (Edit), Academ
icPress, 31, 289-298, 1996.
Year). The imidazole derivative is described in JP-A-7-50317 (WO 93/14081) and the oxazole derivative is described in JP-A-9-505055 (WO95 / 13) as having an inhibitory action on p38 MAP kinase.
067). On the other hand, the following compounds are known as thiazole compounds. 1) Analgesia, antipyretic, anti-inflammatory, anti-ulcer, thromboxane A ₂
(TXA ₂ ) a formula having a synthase inhibitory action and a platelet aggregation inhibitory action

[Chemical 6] [In the formula, R ¹ is a cycloalkyl group, a cyclic amino group, an amino group which may have 1 or 2 lower alkyl, phenyl, acetyl or lower alkoxycarbonylacetyl as a substituent, a hydroxyl group, a carboxyl group as a substituent, or As an alkyl group which may have a lower alkoxycarbonyl or a substituent, carboxyl, 2-
Carboxyethenyl or a phenyl group which may have 2-carboxy-1-propenyl, R ² is a pyridyl group which may have a lower alkyl as a substituent,
R ³ represents a phenyl group which may have lower alkoxy, lower alkyl, hydroxyl, halogen or methylenedioxy as a substituent. ] A 1,3-thiazole derivative represented by the following or a salt thereof (JP-A-60-58981). 2) Formula with analgesic, antipyretic, anti-inflammatory, anti-ulcer, TXA ₂ synthase inhibition, platelet aggregation inhibitory action

[Chemical 7] [In the formula, R ¹ is an alkyl group which may have a substituent,
An alkenyl group, an aryl group, an aralkyl group, a cycloalkyl group, a heterocyclic group having a carbon bond as a bond, or an amino group,
R ² represents a pyridyl group which may be substituted with an alkyl group, and R ³ represents a phenyl group which may have a substituent. ] The 1,3-thiazole derivative or its salt represented by these (Japanese Unexamined Patent Publication No. 61-10580).

3) Analgesia, antipyretic, anti-inflammatory, anti-ulcer, TXA
₍₂₎ Formula that has a synthase inhibitory action and a platelet aggregation inhibitory action

[Chemical 8] [In the formula, R ¹ is an alkyl group which may have a substituent,
An alkenyl group, an aryl group, an aralkyl group, a cycloalkyl group, a heterocyclic group having a carbon bond as a bond, or an amino group,
R ² represents a pyridyl group which may be substituted with an alkyl group, and R ³ represents an aryl group which may have a substituent. ] The 1,3-thiazole derivative represented by these or its salt (USP 4,612,321). 4) Formula with gastric acid secretion inhibitory action

[Chemical 9] [Wherein, R ¹ is optionally substituted phenyl, and R ² is C
_1-6 alkyl or (CH ₂ ) _n Ar, n is 0 to 2, A
r is optionally substituted phenyl, R ³ is hydrogen or C
_1-4 alkyl, R ⁴ is hydrogen, C _1-4 alkyl, etc., R ⁵
_Represents hydrogen or C _1-4 alkyl, R ⁶ represents hydrogen, C _1-4 alkyl and the like. ] The compound or its salt represented by this (Tokukaihei 7-503023 gazette, WO93 / 15071). 5) Formulas that are anti-inflammatory and anti-allergic agents

[Chemical 10] [In the formula, R¹Is pyridyl, R²Is phenyl, R³as well as
R^FourIs hydrogen or methyl, R ^FiveIs methyl, R⁶Is hydrogen,
Indicates chill, etc. ] The compound or its salt represented by (DE-
A-3601411). 6) Having anti-inflammatory, antipyretic, analgesic and antiallergic effects
And then the formula

[Chemical 11] [In the formula, R ¹ is lower alkyl substituted with halogen, R ²
Represents pyridyl and the like, and R ³ represents phenyl and the like. ] The compound or its salt represented by these (JP-A-5-70446). 7) Selective production inhibitory action of TNF-α and / or IFN
-As having a γ production inhibitory action, the formula

[Chemical 12] [Wherein R is a lower alkyl group; a lower haloalkyl group; a lower hydroxyalkyl group; a lower alkoxy lower alkyl group; an aralkyloxy lower alkyl group or the like, and R ¹ is a cycloalkyl which may be substituted with a lower alkyl group or the like. And R ² represents an optionally substituted aryl group or the like. ] The thiazole compound represented by these, or its pharmaceutically acceptable salt (Unexamined-Japanese-Patent No. 11-49762). W
O00 / 64894 discloses a formula which may be N-oxidized.

[Chemical 13] [In the formula, R¹Is a hydrogen atom, or an optionally substituted charcoal
Hydrogenated group, optionally substituted heterocyclic group, substituent
An amino group or an acyl group which may have^TwoIs
An aromatic group which may have a substituent is represented by R³Is a hydrogen atom,
Having a pyridyl group which may have a substituent or a substituent
X is an oxygen atom or an acid.
An optionally converted sulfur atom, Y is a bond, an oxygen source
Child, optionally oxidized sulfur atom or formula NR^Four(formula
Medium, R ^FourIs a hydrogen atom or a hydrocarbon which may have a substituent
(Representing an elementary group or an acyl group), and Z is a group.
Divalent chain hydrocarbon that may have a joint or a substituent
Indicates a basic group. ] The compound or its salt represented by
38MAP kinase inhibitory action and TNF-α inhibitory action
However, p38MAP kinase-related diseases and TNF-α-related diseases
It has been described to be useful as a preventive / therapeutic agent for patients.
It In WO00 / 63204, the formula is

[Chemical 14] [Wherein a is N or C; b is CH when a is N,
when a is C, then O; = means that the azole ring is an imidazole ring
Or a single bond or double depending on whether it is an oxazole ring
A bond; Z is N or CH; W is -NR₆-Y- (R
₆Is a hydrogen atom, C_1-4Alkyl group, C_3-8Cycloa
Rukiru group, C_3-8Cycloalkyl-C_1-3Alkyl
Base, C_6-18Aryl group, C_3-18Heteroaryl
Base, C_7-19Aralkyl group or C_4-19Heteroa
Aralkyl group, -Y- is C_1-4Alkylene group or bond
Represents a joint), -O- or -S-_TwoIs phenyl
Groups (halogen atom, trifluoromethyl, cyano, amine
De, thioamide, carboxylate, thiocarboxylate
Red, C_1-4Alkoxy, C _1-4Alkyl, amino
And mono- or di-C_1-4Composed of alkylamino
Substituted with one or more substituents selected from the group
R)_ThreeIs hydrogen atom, halogen atom, C
_1-10Alkyl group, C_1-4Alkenyl group, C
_3-10Cycloalkyl group, C_3-18Heterocycloa
Rukiru group, C_{6- 18}Aryl group, C_3-18Heteroa
Reel group or -CH = N-NH-C (NH) NH
_Two(C each optionally substituted by hydroxy
_1-4Alkyl, halogen atom, substituted with halogen
C_1-4Alkyl, hydroxy, C_1-4Alkoxy,
C_1-4Alkylthio, carboxy, C_1-6Alkyl
Or C_{1 -6}C which may be substituted with alkoxy
Rubonyl, amino, mono- or di-C _1-4Alkyla
Mino and 5- to 7-membered N-heterocyclic groups (further hetero
Which may contain atoms)
Which may be substituted with 4 substituents), R₅Is
C_6-18Aryl group, C_3-18Heteroaryl group
Or C_3-12Cycloalkyl group (each C_1-4A
Rutile, halogen, C substituted with halogen_1-4Al
Kill, hydroxy, C_1-4Alkoxy, C_1-4Al
Kirthio, amino, mono- or di-C_1-4Alkyla
Mino and 5- to 7-membered N-heterocyclic groups (further hetero
Which may contain atoms)
It may be substituted with 4 substituents). ]
The compound represented by or a salt thereof is a p38 MAP kinase inhibitor.
Has a harmful effect and as a preventive and therapeutic agent for rheumatoid arthritis, etc.
It is described that it is for use. WO01 / 10865
No.

[Chemical 15] [In the formula, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. , R ² is a 4-pyridyl group having a substituent containing no aromatic group, and R 2
³ represents an aromatic group which may have a substituent. ] A 1,3-thiazole compound substituted at the 5-position with a 4-pyridyl group having a substituent not containing an aromatic group (provided that N- [4- (3,5-dimethylphenyl ) -5- (2-
Hydroxy-4-pyridyl) -1,3-thiazol-2-yl] acetamide and 4- [2- (acetylamino) -4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl acetate) or its salt or formula

[Chemical 16] [In the formula, R ^1a represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which has a substituent or an acyl group. , R ^2a represents a pyridyl group having a substituent containing no aromatic group at a position adjacent to the nitrogen atom of the pyridyl group, and R ^3a represents an aromatic group which may have a substituent. ] A 1,3-thiazole compound substituted with a pyridyl group having a substituent not containing an aromatic group at the 5-position next to the nitrogen atom of the pyridyl group (provided that N- [4 -(3,5-Dimethylphenyl) -5- (2-hydroxy-4-pyridyl) -1,3-thiazol-2-yl] acetamide and 4- [2- (acetylamino) -4- (3,5 -Dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridylacetate) or a salt thereof has excellent p38MAP kinase inhibitory action and TNF-α inhibitory action, and p38MAP kinase-related diseases and TNF- α
It is described to be useful as a preventive / therapeutic agent for related diseases.

[0004]

The present invention is based on p38MA.
It is an object of the present invention to provide a preventive / therapeutic agent for pain or an osteoclast activation inhibitory or inhibitory agent containing a P kinase inhibitor or / and a TNF-α production inhibitor.

[0005]

Means for Solving the Problems The inventors of the present invention have conducted extensive studies in view of the above problems, and as a result, have found that a p38MAP kinase inhibitor or (and) used as a prophylactic / therapeutic agent for diseases such as rheumatism and arthritis. It was also found that a TNF-α production inhibitor unexpectedly exerts excellent preventive and therapeutic effects on pain, suppresses osteoclast activation, and inhibits osteoclast formation. . The present inventors have completed the present invention as a result of further studies based on this finding.

That is, the present invention relates to [1] p38MAP
Prevention and / or treatment of pain or (and) inhibition of osteoclast activation or (and) formation inhibitor comprising a kinase inhibitor or (and) TNF-α production inhibitor, [2] p
38MAP Kinase Inhibitor or (and) TNF-α
Pain prevention according to item [1], which comprises a production inhibitor
[3] A therapeutic agent, [3] a p38MAP kinase inhibitor or (and) a TNF-α production inhibitor, and the osteoclast activation inhibitor or (and) formation inhibitor according to [1], [4] The p38 MAP kinase inhibitor or (and) TNF-α production inhibitor is a 1,3-thiazole compound substituted with a pyridyl group optionally having a 5-position, a salt thereof, or a prodrug thereof. The agent according to [1], [5] a p38MAP kinase inhibitor or (and) a TNF-α production inhibitor has the formula:

[Chemical 17] [In the formula, R ¹ represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. , R ² represents a pyridyl group which may have a substituent, and R ³ represents an aromatic group which may have a substituent. ] The compound of [1], which is a compound represented by the following formula or a salt thereof or a prodrug thereof, [6] p38 MAP kinase inhibitor or (and) TNF-α production inhibitor, is N-oxidized, Good expression

[Chemical 18] [In the formula, R ^1a represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. To R ^2a
Is an aromatic group which may have a substituent, R ^3a represents a hydrogen atom, a pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X ^a is an oxygen atom or an optionally oxidized sulfur atom, Y ^a is a bond, an oxygen atom, an optionally oxidized sulfur atom or a formula
NR ^4a (in the formula, R ^4a represents a hydrogen atom, an optionally substituted hydrocarbon group or an acyl group), and Z ^a has a bond or a substituent. It represents a divalent chain hydrocarbon group which may be present. ] The compound represented by the following formula or its salt, or the agent of [1] which is a prodrug thereof, [7] p38MAP kinase inhibitor or (and) TNF-α production inhibitor has the formula:

[Chemical 19] [Wherein a is N or C; b is CH when a is N,
when a is C, then O; = means that the azole ring is an imidazole ring
Or a single bond or double depending on whether it is an oxazole ring
Bond; Z_bIs N or CH; W_bIs -NR_6b-Y
_b-(R_6bIs a hydrogen atom, C_1-4Alkyl group, C_3-
8Cycloalkyl group, C_3-8Cycloalkyl-C
_1-3Alkyl group, C_{6-1 8}Aryl group, C_3-18
Heteroaryl group, C_7-19Aralkyl group or C
_4-19A heteroaralkyl group,_b-Is C_1-4A
A alkylene group or a bond), -O- or -S-
To R_2bIs a phenyl group (halogen atom, trifluoro
Methyl, cyano, amide, thioamide, carboxylate
G, thiocarboxylate, C_1-4Alkoxy, C
_1-4Alkyl, amino and mono- or di-C_1-4
1 or more selected from the group consisting of alkylamino
R which may be substituted with the above substituents)_3bIs hydrogen
Atom, halogen atom, C_1-10Alkyl group, C_2-4
Alkenyl group, C_3-10Cycloalkyl group, C
_3-18Heterocycloalkyl group, C_{6 -18}Aryl
Base, C_3-18Heteroaryl group or -CH = NN
H-C (NH) NH_Two(C above_1-10An alkyl group,
C_2-4Alkenyl group, C_{3-1 0}Cycloalkyl group,
C_3-18Heterocycloalkyl group, C_6-18Ally
Lu group, C_3-18A heteroaryl group or -CH = N-
NH-C (NH) NH_TwoAre each substituted with hydroxy
May be C_1-4Alkyl, halogen atom, ha
C substituted with a rogen_1-4Alkyl, hydroxy, C
_1-4Alkoxy, C_1-4Alkylthio, carboxy
Shi, C_1-6Alkyl or C_1-6Set with alkoxy
Optionally substituted carbonyl, amino, mono- or di-
-C_1-4Alkylamino and 5- to 7-membered N-hete
A ring group (which may also contain heteroatoms)
Substituted with 1 to 4 substituents selected from the group
R)_5bIs C_6-18Aryl group, C
_3-18Heteroaryl group or C_{3-1 Two}Cycloal
Kill group (each C_1-4Alkyl, halogen, halogen
C replaced by_1-4Alkyl, hydroxy, C
_1-4Alkoxy, C_1-4Alkylthio, amino, mo
No or di-C_1-4Alkylamino and 5 to 7
Member N-heterocyclic group (may further contain a hetero atom)
1) to 4 substituents selected from the group consisting of
May be replaced). ] A compound represented by
Or [1] which is a salt thereof or a prodrug thereof.
[8] p38 MAP kinase inhibitor or (and
And 5) the TNF-α production inhibitor contains an aromatic group at the 5-position.
1,3 substituted with 4-pyridyl group having no substituent
-Thiazole compound (IV) or a salt thereof or a salt thereof
The agent according to item [1], which is a rodrug,

[9] The 1, 3
-The thiazole compound is of the formula

[Chemical 20] [In the formula, R ^1c represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. , R ^2c represents a 4-pyridyl group having a substituent containing no aromatic group, and R ^3c represents an aromatic group which may have a substituent. [10] The agent according to [8], which is a compound represented by the formula or a salt thereof, [10] a p38MAP kinase inhibitor or (and) a TNF-α production inhibitor, wherein the 5-position does not contain an aromatic group. The agent according to item [1], which is a 1,3-thiazole compound (V) substituted with a pyridyl group having a group adjacent to the nitrogen atom of the pyridyl group or a salt thereof or a prodrug thereof, [11] The 1,3-thiazole compound has the formula

[Chemical 21] [In the formula, R^1dMay have a hydrogen atom or a substituent
Hydrocarbon group, optionally substituted heterocyclic group, substituted
An amino group or an acyl group which may have a group, R^2dIs
Substitute a substituent containing no aromatic group next to the nitrogen atom of the pyridyl group.
Pyridyl group at the position^3dHas a substituent
It represents an aromatic group which may be added. ] The compound represented by
Is a salt thereof, the agent of [10], [12] p38
MAP kinase inhibitor or (and) TNF-α production
Inhibitors have 4-position substituents that do not contain aromatic groups at the 5-position.
4-pyridyl having a position next to the nitrogen atom of the lysyl group
1,3-thiazole compound (VI) substituted with a group
Or [1] which is a salt thereof or a prodrug thereof.
[13] p38 MAP kinase inhibitor or (
And) the TNF-α production inhibitor is N- [5- (2-benzoyl)
Amino-4-pyridyl) -4- (3,5-dimethylphenyl) -1,3
-Thiazol-2-yl] acetamide, N- [5- (2-benzyl
Luamino-4-pyridyl) -4- (3,5-dimethylphenyl)-
1,3-thiazol-2-yl] acetamide, N- [4- [4- (4
-Methoxyphenyl) -2-methyl-1,3-thiazol-5-y
] -Pyridyl] benzamide, N- [4- [2- (4-full
Orophenyl) -4- (3-methylphenyl) -1,3-thiazo
L-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazo
L-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [4- (3-methylphenyl) -2-propyl-1,3-thiazo
-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [2-butyl-4- (3-methylphenyl) -1,3-thiazo
L-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [4- (3-methylphenyl) -2- (4-methylthiophene
Nyl) -1,3-thiazol-5-yl] -2-pyridyl] phenyl
Luacetamide, N- [4- [2-ethyl-4- (3-methylphene
Nyl) -1,3-thiazol-5-yl] -2-pyridyl] benz
Amide, N- [4- [2-ethyl-4- (3-methylphenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] -3-phenylpro
Pionamide, N- [4- [2-ethyl-4- (3-methylphenyl
L) -1,3-thiazol-5-yl] -2-pyridyl] -3- (4-me
Toxyphenyl) propionamide, N- [4- [2-ethyl
-4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] -4-phenylbutyramide, N- [4- [4- (3-
Methylphenyl) -2-propyl-1,3-thiazol-5-a
] -2-Pyridyl] benzamide, N- [4- [4- (3-Methyl
Luphenyl) -2-propyl-1,3-thiazol-5-yl] -2-
Pyridyl] -3-phenylpropionamide, N- [4- [2-
Butyl-4- (3-methylphenyl) -1,3-thiazol-5-y
] -2-pyridyl] benzamide, N- [4- [2-butyl-4-]
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pi
Lysyl] -3-phenylpropionamide, N- [4- [2- (4
-Fluorophenyl) -4- (3-methylphenyl) -1,3-thi
Azol-5-yl] -2-pyridyl] benzamide, N- [4-
[2- (4-fluorophenyl) -4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] -3-phenylp
Ropionamide, N- [4- [4- (3-methylphenyl) -2-
(4-Methylthiophenyl) -1,3-thiazol-5-yl] -2
-Pyridyl] benzamide, N- [4- [4- (3-methylphene
Nyl) -2- (4-methylthiophenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -3-phenylpropionamide, N
-Benzyl-N- [4- [2-ethyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] amine, N- [4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -N- (2-phenylethyl) ami
N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thio]
Azol-5-yl] -2-pyridyl] -N- (3-phenylpro
Pill) amine, N-benzyl-N- [4- [4- (3-methylphen
Nyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridy
L] amine, N- [4- [4- (3-methylphenyl) -2-pro]
Pyr-1,3-thiazol-5-yl] -2-pyridyl] -N- (2-fu
Phenylethyl) amine, N- [4- [4- (3-methylpheny
) -2-Propyl-1,3-thiazol-5-yl] -2-pyridy
] -N- (3-phenylpropyl) amine, N-benzyl-N-
[4- [2-butyl-4- (3-methylphenyl) -1,3-thiazo
L-5-yl] -2-pyridyl] amine, N- [4- [2-butyl-4]
-(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pi
Lysyl] -N- (2-phenylethyl) amine, N- [4- [2-
Butyl-4- (3-methylphenyl) -1,3-thiazol-5-y
] -2-pyridyl] -N- (3-phenylpropyl) amine,
N-benzyl-N- [4- [4- (3-methylphenyl) -2- (4-me
Tylthiophenyl) -1,3-thiazol-5-yl] -2-pyri
Zyl] amine, N- [4- [4- (3-methylphenyl) -2- (4
-Methylthiophenyl) -1,3-thiazol-5-yl] -2-pi
Lysyl] -N- (2-phenylethyl) amine, N- [4- [4-
(3-Methylphenyl) -2- (4-methylthiophenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] -N- (3-phenyl
Propyl) amine, N- [4- [4- (3-methylphenyl) -2
-(4-Methylsulfonylphenyl) -1,3-thiazole-5-
Il-2-pyridyl] benzamide, N- [4- [4- (3-me
Tylphenyl) -2- (4-methylsulfonylphenyl) -1,
3-thiazol-5-yl] -2-pyridyl] phenylacetoa
Mid, N- [4- [4- (3-methylphenyl) -2- (4-methyl
Sulfonylphenyl) -1,3-thiazol-5-yl] -2-pi
Lysyl] -3-phenylpropionamide, N-benzyl-N-
[4- [4- (3-methylphenyl) -2- (4-methylsulfoni
Luphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Amine, N- [4- [4- (3-methylphenyl) -2- (4-methyl)
L-sulfonylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] -N- (3-phenylpropyl) amine, N- [4-
[4- (3-methylphenyl) -2- (4-methylsulfonyl group
Phenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-
(2-phenylethyl) amine, N- (4-fluorobenzyl
) -N- [4- [4- (3-Methylphenyl) -2- (4-methyls)
Rufonylphenyl) -1,3-thiazol-5-yl] -2-pyri
Zil] amine, (S) -N- [4- (3-methylphenyl) -5-
(2- (1-phenylethylamino) -4-pyridyl) -1,3-thi
Azol-2-yl] nicotinamide, (R) -N- [4- (3-
Methylphenyl) -5- (2- (1-phenylethylamino)-
4-Pyridyl) -1,3-thiazol-2-yl] nicotinami
, (S) -N- [4- (3-methylphenyl) -5- (2- (1-
Phenylethylamino) -4-pyridyl) -1,3-thiazole-2
-Yl] -2-methylnicotinamide, (R) -N- [4- (3-me
Tylphenyl) -5- (2- (1-phenylethylamino) -4-
Pyridyl) -1,3-thiazol-2-yl] -2-methylnicoti
Namide, (S) -N- [4- (3-methylphenyl) -5- (2-
(1-Phenylethylamino) -4-pyridyl) -1,3-thiazo
-2-L] -2-chloronicotinamide, (R) -N- [4-
(3-Methylphenyl) -5- (2- (1-phenylethylamido
No) -4-Pyridyl) -1,3-thiazol-2-yl] -2-chloro
Nicotinamide, (S) -N- [4- (3-methylphenyl) -5
-(2- (1-Phenylethylamino) -4-pyridyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide,
(R) -N- [4- (3-methylphenyl) -5- (2- (1-phenyl
Ruethylamino) -4-pyridyl) -1,3-thiazol-2-i
L] -2-methoxynicotinamide, N- [5- (2-benzyl
Amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thi
Azol-2-yl] nicotinamide, N- [5- (2-benzyl
Lumino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide, N-
[5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl
1,3-Thiazol-2-yl] -2-chloronicotine
Amide, N- [5- (2-benzylamino-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazol-2-yl] -2-me
Tylnicotinamide, N- [5- (2-benzoylamino-4-
Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] nicotinamide, N- [5- (2-benzoylamino-
4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -2-methylnicotinamide, N- [5- (2-benzo
Ilamino-4-pyridyl) -4- (3-methylphenyl) -1,3
-Thiazol-2-yl] -2-chloronicotinamide, N- [5
-(2-benzoylamino-4-pyridyl) -4- (3-methylphenyl
1,3-thiazol-2-yl] -2-methoxynicoti
Namide, (S) -N- (1-phenylethyl) -4- [2-ethyl]
Lu-4- (3-methylphenyl) -1,3-thiazol-5-yl]-
2-pyridylamine, (R) -N- (1-phenylethyl) -4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridylamine, (S) -N- (1-phenylethyl
) -4- [4- (3-Methylphenyl) -2-propyl-1,3-thio
Azol-5-yl] -2-pyridylamine, (R) -N- (1-f
Phenylethyl) -4- [4- (3-methylphenyl) -2-propyi
L-1,3-thiazol-5-yl] -2-pyridylamine, (S)
-N- (1-phenylethyl) -4- [2-butyl-4- (3-methyl
Phenyl) -1,3-thiazol-5-yl] -2-pyridylami
, (R) -N- (1-phenylethyl) -4- [2-butyl-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pi
Lysylamine, (S) -N- (1-phenylethyl) -4- [4-
(3-Methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridylamine, (R) -N-
(1-Phenylethyl) -4- [4- (3-methylphenyl) -2-
(4-Methylthiophenyl) -1,3-thiazol-5-yl] -2
-Pyridylamine, (S) -N- (1-phenylethyl) -4-
[4- (3-methylphenyl) -2- (4-methylsulfonyl group
1,3-Thiazol-5-yl] -2-pyridylami
, (R) -N- (1-phenylethyl) -4- [4- (3-methyl
Phenyl) -2- (4-methylsulfonylphenyl) -1,3-thi
Azol-5-yl] -2-pyridylamine, (S) -N- (1-f
Phenylethyl) -4- [2- (4-fluorophenyl) -4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridy
Lumine, (R) -N- (1-phenylethyl) -4- [2- (4-
Fluorophenyl) -4- (3-methylphenyl) -1,3-thia
Zol-5-yl] -2-pyridylamine or a salt thereof
[14] The agent according to [1], [14] postmenopausal or senile
Primary osteoporosis, inflammation, hematological malignancies, endocrine disorders
Or secondary osteoporosis caused by drug administration, tumor bone
Destruction or alteration of bone / joint tissue associated with metastasis or rheumatism
Form, Paget's disease or hypercalcemia
The agent according to item [3], which is an agent, [15] for mammals
A p38MAP kinase inhibitor or (and) TN
Characterized by administering an effective amount of an F-α production inhibitor
Pain prevention / treatment method [16] For mammals, p
38MAP Kinase Inhibitor or (and) TNF-α
Osteoclasts characterized by administering an effective amount of a production inhibitor
Method for suppressing activation of cell and / or inhibiting formation of cell, [1
7] For mammals, p38MAP kinase inhibitor or
Or (and) administer an effective amount of TNF-α production inhibitor
Postmenopausal or senile primary bone characterized by
Porosis, inflammation, hematological malignancies, endocrine disorders or drugs
Secondary osteoporosis, tumor bone metastasis or
Is the destruction or deformation of bone and joint tissue associated with rheumatism, Pa
prevention and treatment of get disease or hypercalcemia,
[18] p38M for producing a prophylactic / therapeutic agent for pain
AP kinase inhibitor or (and) TNF-α production inhibition
Use of harmful drugs, [19] suppression of osteoclast activation or (
And) p38MAP Kinner for the production of inhibitor of formation
ZE inhibitor or (and) TNF-α production inhibitor
And [20] postmenopausal or senile primary bone coarse
Porosis, inflammation, hematological malignancies, endocrine disorders or drugs
Secondary osteoporosis resulting from administration, tumor bone metastasis or
Destruction or deformation of bone and joint tissue associated with rheumatism, Page
To manufacture preventive and / or therapeutic agent for t disease or hypercalcemia
P38 MAP kinase inhibitor or (and) for
Use of a TNF-α production inhibitor containing a [21] pyridyl group
Α of the nitrogen atom of the pyridyl group of the compound or its salt
The compound characterized by introducing a substituent at position
Is a method for reducing the P450 inhibitory effect of the salt, [22] pyri.
Compounds containing a dil group and an aromatic hydrocarbon group or the same
A polar group is introduced to the aromatic hydrocarbon group of the salt.
Of the P450 inhibitory action of the compound or its salt
Mitigation method, [23] Furthermore, the nitrogen atom of the pyridyl group
The method according to item [22], wherein a substituent is introduced at the α-position, [2
4] P450 is CYP2C9, CYP2D6 or CY
One of [21] or [22] which is P3A4
Method, [25] substituent is (i) halogen atom, (ii) C
_1-6Alkyl group, C_2-6Alkenyl group, C_2-6A
Lucinyl group, C _3-6Cycloalkyl group, C_6-14A
Reel base or C_7-16Aralkyl groups [these groups
Is oxo, halogen atom, C_1-3Alkylene Dioki
Si, nitro, cyano, optionally halogenated C
_1-6Alkyl, optionally halogenated C_2-6
Alkenyl, carboxy C_2-6Alkenyl, halogen
C which may be converted_2-6Alkynyl, halogenated
May be C_3-6Cycloalkyl, C_6-14A
Reel, optionally halogenated C_1-8Arcoki
Shi, C_1-6Alkoxy-carbonyl-C_1-6Arco
Xy, hydroxy, C_{6 -14}Aryloxy, C
_7-16Aralkyloxy, mercapto, halogenated
May be C_1-6Alkylthio, C_6-14Ants
Luthio, C_7-16Aralkylthio, amino, mono-
C_1-6Alkylamino, mono-C_6-14Arylua
Mino, Di-C_1-6Alkylamino, di-C_6-14A
Reel amino, formyl, carboxy, C_1-6Archi
Le-carbonyl, C_3-6Cycloalkyl-carboni
Le, C_1-6Alkoxy-carbonyl, C_6-14Ants
Ar-carbonyl, C_7-16Aralkyl-Carboni
Le, C_6-14Aryloxy-carbonyl, C
_7-16Aralkyloxy-carbonyl, 5- or 6-membered compound
Elementary ring carbonyl, carbamoyl, thiocarbamoyl, mo
No-C_1-6Alkyl-carbamoyl, di-C_1-6A
Ruquil-carbamoyl, C_6-14Aryl-carbamo
Yl, 5- or 6-membered heterocyclic carbamoyl, C_1-6Archi
Lesulfonyl, C_6-14Arylsulfonyl, C
_1-6Alkylsulfinyl, C_6-14Arylsul
Finyl, formylamino, C_1-6Alkyl-carbo
Nylamino, C_6-14Aryl-carbonylamino,
C_1-6Alkoxy-carbonylamino, C_1-6Al
Killsulfonylamino, C_6-14Arylsulfonyl
Amino, C_1-6Alkyl-carbonyloxy, C
_6-14Aryl-carbonyloxy, C_1-6Arco
Xy-carbonyloxy, mono-C_1-6Alkyl-Mo
Lubamoyloxy, di-C_1-6Alkyl-carbamoy
Roxy, C_6-14Aryl-carbamoyloxy,
Nicotinoyloxy, other than one nitrogen atom and carbon atom
1 or more selected from nitrogen atom, sulfur atom and oxygen atom
May contain 1 to 4 heteroatoms 5
To 7-membered saturated cyclic amino (this cyclic amino is C
_1-6Alkyl, C_6-14Aryl, C_1-6Archi
L-carbonyl, a 5- to 10-membered aromatic heterocyclic group and
May have a substituent selected from the group consisting of oxo
I), nitrogen atoms, sulfur atoms and oxygen atoms in addition to carbon atoms
Containing 1 to 4 1 or 2 heteroatoms selected from
5- to 10-membered aromatic heterocyclic group, sulfo, sulfamo
Ilu, sulfinamoyl and sulfenamoyl
1 to 5 substituents selected from the group (substituent group A)
Optionally have], (iii) selected from the substituent group A
Other than carbon atom, which may have 1 to 3 substituents
1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom
5- to 14-membered containing 1 to 4 heteroatoms
A heterocyclic group, (Iv) Formula:-(C = O) -R^Five,-(C = O) -OR^Five,-
(C = O) -NR^FiveR⁶,-(C = S) -NHR^FiveOr-SO₂
-R⁷ (In the formula, R^FiveIs selected from the group consisting of hydrogen atom and substituent A
C which may have 1 to 3 substituents_1-6Archi
Lu group, C_2-6Alkenyl group, C_2-6An alkynyl group,
C_3-6Cycloalkyl group, C_6-14Aryl group
Kuha C_7-16Aralkyl group or substituent selected from group A
A carbon atom which may have 1 to 3 substituents
Other than nitrogen atom, sulfur atom and oxygen atom 1
Or 5 to 14 containing 1 to 4 heteroatoms
Membered heterocyclic group is R⁶Is a hydrogen atom or C_1-6Alkyl
The base is R⁷Does not have 1 substituent selected from Group A of substituents
C which may have 3_1-6Alkyl group, C_2-6
Alkenyl group, C_2-6Alkynyl group, C_3-6Cyclo
Alkyl group, C_6-14Aryl group or C_{7-1 6}
The aralkyl group or the substituent selected from the substituent group A is 1
To nitrogen atoms other than carbon atoms, which may have 3 to 3.
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 14-membered heterocyclic group containing 1 to 4 terror atoms
Represents an acyl group, (v) an amino group (this amino group
No group is a substituent selected from Group A of Substituents 1 to 3
C which may have_1-6Alkyl group, C_2-6Al
Kenyl group, C_2-6Alkynyl group, C_3-6Cycloal
Kill group, C_6-14Aryl group or C_{7-1 6}Ara
1 to 1 substituents selected from the group
Nitrogen atom, sulfur other than carbon atom, which may have 3
1 or 2 heteroatoms selected from atoms and oxygen atoms
A 5 to 14 membered heterocyclic group containing 1 to 4 of
Selected from the group consisting of acyl groups represented by (iv) above
(May have 1 or 2 substituents), (vi) 1
In addition to nitrogen atom and carbon atom, nitrogen atom, sulfur atom and acid
1 or 2 heteroatoms selected from elementary atoms
5 to 7-membered non-aromatic cyclic amino which may contain 4
A group (this cyclic amino group is C_1-6Alkyl, C
_6-14Aryl, C_1-6Alkyl-carbonyl, 5
To a 10-membered aromatic heterocyclic group and oxo
Which may have 1 to 3 substituents selected from the group),
And (vii) no substituent selected from Group A of substituents
May have three, C_{1 -6}Alkoxy group, C
_6-14Aryloxy group or C_7-16Aralkyl
1st to 3rd [21] selected from oxy groups
Or [26] the polar group is (1) halo.
Gen atom, (2) hydroxy, (3) substituent selected from group A
A substituent selected from the substituents and the acyl represented by (iv) above.
An amino optionally having 1 or 2 substituents, (4) di
Toro, (5) Carboxy, (6) Formyl, (7) Substituent
It may have 1 to 3 substituents selected from Group A
I C_1-6Alkoxy, selected from group (8) substituent A
C which may have 1 to 3 substituents _1-6Arco
Xy-carbonyl, (9) cyano and (10) above (1)
Have 1 to 3 groups represented by ~ (9) as substituents
C_1-6Alkyl or C_6-14Chosen from aryl
The method according to item [22], which is 1 to 3
It The present invention further provides [27] p38 MAP kinase.
The inhibitor or (and) TNF-α production inhibitor is N-
Formula that may be oxidized

[Chemical formula 22] [In the formula, C ring represents a 4-pyrimidinyl group which may have a substituent, R ^1m represents a hydrogen atom, a hydrocarbon group which may have a substituent, and a substituent which may have a substituent. A heterocyclic group, an optionally substituted amino group or an acyl group is replaced by R ^2m
Represents an aromatic group which may have a substituent. ] The compound or its salt represented by these], or the agent of [1] which is its prodrug, [28] compound (Im) is
Formula that may be oxidized

[Chemical formula 23] [In the formula, Z ⁿ is a bond, —NR ⁴ⁿ — (R ⁴ⁿ is a hydrogen atom,
Represents a hydrocarbon group which may have a substituent), an oxygen atom or a sulfur atom which may be oxidized, and W ⁿ represents a bond or a divalent hydrocarbon group which may have a substituent. R ¹ⁿ represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group, R ²ⁿ represents an aromatic group which may have a substituent, R ³ⁿ represents a hydrogen atom, a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent. . ] The agent according to item [27], which is a compound represented by the formula or a salt thereof, [29] the agent according to item [28], wherein W ⁿ and Z ⁿ are both bonds.
[30] Compound (Im) is an N-oxidized formula

[Chemical formula 24] [In the formula, W ^f represents a divalent hydrocarbon group which may have a bond or a substituent, and R ^1f represents a hydrogen atom, a hydrocarbon group which may have a substituent, or a substituent. A heterocyclic group which may be substituted, an amino group or an acyl group which may have a substituent, R ^2f represents an aromatic group which may have a substituent, R ^2f
3f represents a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, and R ^4f represents a hydrogen atom or a hydrocarbon group which may have a substituent. ] The agent according to item [27], which is a compound represented by the formula or a salt thereof,
[31] The compound (If ′) is a formula which may be N-oxidized.

[Chemical 25] [In the formula, R ^1g represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. R ^2g is an aromatic group which may have a substituent, R ^3g is a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, ^{4 g} represents a hydrogen atom or a hydrocarbon group which may have a substituent. ] The compound represented by the formula [30], which is a compound or a salt thereof, [32] compound (If ′) is optionally N-oxidized.

[Chemical formula 26] [In the formula, R ^1h represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. R ^2h is an aromatic group which may have a substituent, R ^3h is a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, ^4h represents a hydrogen atom or a hydrocarbon group which may have a substituent. ] The agent according to item [30], which is a compound represented by the formula or a salt thereof.

The p38MAP kinase inhibitor or (and) TNF-α production inhibitor used in the present invention includes p38MAP kinase inhibitory action or (and) T
The substance is not particularly limited as long as it has a NF-α production inhibitory action, and examples thereof include the following compounds (I) to (VII). [Compound (I)] (1) 1,3-thiazole compound substituted at the 5-position with an optionally substituted pyridyl group or a salt thereof, (2)
A 1,3-thiazole compound or a salt thereof substituted at the 5-position with an optionally substituted pyridyl group (provided that the formula is

[Chemical 27] [In the formula, Ar represents an unsubstituted or substituted aryl group bonded to a thiazole ring via a carbon atom of an aromatic ring, and R is a carbon atom bonded to a nitrogen atom via a hydrogen atom, an acyl group or a carbon atom of an aromatic ring. It represents 10 or less monovalent aromatic groups. ]
A compound represented by or a salt thereof), (3) 1,3-
The compound according to item (1) or (2), wherein the thiazole compound is a 1,3-thiazole compound in which the 4-position is substituted with an aromatic group which may have a substituent, (4) 1 , 3
-The thiazole compound is a 1,3-thiazole compound in which the 2-position is substituted with an aryl group which may have a substituent or an amino group which may have a substituent. The compound according to the item (2), (5) the 1,3-thiazole compound has the formula

[Chemical 28] [In the formula, R¹Is a hydrogen atom, or an optionally substituted charcoal
Hydrogenated group, optionally substituted heterocyclic group, substituent
An amino group or an acyl group which may have R,^TwoIs replaced
A pyridyl group which may have a group, and R^ThreeIs a substituent
The aromatic group which may be possessed is shown. ] The compound represented by
Or a compound thereof according to item (1) or (2), which is a salt thereof
Things, (6) R¹Is (i) hydrogen atom, (ii) C_1-10A
Rukiru group, C_2-6Alkenyl group, C_2-6Alkynyl
Base, C_3-6Cycloalkyl group, C_6-14Aryl group
Or C_7-16Aralkyl groups (these groups are oxo,
Halogen atom, C_1-3Alkylenedioxy, nitro,
Cyano, optionally halogenated C_1-6Archi
R, optionally halogenated C_2-6Alkenyl,
Carboxy C_2-6Alkenyl, halogenated
Good C_2-6Alkynyl, may be halogenated
I C_3-6Cycloalkyl, C_6-14Aryl, halo
C which may be genated_1-8Alkoxy, C_1-6
Alkoxy-carbonyl-C_1-6Alkoxy, hydro
Kish, C_{6 -14}Aryloxy, C_7-16Aralchi
Luoxy, mercapto, optionally halogenated C
_1-6Alkylthio, C_6-14Arylthio, C
_7-16Aralkylthio, amino, mono-C_1-6Al
Kiramino, Mono-C_6-14Arylamino, di-C
_1-6Alkylamino, di-C_6-14Arylami
No, formyl, carboxy, C_1-6Alkyl-carbo
Nil, C_3-6Cycloalkyl-carbonyl, C_1-6
Alkoxy-carbonyl, C_6-14Aryl-carbo
Nil, C_7-16Aralkyl-carbonyl, C_6-14
Aryloxy-carbonyl, C_7-16Aralkillo
Xy-carbonyl, 5- or 6-membered heterocycle-carbonyl,
Lubamoyl, thiocarbamoyl, mono-C_1-6Archi
Le-carbamoyl, di-C_1-6Alkyl-carbamoy
Le, C_6-14Aryl-carbamoyl, 5- or 6-membered compound
Carbamoyl ring C, C_1-6Alkylsulfonyl, C
_6-14Arylsulfonyl, C_1-6Alkylsulf
Inyl, C_6-14Arylsulfinyl, formyla
Mino, C_1-6Alkyl-carbonylamino, C
_6-14Aryl-carbonylamino, C_1-6Arco
Xy-carbonylamino, C_1-6Alkylsulfonyl
Amino, C_6-14Arylsulfonylamino, C
_1-6Alkyl-carbonyloxy, C_6-14Ally
L-carbonyloxy, C_1-6Alkoxy-Carbonii
Roxy, Mono-C_1-6Alkyl-carbamoyl oki
Shi, C_1-6Alkyl-carbamoyloxy, C
_6-14Aryl-carbamoyloxy, nicotinoyl
Oxy, in addition to one nitrogen atom and a carbon atom, a nitrogen atom,
1 or 2 types of hetero selected from sulfur atom and oxygen atom
5 to 7 membered saturated optionally containing 1 to 4 atoms
Cyclic amino (This cyclic amino is C_1-6Alkyl, C
_6-14Aryl, C_1-6Alkyl-carbonyl, 5
To a 10-membered aromatic heterocyclic group and oxo
Other than carbon atom)
1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom
5- to 10-membered compounds containing 1 to 4 heteroatoms
Aromatic heterocyclic group, sulfo, sulfamoyl, sulfinamo
Group consisting of yl and sulfenamoyl (substituent group A)
May have a substituent selected from], (iii) above
It may have a substituent selected from the above-mentioned substituent group A.
In addition to carbon atoms, nitrogen, sulfur and oxygen atoms
Contains 1 to 4 1 or 2 heteroatoms selected from
Remove any one hydrogen atom from a 5- to 14-membered heterocycle
A monovalent heterocyclic group (Iv) Formula:-(C = O) -R^Five,-(C = O) -OR^Five,-
(C = O) -NR^FiveR⁶,-(C = S) -NHR^FiveOr-S
O₂-R⁷ (In the formula, R^FiveIs a hydrogen atom, C shown in (ii) above
_1-6Alkyl group, C_{2- 6}Alkenyl group, C_2-6A
Lucinyl group, C_3-6Cycloalkyl group, C_{6-1 Four}A
Reel base or C_7-16Aralkyl group or above
The heterocyclic group shown in (iii) is replaced by R⁶Is a hydrogen atom or C
_1-6An alkyl group, R⁷Is C shown in (ii) above
_1-6Alkyl group, C_2-6Alkenyl group, C_2-6A
Lucinyl group, C_3-6Cycloalkyl group, C_6-14A
Reel base or C_7-16Aralkyl group or above
(Representing the heterocyclic group shown in (iii))
Group, (v) amino group (this amino group is shown in (ii) above.
Done C_1-6Alkyl group, C _2-6Alkenyl group, C
_2-6Alkynyl group, C_3-6Cycloalkyl group, C_6
-14Aryl group or C_7-16Aralkyl group,
The heterocyclic group shown in (iii) above and the acyl group shown in (iv) above.
Have a substituent selected from the above-mentioned substituent group A and
May be C_1-6Selected from the group consisting of alkylidene groups
Optionally have a substituent), or (vi) one nitrogen
In addition to elementary and carbon atoms, nitrogen, sulfur and oxygen
1 to 4 of 1 or 2 heteroatoms selected from atoms
5 to 7-membered non-aromatic cyclic amino group which may contain
(This cyclic amino group is C_1-6Alkyl, C_6-14
Aryl, C_1-6Alkyl-carbonyl, 5 to 1
Selected from the group consisting of 0-membered aromatic heterocyclic groups and oxo
R may have a substituent); R²Is the above substituent A
A pyridyl group which may have a substituent selected from the group
R;³Has a substituent selected from the group A of substituents
May be C_6-14Monocyclic or condensed polycyclic aromatic carbonization
Having a hydrogen group or a substituent selected from Substituent Group A
In addition to carbon atoms, nitrogen atom, sulfur atom and oxygen source
1 to 4 heteroatoms of 1 or 2 kinds selected from child
Any one water from a 5- to 14-membered aromatic heterocycle containing
A group showing a monovalent aromatic heterocyclic group formed by removing elementary atoms
The compound according to item (5), (7) R¹Is a halogen atom,
C which may be halogenated_1-6Alkyl, carbo
Kishi C_2-6Alkenyl, optionally halogenated
C_1-6Alkoxy, C_1-6Alkoxy-carbonyl
-C_1-6Alkoxy, hydroxy, amino, mono-or
Is di-C_1-6Alkylamino, carboxy, C_1-6
Alkoxy-carbonyl, mono- or di-C_1-6Al
Kill-carbamoyl, C_6-14Aryl-carbonyl
Amino, C_1-3Alkylenedioxy, C_1-6Archi
Lucio, C_6-14Arylthio, C_1-6Alkyls
Rufinil, C_6-14Arylsulfinyl, C
_1-6Alkylsulfonyl, C_6-14Aryl sulfo
Having 1 to 5 substituents selected from nyl and nitro
May be C_6-14Aryl group (preferably C
_6-10Aryl), halogen atom, halogenated
May be C_1-6Alkyl, carboxy C _2-6A
Lucenyl, optionally halogenated C_1-6Arco
Kish, C_1-6Alkoxy-carbonyl-C_1-6Al
Coxy, hydroxy, amino, mono- or di-C_1-6
Alkylamino, carboxy, C_1-6Alkoxy-ca
Lubonyl, mono- or di-C_1-6Alkyl-carbamo
Ill and C_6-14Selected from aryl-carbonylamino
C optionally having 1 to 5 substituents_1-8
Alkyl group, halogen atom, even if halogenated
Good C_1-6Alkyl, carboxy C _2-6Archeni
R, optionally halogenated C_1-6Alkoxy,
C_1-6Alkoxy-carbonyl-C_1-6Arcoki
Ci, hydroxy, amino, mono- or di-C_1-6Al
Kiramino, carboxy, C_1-6Alkoxy-carbo
Nyl, mono- or di-C_1-6Alkyl-carbamoyl
And C_6-14Selected from aryl-carbonylamino
C which may have 1 to 5 substituents_3-6Shiku
Low alkyl group (eg cyclohexyl), C_7-16A
Aralkyl group (eg, phenyl-C_1-6Alkyl group),
In addition to carbon atom, it is selected from nitrogen atom, sulfur atom and oxygen atom.
Containing 1 or 2 or 1 to 4 heteroatoms
5- to 10-membered aromatic heterocyclic group (eg, pyridyl, thiee
5- or 6-membered aromatic heterocyclic group such as nyl), C
_6-14Aryl (eg, phenyl), C_1-6Alkyl
-Carbon atom which may have carbonyl or oxo
Besides, one or more selected from nitrogen atom, sulfur atom and oxygen atom
Is 2 to 5 or 10 containing 1 to 2 heteroatoms
Membered non-aromatic heterocyclic groups (eg piperidino, piperazino, etc.)
5- or 6-membered non-aromatic cyclic amino group), the following (1)
1 to 2 substituents selected from the group consisting of
Optionally substituted amino group [(1) C_1-6Alkyl,
(2) C_6-14Aryl, (3) C_{7- 16}Aralchi
(4) Other than carbon atom, nitrogen atom, sulfur atom and oxygen source
5 containing 1 or 2 heteroatoms selected from children
6-membered heterocyclic group (eg, pyridyl), (5) halogen atom
Child, C_1-6Alkyl, C_1-6Alkoxy, carboxy
Shi, C _1-6Alkoxy-carbonyl, cyano, tetra
Having 1 to 3 substituents each selected from gin and the like
May be C_1-6Alkyl-carbonyl, C_3-6
Cycloalkyl-carbonyl, C_6-14Aryl-Ca
Lubonyl, C_7-16Aralkyl-carbonyl, C
_1-6Alkyl-carbamoyl or 5- or 6-membered complex
Ring-carbonyl group, (6) halogen atom, C_1-6Al
Kill, C_1-6Alkoxy, carboxy, C_1-6Al
Coxy-carbonyl, cyano, nitro, mono- or
The-C_1-6Substituent selected from alkylamino etc. is 1
To C which may have 3 to 3_6-14Aryl-Cal
Vamoyl group, (7) di-C_1-6Alkylamino-C
_1-6Alkylidene], or a carboxy group
The agent according to item (5), (8) R¹Is C_1-6Alkylsul
C which may have honyl_6-14Is an aryl group
The compound according to item (5), (9) R^TwoHas a substituent
A compound according to item (5), which is an optionally substituted 4-pyridyl group.
Thing, (10) R^ThreeIs an optionally substituted C
_6-10The compound according to item (5), which is an aryl group,
(11) R^ThreeIs a phenyl group which may have a substituent
A compound according to item (5), (12) R^ThreeIs halogen
Atom, C_1-3Alkylenedioxy, halogenated
May be C_1-6Alkyl, carboxy C_2-6Al
Kenyl, optionally halogenated C_1-8Arcoki
Ci, carboxy C_1-8Alkoxy, hydroxy, C
_6-14Aryloxy, C_1-6Alkoxy-carbo
Nil, C_1-6Alkyl-carbonyloxy, mono- or
Is di-C_1-6Alkylamino and C_1-6Alkoxy
-Carbonyl-C_1-6Selected from the group consisting of alkoxy
Optionally substituted C_6-14With an aryl group
A compound according to item (5), (13) R³Is halogen
Atom and C_1-6Having a substituent selected from alkyl groups
A compound according to item (5), which is an optionally substituted phenyl group.
Thing, (14) R¹Is the formula:-(C = O) -R⁵ Or-
(C = O) -NR⁵R⁶[In the formula, each symbol has the same meaning as above.
Show. ] It may have 1 or 2 acyls represented by
Amino group, C_1-6Alkylthio, C_6-14Ants
Luthio, C_1-6Alkylsulfinyl, C_6-14
Arylsulfinyl, C_1-6Alkylsulfonyl,
C_6-14Selected from arylsulfonyl, carboxy, etc.
C optionally having 1 to 5 substituents
_6-14Substituted with an aryl group or halogen atom
May be C_1-6An alkyl group, R^TwoIs a pyridyl group,
R^ThreeIs a halogen atom or optionally halogenated C
_1-6Alkyl, optionally halogenated C_1-6
There is no 1 substituent selected from alkoxy and carboxy
C which may have 5_6-14First showing an aryl group
The compound according to item (5), (15) R¹Is (i) halogen
Atom, optionally halogenated C_1-6Alkyl,
Carboxy C_2-6Alkenyl, halogenated
Good C_1-6Alkoxy, C_1-6Alkoxy-Cal
Bonyl-C_1-6Alkoxy, hydroxy, amino, mo
No or di-C_1-6Alkylamino, carboxy, C
_1-6Alkoxy-carbonyl, mono- or di-C
_1-6Alkyl-carbamoyl and C_{6 -14}Aryl
1 to 5 substituents selected from carbonylamino
C which each may have_1-8Alkyl, C_3-6
Cycloalkyl or C_6-14Aryl, (ii) 5-membered
Elementary ring group, (iii) (1) C_1-6Alkyl, (2) C
_6-14Aryl, (3) C_7-16Aralkyl, (4)
6-membered heterocyclic group and (5) halogen atom, C_1-6Archi
Le, C_{1 -6}Alkoxy, carboxy and C_1-6Al
1 to 3 substituents selected from cooxy-carbonyl
C which each may have_1-6Alkyl-carboni
Le, C_3-6Cycloalkyl-carbonyl, C_6-14
Aryl-carbonyl, C _7-16Aralkyl-Carbo
Nil, C_1-6Alkyl-carbamoyl or 5 or
1 or 2 substituents selected from 6-membered heterocycle-carbonyl
An amino group which may have one or di-C_1-6Archi
Lumino-C_1-6Alkylidene which may have
Mino group, (iv) C_1-6Alkyl-carbonyl or oki
5- or 6-membered non-aromatic cyclic amine which may be substituted with
Or a (v) carboxy group to R^TwoIs a pyridyl group,
R^ThreeIs a halogen atom, C_1-3Alkylenedioxy, ha
C which may be rogenated_1-6Alkyl, carboxy
C_2-6Alkenyl, optionally halogenated C
_1-8Alkoxy, hydroxy, C_7-16Aralkyl
Oxy and C_{1 -6}Select from alkyl-carbonyloxy
C optionally having 1 to 3 substituents
_6-10Aryl group (two adjacent ar groups as substituents
Even if a kill group is bonded to form a 5-membered non-aromatic carbocycle
A compound according to item (5), which represents¹But
C_1-6C optionally having alkylsulfonyl
_6-14The aryl group is R^TwoIs a pyridyl group, R³Ha
C which may have a rogen atom_{6- 14}Aryl group
The compound according to item (5), (17) N-ethyl-
[4- (4-methoxyphenyl) -5- (4-pyridy
L) -1,3-thiazol-2-yl] amine (reference example
A23-269), N-propyl- [4- (3,5-di
Methylphenyl) -5- (4-pyridyl) -1,3-thi
Azol-2-yl] amine (Reference Example A23-27
6), N-butyl- [4- (3,5-dimethylphenyl)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] amine (Reference Example A23-280), N-benz
Ru- [4- (3,5-dimethylphenyl) -5- (4-
Pyridyl) -1,3-thiazol-2-yl] amine
(Reference Example A23-281), N-propyl- [4- (4
-Methoxyphenyl) -5- (4-pyridyl) -1,3
-Thiazol-2-yl] amine (Reference Example A23-29
0), N-isopropyl- [4- (4-methoxyphenyl)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] amine (Reference Example A23-291), N- [4-
(4-Methoxyphenyl) -5- (4-pyridyl)-
1,3-Thiazol-2-yl] -N′-phenylure
A (Reference Example A23-296), 4-[[[4- (4-meth
Xyphenyl) -5- (4-pyridyl) -1,3-thia
Zol-2-yl] amino] carbonyl] benzoic acid (reference
Example A23-299), methyl 4- [2- [4- (methylthio
E) Phenyl] -5- (4-pyridyl) -1,3-thia
Zol-4-yl] phenyl ether (Reference Example A23-
300), 4- [4- (3,5-dimethylphenyl)-
5- (4-pyridyl) -1,3-thiazol-2-i
]] Phenylmethyl sulfide (Reference Example A23-30
2), 4- [4- (4-methoxyphenyl) -5- (4
-Pyridyl) -1,3-thiazol-2-yl] phenyl
Rumethyl sulfoxide (Reference Example A23-303), 4-
[4- (3,5-dimethylphenyl) -5- (4-pyri
Dil) -1,3-thiazol-2-yl] phenylmethy
Rusulfoxide (Reference Example A23-305), 4- [4-
(4-Methoxyphenyl) -5- (4-pyridyl)-
1,3-thiazol-2-yl] phenylmethylsulfo
(Reference Example A23-306), 4- [4- (3,5-di)
Methylphenyl) -5- (4-pyridyl) -1,3-thi
Azol-2-yl] phenylmethyl sulfone (reference example
A23-308), 4- [4- (4-fluorophenyl)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] phenylmethyl sulfide (Reference Example A23-3
09), 4- [4- (4-chlorophenyl) -5- (4
-Pyridyl) -1,3-thiazol-2-yl] phenyl
Rumethyl sulfide (Reference Example A23-310), 4-
[4- (4-fluorophenyl) -5- (4-pyridy
Lu) -1,3-thiazol-2-yl] phenylmethyl
Sulfoxide (Reference Example A23-311), 4- [4-
(4-chlorophenyl) -5- (4-pyridyl) -1,
3-thiazol-2-yl] phenylmethyl sulfoxy
(Reference example A23-312), 4- [4- (4-fluor
Rophenyl) -5- (4-pyridyl) -1,3-thiazo
2-l] phenylmethyl sulfone (Reference Example A2
3-313), 4- [4- (4-chlorophenyl) -5
-(4-Pyridyl) -1,3-thiazol-2-yl]
Phenylmethyl sulfone (Reference Example A23-314), N
-[4- (3,5-dimethylphenyl) -5- (4-pi
Lysyl) -1,3-thiazol-2-yl] -N′-fu
Enylurea (Reference Example A23-315), 2-hydroxy
Ci-N- [4- (4-methoxyphenyl) -5- (4-
Pyridyl) -1,3-thiazol-2-yl] propio
Namide (Reference Example A23-325), 4- [4- (3,
4-dimethylphenyl) -5- (4-pyridyl) -1,
3-Thiazol-2-yl] phenylmethyl sulfide
(Reference Example A23-326), 4- [4- (3,4-dimme
Tylphenyl) -5- (4-pyridyl) -1,3-thia
Zol-2-yl] phenylmethyl sulfoxide (reference
Example A23-327), 4- [4- (3,4-dimethylphenyl)
Phenyl) -5- (4-pyridyl) -1,3-thiazole
-2-yl] phenylmethyl sulfone (Reference Example A23-
328), 2-hydroxy-N- [4- (4-methoxy
Phenyl) -5- (4-pyridyl) -1,3-thiazo
Lu-2-yl] acetamide (Reference Example A23-32
9), 4-[[[4- (3,5-dimethylphenyl) -5
-(4-Pyridyl) -1,3-thiazol-2-yl]
Amino] carbonyl] benzoic acid (Reference Example A23-33
7), 3-[[[4- (3,5-dimethylphenyl) -5
-(4-Pyridyl) -1,3-thiazol-2-yl]
Amino] carbonyl] benzoic acid (Reference Example A23-34
2), 4- (4-fluorophenyl) -2-phenyl-
5- (4-pyridyl) -1,3-thiazole (Reference Example A
44-1), methyl 4- [4- (3-methylphenyl)
-5- (4-pyridyl) -1,3-thiazol-2-i
Lu] phenyl sulfide (Reference Example A44-7), methyl
4- [4- (3-methylphenyl) -5- (4-pyridy
L) -1,3-thiazol-2-yl] phenylsulfo
Xide (Reference Example A44-8), methyl 4- [4- (3-
Methylphenyl) -5- (4-pyridyl) -1,3-thi
Azol-2-yl] phenyl sulfone (Reference Example A44
-26), or a salt thereof.

Examples of the "acyl group" include those represented by the formula:-(C
^{= O) -R 5, - (} C = O) -OR 5, - (C = O) -NR
⁵ R ⁶ ,-(C = S) -NHR ⁵ or -SO ₂ -R
⁷ (in the formula, R ⁵ is a hydrogen atom, a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, R 5
⁶ represents a hydrogen atom or a C _1-6 alkyl group, and R ⁷ represents a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent. ) And the like. In the above formula, examples of the “hydrocarbon group” of the “hydrocarbon group which may have a substituent” represented by R ⁵ include, for example, a chain or cyclic hydrocarbon group (eg, alkyl, alkenyl, alkynyl, Cycloalkyl, aryl, aralkyl, etc.) and the like. Of these, 1 to 16 carbon atoms
Individual chain or cyclic hydrocarbon groups and the like are preferable. As the “alkyl”, for example, C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl etc.) and the like are preferable. “Alkenyl” is, for example, C
_2-6 alkenyl (eg, vinyl, allyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl,
2-Methyl-2-propenyl, 1-methyl-2-propenyl, 2-methyl-1-propenyl, etc.) are preferred.
Examples of the “alkynyl” include C _2-6 alkynyl (eg, ethynyl, propargyl, 1-butynyl, 2
-Butynyl, 3-butynyl, 1-hexynyl, etc.) and the like are preferable. “Cycloalkyl” includes, for example, C _3-6
Cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like are preferable. Examples of the “aryl” include C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2
-Biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like) and the like are preferable. "Aralkyl"
Examples include C _7-16 aralkyl (eg, benzyl, phenethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, 5-
Phenylpentyl etc.) and the like are preferable.

The "substituent" of the "hydrocarbon group which may have a substituent" represented by R ⁵ is, for example, oxo,
Halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.),
C _{1 -3} alkylenedioxy (e.g., methylenedioxy,
Ethylenedioxy etc.), nitro, cyano, optionally halogenated C _1-6 alkyl, optionally halogenated C _2-6 alkenyl, carboxy C _2-6 alkenyl (eg, 2-carboxyethenyl) , 2-carboxy-2-methylethenyl), optionally halogenated C _2-6 alkynyl, optionally halogenated C
_3-6 cycloalkyl, C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like), optionally halogenated C _1-8 alkoxy, C _1-6 alkoxy-carbonyl-C _1-6 alkoxy (eg, ethoxycarbonylmethyloxy, etc.), hydroxy, C _6-14 aryloxy (eg, phenyloxy, 1-naphthyloxy, 2-naphthyl) Oxy etc.),
C _7-16 aralkyloxy (eg, benzyloxy, phenethyloxy, etc.), mercapto, optionally halogenated C _1-6 alkylthio, C _6-14 arylthio (eg, phenylthio, 1-naphthylthio, 2-
Naphthylthio etc.), C _7-16 aralkylthio (eg benzylthio, phenethylthio etc.), amino, mono-C _1-6 alkylamino (eg methylamino, ethylamino etc.), mono-C _6-14 arylamino ( (Eg, phenylamino, 1-naphthylamino, 2-naphthylamino, etc.), di-C _1-6 alkylamino (eg, dimethylamino, diethylamino, ethylmethylamino, etc.), di-
C _{6- 14} arylaminocarbonyl (e.g., diphenylamino etc.), formyl, carboxy, carboxy _{-C 2-6} alkenyl, carboxy _{-C 1-6 alkyl, C 1-6} alkyl - carbonyl (e.g., acetyl, propionyl, etc.), C _3-6 cycloalkyl-carbonyl (eg, cyclopropylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, etc.), C _1-6 alkoxy-carbonyl (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl, etc.), C _6-14 aryl-carbonyl (eg, benzoyl, 1-naphthoyl, 2-naphthoyl, etc.), C _7-16
Aralkyl-carbonyl (eg, phenylacetyl, 3-
Phenylpropionyl etc.), C _6-14 aryloxy-carbonyl (eg, phenoxycarbonyl etc.), C
_7-16 aralkyloxy-carbonyl (eg, benzyloxycarbonyl, phenethyloxycarbonyl, etc.),
5- or 6-membered heterocyclic-carbonyl (eg, nicotinoyl, isonicotinoyl, thenoyl, furoyl, morpholinocarbonyl, thiomorpholinocarbonyl, piperazine-1-
Ylcarbonyl, pyrrolidin-1-ylcarbonyl, etc.), carbamoyl, thiocarbamoyl, mono-C
_1-6 alkyl-carbamoyl (eg, methylcarbamoyl, ethylcarbamoyl, etc.), di-C _1-6 alkyl-
Carbamoyl (eg, dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.), mono- or di-C _6-14 aryl-carbamoyl (eg, phenylcarbamoyl, 1-naphthylcarbamoyl, 2-naphthylcarbamoyl, etc.), mono- or di- -5 or 6-membered heterocyclic carbamoyl (eg, 2-pyridylcarbamoyl, 3-
Pyridylcarbamoyl, 4-pyridylcarbamoyl, 2
-Thienylcarbamoyl, 3-thienylcarbamoyl, etc.), C _1-6 alkylsulfonyl (eg, methylsulfonyl, ethylsulfonyl, etc.), C _1-6 alkylsulfinyl (eg, methylsulfinyl, ethylsulfinyl, etc.), C _6-14 aryl Sulfonyl (eg, phenylsulfonyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl, etc.), C _6-14 arylsulfinyl (eg, phenylsulfinyl, 1-naphthylsulfinyl, 2-
Naphthylsulfinyl, etc.), formylamino, C _1-6
Alkyl-carbonylamino (eg, acetylamino etc.), C _6-14 aryl-carbonylamino (eg, benzoylamino, naphthoylamino etc.), C _1-6 alkoxy-carbonylamino (eg, methoxycarbonylamino, ethoxycarbonylamino). , propoxycarbonylamino, butoxycarbonylamino, _{etc.), C 1-6} alkylsulfonylamino (e.g., methylsulfonylamino, ethylsulfonylamino, _{etc.), C 6- 14} aryl-sulfonylamino (e.g., phenylsulfonylamino, 2
-Naphthylsulfonylamino, 1-naphthylsulfonylamino, etc.), C _1-6 alkyl-carbonyloxy (eg, acetoxy, propionyloxy, etc.), C
_6-14 aryl-carbonyloxy (eg, benzoyloxy, naphthylcarbonyloxy, etc.), C _1-6 alkoxy-carbonyloxy (eg, methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.), mono- C
_1-6 alkyl-carbamoyloxy (eg, methylcarbamoyloxy, ethylcarbamoyloxy, etc.), di-
C _1-6 alkyl-carbamoyloxy (eg, dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), C _6-14 aryl-carbamoyloxy (eg,
Phenylcarbamoyloxy, naphthylcarbamoyloxy, etc.), nicotinoyloxy, optionally substituted 5- to 7-membered saturated cyclic amino, 5- to 10-membered aromatic heterocyclic group (eg, 2-thienyl, 3-thienyl) , 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl,
3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2
-Benzo [b] thienyl, 3-benzo [b] thienyl,
2-benzo [b] furanyl, 3-benzo [b] furanyl and the like), sulfo and the like. The “hydrocarbon group” may have, for example, 1 to 5, preferably 1 to 3 substituents at the substitutable position, and the number of substituents is 2
In the case of one or more, each substituent may be the same or different.

The above-mentioned "optionally halogenated C"
_{As the} " _1-6 alkyl", for example, C _1-6 alkyl optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) (eg, Methyl, ethyl, propyl, isopropyl,
Butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.) and the like. As a specific example,
Methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoropropyl, isopropyl, butyl , 4,4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6-trifluorohexyl, etc. Can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkenyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg,
C, which may have (fluorine, chlorine, bromine, iodine, etc.)
_2-6 alkenyl (eg vinyl, propenyl, isopropenyl, 2-buten-1-yl, 4-penten-1-yl, 5-hexen-1-yl) and the like can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkynyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.)
C _2-6 alkynyl which may have (eg, 2-butyn-1-yl, 4-pentyn-1-yl, 5-hexyn-1-yl, etc.) and the like can be mentioned. The above-mentioned “optionally halogenated C _3-6 cycloalkyl” has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.). Optionally C _3-6 cycloalkyl (eg, cyclopropyl,
Cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like. Specific examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4,4-
Dichlorocyclohexyl, 2,2,3,3-tetrafluorocyclopentyl, 4-chlorocyclohexyl and the like can be mentioned. The above “optionally halogenated C _1-8
As the "alkoxy", for example, C _1-8 alkoxy (eg, methoxy, ethoxy) optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine etc.) , Propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy, etc.) and the like. Specific examples include, for example, methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy,
4,4,4-trifluorobutoxy, isobutoxy, se
Examples include c-butoxy, pentyloxy, hexyloxy and the like. The above-mentioned “optionally halogenated C _1-6 alkylthio” has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) And C _1-6 alkylthio (eg, methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec-butylthio, tert-butylthio, etc.) and the like. Specific examples include methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like. Examples of the "5- to 7-membered saturated cyclic amino" of the "5- to 7-membered saturated cyclic amino optionally having a substituent" include, for example, 1
5 to 7-membered saturated cyclic amino which may contain 1 or 2 kinds selected from nitrogen atom, sulfur atom and oxygen atom, and 1 to 4 hetero atoms in addition to the nitrogen atom and carbon atom, Specific examples include pyrrolidin-1-yl, piperidino, piperazin-1-yl, morpholino,
Examples thereof include thiomorpholino and hexahydroazepin-1-yl. The “5 to 7 optionally having a substituent”
Examples of the “substituent” of the “membered saturated cyclic amino” include C
_1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.), C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl) , 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2
- _{anthryl), C 1-6} alkyl - carbonyl (e.g., acetyl, propionyl, etc.), 5- to 10-membered aromatic Hajime Tamaki (e.g., 2-thienyl, 3-thienyl, 2-
Pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-
Quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-
Isoquinolyl, 5-isoquinolyl, 1-indolyl, 2
-Indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b] furanyl), oxo and the like are 1 to 1 There are three.

The "heterocyclic group" of the "heterocyclic group which may have a substituent" represented by R ⁵ is, for example, 1 or 2 selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to the carbon atom. 5 to 14 membered (monocyclic, bicyclic or tricyclic) heterocyclic ring containing two kinds or 1 to 4 heteroatoms, preferably (i) 5 to 14 membered (preferably 5 to 10 membered) aromatic heterocycle And a monovalent group obtained by removing any one hydrogen atom from a ring, (ii) a 5- to 10-membered non-aromatic heterocycle or (iii) a 7- to 10-membered heterocyclic bridge ring. Examples of the above-mentioned “5- to 14-membered (preferably 5 to 10-membered) aromatic heterocycle” include, for example, thiophene, benzo [b] thiophene, benzo [b] furan, benzimidazole, benzoxazole, benzothiazole and benziso. Thiazole, naphtho [2,3-b] thiophene,
Furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole,
Isoindole, 1H-indazole, purine, 4H-
Quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline,
Carbazole, β-carboline, phenanthridine, acridine, phenazine, thiazole, isothiazole,
An aromatic heterocycle such as phenothiazine, isoxazole, furazan, phenoxazine, or one or more (preferably 1 or 2) aromatic rings (eg, benzene ring) of these rings (preferably monocycles); Examples thereof include rings formed by condensation. The above "5- to 10-membered non-aromatic heterocycle"
Examples thereof include pyrrolidine, imidazoline, pyrazolidine, pyrazoline, piperidine, piperazine, morpholine, thiomorpholine, dioxazole, oxadiazoline, thiadiazoline, triazoline, thiadiazole, dithiazole and the like. Above "7 to 10
Examples of the “membered hetero bridge ring” include quinuclidine, 7-
Azabicyclo [2.2.1] heptane and the like can be mentioned.
The "heterocyclic group" is preferably 1 or 2 kinds selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom,
A 5- to 14-membered (preferably 5- to 10-membered) (monocyclic or bicyclic) heterocyclic group containing 1 to 4 heteroatoms is preferable. Specifically, for example, 2-thienyl, 3-thienyl, 2-furyl, 3-furyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3
-Quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, 3 -Pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-indolyl, 2-indolyl, 3
-Aromatic heterocyclic groups such as indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b] furanyl, for example 1-pyrrolidinyl , 2-pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl And non-aromatic heterocyclic groups such as morpholino and thiomorpholino. Of these, for example, a 5- or 6-membered heterocyclic group containing 1 to 3 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom is more preferable. Specifically, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl,
2-furyl, 3-furyl, pyrazinyl, 2-pyrimidinyl, 3-pyrrolyl, 3-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-pyrrolidinyl, 2-
Pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-
Examples thereof include piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like. The "substituent" of the "heterocyclic group optionally having substituent (s)" is, for example, the "substituent" of the "hydrocarbon group optionally having substituent (s)" for R ^5. The same thing is mentioned. The "heterocyclic group"
Is, for example, 1 to 5 at the substitutable position of the above substituent.
It may have one, preferably 1 to 3, and when the number of substituents is 2 or more, each substituent may be the same or different.

R⁶"C_1-6Alkyl group "
For example, methyl, ethyl, propyl, isopro
Pill, butyl, isobutyl, sec-butyl, tert-butyl
And pentyl, hexyl and the like. R⁷Indicated by
“A hydrocarbon group which may have a substituent” and “substitution
Examples of the “heterocyclic group which may have a group” include the groups described above.
R⁵“A hydrocarbon that may have a substituent
Group "and" heterocyclic group optionally having substituent (s) "
I can name each one. R¹"Has a substituent
Examples of the “hydrocarbon group which may be present” include, for example, R⁵Indicated by
Examples include "hydrocarbon group which may have a substituent (s)"
It R¹“Heterocycle which may have a substituent
Examples of the “group” include R ⁵"Has a substituent
And a heterocyclic group which may be present.

R¹“It may have a substituent
“Amino group” has (1) one or two substituents
Optionally having an amino group and (2) a substituent
Good cyclic amino groups are mentioned. [Substituent in (1) above]
“Substituent” of “amino group which may have 1 or 2”
Is, for example, a hydrocarbon which may have a substituent.
Group, optionally substituted heterocyclic group, acyl group, group
Examples thereof include an alkylidene group which may have a substituent.
It These "hydrocarbon groups optionally having substituent (s)" and
And “heterocyclic group optionally having substituent (s)” include
Note R⁵“A hydrocarbon that may have a substituent
Similar to "group" and "heterocyclic group optionally having substituent (s)"
Each one is listed. The "having a substituent
As "alkylidene group" of "moyo alkylidene group"
Is, for example, C_1-6Alkylidene (eg, methylide
, Ethylidene, propylidene, etc.) and the like. The
“Substitution of“ alkylidene group optionally having substituent (s) ”
As the “group”, the above R⁵"Has a substituent
1 is the same as the "substituent" of "optional hydrocarbon group"
The number is 5, and preferably 1 to 3. the above
“Amino group which may have 1 or 2 substituents”
When there are two "substituents", each substituent is the same or different.
You may stay. The above (2) "may have a substituent
"Cyclic amino group" of "cyclic amino group" means one nitrogen atom
In addition to elementary and carbon atoms, nitrogen, sulfur and oxygen
1 or 2 species selected from atoms, 1 to 4 heteroatoms
5- to 7-membered non-aromatic cyclic amino which may contain a child
Group, and specific examples thereof include pyrrolidin-1-y
Le, piperidino, piperazin-1-yl, morpholino,
Thiomorpholino, hexahydroazepin-1-yl, a
Midazolidin-1-yl, 2,3-dihydro-1H-i
Midazol-1-yl, tetrahydro-1 (2H) -pi
Limidinyl, 3,6-dihydro-1 (2H) -pyrimidi
Nil, 3,4-dihydro-1 (2H) -pyrimidinyl, etc.
Is mentioned. "Cyclic amino which may have a substituent
Examples of the “substituent” of the “group” include the above R⁵Indicated by
“Substitution of“ hydrocarbon group which may have a substituent (s) ”
"Group which may have a substituent"
The same as "substituent" of "7-membered saturated cyclic amino"
One to three can be mentioned. No 5 with 1 oxo
Examples of the 7-membered non-aromatic cyclic amino group include 2-o.
Xoimidazolidin-1-yl, 2-oxo-2,3-
Dihydro-1H-imidazol-1-yl, 2-oxo
Tetrahydro-1 (2H) -pyrimidinyl, 2-oxo
-3,6-dihydro-1 (2H) -pyrimidinyl, 2-
Oxo-3,4-dihydro-1 (2H) -pyrimidini
2-oxopyrrolidin-1-yl, 2-oxopipe
Lysino, 2-oxopiperazin-1-yl, 3-oxo
Piperazin-1-yl, 2-oxo-2,3,4,5,6,7
-Hexahydroazepin-1-yl and the like. R
¹Is preferably an amino group which may have a substituent
And an aryl group which may have a substituent. The
Preferred as "amino group optionally having substituent (s)"
Is the formula:-(C = O) -R⁵,-(C = O) -OR⁵,-
(C = O) -NR⁵R⁶,-(C = S) -NHR⁵Or-
SO_Two-R⁷[In the formula, each symbol has the same meaning as described above. ]
An amino which may have 1 or 2 acyls represented by
Group etc. More preferably, R¹Is the formula:-(C = O)
-R⁵ Or- (C = O) -NR⁵R ⁶[In the formula, each symbol is
Same meaning as above. ] 1 or 2 acyls represented by
It is an amino group which may have. Said "has a substituent
As the "optionally substituted aryl group", for example, C
_{1- 6}Alkylthio, C_6-14Arylthio, C
_1-6Alkylsulfinyl, C _6-14Arylsul
Finil, C_1-6Alkylsulfonyl, C_6-14A
Substituent selected from reelsulfonyl, carboxy, etc.
C optionally having 1 to 5_6-14Aryl group
(Preferably phenyl etc.) and the like.

In particular, R¹as, Halogen atom, optionally halogenated C_1-6
Alkyl, carboxy C _2-6Alkenyl, halogenated
May be C_1-6Alkoxy, C_1-6Arco
Xy-carbonyl-C_1-6Alkoxy, hydroxy,
Amino, mono- or di-C_1-6Alkylamino, cal
Boxy, C_1-6Alkoxy-carbonyl, mono- or
The-C_1-6Alkyl-carbamoyl, C_6-14Ants
R-carbonylamino, C_1-3Alkylene Dioki
Shi, C_1-6Alkylthio, C_{6-1 Four}Arylthio,
C_1-6Alkylsulfinyl, C_6-14Aryls
Rufinil, C_1-6Alkylsulfonyl, C_6-14
1 for a substituent selected from arylsulfonyl, nitro, etc.
To C which may have 5 to 5_6-14Aryl group (good
More preferably C_6-10Aryl), Halogen atom, optionally halogenated C_1-6
Alkyl, carboxy C _2-6Alkenyl, halogenated
May be C_1-6Alkoxy, C_1-6Arco
Xy-carbonyl-C_1-6Alkoxy, hydroxy,
Amino, mono- or di-C_1-6Alkylamino, cal
Boxy, C_1-6Alkoxy-carbonyl, mono- or
The-C_1-6Alkyl-carbamoyl and C_6-14A
There is no 1 substituent selected from reel-carbonylamino
C which may have 5_1-8An alkyl group, Halogen atom, optionally halogenated C_1-6
Alkyl, carboxy C _2-6Alkenyl, halogenated
May be C_1-6Alkoxy, C_1-6Arco
Xy-carbonyl-C_1-6Alkoxy, hydroxy,
Amino, mono- or di-C_1-6Alkylamino, cal
Boxy, C_1-6Alkoxy-carbonyl, mono- or
The-C_1-6Alkyl-carbamoyl and C_6-14A
There is no 1 substituent selected from reel-carbonylamino
C which may have 5_3-6Cycloalkyl group
(Eg cyclohexyl), C_7-16Aralkyl groups (eg phenyl-C_1-6A
Rukiru group), From nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom
1 or 2 selected, containing 1 to 4 heteroatoms
A 5- to 10-membered aromatic heterocyclic group (eg, pyridyl, thi
5 to 6-membered aromatic heterocyclic group such as enyl), C_6-14Aryl (eg, phenyl), C_1-6Al
Carbon source optionally having a carbonyl-carbonyl or oxo
Besides nitrogen, selected from nitrogen atom, sulfur atom and oxygen atom
1 or 2 kinds, 5 to 5 containing 1 to 2 heteroatoms
10-membered non-aromatic heterocyclic group (eg, piperidino, piperazi
A 5- or 6-membered non-aromatic cyclic amino group such as 1 is a substituent selected from the group consisting of the following (1) to (7)
Or an amino group which may have two [(1) C_1-6A
Rukiru, (2) C_6-14Aryl, (3) C_{7- 16}A
Ralalkyl, (4) nitrogen atoms other than carbon atoms, sulfur atoms and
Contains 1 or 2 heteroatoms selected from oxygen atoms
5- or 6-membered heterocyclic group (eg, pyridyl), (5) halogen
Atom, C_1-6Alkyl, C_1-6Alkoxy, cal
Boxy, C _1-6Alkoxy-carbonyl, cyano, te
1 to 3 substituents each selected from tolazine, etc.
C which may have_1-6Alkyl-carbonyl, C
_3-6Cycloalkyl-carbonyl, C_6-14Ally
Le-carbonyl, C_7-16Aralkyl-carbonyl,
C_1-6Alkyl-carbamoyl or 5- or 6-membered compound
Elementary ring-carbonyl group, (6) halogen atom, C_1-6A
Rukiru, C_1-6Alkoxy, carboxy, C_1-6A
Lucoxy-carbonyl, cyano, nitro, mono-young
Is di-C_1-6Substituents selected from alkylamino, etc.
1 to 3 optionally have C_6-14Aryl-Ca
Lubamoyl group, (7) di-C_1-6Alkylamino-C
_1-6Alkylidene], or A carboxy group or the like is preferably used.

The "pyridyl group" of the "optionally substituted pyridyl group" represented by R 2 is 1 to 2
Examples include-, 3- or 4-pyridyl groups. The “substituent” of the “optionally substituted pyridyl group” for R 2 is, for example, the “substitution” of the “optionally substituted hydrocarbon group” for R 5 above. The same as "group" can be mentioned. The "pyridyl group" may have, for example, 1 to 5, preferably 1 to 3 substituents at the substitutable position, and when the number of substituents is 2 or more,
Each substituent may be the same or different. Moreover, the nitrogen atom in the ring of the "pyridyl group" may be N-oxidized. R 2 is preferably a pyridyl group which may have a substituent (eg, 3-pyridyl group, 4-pyridyl group, etc., preferably 4-pyridyl group). As the R 2, C 1-6 alkyl (e.g., methyl), hydroxy and C 1 -6 alkyl - carbonyloxy (e.g., acetyloxy), 1 to substituents selected from the group consisting of 2
Pyridyl group which may have one is preferable.

The "aromatic group" of the "aromatic group which may have a substituent (s)" represented by R ³ includes an aromatic hydrocarbon group or an aromatic heterocyclic group. Examples of the "aromatic hydrocarbon group" include monocyclic or condensed polycyclic (2 or 3 ring) aromatic hydrocarbon groups having 6 to 14 carbon atoms. Specific examples thereof include phenyl and 1-
C such as naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like.
_6-14 aryl etc. are mentioned. Examples of the "aromatic heterocyclic group" include 1 to 2 members selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom, and preferably 5 to 14 member (containing 1 to 4 heteroatoms ( It is preferably a 5- to 10-membered (monocyclic or bicyclic) aromatic heterocyclic group. Specifically, for example, 2-thienyl, 3-thienyl, 2-furyl, 3-furyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3
-Quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, 3 -Pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-indolyl, 2-indolyl, 3
-Aromatic heterocyclic groups such as -indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl and 3-benzo [b] furanyl. Examples of the "substituent" of the "aromatic group optionally having substituent (s)" include "substituent" of "hydrocarbon group optionally having substituent (s)" represented by R ^5. 1-5 similar, preferably 1
To three. When the number of substituents is 2 or more, each substituent may be the same or different. Also, two adjacent substituents may form a 4- to 7-membered non-aromatic carbocycle. It is preferably a 5-membered non-aromatic carbocycle.
R ³ is preferably C _6-10 which may have a substituent.
It is an aryl group. More preferably, it is a phenyl group which may have a substituent. As the substituents of these C _6-10 aryl group and phenyl group, a halogen atom, C
_1-3 alkylenedioxy, _{C 1-6} alkyl which may be halogenated, carboxy _{C 2-6} alkenyl,
1 to 3 substituents selected from C _3-6 cycloalkyl, optionally halogenated C _1-8 alkoxy, hydroxy, C _7-16 aralkyloxy, C _1-6 alkyl-carbonyloxy and carboxy are Preferably, in particular, optionally halogenated C _1-6 alkyl (eg, C _1-3 alkyl such as methyl and ethyl), optionally halogenated C _1-8 alkoxy (eg, methoxy, ethoxy, etc.) C _1-3 alkoxy) is preferred. In addition, two adjacent alkyl groups may be bonded as a substituent to form a 5-membered non-aromatic carbocycle.

However, the compound (I) has the formula

[Chemical 29] [In the formula, Ar represents an unsubstituted or substituted aryl group bonded to a thiazole ring via a carbon atom of an aromatic ring, and R is a carbon atom bonded to a nitrogen atom via a hydrogen atom, an acyl group or a carbon atom of an aromatic ring. It represents 10 or less monovalent aromatic groups. ]
The case where the compound represented by is not included is preferable.

The compound (I) is, for example, a compound
(Ia) is preferred. As the compound (Ia),
The compounds (A) to (B) and the like are preferable. (A) R¹Is the formula:-(C = O) -R⁵ Or- (C = O)
-NR⁵R⁶[In the formula, each symbol has the same meaning as described above. ]
An amino which may have 1 or 2 acyls represented by
Group or C_1-6Alkylthio, C_6-14Arylchi
Oh, C_1-6Alkylsulfinyl, C_6-14Ally
Rusulfinyl, C_1-6Alkylsulfonyl, C
_6-14Selected from arylsulfonyl, carboxy, etc.
C optionally having 1 to 5 substituents_6-14
Aryl group; R^TwoIs C_1-6Alkyl, hydroxy and
C_1-6Substitution selected from alkyl-carbonyloxy
A pyridyl group optionally having 1 to 5 groups; R^ThreeBut
Halogen atom, optionally halogenated C_1-6A
Rukyi, optionally halogenated C_1-6Arcoki
1 to 5 substituents selected from Si and carboxy
C which may be_6-14A compound which is an aryl group (I
a). (B) R¹Is (i) a halogen atom, halogenated
May be C_1-6Alkyl, carboxy C_2-6Arche
Nyl, optionally halogenated C_1-6Arcoki
Shi, C_1-6Alkoxy-carbonyl-C_1-6Arco
Xy, hydroxy, amino, mono- or di-C_1-6A
Ruquilamino, carboxy, C_1-6Alkoxy-Cal
Bonyl, mono- or di-C_1-6Alkyl-carbamoy
Le and C_{6- 14}Selected from aryl-carbonylamino
C optionally having 1 to 5 substituents each represented by
_1-8Alkyl, C_3-6Cycloalkyl or C
_6-14Aryl (preferably C_6-10Aryl),
(Ii) 5-membered heterocyclic group, (iii) (1) C_1-6Alkyl,
(2) C_6-14Aryl, (3) C_7-16Aralchi
(4) 6-membered heterocyclic group and (5) halogen atom, C
_1-6Alkyl, C_{1 -6}Alkoxy, carboxy and
C_1-6A substituent selected from alkoxy-carbonyl
1 to 3 C each may have_1-6Archi
Le-carbonyl, C_3-6Cycloalkyl-carboni
Le, C_6-14Aryl-carbonyl, C _7-16Ara
Rukiru-carbonyl, C_1-6Alkyl-carbamoyl
Or a unit selected from 5- or 6-membered heterocycle-carbonyl
An amino group which may have 1 or 2 substituents, or di-
C_1-6Alkylamino-C_1-6Have alkylidene
Optionally an amino group, (iv) C_1-6Alkyl-cal
5- or 6-membered non-substituted by bonyl or oxo
Aromatic cyclic amino group or (v) carboxy group; R^TwoIs C
_1-6Alkyl, hydroxy and C_1-6Alkyl-Mo
Having 1 to 3 substituents selected from rubonyloxy
Optionally substituted pyridyl group; R^ThreeIs a halogen atom, C
_1-3Alkylenedioxy, may be halogenated
I C_1-6Alkyl, carboxy C_2-6Alkenyl,
C which may be halogenated_1-8Alkoxy, hydr
Roxy, C_7-16Aralkyloxy and C_{1 -6}Al
1 to 1 substituents selected from the group
C which may have 3_6-10Aryl group (substituent
As a 5-membered non-aromatic compound by combining two adjacent alkyl groups
A compound (I which may form a group carbocycle) (I
a). Further, the compound (I) or the compound (Ia) is preferred.
Specific examples include [4- (4-methoxyphenyl)
-5- (4-pyridyl) -1,3-thiazol-2-i
L] amine (Reference Example A13-14), [4-phenyl-5]
-(4-Pyridyl) -1,3-thiazol-2-yl]
Amine (Reference Example A13-15), N-methyl [4- (4
-Methoxyphenyl) -5- (4-pyridyl) -1,3
-Thiazol-2-yl] amine (Reference Example A13-1
6), N-methyl [4-phenyl-5- (4-pyridy
Lu) -1,3-thiazol-2-yl] amine (reference example
A13-47), N-methyl [4- (4-fluorophene
Nyl) -5- (4-pyridyl) -1,3-thiazole-
2-yl] amine (Reference Example A13-69), N-methyl
[4- (4-chlorophenyl) -5- (4-pyridyl)
-1,3-thiazol-2-yl] amine (Reference Example A1
3-70), N-methyl [4- (4-bromophenyl)
-5- (4-pyridyl) -1,3-thiazol-2-i
Lu] amine (Reference Example A13-71), 2-phenyl-N
-[4-phenyl-5- (4-pyridyl) -1,3-thio
Azol-2-yl] acetamide (Reference Example A23-2
9), 3-phenyl-N- [4-phenyl-5- (4-
Pyridyl) -1,3-thiazol-2-yl] propio
Namide (Reference Example A23-30), N- [4- (3-
Lolophenyl) -5- (4-pyridyl) -1,3-thia
Zol-2-yl] acetamide (Reference Example A23-4
9), N- [4- (3-chlorophenyl) -5- (4-
Pyridyl) -1,3-thiazol-2-yl] propio
Namide (Reference Example A23-50), N- [4- (3-me
Tylphenyl) -5- (4-pyridyl) -1,3-thia
Zol-2-yl] acetamide (Reference Example A23-5
1), N- [4- (3-methylphenyl) -5- (4-
Pyridyl) -1,3-thiazol-2-yl] propio
Amide (Reference Example A23-52), [4- (3-chloro)
Phenyl) -5- (4-pyridyl) -1,3-thiazo
Lu-2-yl] amine (Reference Example A23-59), [4-
(3-methylphenyl) -5- (4-pyridyl) -1,
3-thiazol-2-yl] amine (Reference Example A23-6
0), [4- (4-chlorophenyl) -5- (4-pyryl)
(Zil) -1,3-thiazol-2-yl] amine (reference
Example A23-61), [4- (4-methylphenyl) -5
-(4-Pyridyl) -1,3-thiazol-2-yl]
Amine (Reference Example A23-62), N- [4-phenyl-
5- (4-pyridyl) -1,3-thiazol-2-i
L] acetamide (Reference Example A23-71), N-phenyl
L- [4- (4-methoxyphenyl) -5- (4-pyri
(Zil) -1,3-thiazol-2-yl] amine (reference
Example A23-80), N- [4- (4-methoxyphenyl)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] nicotinamide (Reference Example A23-101), N
-[4- (4-methoxyphenyl) -5- (4-pyridy
Lu) -1,3-thiazol-2-yl] isonicotinia
Mido (Reference Example A23-102), [4- (3,4-dimme
Tylphenyl) -5- (4-pyridyl) -1,3-thia
Zol-2-yl] amine (Reference Example A23-125),
N- [4- (3,5-dimethylphenyl) -5- (4-
Pyridyl) -1,3-thiazol-2-yl] acetoa
Mido (Reference Example A23-128), [4- (2-naphthi)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] amine (Reference Example A23-144), N-ethyl
-N '-[4- (4-methoxyphenyl) -5- (4-
Pyridyl) -1,3-thiazol-2-yl] urea
(Reference Example A23-156), N- [4- (3,5-dimme
Tylphenyl) -5- (4-pyridyl) -1,3-thia
Zol-2-yl] isonicotinamide (Reference Example A23
-200), N-ethyl- [4- (4-methoxyphenyl)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] amine (Reference Example A23-269), N-propyi
Ru- [4- (3,5-dimethylphenyl) -5- (4-
Pyridyl) -1,3-thiazol-2-yl] amine
(Reference Example A23-276), N-butyl- [4- (3,
5-dimethylphenyl) -5- (4-pyridyl) -1,
3-thiazol-2-yl] amine (Reference Example A23-2
80), N-benzyl- [4- (3,5-dimethylphene
Nyl) -5- (4-pyridyl) -1,3-thiazole-
2-yl] amine (Reference Example A23-281), N-pro
Pill- [4- (4-methoxyphenyl) -5- (4-pi
Lysyl) -1,3-thiazol-2-yl] amine (see
Consideration A23-290), N-isopropyl- [4- (4
-Methoxyphenyl) -5- (4-pyridyl) -1,3
-Thiazol-2-yl] amine (Reference Example A23-29
1), N- [4- (4-methoxyphenyl) -5- (4
-Pyridyl) -1,3-thiazol-2-yl] -N '
-Phenylurea (Reference Example A23-296), 4-
[[[4- (4-Methoxyphenyl) -5- (4-pyridyl
Lu) -1,3-thiazol-2-yl] amino] carboni
Le] benzoic acid (Reference Example A23-299), methyl 4- [2
-[4- (Methylthio) phenyl] -5- (4-pyridy
L) -1,3-thiazol-4-yl] phenylete
(Reference Example A23-300), 4- [4- (3,5-di)
Methylphenyl) -5- (4-pyridyl) -1,3-thi
Azol-2-yl] phenylmethyl sulfide (reference
Example A23-302), 4- [4- (4-methoxyphenyl)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] phenylmethyl sulfoxide (Reference Example A23-
303), 4- [4- (3,5-dimethylphenyl)-
5- (4-pyridyl) -1,3-thiazol-2-i
] Phenylmethyl sulfoxide (Reference Example A23-30
5), 4- [4- (4-methoxyphenyl) -5- (4
-Pyridyl) -1,3-thiazol-2-yl] phenyl
Lumethyl sulfone (Reference Example A23-306), 4- [4
-(3,5-Dimethylphenyl) -5- (4-pyridy
Lu) -1,3-thiazol-2-yl] phenylmethyl
Sulfone (Reference Example A23-308), 4- [4- (4-
Fluorophenyl) -5- (4-pyridyl) -1,3-
Thiazol-2-yl] phenylmethyl sulfide (see
Consideration A23-309), 4- [4- (4-chlorophenyl)
) -5- (4-Pyridyl) -1,3-thiazole-2
-Yl] phenylmethyl sulfide (Reference Example A23-3
10), 4- [4- (4-fluorophenyl) -5-
(4-Pyridyl) -1,3-thiazol-2-yl] fu
Phenylmethyl sulfoxide (Reference Example A23-311),
4- [4- (4-chlorophenyl) -5- (4-pyridy
Lu) -1,3-thiazol-2-yl] phenylmethyl
Sulfoxide (Reference Example A23-312), 4- [4-
(4-Fluorophenyl) -5- (4-pyridyl)-
1,3-thiazol-2-yl] phenylmethylsulfo
(Reference Example A23-313), 4- [4- (4-chloro)
Phenyl) -5- (4-pyridyl) -1,3-thiazo
Lu-2-yl] phenylmethylsulfone (Reference Example A23
-314), N- [4- (3,5-dimethylphenyl)
-5- (4-pyridyl) -1,3-thiazol-2-i
L] -N'-phenylurea (Reference Example A23-31
5), 2-hydroxy-N- [4- (4-methoxyphen
Nyl) -5- (4-pyridyl) -1,3-thiazole-
2-yl] propionamide (Reference Example A23-32
5), 4- [4- (3,4-dimethylphenyl) -5-
(4-Pyridyl) -1,3-thiazol-2-yl] fu
Phenylmethyl sulfide (Reference Example A23-326), 4
-[4- (3,4-dimethylphenyl) -5- (4-pi
Lysyl) -1,3-thiazol-2-yl] phenylme
Tyl sulfoxide (Reference Example A23-327), 4- [4
-(3,4-Dimethylphenyl) -5- (4-pyridy
Lu) -1,3-thiazol-2-yl] phenylmethyl
Sulfone (Reference Example A23-328), 2-hydroxy-
N- [4- (4-methoxyphenyl) -5- (4-pyri
Zil) -1,3-thiazol-2-yl] acetamide
(Reference Example A23-329), 4-[[[4- (3,5-di
Methylphenyl) -5- (4-pyridyl) -1,3-thi
Azol-2-yl] amino] carbonyl] benzoic acid (see
Consideration example A23-337), 3-[[[4- (3,5-dimethyl)
Ruphenyl) -5- (4-pyridyl) -1,3-thiazo
Ru-2-yl] amino] carbonyl] benzoic acid (reference example
A23-342), or a salt thereof or the like is preferable. Also,
Specific preferred examples of compound (I) or (Ia) include 4
-(4-Fluorophenyl) -2-phenyl-5- (4
-Pyridyl) -1,3-thiazole (Reference Example A44-
1), methyl 4- [4- (3-methylphenyl) -5-
(4-Pyridyl) -1,3-thiazol-2-yl] fu
Phenyl sulfide (Reference Example A44-7), methyl 4-
[4- (3-methylphenyl) -5- (4-pyridyl)
-1,3-Thiazol-2-yl] phenyl sulfoxy
(Reference example A44-8), methyl 4- [4- (3-methyi)
Ruphenyl) -5- (4-pyridyl) -1,3-thiazo
2-l] phenylsulfone (Reference Example A44-2
6) etc. are also mentioned. Furthermore, compound (I) or (I
As a), (S) -N- [4- (3-methylphenyl) -5-
(2- (1-phenylethylamino) -4-pyridyl) -1,3-thi
Azol-2-yl] nicotinamide, (R) -N- [4- (3-
Methylphenyl) -5- (2- (1-phenylethylamino)-
4-Pyridyl) -1,3-thiazol-2-yl] nicotinami
, (S) -N- [4- (3-methylphenyl) -5- (2- (1-
Phenylethylamino) -4-pyridyl) -1,3-thiazole-2
-Yl] -2-methylnicotinamide, (R) -N- [4- (3-me
Tylphenyl) -5- (2- (1-phenylethylamino) -4-
Pyridyl) -1,3-thiazol-2-yl] -2-methylnicoti
Namide, (S) -N- [4- (3-methylphenyl) -5- (2-
(1-Phenylethylamino) -4-pyridyl) -1,3-thiazo
-2-L] -2-chloronicotinamide, (R) -N- [4-
(3-Methylphenyl) -5- (2- (1-phenylethylamido
No) -4-Pyridyl) -1,3-thiazol-2-yl] -2-chloro
Nicotinamide, (S) -N- [4- (3-methylphenyl) -5
-(2- (1-Phenylethylamino) -4-pyridyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide,
(R) -N- [4- (3-methylphenyl) -5- (2- (1-phenyl
Ruethylamino) -4-pyridyl) -1,3-thiazol-2-i
L] -2-methoxynicotinamide, N- [5- (2-benzyl
Amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thi
Azol-2-yl] nicotinamide, N- [5- (2-benzyl
Lumino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide, N-
[5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl
1,3-Thiazol-2-yl] -2-chloronicotine
Amide, N- [5- (2-benzylamino-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazol-2-yl] -2-me
Tylnicotinamide, N- [5- (2-benzoylamino-4-
Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] nicotinamide, N- [5- (2-benzoylamino-
4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -2-methylnicotinamide, N- [5- (2-benzo
Ilamino-4-pyridyl) -4- (3-methylphenyl) -1,3
-Thiazol-2-yl] -2-chloronicotinamide, N- [5
-(2-benzoylamino-4-pyridyl) -4- (3-methylphenyl
1,3-thiazol-2-yl] -2-methoxynicoti
Namide, (S) -N- (1-phenylethyl) -4- [2-ethyl]
Lu-4- (3-methylphenyl) -1,3-thiazol-5-yl]-
2-pyridylamine, (R) -N- (1-phenylethyl) -4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridylamine, (S) -N- (1-phenylethyl
) -4- [4- (3-Methylphenyl) -2-propyl-1,3-thio
Azol-5-yl] -2-pyridylamine, (R) -N- (1-f
Phenylethyl) -4- [4- (3-methylphenyl) -2-propyi
L-1,3-thiazol-5-yl] -2-pyridylamine, (S)
-N- (1-phenylethyl) -4- [2-butyl-4- (3-methyl
Phenyl) -1,3-thiazol-5-yl] -2-pyridylami
, (R) -N- (1-phenylethyl) -4- [2-butyl-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pi
Lysylamine, (S) -N- (1-phenylethyl) -4- [4-
(3-Methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridylamine, (R) -N-
(1-Phenylethyl) -4- [4- (3-methylphenyl) -2-
(4-Methylthiophenyl) -1,3-thiazol-5-yl] -2
-Pyridylamine, (S) -N- (1-phenylethyl) -4-
[4- (3-methylphenyl) -2- (4-methylsulfonyl group
1,3-Thiazol-5-yl] -2-pyridylami
, (R) -N- (1-phenylethyl) -4- [4- (3-methyl
Phenyl) -2- (4-methylsulfonylphenyl) -1,3-thi
Azol-5-yl] -2-pyridylamine, (S) -N- (1-f
Phenylethyl) -4- [2- (4-fluorophenyl) -4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridy
Lumine, (R) -N- (1-phenylethyl) -4- [2- (4-
Fluorophenyl) -4- (3-methylphenyl) -1,3-thia
Zol-5-yl] -2-pyridylamine, or its salt
preferable.

The salts of compounds (I) and (Ia) include
Examples thereof include metal salts, ammonium salts, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like. Preferable examples of the metal salt include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt, magnesium salt and barium salt; aluminum salt and the like. Preferable examples of salts with organic bases include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N'-dibenzylethylenediamine. And the like. Suitable examples of salts with inorganic acids include:
Examples thereof include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like. Preferable examples of salts with organic acids include formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfone. Examples thereof include salts with acids and p-toluenesulfonic acid. Suitable examples of salts with basic amino acids include, for example, salts with arginine, lysine, ornithine, and suitable examples of salts with acidic amino acids include, for example, salts with aspartic acid, glutamic acid, etc. To be Of these, pharmaceutically acceptable salts are preferable. For example, when the compound has an acidic functional group, an inorganic salt such as an alkali metal salt (eg, sodium salt, potassium salt, etc.), an alkaline earth metal salt (eg, calcium salt, magnesium salt, barium salt, etc.), In the case where the compound has a basic functional group such as an ammonium salt, or a salt with an inorganic acid such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, acetic acid, phthalic acid, fumaric acid, oxalic acid, etc. Examples thereof include salts with organic acids such as acids, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid and p-toluenesulfonic acid.

The method for producing the compound (I) (including the compound (Ia)) is described, for example, in WO01 / 10865, JP-A-60.
-58981, JP-A-61-1580,
Japanese Patent Publication No. 7-503023, WO 93/1507
1, DE-A-3601411, JP-A-5-70446.
It can be obtained by the method described in Japanese Patent Publication or the like or a method similar thereto. Compound (I) is configurational
When present as isomers (configurational isomers), diastereomers, conformers, etc., each can be isolated by the above-mentioned separation and purification means, if desired. When compound (I) is a racemate, it can be separated into S-form and R-form by a usual optical resolution means. In the case where compound (I) has stereoisomers, the present invention includes the case where these isomers are used alone and the case where they are a mixture thereof. In addition, compound (I) may be a hydrate or non-hydrate. The compound (I) may be labeled with an isotope (eg ³ H, ¹⁴ C, ³⁵ S) and the like.

[Compound (II)] (1) Formula that may be N-oxidized

[Chemical 30] [In the formula, R ^1a represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. To R ^2a
Is an aromatic group which may have a substituent, R ^3a represents a hydrogen atom, a pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X ^a is an oxygen atom or an optionally oxidized sulfur atom, Y ^a is a bond, an oxygen atom, an optionally oxidized sulfur atom or a formula
NR ^4a (in the formula, R ^4a represents a hydrogen atom, an optionally substituted hydrocarbon group or an acyl group), and Z ^a has a bond or a substituent. It represents a divalent chain hydrocarbon group which may be present. ] The compound or its salt represented by these, (2) The compound of (1) description whose Za is a divalent chain hydrocarbon group which may have ^a substituent, (3)
formula

[Chemical 31] [In the formula, n represents 0 or 1, and other symbols are in the item (1).
And a salt thereof.
The compound according to item (1), (4) R^1aIs (i) hydrogen source
Child, (ii) C_1-6Alkyl group, C_2-6Alkenyl
Base, C_2-6Alkynyl group, C _3-6Cycloalkyl
Base, C_6-14Aryl group or C_7-16Aralkyl
Groups [these groups include oxo, halogen atoms, C_1-3A
Rukirenedioxy, nitro, cyano, halogenated
May be C_1-6Alkyl, even if halogenated
Good C_2-6Alkenyl, carboxy C_2-6Archeni
R, optionally halogenated C_2-6Alkynyl,
C which may be halogenated_3-6Cycloalkyl,
C_6-14Aryl, optionally halogenated C
_1-8Alkoxy, C_1-6Alkoxy-carbonyl-
C_1-6Alkoxy, hydroxy, C_{6 -14}Aryl
Oxy, C_7-16Aralkyloxy, mercapto, ha
C which may be rogenated_1-6Alkylthio, C
_6-14Arylthio, C_7-16Aralkylthio, a
Mino, Mono-C_1-6Alkylamino, mono-C
_6-14Arylamino, di-C_1-6Alkylami
No, J-C_6-14Arylamino, formyl, carbo
Kish, C_1-6Alkyl-carbonyl, C_3-6Cyclo
Alkyl-carbonyl, C_1-6Alkoxy-Carbonii
Le, C_6-14Aryl-carbonyl, C_7-16Ara
Rukiru-carbonyl, C_6-14Aryloxy-cal
Bonil, C_7-16Aralkyloxy-carbonyl, 5
Or 6-membered heterocyclic carbonyl, carbamoyl, thiocarba
Moyle, Mono-C_1-6Alkyl-carbamoyl, di-
C_1-6Alkyl-carbamoyl, C_6-14Aryl
-Carbamoyl, 5- or 6-membered heterocyclic carbamoyl, C
_1-6Alkylsulfonyl, C_6-14Aryl sulfo
Nil, C_1-6Alkylsulfinyl, C_6-14Ants
Ursulfinyl, formylamino, C_1-6Alkyl
-Carbonylamino, C_6-14Aryl-carbonyl
Amino, C_1-6Alkoxy-carbonylamino, C
_1-6Alkylsulfonylamino, C_6-14Aryl
Sulfonylamino, C_1-6Alkyl-carbonyl
Shi, C_6-14Aryl-carbonyloxy, C_1-6
Alkoxy-carbonyloxy, mono-C_1-6Archi
L-carbamoyloxy, di-C_1-6Alkyl-cal
Vamoyloxy, C_6-14Aryl-carbamoyl
Xy, nicotinoyloxy, 1 nitrogen atom and carbon atom
Besides, it is selected from nitrogen atom, sulfur atom and oxygen atom.
May contain 1 to 4 1 or 2 heteroatoms
5- to 7-membered saturated cyclic amino (this cyclic amino is C
_1-6Alkyl, C_6-14Aryl, C_1-6Archi
L-carbonyl, a 5- to 10-membered aromatic heterocyclic group and
May have a substituent selected from the group consisting of oxo
I), nitrogen atoms, sulfur atoms and oxygen atoms in addition to carbon atoms
Containing 1 to 4 1 or 2 heteroatoms selected from
5- to 10-membered aromatic heterocyclic group, sulfo, sulfamo
Ilu, sulfinamoyl and sulfenamoyl
Group having a substituent selected from the group (substituent group A)
Good], (iii) having a substituent selected from Substituent Group A
Optionally, in addition to carbon atoms, nitrogen atoms, sulfur atoms and
No 1 or 2 heteroatoms selected from oxygen atoms
A 5- to 14-membered heterocyclic group containing 4 (Iv) Formula:-(C = O) -R^5a,-(C = O) -OR^5a,
-(C = O) -NR^5aR^{6 a},-(C = S) -NHR^5aor
Is -SO₂-R^7a (In the formula, R^5aIs selected from the group consisting of hydrogen atom and substituent A
C which may have a substituent_1-6Alkyl group, C
_2-6Alkenyl group, C_2-6Alkynyl group, C_{Three -6}
Cycloalkyl group, C_6-14Aryl group or C
_7-16An aralkyl group or a group selected from the substituent group A
In addition to carbon atoms, which may have a substituent, nitrogen atoms, sulfur
1 or 2 heteroatoms selected from yellow atom and oxygen atom
A 5- to 14-membered heterocyclic group containing 1 to 4 children is represented by R
^6aIs a hydrogen atom or C_1-6An alkyl group, R^7aIs
C which may have a substituent selected from the group A of substituents
_1-6Alkyl group, C_2-6Alkenyl group, C_2-6A
Lucinyl group, C_3-6Cycloalkyl group, C_6-14A
Reel base or C_7-16Aralkyl group or substituent
A carbon atom which may have a substituent selected from group A
Other than nitrogen atom, sulfur atom and oxygen atom 1
Or 5 to 14 containing 1 to 4 heteroatoms
Member of heterocyclic group), (v) amino
Group (this amino group is a substituent selected from the group A of substituents)
May have C_1-6Alkyl group, C_2-6Al
Kenyl group, C_2-6Alkynyl group, C _3-6Cycloal
Kill group, C_6-14Aryl group or C_7-16Ara
Having a substituent selected from the group R and substituents A
May be, in addition to carbon atoms, nitrogen atoms, sulfur atoms and oxygen
1 to 4 of 1 or 2 heteroatoms selected from atoms
A 5- to 14-membered heterocyclic group containing 1 to 4 groups shown in (iv) above
Having a substituent selected from the acyl group and the substituent group A
May be C_1-6Selected from the group consisting of alkylidene groups
Optionally substituted)), or (vi) one
In addition to nitrogen atom and carbon atom, nitrogen atom, sulfur atom and acid
1 or 2 heteroatoms selected from elementary atoms
5 to 7-membered non-aromatic cyclic amino which may contain 4
A group (this cyclic amino group is C_1-6Alkyl, C
_6-14Aryl, C_1-6Alkyl-carbonyl, 5
To a 10-membered aromatic heterocyclic group and oxo
R which may have a substituent selected from the group; R²Is
C which may have a substituent selected from the group A of substituents
_6-14A monocyclic or condensed polycyclic aromatic hydrocarbon group or
Charcoal which may have a substituent selected from Substituent Group A
Other than elementary atom, selected from nitrogen atom, sulfur atom and oxygen atom
5 containing 1 to 4 1 or 2 heteroatoms
A 14-membered aromatic heterocyclic group; R^3aIs a hydrogen atom,
Pyryl which may have a substituent selected from Substituent group A
Having a substituent selected from the group Z or a substituent group A
May be C_6-14Monocyclic or condensed polycyclic aromatic carbonization
A hydrogen group; X^aIs O, S, SO or SO_TwoA; Y^aIs
Bond, O, S, SO, SO_TwoOr the formula NR^4a(In the formula,
R^4aIs a hydrogen atom, a substituent selected from the substituent group A
May have C_1-6Alkyl group, C_2-6Al
Kenyl group, C_2-6Alkynyl group, C_3-6Cycloal
Kill group, C_6-14Aryl group or C_7-16Ara
Alkyl group or the acyl group shown in (iv) above)
The group^aIs a bond or a substituent selected from Group A
C which may have a substituent_{1- 15}An alkylene group,
C_2-16Alkenylene group or C_2-16Alkynile
The compound according to item (1) or (3), which represents an amide group,
(5) R^1aIs an amino group which may have a substituent
(6) R^1aIs (i) C
_1-6Alkyl group, (ii) C_1-6Alkylthio, C_1
-6Selected from alkylsulfonyl and halogen atoms
C optionally substituted with a substituent_6-14Aryl group
Or (iii) formula-(C = O) -R^{5a '}(In the formula, R ^{5a '}
Is C_1-6Alkyl group, C_6-14Aryl group
Is a nitrogen atom, sulfur atom or oxygen atom in addition to carbon atom
Contains 1 to 4 1 or 2 heteroatoms selected from
5 to 14-membered heterocyclic group)
Item (1) which is an amino group which may have one or two
Described compound, (7) R^1aIs-(C = O) -R
^{5a ' '}(In the formula, R^{5a ' '}Is C_6-14Aryl group
In addition to carbon atom, nitrogen atom, sulfur atom and oxygen atom
Containing 1 to 4 1 or 2 heteroatoms selected from
Represents a 5- to 14-membered heterocyclic group)
A (1) which is an amino group which may have 1 or 2
(8) R^2aEven if it has a substituent
Good C_6-14A compound according to item (1), which is an aryl group.
Things, (9) R^2aIs a halogen atom or C_1-6Al
C optionally substituted by Coxy_6-14An aryl group,
Or in addition to carbon atom, nitrogen atom, sulfur atom and oxygen atom
Containing 1 to 4 1 or 2 heteroatoms selected from
Item (1), which is a 5- to 14-membered aromatic heterocyclic group
Compounds listed, (10) R^2aIs C_6-14Aryl group
Or a carbon atom, a nitrogen atom, a sulfur atom and an oxygen atom.
Contains 1 to 4 1 or 2 heteroatoms selected from
The compound according to item (1), which is a 5- to 14-membered heterocyclic group.
Things, (11) R^3aIs an optionally substituted C
_6-14The compound according to item (1), which is an aryl group,
(12) R^3aIs 1 or 2 C_1-6Alkyl again
Is C_1-6C optionally substituted with alkoxy
_6-14The compound according to item (1), which is an aryl group,
(13) X^aIs a sulfur atom which may be oxidized.
The compound according to item (1), (14) X^aIs a sulfur atom
The compound according to item (1), (15) Y^aIs an oxygen atom or
Formula NR^4a(In the formula, R^4aHas the same meaning as in (1)
A compound represented by the formula (1), which is a group represented by
(16) Y^aIs an oxygen atom, optionally oxidized sulfur source
Child or expression NR^{4a '}(R^{4a '}Is C_1-6Alkyl
A compound represented by the formula (1), which is a group represented by
Things, (17) Y^aItem (1) wherein is O, NH or S
Compounds described, (18) Z^aMay have a substituent
A compound according to item (1), which is a lower alkylene group,
(19) Z^aMay have a bond or oxo
C_1-6The compound according to item (1), which is an alkylene group,
(20) R^1aIs (i) C_1-6Alkyl group, (ii) C
_1-6Alkylthio, C _1-6Sulfonyl and halogen
C optionally substituted with a substituent selected from
_6-14Aryl group or (iii) formula- (C = O) -R^5a
'(In the formula, R^{5a '}Is C_1-6Alkyl group, C
_6-14Nitrogen atom other than aryl group or carbon atom,
1 or 2 types of hetero selected from sulfur atom and oxygen atom
Shows 5 to 14 membered heterocyclic groups containing 1 to 4 atoms.
A) which may have 1 or 2 acyls represented by
Mino group; R^2aIs a halogen atom or C_1-6Arco
C optionally substituted by xy _6-14Aryl group,
Or a carbon atom, a nitrogen atom, a sulfur atom and an oxygen atom.
Contains 1 to 4 1 or 2 heteroatoms selected from
5- to 14-membered aromatic heterocyclic group; R^3aIs 1 or 2
C's_1-6Alkyl or C_1-6Replace with alkoxy
May be C_6-14Aryl group; X^aIs Iohara
Child; Y^aIs an oxygen atom or an optionally oxidized sulfur atom.
Or formula NR^{4a '}(R^{Four a '}Is C_1-6Alkyl group
A group represented by;^aIs oxo or C_1-6Al
C that may have a kill_1-6Alkylene group or bond
A compound according to item (1), which is a joint, (21) R^1aBut
-(C = O) -R^{5a ' '}(In the formula, R^{5a ' '}Is C
_6-14Nitrogen atom other than aryl group or carbon atom,
1 or 2 types of hetero selected from sulfur atom and oxygen atom
Shows 5 to 14 membered heterocyclic groups containing 1 to 4 atoms.
A) which may have 1 or 2 acyls represented by
Mino group; R^2aIs C_6-14Aryl group or carbon atom
Other than nitrogen atom, sulfur atom and oxygen atom 1
Or 5 to 14 containing 1 to 4 heteroatoms
Membered aromatic heterocyclic group; R^3aIs 1 or 2 C_1-6
Alkyl or C_1-6Even if it is substituted with alkoxy
Good C_6-14Aryl group; X^aIs a sulfur atom; Y^aBut
O, NH or S; Z^aHas a bond or oxo
May be C_1-6Item (1) which is an alkylene group
Compound of (22) N- [5- (2-benzoylamino-4-pi
Lysyl) -4- (3,5-dimethylphenyl) -1,3-thiazole
-2-yl] acetamide (Reference Example D compound 9), N- [5-
(2-benzylamino-4-pyridyl) -4- (3,5-dimethylphenyl)
(Phenyl) -1,3-thiazol-2-yl] acetamide (reference
Example D Compound 10), N- [4- [4- (4-methoxyphenyl)
-2-Methyl-1,3-thiazol-5-yl] -2-pyridyl] ben
Zamide (Reference Example D compound 13), N- [4- [2- (4-full
Orophenyl) -4- (3-methylphenyl) -1,3-thiazo
Lu-5-yl] -2-pyridyl] phenylacetamide (reference
Example D Compound 14), N- [4- [2-ethyl-4- (3-methylphenyl)
Phenyl) -1,3-thiazol-5-yl] -2-pyridyl] fe
Nylacetamide (Reference Example D compound 15-2), N- [4-
[4- (3-methylphenyl) -2-propyl-1,3-thiazole
-5-yl] -2-pyridyl] phenylacetamide (reference example
D compound 15-3), N- [4- [2-butyl-4- (3-methyl
Phenyl) -1,3-thiazol-5-yl] -2-pyridyl] fu
Phenylacetamide (Reference Example D compound 15-4), N-
[4- [4- (3-methylphenyl) -2- (4-methylthiophene
Nyl) -1,3-thiazol-5-yl] -2-pyridyl] phenyl
Luacetamide (Reference Example D compound 15-6), N- [4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] benzamide (Reference Example D compound 1
6-1), N- [4- [2-ethyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] -3-phenylp
Ropionamide (Reference Example D compound 16-2), N- [4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -3- (4-methoxyphenyl) pro
Pionamide (Reference Example D compound 16-3), N- [4- [2-
Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-y
] -2-Pyridyl] -4-phenylbutyramide (Reference Example D
Compound 16-5), N- [4- [4- (3-methylphenyl) -2
-Propyl-1,3-thiazol-5-yl] -2-pyridyl] ben
Zamide (Reference Example D compound 16-7), N- [4- [4- (3-
Methylphenyl) -2-propyl-1,3-thiazol-5-a
] -2-Pyridyl] -3-phenylpropionamide (reference
Example D Compound 16-8), N- [4- [2-butyl-4- (3-methyl)
Luphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Benzamide (Reference Example D compound 16-9), N- [4- [2-
Butyl-4- (3-methylphenyl) -1,3-thiazol-5-y
] -2-Pyridyl] -3-phenylpropionamide (reference
Example D Compound 16-10), N- [4- [2- (4-fluorophene
Nyl) -4- (3-methylphenyl) -1,3-thiazol-5-y
] -2-Pyridyl] benzamide (Reference Example D compound 16
-11), N- [4- [2- (4-fluorophenyl) -4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridy
] -3-Phenylpropionamide (Reference Example D, Compound 1
6-12), N- [4- [4- (3-methylphenyl) -2- (4-
Methylthiophenyl) -1,3-thiazol-5-yl] -2-pi
Lysyl] benzamide (Reference Example D compound 16-15),
N- [4- [4- (3-methylphenyl) -2- (4-methylthiof)
Phenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-f
Phenylpropionamide (Reference Example D compound 16-1
6), N-benzyl-N- [4- [2-ethyl-4- (3-methylphene)
Nyl) -1,3-thiazol-5-yl] -2-pyridyl] amine
(Reference Example D compound 19-2), N- [4- [2-ethyl-4- (3
-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridy
]]-N- (2-phenylethyl) amine (Reference Example D compound
19-3), N- [4- [2-ethyl-4- (3-methylpheny
) -1,3-Thiazol-5-yl] -2-pyridyl] -N- (3-fu
Phenylpropyl) amine (Reference Example D compound 19-4),
N-benzyl-N- [4- [4- (3-methylphenyl) -2-propyi
L-1,3-thiazol-5-yl] -2-pyridyl] amine (see
Consideration D Compound 19-5), N- [4- [4- (3-methylphenyl)
) -2-Propyl-1,3-thiazol-5-yl] -2-pyridy
]]-N- (2-phenylethyl) amine (Reference Example D compound
19-6), N- [4- [4- (3-methylphenyl) -2-pro
Pyr-1,3-thiazol-5-yl] -2-pyridyl] -N- (3-fu
Phenylpropyl) amine (Reference Example D compound 19-7),
N-benzyl-N- [4- [2-butyl-4- (3-methylphenyl)]
-1,3-thiazol-5-yl] -2-pyridyl] amine (reference
Example D Compound 19-8), N- [4- [2-butyl-4- (3-methyl)
Luphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (2-phenylethyl) amine (Reference Example D compound 19-
9), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -N- (3-phenylp
Ropyl) amine (Reference Example D compound 19-10), N-ben
Zil-N- [4- [4- (3-methylphenyl) -2- (4-methylthio)
Ophenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Amine (Reference Example D compound 19-17), N- [4- [4- (3-
Methylphenyl) -2- (4-methylthiophenyl) -1,3-thi
Azol-5-yl] -2-pyridyl] -N- (2-phenylethyl
R) amine (Reference Example D compound 19-18), N- [4- [4-
(3-Methylphenyl) -2- (4-methylthiophenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] -N- (3-phenyl
Propyl) amine (Reference Example D compound 19-19), N-
[4- [4- (3-methylphenyl) -2- (4-methylsulfoni
Luphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Benzamide (Reference Example D compound 20), N- [4- [4- (3-
Methylphenyl) -2- (4-methylsulfonylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] phenylacet
Amide (Reference Example D compound 21-1), N- [4- [4- (3-me
Tylphenyl) -2- (4-methylsulfonylphenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] -3-phenylpro
Pionamide (Reference Example D compound 21-2), N-benzyl
-N- [4- [4- (3-methylphenyl) -2- (4-methylsulfon
Nylphenyl) -1,3-thiazol-5-yl] -2-pyridy
Lu] amine (Reference Example D compound 21-5), N- [4- [4-
(3-Methylphenyl) -2- (4-methylsulfonylpheny
) -1,3-Thiazol-5-yl] -2-pyridyl] -N- (3-fu
Phenylpropyl) amine (Reference Example D compound 21-6),
N- [4- [4- (3-methylphenyl) -2- (4-methylsulfon
Nylphenyl) -1,3-thiazol-5-yl] -2-pyridy
]]-N- (2-phenylethyl) amine (Reference Example D compound
25-1), N- (4-fluorobenzyl) -N- [4- [4- (3
-Methylphenyl) -2- (4-methylsulfonylphenyl)
-1,3-thiazol-5-yl] -2-pyridyl] amine (reference
Example D Compound 25-2) or a salt thereof.

In the above formula, R ^1a represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, or an amino group which may have a substituent. Alternatively, it represents an acyl group. As the “acyl group” represented by R ^1a ,
For example Formula ^{:-( C = O) -R 5a,} - (C = O) -OR 5a,
^{- (C = O) -NR 5a} R 6a, - (C = S) -NHR 5a or -SO ₂ -R ^7a (wherein, R ^5a is a hydrogen atom may be an optionally substituted hydrocarbon group Or a heterocyclic group which may have a substituent, R ^6a represents a hydrogen atom or a C _1-6 alkyl group, R ^7a represents a hydrocarbon group which may have a substituent or a substituent Represents an optionally substituted heterocyclic group). In the above formula, examples of the “hydrocarbon group” of the “hydrocarbon group which may have a substituent” represented by R ^5a include, for example, a chain or cyclic hydrocarbon group (eg,
Alkyl, alkenyl, alkynyl, cycloalkyl,
Aryl, aralkyl, etc.) and the like. this house,
A chain or cyclic hydrocarbon group having 1 to 16 carbon atoms is preferable. Examples of the “alkyl” include C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl,
(Pentyl, hexyl, etc.) and the like are preferable, and C _1-3 alkyl (eg, methyl, ethyl, propyl, isopropyl) is particularly preferable. “Alkenyl” is, for example, C
_2-6 alkenyl (eg, vinyl, allyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl,
2-Methyl-2-propenyl, 1-methyl-2-propenyl, 2-methyl-1-propenyl, etc.) are preferred.
Examples of the “alkynyl” include C _2-6 alkynyl (eg, ethynyl, propargyl, 1-butynyl, 2
-Butynyl, 3-butynyl, 1-hexynyl, etc.) and the like are preferable. “Cycloalkyl” includes, for example, C _3-6
Cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like are preferable. Examples of the “aryl” include C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2
-Biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like) and the like are preferable. "Aralkyl"
Examples include C _7-16 aralkyl (eg, benzyl, phenethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, 5-
Phenylpentyl etc.) and the like are preferable.

R^5a“Even if it has a substituent,
Examples of the “substituent” of the “good hydrocarbon group” include
So, halogen atom (eg, fluorine, chlorine, bromine, iodine
Etc.), C _1-3Alkylenedioxy (eg methylenedio
Xy, ethylenedioxy, etc.), nitro, cyano, halogen
C which may be converted to_1-6Alkyl, halogenated
May be C_2-6Alkenyl, carboxy C
_2-6Alkenyl (eg, 2-carboxyethenyl, 2-
Carboxy-2-methylethenyl etc.), halogenated
May be C_2-6Alkynyl, halogenated
May be C_3-6Cycloalkyl, C_6-14Aryl
(Eg phenyl, 1-naphthyl, 2-naphthyl, 2-bi
Phenylyl, 3-biphenylyl, 4-biphenylyl, 2
-Anthryl, etc.), optionally halogenated C
_1-8Alkoxy, C_1-6Alkoxy-carbonyl-
C_1-6Alkoxy (eg, ethoxycarbonylmethyl
Xy, etc.), hydroxy, C_6-14Aryloxy
(Eg, phenyloxy, 1-naphthyloxy, 2-naphth
Cyloxy, etc.), C_7-16Aralkyloxy (eg
Benzyloxy, phenethyloxy, etc.), mercap
G, optionally halogenated C_{1- 6}Alkylchi
Oh, C_6-14Arylthio (eg, phenylthio, 1-
Naphthylthio, 2-naphthylthio, etc.), C_7-16Ara
Ruquilthio (eg, benzylthio, phenethylthio
Etc.), amino, mono-C_1-6Alkylamino (eg,
Tilamino, ethylamino, etc.), mono-C_6-14Ants
Amino (eg, phenylamino, 1-naphthylami
No, 2-naphthylamino, etc.), di-C_1-6Alkyla
Mino (eg, dimethylamino, diethylamino, ethylmeth
Tilamino, etc.), di-C_{6 -14}Arylamino (eg,
Diphenylamino, etc.), formyl, carboxy, C
_1-6Alkyl-carbonyl (eg, acetyl, propio
Nil), C_3-6Cycloalkyl-carbonyl (eg,
Cyclopropyl carbonyl, cyclopentyl carbonyl
, Cyclohexylcarbonyl, etc.), C_1-6Arcoki
Si-carbonyl (eg, methoxycarbonyl, ethoxycarboxyl
Lubonyl, propoxycarbonyl, tert-butoxycal
Bonyl etc.), C_6-14Aryl-carbonyl (e.g.
Nzoyl, 1-naphthoyl, 2-naphthoyl, etc.), C
_7-16Aralkyl-carbonyl (eg, phenyl acetyl
, 3-phenylpropionyl, etc.), C_6-14Ally
Luoxy-carbonyl (eg, phenoxycarbonyl
Etc.), C_7-16Aralkyloxy-carbonyl (eg,
Benzyloxycarbonyl, phenethyloxycarboni
Etc.) 5- or 6-membered heterocyclic carbonyl (eg, nicotinoi
Le, isonicotinoyl, thenoyl, furoyl, morpholi
Nocarbonyl, thiomorpholinocarbonyl, piperazine
-1-ylcarbonyl, pyrrolidin-1-ylcarbonyl
Etc.), carbamoyl, thiocarbamoyl, mono-C
_1-6Alkyl-carbamoyl (eg, methylcarbamoyl
, Ethylcarbamoyl), di-C_1-6Alkyl-
Carbamoyl (eg, dimethylcarbamoyl, diethylcarboyl)
Luvamoyl, ethylmethylcarbamoyl, etc.), C
_6-14Aryl-carbamoyl (eg, phenylcarbamoyl
Moyl, 1-naphthylcarbamoyl, 2-naphthylcar
Vamoyl, etc.) 5- or 6-membered heterocyclic carbamoyl (eg, 2
-Pyridylcarbamoyl, 3-pyridylcarbamoyl,
4-pyridylcarbamoyl, 2-thienylcarbamoy
, 3-thienylcarbamoyl, etc.), C _1-6Alkyl
Sulfonyl (eg, methylsulfonyl, ethylsulfonyl
Etc.), C _6-14Arylsulfonyl (eg, phenyls
Rufonyl, 1-naphthylsulfonyl, 2-naphthylsul
Honyl etc.), C_1-6Alkylsulfinyl (eg, methyl
Rusulfinyl, ethylsulfinyl, etc.), C_6-14
Arylsulfinyl (eg, phenylsulfinyl, 1
-Naphthylsulfinyl, 2-naphthylsulfinyl
Etc.), formylamino, C_1-6Alkyl-carbonyl
Amino (eg, acetylamino, etc.), C_6-14Aryl
-Carbonylamino (eg, benzoylamino, naphthoyl
Luamino etc.), C_1-6Alkoxy-carbonylamino
(Eg, methoxycarbonylamino, ethoxycarbonyl
Amino, propoxycarbonylamino, butoxycarbo
Nylamino, etc.), C_1-6Alkylsulfonylamino
(Eg, methylsulfonylamino, ethylsulfonylami
No), C_6-14Arylsulfonylamino (eg,
Phenylsulfonylamino, 2-naphthylsulfonylami
No, 1-naphthylsulfonylamino, etc.), C_1-6Al
Kill-carbonyloxy (eg acetoxy, propioni
Luoxy, etc.), C_6-14Aryl-carbonyloxy
(Eg benzoyloxy, naphthylcarbonyloxy
Etc.), C_1-6Alkoxy-carbonyloxy (eg,
Toxycarbonyloxy, ethoxycarbonyloxy,
Propoxycarbonyloxy, butoxycarbonyloxy
Etc.), Mono-C _1-6Alkyl-carbamoyloxy
(Eg, methylcarbamoyloxy, ethylcarbamoyl
Oxy), di-C_1-6Alkyl-carbamoyl oki
Ci (eg, dimethylcarbamoyloxy, diethylcarba
Moyloxy etc.), C_6-14Aryl-carbamoyl
Oxy (eg, phenylcarbamoyloxy, naphthylca)
Luvamoyloxy, etc.), nicotinoyloxy, substituents
It may have 5 to 7 membered saturated cyclic amino, 5 not
10-membered aromatic heterocyclic group (eg, 2-thienyl, 3-thiene
Nyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2
-Quinolyl, 3-quinolyl, 4-quinolyl, 5-quinoli
8-quinolyl, 1-isoquinolyl, 3-isoquinolyl
L, 4-isoquinolyl, 5-isoquinolyl, 1-india
Ril, 2-indolyl, 3-indolyl, 2-benzoti
Azolyl, 2-benzo [b] thienyl, 3-benzo
[B] Thienyl, 2-benzo [b] furanyl, 3-ben
Zo [b] furanyl, etc.), sulfo, sulfamoyl, sul
Finamoyl, sulfenamoyl and the like can be mentioned. The
The “hydrocarbon group” is, for example, a group capable of substituting the above substituents.
Have 1 to 5, preferably 1 to 3,
Also, when the number of substituents is 2 or more, each substituent is the same or
May be different.

The above-mentioned "optionally halogenated C
_{As the} " _1-6 alkyl", for example, C _1-6 alkyl optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) (eg, Methyl, ethyl, propyl, isopropyl,
Butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.) and the like. As a specific example,
Methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoropropyl, isopropyl, butyl , 4,4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6-trifluorohexyl, etc. Can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkenyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg,
C, which may have (fluorine, chlorine, bromine, iodine, etc.)
_2-6 alkenyl (eg vinyl, propenyl, isopropenyl, 2-buten-1-yl, 4-penten-1-yl, 5-hexen-1-yl) and the like can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkynyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.)
C _2-6 alkynyl which may have (eg, 2-butyn-1-yl, 4-pentyn-1-yl, 5-hexyn-1-yl, etc.) and the like can be mentioned. The above-mentioned “optionally halogenated C _3-6 cycloalkyl” has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.). Optionally C _3-6 cycloalkyl (eg, cyclopropyl,
Cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like. Specific examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4,4-
Dichlorocyclohexyl, 2,2,3,3-tetrafluorocyclopentyl, 4-chlorocyclohexyl and the like can be mentioned. The above “optionally halogenated C _1-8
As the "alkoxy", for example, C _1-8 alkoxy (eg, methoxy, ethoxy) optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine etc.) , Propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy, etc.) and the like. Specific examples include, for example, methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy,
4,4,4-trifluorobutoxy, isobutoxy, se
Examples include c-butoxy, pentyloxy, hexyloxy and the like. The above-mentioned “optionally halogenated C _1-6 alkylthio” has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) And C _1-6 alkylthio (eg, methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec-butylthio, tert-butylthio, etc.) and the like. Specific examples include methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like.

Examples of the "5- to 7-membered saturated cyclic amino" of the above-mentioned "5- to 7-membered saturated cyclic amino optionally having a substituent" include, for example, one nitrogen atom and a carbon atom, and a nitrogen atom. , Which may contain 1 to 4 1 or 2 heteroatoms selected from sulfur atom and oxygen atom 5
To 7-membered saturated cyclic amino, and specific examples thereof include pyrrolidin-1-yl, piperidino, piperazine-
1-yl, morpholino, thiomorpholino, hexahydroazepin-1-yl and the like can be mentioned. Examples of the “substituent” of the “5- to 7-membered saturated cyclic amino optionally having substituent (s)” include C _1-6 alkyl (eg, methyl,
Ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.), C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl, _{etc.), C 1-6}
Alkyl-carbonyl (eg, acetyl, propionyl, etc.), 5- to 10-membered aromatic heterocyclic group (eg, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-
Pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl,
3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b]. 1 to 3 furanyl, 3-benzo [b] furanyl and the like, oxo and the like.

The "heterocyclic group" of the "optionally substituted heterocyclic group" represented by R ^5a is, for example, 1 or 2 selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to the carbon atom. 5 to 14 membered (monocyclic, bicyclic or tricyclic) heterocyclic ring containing 1 to 4 heteroatoms, preferably (i) 5 to 14 membered (preferably 5 to 10 membered, particularly preferably 5) To 6-membered aromatic heterocycle, (ii) 5 to 10-membered (preferably 5 to 6-membered) non-aromatic heterocycle, or (iii) 7 to 10-membered heterocyclic bridged ring
Examples include monovalent groups formed by removing individual hydrogen atoms. Examples of the above-mentioned “5- to 14-membered (preferably 5 to 10-membered) aromatic heterocycle” include, for example, thiophene, benzo [b] thiophene, benzo [b] furan, benzimidazole, benzoxazole, benzothiazole and benziso. Thiazole, naphtho [2,3-b] thiophene,
Furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole,
Isoindole, 1H-indazole, purine, 4H-
Quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline,
Carbazole, β-carboline, phenanthridine, acridine, phenazine, thiazole, isothiazole,
An aromatic heterocycle such as phenothiazine, isoxazole, furazan, phenoxazine, or one or more (preferably 1 or 2) aromatic rings (eg, benzene ring) of these rings (preferably monocycles); Examples thereof include rings formed by condensation. The above "5- to 10-membered non-aromatic heterocycle"
Examples thereof include pyrrolidine, imidazoline, pyrazolidine, pyrazoline, piperidine, piperazine, morpholine, thiomorpholine, dioxazole, oxadiazoline, thiadiazoline, triazoline, thiadiazole, dithiazole and the like. Above "7 to 10
Examples of the “membered hetero bridge ring” include quinuclidine, 7-
Azabicyclo [2.2.1] heptane and the like can be mentioned.
The “heterocyclic group” is preferably 5 to 1 containing preferably 1 to 4 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom.
It is a 4-membered (preferably 5- to 10-membered) (monocyclic or bicyclic) heterocyclic group. Specifically, for example, 2-thienyl, 3-thienyl, 2-furyl, 3-furyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3
-Quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, 3 -Pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-indolyl, 2-indolyl, 3
-Aromatic heterocyclic groups such as indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b] furanyl, for example 1-pyrrolidinyl , 2-pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl And non-aromatic heterocyclic groups such as morpholino and thiomorpholino. Of these, for example, a 5- or 6-membered heterocyclic group containing 1 to 3 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom is more preferable. Specifically, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl,
2-furyl, 3-furyl, pyrazinyl, 2-pyrimidinyl, 3-pyrrolyl, 3-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-pyrrolidinyl, 2-
Pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-
Examples thereof include piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like. Examples of the "substituent" of the "heterocyclic group ^optionally having substituent (s)" include the "substituent" of the "hydrocarbon group optionally having substituent (s)" represented by R ^5a above. The same thing is mentioned. The “heterocyclic group” may have, for example, 1 to 5, preferably 1 to 3 substituents at the substitutable position. When the number of substituents is 2 or more, each substituent is It may be the same or different.

Examples of the "C _1-6 alkyl" represented by R ^6a include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl and the like. Examples of the “hydrocarbon group which may have a substituent” and the “heterocyclic group which may have a substituent” represented by R ^7a include, for example, the “hydrogen group having a substituent” represented by R ^5a. And a "heterocyclic group which may have a substituent (s)". Examples of the "hydrocarbon group optionally having substituent (s)" and "heterocyclic group optionally having substituent (s)" represented by R ^1a include, for example, "having a substituent group" represented by R ^5a above. And a "heterocyclic group which may have a substituent (s)".

The "optionally substituted amino group" for R ^1a includes, for example, (1) an optionally substituted amino group and (2) a substituted group. Examples thereof include a cyclic amino group which may be possessed. Above (1)
The "substituent" of the "amino group which may have 1 or 2 substituents" is, for example, a hydrocarbon group which may have a substituent, or a substituent which may have a substituent. Examples thereof include a heterocyclic group, an acyl group, and an alkylidene group which may have a substituent. These "hydrocarbon group optionally having substituent (s)" and "heterocyclic group optionally having substituent (s)" are "carbon optionally having substituent (s)" for R ^5. The same groups as the “hydrogen group” and “heterocyclic group optionally having substituent (s)” can be mentioned, respectively. Examples of the “acyl group” include those similar to the “acyl group” for R ¹ . Examples of the “alkylidene group” of the “alkylidene group optionally having substituent (s)” include C _1-6 alkylidene group (eg, methylidene, ethylidene, propylidene, etc.) and the like. The "substituent" of the "alkylidene group which may have a substituent (s)" is the same as the "substituent" of the "hydrocarbon group which may have a substituent (s)" for R ^5a . Things 1 to 5
And preferably 1 to 3. "Substituent" of the above "amino group optionally having 1 or 2 substituents"
When is 2, each substituent may be the same or different.

The "cyclic amino group" of the above-mentioned "cyclic amino group which may have a substituent (s)" includes, in addition to one nitrogen atom and a carbon atom, a nitrogen atom, a sulfur atom and an oxygen atom. 1 to 4 of 1 or 2 heteroatoms selected from
And a 5- to 7-membered non-aromatic cyclic amino group which may be included, and specific examples include pyrrolidin-1-yl,
Piperidino, piperazin-1-yl, morpholino, thiomorpholino, hexahydroazepin-1-yl, imidazolidin-1-yl, 2,3-dihydro-1H-imidazol-1-yl, tetrahydro-1 (2H) -pyrimidinyl , 3,6-dihydro-1 (2H) -pyrimidinyl, 3,4-dihydro-1 (2H) -pyrimidinyl and the like. "Cyclic amino which may have a substituent"
The "substituent" is, for example, the "substituent" of the "hydrocarbon group which may have a substituent" represented by R ^5.
As described in detail above, "5 to 7 optionally having substituent (s)"
The same as the "substituent" of the "membered saturated cyclic amino group"
To three. Specific examples of the 5- to 7-membered non-aromatic cyclic amino group having 1 oxo include 2-oxoimidazolidin-1-yl, 2-oxo-2,3-dihydro-1H-imidazol-1-yl, 2-oxotetrahydro-1 (2H) -pyrimidinyl, 2-oxo-
3,6-dihydro-1 (2H) -pyrimidinyl, 2-oxo-3,4-dihydro-1 (2H) -pyrimidinyl,
2-oxopyrrolidin-1-yl, 2-oxopiperidino, 2-oxopiperazin-1-yl, 3-oxopiperazin-1-yl, 2-oxo-2,3,4,5,6,7-
Hexahydroazepin-1-yl and the like can be mentioned.

R^1aMay have a substituent
An amino group, an aryl group which may have a substituent, and
An alkyl group which may have a substituent and the like are preferable. The
More preferred as "an amino group which may have a substituent (s)"
Specifically, the formula:-(C = O) -R^5a,-(C = O) -O
R^5a,-(C = O) -NR^5aR^6a,-(C = S) -NH
R^5aOr-SO₂-R^7a(In the formula, each symbol is the same as above.
Even if it has 1 or 2 acyls represented by
It is a good amino group. Particularly preferably, the formula:-(C = O)
-R^5aOr- (C = O) -NR^5aR^6a(Each symbol in the formula
Has the same meaning as above) 1 or 2 acyl represented by
It is an amino group which may have. The “having a substituent
The "aryl group which may be present" is preferably, for example, C
_{1- 6}Alkylthio, C_6-14Arylthio, C
_1-6Alkylsulfinyl, C _6-14Arylsul
Finil, C_1-6Alkylsulfonyl, C_6-14A
Substituent selected from reelsulfonyl, carboxy, etc.
C optionally having 1 to 5_6-14Aryl group
(Preferably phenyl etc.) and the like. Said "has a substituent
As the “optionally substituted alkyl group”, for example,
Rogen atom, C_1-6Alkoxy, hydroxy, carbo
Kiss and C_1-6Selected from alkoxy-carbonyl, etc.
C optionally substituted with 1 to 3 substituents_1
-6Alkyl groups (eg methyl, ethyl, propyl, iso
Propyl, butyl, isobutyl, sec-butyl, tert-butyl
(E.g., chill and the like), especially C such as methyl and ethyl
_1-3Alkyl groups are preferred. Among them, R^1aAs
Is (i) C_1-6Alkyl group (eg, methyl, ethyl,
C such as propyl and butyl_1-4Alkyl group), (ii)
C_1-6Alkylthio (eg, methylthio), C_1-6A
Lucylsulfonyl (eg, methylsulfonyl) and halo
A position selected from a gen atom (eg, chlorine atom, fluorine atom)
C optionally substituted with a substituent_6-14Aryl group
(Eg, a phenyl group) or (iii) formula — (C═O) —R^5a
'[In the formula, R^{5a '}Is C_1-6Alkyl group (eg, methyl
C such as le_{1 -3}Alkyl group), C_6-14Aryl
Groups other than groups (eg phenyl groups) or carbon atoms
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 14-membered heterocyclic group containing 1 to 4 terror atoms
(For example, in addition to carbon atoms such as pyridyl groups, nitrogen atoms, sulfur
1 to 2 heteroatoms selected from atoms and oxygen atoms
A 5- or 6-membered heterocyclic group including a child)]
An amino group which may have one or two acyl groups is preferable.
Good R^{5a '}And R^{5a ' '}As a phenyl group
Alternatively, a pyridyl group is preferable.

In the above formula, R ^2a represents an aromatic group which may have a substituent. Examples of the “aromatic group” of the “aromatic group which may have a substituent” represented by R ^2a include an aromatic hydrocarbon group and an aromatic heterocyclic group.
Examples of the "aromatic hydrocarbon group" include monocyclic or condensed polycyclic (2 or 3 ring) aromatic hydrocarbon groups having 6 to 14 carbon atoms. Specific examples thereof include C _6-14 aryl such as phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like, preferably C.
_6-10 aryl etc. (eg phenyl, 1-naphthyl,
2-naphthyl and the like, preferably phenyl and the like). The “aromatic heterocyclic group” is a 5 to 14-membered (preferably 5 to 10-membered) containing 1 to 4 1 or 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom. ) Monovalent groups and the like formed by removing any one hydrogen atom from an aromatic heterocycle can be mentioned. Examples of the above-mentioned “5- to 14-membered (preferably 5 to 10-membered) aromatic heterocycle” include, for example, thiophene, benzo [b] thiophene, benzo [b] furan, benzimidazole, benzoxazole, benzothiazole and benziso. Thiazole, naphtho [2,3-b] thiophene,
Furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole,
Isoindole, 1H-indazole, purine, 4H-
Quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline,
Carbazole, β-carboline, phenanthridine, acridine, phenazine, thiazole, isothiazole,
An aromatic heterocycle such as phenothiazine, isoxazole, furazan, phenoxazine, or one or more (preferably 1 or 2) aromatic rings (eg, benzene ring) of these rings (preferably monocycles); Examples thereof include rings formed by condensation. The "aromatic heterocyclic group" is preferably a 5 to 14-membered (preferably 1 to 4) heteroatom selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom, and preferably 1 to 4 heteroatoms. 5 to 10
Member) (monocyclic or bicyclic) aromatic heterocyclic group and the like, specifically, for example, 2-thienyl, 3-thienyl, 2-furyl,
3-furyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-
Quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, 3-pyridazinyl, 3-isothiazolyl, 3- Isoxazolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b]
Examples thereof include aromatic heterocyclic groups such as thienyl, 2-benzo [b] furanyl and 3-benzo [b] furanyl. Examples of the "substituent" of the "aromatic group ^optionally having substituent (s)" include "substituent" of "hydrocarbon group optionally having substituent (s)" for R ^5a. The same one 1
To 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituent may be the same or different.

R ^2a is, in addition to (1) a C _6-14 aryl group which may have a substituent or (2) a carbon atom which may have a substituent, a nitrogen atom, a sulfur atom and oxygen. A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 1 or 2 heteroatoms selected from atoms is preferable, and among them, (1) halogen atom (eg, chlorine atom, fluorine atom) or C _{1- 6} alkoxy (eg, methoxy)
A C _6-14 aryl group (eg, a phenyl group, a naphthyl group) which may be substituted with, and (2) 1 or 2 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to the carbon atom. 5 to 14-membered aromatic heterocyclic groups containing 4 to 4 (eg, 5 to 14 containing 1 to 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms such as pyridyl group and thienyl group) A 6-membered aromatic heterocyclic group) and the like are preferable, and a phenyl group and a pyridyl group are particularly preferable.

In the above formula, R^3aHas a hydrogen atom and a substituent
Optionally having a pyridyl group or a substituent
Represents an aromatic hydrocarbon group. R^3a“Substituent
As a "substituent" of the "pyridyl group which may have"
Is, for example, R^5a"Has a substituent
And the same as the "substituent" of "good hydrocarbon group"
Be done. The "pyridyl group" is, for example, substituted by the above-mentioned substituent.
1 to 5, preferably 1 to 3 in possible positions
And the number of substituents is 2 or more, each substituent is
May be the same or different. In addition, the "pyridyl
The ring nitrogen atom of the “group” may be N-oxidized.
Yes. R^3a"Aromatic which may have a substituent
The “aromatic hydrocarbon group” of the “group hydrocarbon group” is as defined above.
R^2a"Aromatic which may have a substituent
And the same as the "aromatic hydrocarbon group" of "group"
Preferably phenyl, 1-naphthyl, 2-na
Futyl, 2-biphenylyl, 3-biphenylyl, 4-bi
C such as phenylyl and 2-anthryl_6-14Aryl
Etc., more preferably C_6-10Aryl etc.
Nil, 1-naphthyl, 2-naphthyl and the like, preferably fe
Nil, etc.) and the like. R^3a"Has a substituent
As the “substituent” of the “optional aromatic hydrocarbon group”,
R mentioned above^2a"May have a substituent
The same as the substituents of the "aromatic group" and the like can be mentioned. R
^3aAs, C optionally having a substituent_6-14A
Reel groups are preferred, especially 1 or 2 Cs_1-6
Alkyl (eg, methyl, ethyl, etc.) or C_1-6A
Substituted with lucoxy (eg, methoxy, ethoxy, etc.)
May be C _6-14Aryl group and the like are preferable, and particularly
1 or 2 C_1-6Alkyl or C_1-6Arco
Phenyl group optionally substituted with xy (eg, 3-meth)
Xyphenyl, 2-methylphenyl, 2,4-dimethyl
Such as phenyl) is preferred.

In the above formula, X^aIs an oxygen atom or is oxidized
Indicates a sulfur atom that may be present. X^a"Oxidized
“Sulfur atom which may be present” includes S, SO, SO _TwoBut
Can be mentioned. X^aPreferably, even if oxidized
It is a good sulfur atom. More preferably S. The formula
Medium, Y^aIs a bond, oxygen atom, or sulfur that may be oxidized.
Yellow atom or formula NR^4a(In the formula, R^4aIs a hydrogen atom, a substituent
Represents a hydrocarbon group or an acyl group which may have)
Show. Y^a"The optionally oxidized sulfur source
"Child," S, SO, SO _TwoIs mentioned.

The "hydrocarbon group which may have a substituent (s)" for R ^4a is the same as the "hydrocarbon group which may have a substituent (s)" for R ^5a. And C, such as methyl and ethyl, among others.
Preferred are _1-6 alkyl groups, especially C _1-3 alkyl groups such as methyl. Examples of the “acyl group” for R ^4a include the same ones as the “acyl group” for R ^1a .

As Y ^a , an oxygen atom, an optionally oxidized sulfur atom, a group represented by the formula NR ^4a (in the formula, R ^4a has the same meaning as described above) and the like are preferable, and an oxygen atom is particularly preferable. , An optionally oxidized sulfur atom, formula NR ^4a
A group represented by ^“ (R ^{4a ′} is a hydrogen atom or a C _1-6 alkyl group) is preferable, and further, an oxygen atom, S, S
O ₂ , NH, N (CH ₃ ) and the like are preferable, and O or NH is particularly preferable.

In the above formula, Z^aHas a bond or substituent
A divalent chain hydrocarbon group which may be present is shown. Z^aTable
“A divalent chain hydrocarbon that may have a substituent
Examples of the “divalent chain hydrocarbon group” of “group” include C
_1-15Alkylene groups (eg methylene, ethylene,
Ropylene, Butylene, Pentamethylene, Hexamethylene
Amine, heptamethylene, octamethylene, etc., preferably C
_1-6Alkylene, etc.), C_2-16Alkenylene group (eg
For example vinylene, propylene, 1-butenylene, 2-butene
Nylene, 1-pentenylene, 2-pentenylene, 3-pe
N) and C)_2-16Alkynylene group (Echinile
, Propynylene, 1-butynylene, 2-butynylene,
1-pentynylene, 2-pentynylene, 3-pentynile
Etc.) and the like, and preferably C_1-15Alkylene
A group, particularly preferably C_1-6An alkylene group and the like. Z
^aRepresented by "a divalent chain carbon which may have a substituent
Examples of the “substituent” of the “hydrogen group” include the above R^5aso
Of the "hydrocarbon group which may have a substituent (s)"
The same thing as a "substituent" etc. are mentioned. Z^aAs
Is C_1-3Alkyl (eg, methyl), oxo, etc.
A lower alkylene group which may have a substituent (eg methylene
C such as ethylene, ethylene and propylene _1-6Alkylene
Groups, especially C_1-3Alkylene group) is preferable,
C which may have oxo_1-6Alkylene group (eg,
C such as methylene, ethylene, propylene_1-3Archi
Ren groups, especially methylene) are preferred. More specifically
Is Z^aAs -CH_Two-,-(CH_Two)_Two-,-
(CH_Two) _Three-, -CO-, -CH_TwoCO-,-(CH
_Two)_TwoCO-, -CH (CH_Three)-Is used,
To -CH_Two-, -CO- and the like are preferable.

The nitrogen atom in compound (II) may be N-oxidized. Expression

[Chemical 32] [The symbols in the formulas have the same meanings as described above. ] The nitrogen atom as a constituent atom of the 4-pyridyl group substituted at the 5-position of the ring represented by

[Chemical 33] [In the formula, n represents 0 or 1, and other symbols have the same meanings as described above. ] The compound represented by these, its salt, etc. are preferable.

As the compound (II), for example, the following compounds (A) to (F) are preferably used. (A) R ^1a is an ^optionally substituted amino group, R ^1a
2a is a C _6-14 aryl group _optionally having a substituent, R ^3a is a C _6-14 aryl group _optionally having a substituent, X is a sulfur atom, Y is an oxygen atom or a formula NR.
Compound (II) wherein the group represented by ^4a (in the formula, R ^4a has the same meaning as described above) or (and) Z is a lower alkylene group which may have a substituent. (B) R ^1a is (i) a C _1-6 alkyl group (eg, C _1-4 alkyl group such as methyl, ethyl, propyl, butyl), (ii) C _1-6 alkylthio (eg, methylthio), C C optionally substituted with a substituent selected from _1-6 alkylsulfonyl (eg, methylsulfonyl) and halogen atom (eg, chlorine atom, fluorine atom)
_6-14 aryl group (eg, phenyl group) or (iii)
Formula ^{- (C = O) -R 5a} ' wherein, R ^5a' is _{C 1-6} alkyl group (e.g., _{C 1-3} alkyl group such as methyl),
C _6-14 aryl group (eg, phenyl group) or 5 to 14-membered heterocyclic group containing 1 to 4 1 or 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom ( Examples of the present invention include a 5- to 6-membered heterocyclic group containing 1 to 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms such as pyridyl group). 2 optionally have amino groups; R ^2a is a halogen atom (eg, chlorine atom, fluorine atom) or C _1-6 alkoxy (eg, methoxy)
A C _6-14 aryl group (eg, a phenyl group, a naphthyl group) optionally substituted with 1 to 4 kinds of 1 or 2 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom. 5 to 14-membered aromatic heterocyclic group containing 1 to 2 members (eg, pyridyl group, thienyl group, etc., and 1 to 2 hetero atoms selected from nitrogen atom, sulfur atom and oxygen atom) Aromatic heterocyclic group); R ^3a is a C _6-14 aryl group optionally substituted with 1 or 2 C _1-6 alkyl (eg, methyl) or C _1-6 alkoxy (eg, methoxy). (Particularly a phenyl group); X ^a is a sulfur atom; Y ^a is an oxygen atom,
Optionally oxidized sulfur atom or formula NR
^{4a '(R 4 a'} is a hydrogen atom or a _{C 1-6} alkyl group) group represented by (in particular, an oxygen atom, S, _SO 2, N
H, N (CH ₃ ), etc.); Z ^a is oxo or C _1-6
Compound (II) which is a C _1-6 alkylene group (especially C _1-3 alkylene group) which may have alkyl (eg, C _1-3 alkyl such as methyl) or a bond. (C) R ^1a is of the formula-(C = O) -R ^{5a ' '} [wherein R ^{5a
“ ”} Is a C _6-14 aryl group (eg, phenyl group) or a 5- to 14-membered hetero group containing 1 to 4 1 or 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom. Represents a cyclic group (eg, a 5- to 6-membered heterocyclic group containing 1 to 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms such as pyridyl group)] 1 or 2 amino groups which may have 1 or 2; R ^2a is a C _6-14 aryl group (eg, a phenyl group) or one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom. A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 heteroatoms (eg, 1 to 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom such as pyridyl group 5 To 6-member fragrance Group heterocyclic group); R ^3a is 1
Or two C _1-6 alkyl (eg methyl) or C
C _6-14 aryl group (especially phenyl group) which may be substituted with _1-6 alkoxy (eg, methoxy); X ^a
Is a sulfur atom; Y ^a is O, NH or S; Z ^a is ^a C _1-6 alkylene group which may have ^a bond or oxo (particularly C such as methylene or ethylene which may have oxo). A compound (II) which is a _1-3 alkylene group). (D) Compound (II) produced in Reference Examples D1 to 79. (E) [4- (3,5-Dimethylphenyl) -5- (2-phenylmethyloxy-4-pyridyl) -1,3-thiazol-2-yl] amine (Reference Example D compound 1), N- [4- [2-benzoylamino-4-
(4-Methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Compound 2 of Reference Example D), N- [4- (4-methoxyphenyl) -5- [2-[( 3-Pyridylcarbonylamino)]-4-pyridyl] -1,3-thiazol-2-yl] nicotinamide (Reference Example D compound 3), N- [4- [2-amino-4- (4-methoxyphenyl) ) -1,3-Thiazol-5-yl] -2-pyridyl] benzamide (Reference Example D compound 4), N- [4- [2-amino-4-]
(3,5-Dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Reference Example D compound 5), N- [4- [2-
Amino-4- (3,5-dimethylphenyl) -1,3-thiazole-5-
Iyl] -2-pyridyl] benzylamine (Reference Example D compound 6), N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] benzamide hydrochloride (Reference Example D compound 7), N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazole-5] -Yl] -2-pyridyl] benzylamine dihydrochloride (Reference Example D compound 8). (F) N- [5- (2-benzoylamino-4-pyridyl) -4-
(3,5-Dimethylphenyl) -1,3-thiazol-2-yl] acetamide (Reference Example D compound 9), N- [5- (2-benzylamino-4-pyridyl) -4- (3,5 -Dimethylphenyl) -1,3
-Thiazol-2-yl] acetamide (Reference Example D compound 1
0), N- [4- [4- (4-methoxyphenyl) -2-methyl-1,
3-Thiazol-5-yl] -2-pyridyl] benzamide (Reference Example D compound 13), N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3- Thiazol-5-yl] -2-pyridyl] phenylacetamide (Reference Example D compound 14), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-Pyridyl] phenylacetamide (Reference Example D compound 15-2), N- [4- [4-
(3-Methylphenyl) -2-propyl-1,3-thiazole-5-
Il] -2-pyridyl] phenylacetamide (Reference Example D
Compound 15-3), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide (Reference Example D compound 15-4) ), N- [4-
[4- (3-Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide (Reference Example D compound 15-6), N- [4 -[2-
Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Reference Example D compound 16
-1), N- [4- [2-ethyl-4- (3-methylphenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Reference Example D compound 16-2), N- [4- [2-
Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3- (4-methoxyphenyl) propionamide (Reference Example D compound 16-3), N- [ 4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl]-
2-Pyridyl] -4-phenylbutyramide (Reference Example D compound 16-5), N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl]- 2-Pyridyl] benzamide (Reference Example D compound 16-7), N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl]-
2-Pyridyl] -3-phenylpropionamide (Reference Example D
Compound 16-8), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Reference Example D compound 16-9) , N- [4- [2-Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl]-
2-Pyridyl] -3-phenylpropionamide (Reference Example D
Compound 16-10), N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Reference Example D) Compound 16
-11), N- [4- [2- (4-fluorophenyl) -4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Reference Example D compound 1
6-12), N- [4- [4- (3-methylphenyl) -2- (4-
Methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Reference Example D compound 16-15),
N- [4- [4- (3-Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Compound of Reference Example D 16-1
6), N-benzyl-N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine (Reference Example D compound 19-2) ), N- [4- [2-ethyl-4- (3
-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Reference Example D compound 19-3), N- [4- [2-ethyl- 4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Reference Example D compound 19-4),
N-benzyl-N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] amine (Reference Example D compound 19-5), N -[4- [4- (3-Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Reference Example D compound 19- 6), N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (reference example) D compound 19-7),
N-benzyl-N- [4- [2-butyl-4- (3-methylphenyl)]
-1,3-thiazol-5-yl] -2-pyridyl] amine (Reference Example D compound 19-8), N- [4- [2-butyl-4- (3-methylphenyl) -1,3- Thiazol-5-yl] -2-pyridyl]-
N- (2-phenylethyl) amine (Reference Example D compound 19-
9), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Reference Example D compound 19-10), N-benzyl-N- [4- [4- (3-methylphenyl)- 2- (4-Methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Amine (Reference Example D compound 19-17), N- [4- [4- (3-
Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Reference Example D compound 19-18), N- [4- [4-
(3-Methylphenyl) -2- (4-methylthiophenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Reference Example D compound 19-19), N-
[4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Benzamide (Reference Example D compound 20), N- [4- [4- (3-
Methylphenyl) -2- (4-methylsulfonylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide (Reference Example D compound 21-1), N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) ) -1,
3-Thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Reference Example D compound 21-2), N-benzyl
-N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine (Reference Example D compound 21-5 ), N- [4- [4-
(3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Reference Example D compound 21-6 ),
N- [4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Reference Example D compound 25-1), N- (4-fluorobenzyl) -N- [4- [4- (3
-Methylphenyl) -2- (4-methylsulfonylphenyl)
-1,3-Thiazol-5-yl] -2-pyridyl] amine (Reference Example D compound 25-2).

Examples of the salt of the compound (II) include metal salts, ammonium salts, salts with organic bases, salts with inorganic acids,
Examples thereof include salts with organic acids, salts with basic or acidic amino acids, and the like. Preferable examples of the metal salt include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt, magnesium salt and barium salt; aluminum salt and the like. Preferable examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine,
Examples thereof include salts with N, N′-dibenzylethylenediamine and the like. Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like. Suitable examples of salts with organic acids include, for example, formic acid,
Examples thereof include salts with acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid and p-toluenesulfonic acid. Suitable examples of salts with basic amino acids include, for example, salts with arginine, lysine, ornithine, and suitable examples of salts with acidic amino acids include, for example, salts with aspartic acid, glutamic acid, etc. To be Of these, pharmaceutically acceptable salts are preferable. For example, when the compound has an acidic functional group, an inorganic salt such as an alkali metal salt (eg, sodium salt, potassium salt, etc.), an alkaline earth metal salt (eg, calcium salt, magnesium salt, barium salt, etc.), In the case where the compound has a basic functional group such as an ammonium salt, or a salt with an inorganic acid such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, acetic acid, phthalic acid, fumaric acid, oxalic acid, etc. Examples thereof include salts with organic acids such as acids, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid and p-toluenesulfonic acid. Compound (II) or a salt thereof is WO0
It can be manufactured according to the method described in 0/64894. In the above formula, R ^1a , R ^2a , R ^3a ,
X ^a , Y ^a and Z ^a are each WO00 / 6489.
It corresponds to R ¹ , R ² , R ³ , X, Y and Z described in Japanese Patent Publication No.

[Compound (III)] formula

[Chemical 34] [Wherein a is N or C; b is CH when a is N,
when a is C, then O; = means that the azole ring is an imidazole ring
Or a single bond or double depending on whether it is an oxazole ring
Bond; Z_bIs N or CH; W_bIs -NR_6b-Y
_b-(R_6bIs a hydrogen atom, C_1-4Alkyl group, C_3-
8Cycloalkyl group, C_3-8Cycloalkyl-C
_1-3Alkyl group, C_{6-1 8}Aryl group, C_3-18
Heteroaryl group, C_7-19Aralkyl group or C
_4-19A heteroaralkyl group,_b-Is C_1-4A
A alkylene group or a bond), -O- or -S-
To R_2bIs a phenyl group (halogen atom, trifluoro
Methyl, cyano, amide, thioamide, carboxylate
G, thiocarboxylate, C_1-4Alkoxy, C
_1-4Alkyl, amino and mono- or di-C_1-4
1 or more selected from the group consisting of alkylamino
R which may be substituted with the above substituents)_3bIs hydrogen
Atom, halogen atom, C_1-10Alkyl group, C_2-4
Alkenyl group, C_3-10Cycloalkyl group, C
_3-18Heterocycloalkyl group, C_{6 -18}Aryl
Base, C_3-18Heteroaryl group or -CH = NN
H-C (NH) NH_Two(C_1-10Alkyl group, C
_2-4Alkenyl group, C_3-10Cycloalkyl group, C
_3-18Heterocycloalkyl group, C_6-18Aryl
Base, C _3-18Heteroaryl group or -CH = NN
H-C (NH) NH_TwoAre each substituted with hydroxy
May be C_1-4Alkyl, halogen atom, halo
C substituted with gen_1-4Alkyl, hydroxy, C
_1-4Alkoxy, C_{1- Four}Alkylthio, carboxy
Shi, C_1-6Alkyl or C_1-6Set with alkoxy
Optionally substituted carbonyl, amino, mono- or di-
-C_1-4Alkylamino and 5- to 7-membered N-hete
A ring group (which may also contain heteroatoms)
Substituted with 1 to 4 substituents selected from the group
R)_5bIs C_6-18Aryl group, C
_3-18Heteroaryl group or C_{3-1 Two}Cycloal
Kill group (each C_1-4Alkyl, halogen, halogen
C replaced by_1-4Alkyl, hydroxy, C
_1-4Alkoxy, C_1-4Alkylthio, amino, mo
No or di-C_1-4Alkylamino and 5 to 7
Member N-heterocyclic group (may further contain a hetero atom)
1) to 4 substituents selected from the group consisting of
May be replaced). ] Or a compound represented by
Its salt. Compound (III) or a salt thereof is WO00 / 63.
No. 204 publication, specifically,
The compounds prepared in the examples can be used
It In the above formula, R_2b, R_3b, R_5b, R_6b, Z_b
And W_bAre respectively WO00 / 63204
R described on page 1 to page 2_Two, R_Three, R₅, R₆, Z and
And W.

[Compounds (IV), (V) and (V
I)] [1] 4-position having a substituent containing no aromatic group 4-
1,3-thiazole compound substituted with pyridyl group (I
V) or a salt thereof, [2] formula

[Chemical 35] [In the formula, R ^1c represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. , R ^2c represents a 4-pyridyl group having a substituent containing no aromatic group, and R ^3c represents an aromatic group which may have a substituent. ] Or a salt thereof, [3] 1,3-thiazole compound in which the 5-position is substituted with a pyridyl group having a substituent not containing an aromatic group at a position adjacent to the nitrogen atom of the pyridyl group ( V) or a salt thereof, [4] formula

[Chemical 36] [In the formula, R^1dMay have a hydrogen atom or a substituent
Hydrocarbon group, optionally substituted heterocyclic group, substituted
An amino group or an acyl group which may have a group, R^2dIs
Substitute a substituent containing no aromatic group next to the nitrogen atom of the pyridyl group.
Pyridyl group at the position^3dHas a substituent
It represents an aromatic group which may be added. ] The compound represented by
Is a salt thereof, and the [5] 5-position is a substituent containing no aromatic group.
4-Pyridyl group having 4-pyridyl at a position adjacent to the nitrogen atom
1,3-thiazole compound substituted with lysyl group (V
I) or a salt thereof, [6] substituent containing no aromatic group
Is a halogen atom, C_1-3Alkylenedioxy, nit
B, cyano, optionally halogenated C_1-6Al
Killed, optionally halogenated C_2-6Archeni
Le, carboxy C_2-6Alkenyl, halogenated
May be C_2-6Alkynyl, halogenated
Good C_{Three -8}Cycloalkyl, C_3-8Cycloalk
R-C_1-6Alkyl, optionally halogenated C
_1-8Alkoxy, C_1-6Alkoxy-carbonyl-
C_{1 -6}Alkoxy, hydroxy, mercapto, halogen
C which may be converted to_{1- 6}Alkylthio, amino,
Mono-C_1-6Alkylamino, di-C_1-6Alkyl
Amino, C_3-8Cycloalkylamino, C_3-8Shiku
Lower alkyl-C_1-6Alkylamino, N-C_3-8Shi
Chloroalkyl-NC_1-6Alkylamino, holmi
Le, carboxy, carboxy-C_2-6Alkenyl, mosquito
Ruboxi-C_{1- 6}Alkyl, even if halogenated
Good C_1-6Alkyl-carbonyl, C_{1 -6}Alkyl
C optionally substituted with_3-8Cycloalkyl-cal
Bonil, C _1-6Alkoxy-carbonyl, carbamoy
Lu, thiocarbamoyl, mono-C_{1 -6}Alkyl-cal
Bamoiru, The-C_1-6Alkyl-carbamoyl, C
_1-6Alkylsulfonyl, C_1-6Alkyl sulfi
Nyl, formylamino, C_{1- 6}Alkyl-carbonyl
Amino, C_1-6C optionally substituted with alkyl_Three
-8Cycloalkyl-carbonylamino, C_1-6Al
Coxy-carbonylamino, C_1-6Alkyl sulfoni
Lumino, C_1-6Alkyl-carbonyloxy, C
_1-6Alkoxy-carbonyloxy, mono-C_1-6
Alkyl-carbamoyloxy, di-C_1-6Alkyl
-Carbamoyloxy, in addition to carbon atoms, nitrogen atoms, sulfur
1 or 2 kinds selected from yellow atom and oxygen atom, 1 to
5- to 7-membered aliphatic heterocyclic group containing 4 heteroatoms
(This aliphatic heterocyclic group is C_1-6Alkyl, C_1-6A
It may have a rukyi-carbonyl or oxo
I), sulfo, sulfamoyl, sulfinamoyl, su
Ruphenamoyl or two or three of these substituents are bonded
Groups (eg halogen atom, cyano, hydroxy, C
_{1- 6}Alkoxy, C_1-6Alkylthio, C_1-6A
Ruquilsulfinyl, C_{1- 6}Alkylsulfonyl, C
_3-8Cycloalkyl, nitrogen atom other than carbon atom, sulfur
1 or 2 heteroatoms selected from atoms and oxygen atoms
A 5- to 7-membered aliphatic heterocyclic group containing 1 to 4 C,
_1-6Alkyl-carbonyl, nitrogen atom other than carbon atom
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 7-membered aliphatic heterocycle containing 1 to 4 terror atoms
-Carbonyl, C_3-8Cycloalkoxy, carbon atom or less
Besides, one or more selected from nitrogen atom, sulfur atom and oxygen atom
Is a 5 to 7 membered fat containing 1 to 4 heteroatoms.
Aliphatic heterocycle-oxy, C_1-6Alkylamino, C
_1-6Alkoxy-carbonyl, C_3-8Cycloarco
Xy-carbonyl, nitrogen atom, sulfur atom in addition to carbon atom
And 1 or 2 heteroatoms selected from oxygen atoms
5 to 7-membered aliphatic heterocycle containing 4 to 4 oxycals
Substituted with a substituent selected from the group consisting of bonyl and the like
You may stay, (i) C_1-6Alkyl, (ii) amino,
(Iii) C_1-6Alkylamino, (iv) C_3-8Shiku
Roalkylamino, (v) nitrogen atom other than carbon atom, sulfur
1 or 2 heteroatoms selected from yellow atom and oxygen atom
5- to 7-membered aliphatic heterocycles containing 1 to 4 offspring-ami
No, (vi) C_1-6Alkyl-carbonylamino, (vi
i) C_3-8Cycloalkyl-carbonylamino, (vii
i) Is it a nitrogen atom, sulfur atom or oxygen atom in addition to carbon atom?
Contains 1 to 4 1 or 2 heteroatoms selected from
5 to 7 membered aliphatic heterocycle-carbonylamino etc.)
A compound according to item [1] to item [5], [7]
(1) The hydrocarbon group which may have a substituent is a substituent
Group A (oxo, halogen atom, C_1-3Alkylene geo
Xy, nitro, cyano, optionally halogenated C
_1-6Alkyl, optionally halogenated C_2-6
Alkenyl, carboxy C_2-6Alkenyl, halogen
C which may be converted_2-6Alkynyl, halogenated
May be C_3-8Cycloalkyl, C_3-8Shiku
Lower alkyl-C_1-6Alkyl, C_6-14Aryl,
C which may be halogenated_1-8Alkoxy, C
_1-6Alkoxy-carbonyl-C_1-6Alkoxy,
Hydroxy, C_6-14Aryloxy, C_7-16A
Aralkyloxy, mercapto, even if halogenated
Good C_1-6Alkylthio, C_6-14Arylthio,
C_7-16Aralkylthio, amino, mono-C_1-6A
Ruquilamino, Mono-C_6-14Arylamino, di-
C_1-6Alkylamino, C_3-8Cycloalkylami
No, J-C_6-14Arylamino, C_3-8Cycloa
Rukiru-C _1-6Alkylamino, N-C_3-8Cyclo
Alkyl-NC_1-6Alkylamino, formyl, mosquito
Ruboxy, optionally halogenated C_1-6Archi
Le-carbonyl, C_1-6Even if it is substituted with alkyl
Good C_3-8Cycloalkyl-carbonyl, C_1-6A
Lucoxy-carbonyl, C_6-14Aryl-Carbonii
Le, C_7-16Aralkyl-carbonyl, C_6-14A
Reel oxy-carbonyl, C_7-16Aralkyl Oki
In addition to carbonyl and carbon atoms, nitrogen and sulfur atoms
And one or two heteroatoms selected from oxygen atoms
5- to 7-membered heterocyclic carbonyl containing 4 ish, carbamo
Yl, thiocarbamoyl, mono-C_{1- 6}Alkyl-Mo
Luba Moyle, The-C_1-6Alkyl-carbamoyl, mo
No-C_{6 -14}Aryl-carbamoyl, di-C
_6-14Aryl-carbamoyl, nitrogen in addition to carbon atom
One or two kinds selected from an atom, a sulfur atom and an oxygen atom
5- to 7-membered heterocyclic cal containing 1 to 4 heteroatoms
Bamoiru, C_1-6Alkylsulfonyl, C_6-14A
Reel sulfonyl, C_1-6Alkylsulfinyl, C
_{6 -14}Arylsulfinyl, formylamino, C
_1-6Alkyl-carbonylamino, C_1-6Alkyl
C optionally substituted with_3-8Cycloalkyl-cal
Bonylamino, C_6-14Aryl-carbonylami
No, C_1-6Alkoxy-carbonylamino, C_1-6
Alkylsulfonylamino, C_6-14Aryl sulfo
Nylamino, C_1-6Alkyl-carbonyloxy, C
_6-14Aryl-carbonyloxy, C_1-6Arco
Xy-carbonyloxy, mono-C_1-6Alkyl-Mo
Lubamoyloxy, di-C_1-6Alkyl-carbamoy
Roxy, Mono-C_6-14Aryl-carbamoyl
Xy, di-c_6-14Aryl-carbamoyloxy,
Nicotinoyloxy, Isonicotinoyloxy, Carbon
Besides nitrogen, selected from nitrogen atom, sulfur atom and oxygen atom
5 to 1 containing 1 to 4 1 or 2 heteroatoms
0-membered heterocyclic group (this heterocyclic group is C_1-6Alkyl, C
_6-14Aryl, optionally halogenated C
_1-6Alkyl-carbonyl, nitrogen atom other than carbon atom
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 10-membered aromatic hetero containing 1 to 4 terror atoms
Having a substituent selected from the group consisting of a ring group and oxo
Optional), sulfo, sulfamoyl, sulfina
Moyl, sulfenamoyl and their substituents are 2 to
Groups with three bonds (eg halogen atom, cyano, hydr
Roxy, C_1-6Alkoxy, C_{6-1 Four}Aryl Oki
Shi, C_1-6Alkylthio, C_6-14Arylthio,
C_1-6Alkylsulfinyl, C_6-14Aryls
Rufinil, C_1-6Alkylsulfonyl, C_6-14
Arylsulfonyl, C_3-8Cycloalkyl, carbon
Besides nitrogen, selected from nitrogen atom, sulfur atom and oxygen atom
5 to 7 containing 1 to 4 1 or 2 heteroatoms
Membered heterocyclic group, C_6-14Aryl, C_1-6Alkyl-
Besides carbonyl and carbon atom, nitrogen atom, sulfur atom and acid
1 or 2 heteroatoms selected from elementary atoms
5 to 7-membered heterocycle-carbonyl containing 4, C_6-14
Aryl-carbonyl, C_3-8Cycloalkoxy, charcoal
Other than elementary atom, selected from nitrogen atom, sulfur atom and oxygen atom
5 containing 1 to 4 1 or 2 heteroatoms
7-membered heterocycle-oxy, C_1-6Alkylamino, C
_6-14Arylamino, C_1-6Alkoxy-carbo
Nil, C_3-8Cycloalkoxy-carbonyl, carbon source
Besides nitrogen, selected from nitrogen atom, sulfur atom and oxygen atom
5 to 7 containing 1 to 4 1 or 2 heteroatoms
Membered heterocycle-oxycarbonyl, C_6-14Aryl-o
Substitute with a substituent selected from the group consisting of oxycarbonyl etc.
(I) C which may be replaced_1-6Alkyl, (ii)
C_6-14Aryl, (iii) amino, (iv) C_1-6
Alkylamino, (v) C_3-8Cycloalkylami
No, (vi) C_6-14Arylamino, (vii) carbon source
Besides nitrogen, selected from nitrogen atom, sulfur atom and oxygen atom
5 to 7 containing 1 to 4 1 or 2 heteroatoms
Membered heterocycle-amino, (viii) C_1-6Alkyl-carbo
Nylamino, (ix) C_3-8Cycloalkyl-carboni
Lumino, (x) C_6-14Aryl-carbonylami
No, (xi) nitrogen atom, sulfur atom and oxygen other than carbon atom
1 to 4 of 1 or 2 heteroatoms selected from atoms
5 to 7-membered heterocycles-carbonylamino etc.)
C, which may have a substituent selected from the group consisting of
_1-6Alkyl group, C_2-6Alkenyl group, C_2-6A
Lucinyl group, C_3-8Cycloalkyl group, C_6-14A
Reel base or C_7-16Substitute (2) for aralkyl group
The heterocyclic group which may have a group is selected from the substituent group A.
Nitrogen atom other than carbon atom which may have a substituent
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 14-membered heterocyclic group containing 1 to 4 terror atoms
Is a compound represented by the formula: — (C═O) —R^5c,-
(C = O) -OR^5c,-(C = O) -NR^5cR^6c,-
(C = S) -NHR^5c,-(C = O) -N (OR^5c)
R^6c,-(C = S) -NHOR^5cOr-SO₂-R
^7c(In the formula, R^5cIs a hydrogen atom or a substituent group A
Optionally substituted C, C_1-6Alkyl
Base, C_2-6Alkenyl group, C_2-6Alkynyl group, C
_3-8Cycloalkyl group, C_6-14Aryl group
Is C_7-16Selected from the group consisting of aralkyl group or substituent A
Nitrogen atom other than carbon atom which may have a substituent
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 14-membered heterocyclic group containing 1 to 4 terror atoms
To R^6cIs a hydrogen atom or C_1-6An alkyl group, R
^7cHas a substituent selected from the group A of substituents
Good, C_1-6Alkyl group, C_{2- 6}Alkenyl group, C
_2-6Alkynyl group, C_3-8Cycloalkyl group, C
_{6-1 Four}Aryl group or C_7-16Aralkyl
May have a substituent selected from the substituent group A
In addition to carbon atoms, nitrogen, sulfur and oxygen atoms
Contains 1 to 4 1 or 2 heteroatoms selected from
An acyl group represented by 5 to 14-membered heterocyclic group)
Is an amino group which may have a substituent (4)
(I) even if it has a substituent selected from Substituent group A
Good C_1-6Alkyl group, C_2-6Alkenyl group, C
_2-6Alkynyl group, C_3-8Cycloalkyl group, C
_6-14Aryl group or C_7-16Aralkyl group,
Substituent A may have a substituent selected from Group A,
In addition to carbon atom, it is selected from nitrogen atom, sulfur atom and oxygen atom.
5 containing 1 to 4 1 or 2 heteroatoms
Ishi 14-membered heterocyclic group, Formula:-(C = O) -R^5c,-(C = O) -OR^5c,-
(C = O) -NR^5cR^{6 c},-(C = S) -NH
R^5c,-(C = O) -N (OR^5c) R^6c,-(C =
S) -NHOR^5cOr-SO₂-R^7c(In the formula, each note
No. has the same meaning as above) A group selected from the acyl group represented by
C which may have a substituent_1-6Made of alkylidene group
May have 1 or 2 substituents selected from the group
An amino group, or (ii) C_1-6Alkyl, C
_6-14Aryl, optionally halogenated C
_1-6Alkyl-carbonyl, C_1-6Alkoxy-ca
Rubonyl, nitrogen atom, sulfur atom and oxygen other than carbon atom
1 to 4 of 1 or 2 heteroatoms selected from atoms
A 5- to 10-membered aromatic heterocyclic group containing oxo and oxo
1 group which may have a substituent selected from the group consisting of
In addition to nitrogen atom and carbon atom, nitrogen atom, sulfur atom and acid
1 or 2 species selected from elementary atoms, 1 to 4 hetero
5- to 7-membered non-aromatic cyclic amine which may contain atoms
(5) an aromatic group-free substituent is a halogen group.
Atom, C_1-3Alkylenedioxy, nitro, cyano,
C which may be halogenated_1-6Alkyl, halogen
C which may be converted to_2-6Alkenyl, carboxy
C_2-6Alkenyl, optionally halogenated C
_2-6Alkynyl, optionally halogenated C_Three
-8Cycloalkyl, C_3-8Cycloalkyl-C
_1-6Alkyl, optionally halogenated C_1-8
Alkoxy, C_1-6Alkoxy-carbonyl-C_1
-6Alkoxy, hydroxy, mercapto, halogenated
May be C_{1- 6}Alkylthio, amino, mono
-C_1-6Alkylamino, di-C_1-6Alkylami
No, C_3-8Cycloalkylamino, C_3-8Cycloa
Rukiru-C_1-6Alkylamino, N-C_3-8Cyclo
Alkyl-NC_1-6Alkylamino, formyl, mosquito
Ruboxy, carboxy-C_2-6Alkenyl, carboxy
Sea C_{1- 6}Alkyl, optionally halogenated C
_1-6Alkyl-carbonyl, C_{1 -6}Substitute with alkyl
May be C_3-8Cycloalkyl-carboni
Le, C _1-6Alkoxy-carbonyl, carbamoyl,
Thiocarbamoyl, mono-C_{1 -6}Alkyl-carbamo
Il, the C_1-6Alkyl-carbamoyl, C_1-6
Alkylsulfonyl, C_1-6Alkylsulfinyl,
Formylamino, C_{1- 6}Alkyl-carbonylami
No, C_1-6C optionally substituted with alkyl_{Three -8}
Cycloalkyl-carbonylamino, C_1-6Arcoki
C-carbonylamino, C_1-6Alkylsulphonyl
Mino, C_1-6Alkyl-carbonyloxy, C_1-6
Alkoxy-carbonyloxy, mono-C_1-6Archi
L-carbamoyloxy, di-C_1-6Alkyl-cal
In addition to vamoyloxy, carbon atom, nitrogen atom, sulfur atom
And 1 or 2 kinds selected from oxygen atoms, 1 to 4
5- to 7-membered aliphatic heterocyclic group containing a hetero atom (this
Aliphatic heterocyclic group is C_1-6Alkyl, C_1-6Alkyl
-Which may have carbonyl or oxo),
Ho, sulfamoyl, sulfinamoyl, sulfenamo
Or a group in which two or three of these substituents are bonded (eg,
For example, halogen atom, cyano, hydroxy, C_{1- 6}Al
Coxy, C_1-6Alkylthio, C_1-6Alkylsul
Finil, C_{1- 6}Alkylsulfonyl, C_3-8Shiku
Low alkyl, nitrogen atom, sulfur atom and acid in addition to carbon atom
1 or 2 heteroatoms selected from elementary atoms
5- to 7-membered aliphatic heterocyclic group containing four, C_1-6Archi
In addition to le-carbonyl and carbon atom, nitrogen atom, sulfur atom and
And one or two heteroatoms selected from oxygen atoms
5- to 7-membered aliphatic heterocycle-carbonyl containing 4 islets,
C_3-8Cycloalkoxy, nitrogen atom in addition to carbon atom,
1 or 2 types of hetero selected from sulfur atom and oxygen atom
5- to 7-membered aliphatic heterocycle containing 1 to 4 atoms-O
Kish, C_1-6Alkylamino, C_1-6Alkoxy-
Carbonyl, C_3-8Cycloalkoxy-carbonyl,
In addition to carbon atom, it is selected from nitrogen atom, sulfur atom and oxygen atom.
5 containing 1 to 4 1 or 2 heteroatoms
Ishi Composed of 7-membered aliphatic heterocycle-oxycarbonyl, etc.
Optionally substituted with a substituent selected from the group: (i)
C_1-6Alkyl, (ii) amino, (iii) C_1-6A
Ruquilamino, (iv) C_3-8Cycloalkylamino,
(V) In addition to carbon atom, nitrogen atom, sulfur atom and oxygen atom
Containing 1 to 4 1 or 2 heteroatoms selected from
A 5- to 7-membered aliphatic heterocycle-amino, (vi) C_1-6
Alkyl-carbonylamino, (vii) C_3-8Cyclo
Alkyl-carbonylamino, other than (viii) carbon atom
1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom
5 to 7 membered aliphatic containing 1 to 4 heteroatoms of the species
Heterocycle-carbonylamino, etc.) with a (6) substituent
The optionally substituted aromatic group is selected from the substituent group A.
C which may have a substituent_6-14Monocyclic or fused poly
Selected from the group A of cyclic aromatic hydrocarbon groups or substituents
Optionally having a substituent, a nitrogen atom in addition to the carbon atom,
1 or 2 types of hetero selected from sulfur atom and oxygen atom
5- to 14-membered aromatic heterocycle containing 1 to 4 atoms
The compound according to item [2] or [4], which represents a group,
[8] R^1cIs (i) a hydrogen atom, (ii) a halogen atom,
C_1-6Alkoxy-carbonyl, carboxy, shea
No, C_1-6Alkylthio, C_1-6Alkyl sulfi
Nil, C_1-6Alkylsulfonyl, hydroxy, C
_1-6Alkoxy and C_1-6Alkyl-carbonyl
May be substituted with a substituent selected from the group consisting of
C_1-6Alkyl group, (iii) halogen atom and formula-
S (O)_n-R ^1f(R^1fIs C_1-6Alkyl group,
n represents a group represented by 0 to 2)
C optionally having a substituent_6-14Aryl
Group, (iv) C_7-15Aralkyl group, (v) C_1-6
Alkyl group, C_1-6Alkyl-carbonyl, halo
Gen atom, C_1-6Alkyl group or C_1-6Arcoki
Optionally substituted with a nitrogen atom in addition to the carbon atom,
1 not selected from the group consisting of oxygen and sulfur atoms
A 5- to 7-membered heterocycle-carbo containing 4 heteroatoms
Nil, C_6-14Aryl-carbamoyl, halogen
C which may be converted to_1-6Alkyl-carbamoy
R, optionally halogenated C_1-6Alkoxy
-Carbonyl, C_1-6Alkoxy-carbamoyl,
C_6-14Selected from aryloxy-carbamoyl
An amino group optionally having 1 or 2 substituents,
(Vi) Oxo, C_1-6Alkyl, C_6-14Aryl
Or C _1-6Substituted with alkoxy-carbonyl
May be, in addition to carbon atoms, nitrogen atoms, sulfur atoms and oxygen
1 or 2 species selected from atoms, 1 to 4 heteroatoms
A 5- to 10-membered heterocyclic group containing a child, (vii) formula- (C =
O) -R^{5d '}(R^{5d '}Is a hydrogen atom, halogenated
May be C_1-6Alkyl group or halogenated
May be C_6-14Represents an aryl group)
Acyl group or (viii) formula- (C = O) -OR
^{5d ' '}(R^{5d ' '}Is a hydrogen atom or C_1-6Archi
[2] which is an acyl group represented by
Is a compound described in [4],

[9] A substituent containing no aromatic group is (1) a C _1-6 alkyl group (wherein C _1-6 alkyl is a halogen atom, cyano, hydroxy, C _3-8 cycloalkyl or a nitrogen atom other than a carbon atom, Optionally substituted with a 5 to 7 membered aliphatic heterocyclic group containing 1 to 4 heteroatoms selected from oxygen atom and sulfur atom),
(2) a halogen atom, (3) an amino group which may have a substituent selected from the group consisting of:
_1-6 alkyl (this C _1-6 alkyl contains 1 to 4 heteroatoms selected from a nitrogen atom, an oxygen atom and a sulfur atom in addition to a halogen atom, cyano, hydroxy, C _3-8 cycloalkyl or a carbon atom 5 To 7-membered aliphatic heterocyclic group), C
_3-8 cycloalkyl, C _1-6 alkyl-carbonyl (this C _1-6 alkyl-carbonyl includes a halogen atom, cyano, hydroxy, C _3-8 cycloalkyl or a carbon atom, as well as a nitrogen atom, an oxygen atom and a sulfur atom). Optionally substituted by a 5 to 7 membered aliphatic heterocyclic group containing 1 to 4 selected heteroatoms), C
_1-6 alkoxy - carbonyl, C _1-6 alkyl optionally substituted by C _3-8 cycloalkyl - carbonyl, nitrogen atom in addition to carbon atoms, 1 to 4 hetero atoms selected from oxygen atom and a sulfur atom A 5- to 7-membered aliphatic heterocyclic group containing (this aliphatic heterocyclic group is C _1-
6 alkyl or C _1-6 alkyl-carbonyl), a 5- to 7-membered aliphatic complex containing 1 to 4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom. A ring-carbonyl group (this aliphatic heterocycle-carbonyl group may be substituted with C _1-6 alkyl or C _1-6 alkyl-carbonyl), (4) in addition to a carbon atom and one nitrogen atom, 5 to 7 optionally containing 1 to 4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom
Member saturated cyclic amino group (this saturated cyclic amino group is C
_1-6 alkyl or C _1-6 alkyl-carbonyl), (5) hydroxy group, or (6) C _1-6 alkyl-carbonyloxy group [2] or [. [4] Item, [10] R ³
Is optionally halogenated C _1-6 alkyl, C
_1-6 alkoxy, halogen atom, carboxy, C
C _6-14 , which may have a substituent selected from the group consisting of _1-6 alkoxy-carbonyl, cyano, C _1-6 alkylthio and C _1-6 alkylsulfonyl.
Besides the aryl group or carbon atom, 1 or 2 kinds selected from nitrogen atom, sulfur atom and oxygen atom, preferably 1
A compound of the formula [2] or [4], which is a 5- to 14-membered aromatic heterocyclic group containing 4 to 4 heteroatoms, [11] formula

[Chemical 37] [In the formula, R^1eIs (i) hydrogen atom, (ii) halogen source
Child, C_1-6Alkoxy-carbonyl, carboxy, si
Ano, C_1-6Alkylthio, C_1-6Alkylsulf
Inyl, C_1-6Alkylsulfonyl, hydroxy, C
_1-6Alkoxy and C_1-6Alkyl-carbonyl
May be substituted with a substituent selected from the group consisting of
C_1-6Alkyl group, (iii) halogen atom and formula-
S (O)_n-R^1f(R^1fIs C_1-6Alkyl group,
n represents a group represented by 0 to 2)
C optionally having a substituent_6-14Aryl
Group, (iv) C_7-15Aralkyl group, (v) C_1-6
Alkyl group, C_1-6Alkyl-carbonyl, C
_1-6Alkoxy-carbonyl, halogen atom, C
_{1- 6}Alkyl group or C_1-6Replaced by alkoxy
In addition to carbon atoms, nitrogen atoms, oxygen atoms and
1 to 4 hetees selected from the group consisting of
A 5- to 7-membered heterocycle containing a carbon atom-carbonyl, C
_6-14Aryl-carbamoyl, halogenated
May be C_1-6Alkyl-carbamoyl, halogen
C which may be converted to_1-6Alkoxy-Carbonii
Le, C_1-6Alkoxy-carbamoyl, C
_6-141 selected from aryloxy-carbamoyl
Or an amino group which may have two substituents, (v
i) oxo, C_1-6Alkyl, C_6-14Aryl,
C_1-6Alkyl-carbonyl, C_1-6Alkoxy-
In addition to carbon atoms, which may be substituted with carbonyl, nitrogen
1 or 2 selected from elementary atom, sulfur atom and oxygen atom
A 5- to 10-membered compound containing 1 to 4 heteroatoms
Elementary ring group, (vii) formula- (C = O) -R^{5d '}(R^{5d '}Is
Hydrogen atom, optionally halogenated C_1-6Archi
Group or optionally halogenated C_6-14Ants
Represents an acyl group) or (viii) a formula-
(C = O) -OR^{5d ' '}(R^{5d ' '}Is a hydrogen atom or
C_1-6Represents an alkyl group), an acyl group represented by R
^2eIs (1) C_1-6Alkyl group (this C_1-6Archi
Is a halogen atom, cyano, hydroxy, C_3-8Shiku
In addition to alkyl or carbon atoms, nitrogen and oxygen atoms
And 1 to 4 heteroatoms selected from sulfur atoms
May be substituted with a 5- to 7-membered aliphatic heterocyclic group
I), (2) halogen atom, and (3) consisting of
An amino group which may have a substituent selected from the group:
C_1-6Alkyl (this C_1-6Alkyl is a source of halogen
Child, cyano, hydroxy, C_3-8Cycloalkyl
Is a nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom
5 to 7 members containing 1 to 4 heteroatoms selected from
Optionally substituted with an aliphatic heterocyclic group), C
_3-8Cycloalkyl, C_1-6Alkyl-carboni
Le (this C_1-6Alkyl-carbonyl is a halogen source
Child, cyano, hydroxy, C_3-8Cycloalkyl
Is a nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom
5 to 7 members containing 1 to 4 heteroatoms selected from
Optionally substituted with an aliphatic heterocyclic group), C
_1-6Alkoxy-carbonyl, C_1-6In alkyl
C which may be substituted_3-8Cycloalkyl-carbo
Nitrogen, carbon atom, nitrogen atom, oxygen atom, and sulfur
5 containing 1 to 4 heteroatoms selected from atoms
7-membered aliphatic heterocyclic group (This aliphatic heterocyclic group is C_1-
6Alkyl or C_1-6Substituted with alkyl-carbonyl
Nitrogen atom, oxygen other than carbon atom
1 to 1 heteroatoms selected from atoms and sulfur atoms
5- to 7-membered aliphatic heterocycle-carbonyl group containing 4
(This aliphatic heterocycle-carbonyl group is C_1-6Alkyl
Or C_1-6Substituted with alkyl-carbonyl
Good), (4) in addition to the carbon atom and one nitrogen atom
Further selected from nitrogen atom, oxygen atom and sulfur atom.
5 to 7 optionally containing 1 to 4 heteroatoms
Member saturated cyclic amino group (this saturated cyclic amino group is C
_1-6Alkyl or C_1-6With alkyl-carbonyl
Optionally substituted), (5) hydroxy group, and
(6) C_1-6Consisting of an alkyl-carbonyloxy group
A device selected from the group (in particular, the group consisting of (1) to (4))
A pyridyl having a substituent at the position adjacent to the nitrogen atom of the pyridyl group.
A dil group (preferably a 4-pyridyl group,
Group is optionally N-oxidized), and R^3e
Is an optionally halogenated C_1-6Alkyl, C
_1-6Alkoxy, halogen atom, carboxy, C
_1-6Alkoxy-carbonyl, cyano, C_{1 -6}Al
Kirthio and C_1-6Group consisting of alkylsulfonyl
C which may have a substituent selected from_6-14
Nitrogen atom, sulfur atom other than aryl group or carbon atom
And 1 or 2 kinds selected from oxygen atoms, preferably 1
A 5- to 14-membered aromatic containing from 4 to 4 heteroatoms
Indicates a heterocyclic group. ] Or a salt thereof represented by
The compound according to item [3], wherein the [12] pyridyl group is 4-pi
The compound according to item [11], which is a lysyl group, [13] R
^1eIs halogen, hydroxy, C_1-6Alkoxy, C
_1-6Alkylthio, C_1-6Alkylsulfinyl
And C_1-6Selected from the group consisting of alkylsulfonyl
C which may have a substituent_1-6Alkyl group, R
^2eIs C _1-6An alkyl-carbonyl-amino group or
C_3-8Cycloalkylamino group is converted to 4-pyridyl group.
4-pyridyl group having a position adjacent to an elementary atom, R^3eBut
C _1-6Selected from the group consisting of alkyl and halogen atoms
Optionally substituted C_6-14Aryl group
The compound according to item [11], which is^1eHa
Rogen, hydroxy, C_1-6Alkoxy, C_1-6A
Luquilcio, C_1-6Alkylsulfinyl and C
_1-6Substitutions selected from the group consisting of alkylsulfonyl
C which may have a group_1-3Alkyl group, R^2eIs C
_1-3Alkyl-carbonyl-amino group or C_3-8
Cycloalkylamino group of 4-pyridyl group nitrogen atom
4-pyridyl group at the adjacent position, R^3eIs methyl
Or a phenyl group which may have a chlorine atom
[11] Item compound, [15] 5- [2- (ter
t-butoxycarbonylamino) -4-pyridyl] -2
-Ethyl-4- (3-methylphenyl) -1,3-thia
Sol (Reference Example H3), [4- (3-methylphenyl)
-5- (2-methyl-4-pyridyl) -1,3-thiazo
2-l] amine (Reference Example H7-4), 2-ethyl
Le-5- (2-fluoro-4-pyridyl) -4- (3-
Methylphenyl) -1,3-thiazole (Reference Example H1
1), 5- (2-fluoro-4-pyridyl) -4- (3
-Methylphenyl) -2- [4- (methylthio) phenyl
]]-1,3-Thiazole (Reference Example H15), 4- (3
-Methylphenyl) -5- (2-methyl-4-pyridyl
) -2- [4- (Methylthio) phenyl] -1,3-
Thiazole (Reference Example H16-1), 4- [2-ethyl-
4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridylamine (Reference Example H22), N-
[4- [2-ethyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] ace
Toamide (Reference Example H29-2), N- [4- [2-ethyl]
Lu-4- (3-methylphenyl) -1,3-thiazole
-5-yl] -2-pyridyl] propionamide (reference
Example H29-4), N- [4- [4- (3-chlorophenyl
) -2-Methyl-1,3-thiazol-5-yl]-
2-Pyridyl] acetamide (Reference Example H30-1), N
-[4- [4- (3-chlorophenyl) -2-ethyl-
1,3-thiazol-5-yl] -2-pyridyl] ace
Toamide (Reference Example H30-2), N- [4- [4- (3
-Chlorophenyl) -2-propyl-1,3-thiazo
Lu-5-yl] -2-pyridyl] acetamide (reference example
H30-3), N- [4- [4- (3-chloropheny
) -2-Methyl-1,3-thiazol-5-yl]-
2-Pyridyl] propionamide (Reference Example H30-
7), N- [4- [4- (3-chlorophenyl) -2-
Ethyl-1,3-thiazol-5-yl] -2-pyridy
L] propionamide (Reference Example H30-8), N- [4
-[4- (3-chlorophenyl) -2-propyl-1,
3-thiazol-5-yl] -2-pyridyl] propio
Namide (Reference Example H30-9), N-cyclohexyl-
4- [2-ethyl-4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridylamine (see
Consideration H36-4), N-cyclohexyl-4- [4-
(3-Methylphenyl) -2- (4-methylsulfonyl)
Phenyl) -1,3-thiazol-5-yl] -2-pi
Lysylamine (Reference Example H36-5), N-cyclopentyl
Ru-4- [2-ethyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridylamine
(Reference Example H36-6), N-cyclopentyl-4- [4
-(3-Methylphenyl) -2- (4-methylsulfoni)
Ruphenyl) -1,3-thiazol-5-yl] -2-
Pyridylamine (Reference Example H36-7), 4- [4- (3
-Chlorophenyl) -2-ethyl-1,3-thiazole
-5-yl] -N-cyclohexyl-2-pyridylami
(Reference Example H36-10), 4- [4- (3-chlorophenyl)
2) Ethyl) -2-ethyl-1,3-thiazol-5-i
] -N-Cyclopentyl-2-pyridylamine (reference
Example H36-11), N- [4- (3-methylphenyl)
-5- (2-methyl-4-pyridyl) -1,3-thiazo
R-2-yl] acetamide (Reference Example H39), N-
[4- (3,5-dimethylphenyl) -5- (2-methyl
Lu-4-pyridyl) -1,3-thiazol-2-yl]
Nicotinamide (Reference Example H42-1), 6-chloro-N
-[4- (3,5-dimethylphenyl) -5- (2-me
Cyl-4-pyridyl) -1,3-thiazol-2-i
Lu] nicotinamide (Reference Example H44-3), N- [4-
(3,5-Dimethylphenyl) -5- (2-methyl-4)
-Pyridyl) -1,3-thiazol-2-yl] -6-
Methylnicotinamide (Reference Example H46-3), N- [4
-(3,5-Dimethylphenyl) -5- (2-methyl-
4-Pyridyl) -1,3-thiazol-2-yl] -6
-Methoxynicotinamide (Reference Example H48-3), 4-
(3-methylphenyl) -5- (2-methyl-4-pyri
Dil) -2- (4-methylsulfinylphenyl)-
1,3-thiazole (Reference Example H54), 4- (3-methyi)
Ruphenyl) -5- (2-methyl-4-pyridyl) -2
-(4-Methylsulfonylphenyl) -1,3-thiazo
(Reference Example H57), 5- (2-fluoro-4-pyridyl)
Zyl) -4- (3-methylphenyl) -2- (4-methyl)
Lesulfonylphenyl) -1,3-thiazole (reference example
H58-4), N- [4- [4- (3-chlorophenyl
) -2- (4-Methylsulfonylphenyl) -1,3
-Thiazol-5-yl] -2-pyridyl] acetami
(Reference Example H58-6), N- [4- [4- (3-black
Rophenyl) -2- (4-methylsulfonylphenyl)
-1,3-thiazol-5-yl] -2-pyridyl] p
Ropionamide (Reference Example H58-7), N- [4- [4
-(3-chlorophenyl) -2- (4-methylsulfoni)
Ruphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] pivalamide (Reference Example H58-8), or
[16] The compound of [11], which is a salt of
[1] to a compound of any one of [5]
Drag.

In the present specification, examples of the "acyl group" include the formula:-(C = O) -R ^5c ,-(C = O) -OR ^5c ,-.
(C = O) -NR ^5c R ^6c ,-(C = S) -NH
^R5c ,-(C = O) -N ( ^OR5c ) ^R6c ,-(C =
S) -NHOR ^5c or -SO ₂ -R ^7c (in the formula, R
^5c represents a hydrogen atom, a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, R ^6c represents a hydrogen atom or a C _1-6 alkyl group, and R ^7c represents a substituent. The hydrocarbon group which may have or the heterocyclic group which may have a substituent is shown. ) And the like.
In the above formula, examples of the “hydrocarbon group” of the “hydrocarbon group optionally having a substituent” represented by R ^5c include a chain or cyclic hydrocarbon group (eg, alkyl, alkenyl, alkynyl, Cycloalkyl, aryl, aralkyl, etc.)
Etc. Of these, a chain or cyclic hydrocarbon group having 1 to 16 carbon atoms is preferable. “Alkyl” includes, for example, C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, se
c-butyl, tert-butyl, pentyl, hexyl, etc.) are preferred. Examples of the “alkenyl” include C _2-6 alkenyl (eg, vinyl, allyl, isopropenyl,
1-butenyl, 2-butenyl, 3-butenyl, 2-methyl-2-propenyl, 1-methyl-2-propenyl, 2
-Methyl-1-propenyl etc.) and the like are preferable. Examples of the “alkynyl” include C _2-6 alkynyl (eg,
Ethinyl, propargyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-hexynyl, etc.) are preferable.
As the “cycloalkyl”, for example, C _3-8 cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like are preferable. “Aryl” includes, for example, C _6-14 aryl (eg,
Phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like) are preferable. Examples of the “aralkyl” include C _7-16 aralkyl (eg, benzyl, phenethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, 5 -Phenylpentyl) and the like are preferable.

R^5c“Even if it has a substituent,
Examples of the “substituent” of the “good hydrocarbon group” include
So, halogen atom (eg, fluorine, chlorine, bromine, iodine
Etc.), C _1-3Alkylenedioxy (eg methylenedio
Xy, ethylenedioxy, etc.), nitro, cyano, halogen
C which may be converted to_1-6Alkyl, halogenated
May be C_2-6Alkenyl, carboxy C
_2-6Alkenyl (eg, 2-carboxyethenyl, 2-
Carboxy-2-methylethenyl etc.), halogenated
May be C_2-6Alkynyl, halogenated
May be C_3-8Cycloalkyl, C_3-8Cycloal
Kill-C_1-6Alkyl, C_6-14Aryl (eg, F
Phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl
Le, 3-biphenylyl, 4-biphenylyl, 2-anth
), Optionally halogenated C _1-8Arco
Kish, C_1-6Alkoxy-carbonyl-C_1-6Al
Coxy (eg, ethoxycarbonylmethyloxy, etc.),
Droxy, C_6-14Aryloxy (eg phenylo
Xy, 1-naphthyloxy, 2-naphthyloxy, etc.),
C_{7 -16}Aralkyloxy (eg, benzyloxy
Ci, phenethyloxy, etc.), mercapto, halogenated
May be C_1-6Alkylthio, C_6-14Ants
Thiol (eg, phenylthio, 1-naphthylthio, 2-
Naphthylthio, etc.), C_{7 -16}Aralkylthio (for example
Benzylthio, phenethylthio, etc.), amino, mono
-C_1-6Alkylamino (eg, methylamino, ethyl
Amino etc.), Mono-C_6-14Arylamino (eg,
Phenylamino, 1-naphthylamino, 2-naphthylami
No)), Di-C_1-6Alkylamino (eg, dimethyl
Mino, diethylamino, ethylmethylamino, etc.), C
_3-8Cycloalkylamino (eg cyclopentylami)
No, cyclohexylamino, etc.), di-C_6-14Ally
Luamino (eg, diphenylamino, etc.), C_3-8Cyclo
Alkyl-C_1-6Alkylamino (eg cyclopentyl
Lumethylamino, cyclohexylmethylamino, cyclo
Pentylethylamino, cyclohexylethylamino
Etc.), N-C_3-8Cycloalkyl-N-C_1-6Al
Kiramino (eg, N-cyclopentyl-N-methylami)
No, N-cyclohexyl-N-methylamino, N-cyclo
Ropentyl-N-ethylamino, N-cyclohexyl-
N-ethylamino, etc.), formyl, carboxy, carbo
Kishi-C_2-6Alkenyl, carboxy-C_1-6Al
Killed, optionally halogenated C_1-6Alkyl-
Carbonyl (eg acetyl, propionyl, pivaloyl)
Etc.), C_1-6Substitute with alkyl (eg methyl, ethyl)
May be C_3-8Cycloalkyl-carbonyl
(Eg, cyclopropylcarbonyl, cyclopentylcar
Bonyl, cyclohexylcarbonyl, 1-methyl-shik
Rohexyl-carbonyl etc.), C_1-6Alkoxy-ca
Rubonyl (eg, methoxycarbonyl, ethoxycarbonyl
, Propoxycarbonyl, tert-butoxycarbonyl
Etc.), C_6-14Aryl-carbonyl (eg, benzoyl
Le, 1-naphthoyl, 2-naphthoyl, etc.), C_7-16
Aralkyl-carbonyl (eg, phenylacetyl, 3-
Phenylpropionyl etc.), C_6-14Aryloxy
-Carbonyl (eg, phenoxycarbonyl, etc.), C
_7-16Aralkyloxy-carbonyl (eg, benzyl
Oxycarbonyl, phenethyloxycarbonyl, etc.),
In addition to carbon atom, it is selected from nitrogen atom, sulfur atom and oxygen atom.
5 containing 1 or 2 or 1 to 4 heteroatoms
To 7-membered heterocyclic carbonyl (eg, nicotinoyl, iso
Nicotinoyl, tenoyl, furoyl, morpholinocarb
Nyl, thiomorpholinocarbonyl, piperazine-1-i
Lucarbonyl, pyrrolidin-1-ylcarbonyl, etc.),
Carbamoyl, thiocarbamoyl, mono-C_1-6Al
Kill-carbamoyl (eg, methylcarbamoyl, ethyl
Carbamoyl etc.), di-C_1-6Alkyl-carbamoy
(Eg, dimethylcarbamoyl, diethylcarbamoyl
, Ethylmethylcarbamoyl), mono- or di-C
_6-14Aryl-carbamoyl (eg, phenylcarbamoyl
Moyl, 1-naphthylcarbamoyl, 2-naphthylcar
Other than carbon atom, nitrogen atom, sulfur atom and
1 or 2 kinds selected from oxygen atoms, 1 to 4 hetets
Mono- or di-5 to 7-membered heterocyclic carba containing an atom
Moyl (eg, 2-pyridylcarbamoyl, 3-pyridyl
Carbamoyl, 4-pyridylcarbamoyl, 2-thieny
Lucarbamoyl, 3-thienylcarbamoyl, etc.), C
_1-6Alkylsulfonyl (eg, methylsulfonyl, ether
Cylsulfonyl etc.), C _1-6Alkylsulfinyl
(Eg, methylsulfinyl, ethylsulfinyl, etc.),
C_6-14Arylsulfonyl (eg, phenylsulfoni
1-naphthylsulfonyl, 2-naphthylsulfonyl
Etc.), C_6-14Arylsulfinyl (eg, phenyl
Sulfinyl, 1-naphthyl Sulfinyl, 2-naphthyl
Rusulfinyl), formylamino, C_1-6Archi
Le-carbonylamino (eg, acetylamino, propio
Nylamino, pivaloylamino, etc.), C_1-6Alkyl
C optionally substituted with_3-8Cycloalkyl-cal
Bonylamino (eg, cyclopropylcarbonylamino,
Cyclopentyl carbonylamino, cyclohexyl calc
Bonylamino etc.), C_6-14Aryl-carbonyl
Mino (eg, benzoylamino, naphthoylamino, etc.),
C_1-6Alkoxy-carbonylamino (eg, methoxy
Carbonylamino, ethoxycarbonylamino, propo
Xycarbonylamino, butoxycarbonylamino
Etc.), C_1-6Alkylsulfonylamino (eg, methyl
Sulfonylamino, ethylsulfonylamino, etc.), C
_6-14Arylsulfonylamino (eg, phenylsulfur
Fonylamino, 2-naphthylsulfonylamino, 1-na
(Futylsulfonylamino, etc.), C_1-6Alkyl-cal
Bonyloxy (eg acetoxy, propionyloxy
Etc.), C_6-14Aryl-carbonyloxy (eg,
Nzoyloxy, naphthylcarbonyloxy, etc.), C
_1-6Alkoxy-carbonyloxy (eg methoxyca
Rubonyloxy, ethoxycarbonyloxy, propoxy
Cycarbonyloxy, butoxycarbonyloxy, etc.),
Mono-C_1-6Alkyl-carbamoyloxy (eg,
Tylcarbamoyloxy, ethylcarbamoyloxy
Etc.), di-C_1-6Alkyl-carbamoyloxy
(Eg, dimethylcarbamoyloxy, diethylcarbamo
Iloxy), mono- or di-C_6-14Aryl-
Carbamoyloxy (eg, phenylcarbamoyloxy)
Ci, naphthylcarbamoyloxy, etc.), nicotinoyloo
Xy, isonicotinoyloxy, even if it has a substituent
Is it a nitrogen atom, a sulfur atom or an oxygen atom other than a good carbon atom?
1 or 2 selected from the group consisting of 1 to 4 heteroatoms
A 5- to 10-membered heterocyclic group (eg, having a substituent
Good 5- to 7-membered aliphatic heterocyclic group, 2-thienyl, 3
-Thienyl, 2-pyridyl, 3-pyridyl, 4-pyridy
2-quinolyl, 3-quinolyl, 4-quinolyl, 5-
Quinolyl, 8-quinolyl, 1-isoquinolyl, 3-iso
Quinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-
In-drill, 2-in-drill, 3-in-drill, 2-bed
Nzothiazolyl, 2-benzo [b] thienyl, 3-ben
Zo [b] thienyl, 2-benzo [b] furanyl, 3-be
Nzo [b] furanyl etc.), sulfo, sulfamoyl, su
Rufinamoyl, sulfenamoyl, these substituents
Two or more (eg, 2-3) bonded groups (eg, halogen
Atom, cyano, hydroxy, C_1-6Alkoxy, C
_6-14Aryloxy, C_1-6Alkylthio, C
_6-14Arylthio, C_1-6Alkylsulfini
Le, C_6-14Arylsulfinyl, C_1-6Archi
Lesulfonyl, C_6-14Arylsulfonyl, C
_3-8Cycloalkyl, nitrogen atom other than carbon atom, sulfur
1 or 2 heteroatoms selected from atoms and oxygen atoms
A 5- to 7-membered heterocyclic group containing 1 to 4 C,_6-14
Aryl, C_1-6Alkyl-carbonyl, carbon atom or less
Besides, one or more selected from nitrogen atom, sulfur atom and oxygen atom
Is a 5 to 7 membered compound containing 1 to 4 heteroatoms.
Elementary ring-carbonyl, C_{6- 14}Aryl-carbonyl,
C_3-8Cycloalkoxy, nitrogen atom in addition to carbon atom,
1 or 2 types of hetero selected from sulfur atom and oxygen atom
A 5 to 7 membered heterocycle-oxy containing 1 to 4 atoms,
C_1-6Alkylamino, C_6-14Arylamino,
C_1-6Alkoxy-carbonyl, C_3-8Cycloal
Coxy-carbonyl, nitrogen atom in addition to carbon atom, sulfur source
1 or 2 heteroatoms selected from a child and an oxygen atom
5- to 7-membered heterocycles containing 1 to 4 oxycarboni
Le, C _6-14Consisting of aryl-oxycarbonyl etc.
Optionally substituted with a substituent selected from the group,
(I) C_1-6Alkyl, (ii) C_6-14Aryl,
(Iii) amino, (iv) C_1-6Alkylamino, (v)
C_3-8Cycloalkylamino, (vi) C_6-14Ants
Amino, (vii) nitrogen atom in addition to carbon atom, sulfur source
1 or 2 heteroatoms selected from a child and an oxygen atom
5- to 7-membered heterocycle-amino containing 1 to 4 (vii
i) C_1-6Alkyl-carbonylamino, (ix) C
_3-8Cycloalkyl-carbonylamino, (x) C
_6-14Aryl-carbonylamino, (xi) carbon atom
Other than nitrogen atom, sulfur atom and oxygen atom 1
Or 5 to 7 member containing 1 to 4 heteroatoms
Heterocycle-carbonylamino, etc.)
Examples include substituents selected from the group. The "hydrocarbon
"Group" does not have, for example, one substituent at the substitutable position
It may have 5 pieces, preferably 1 to 3 pieces.
When the number of substituents is 2 or more, each substituent is the same or different.
You may stay.

The above-mentioned "optionally halogenated C
_{As the} " _1-6 alkyl", for example, C _1-6 alkyl optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) (eg, Methyl, ethyl, propyl, isopropyl,
Butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.) and the like. As a specific example,
Methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoropropyl, isopropyl, butyl , 4,4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6-trifluorohexyl, etc. Can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkenyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg,
C, which may have (fluorine, chlorine, bromine, iodine, etc.)
_2-6 alkenyl (eg vinyl, propenyl, isopropenyl, 2-buten-1-yl, 4-penten-1-yl, 5-hexen-1-yl) and the like can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkynyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.)
C _2-6 alkynyl which may have (eg, 2-butyn-1-yl, 4-pentyn-1-yl, 5-hexyn-1-yl, etc.) and the like can be mentioned. The above-mentioned “optionally halogenated C _3-8 cycloalkyl” has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.). _Optionally C _3-8 cycloalkyl (eg, cyclopropyl,
Cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like. Specific examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4,4-
Dichlorocyclohexyl, 2,2,3,3-tetrafluorocyclopentyl, 4-chlorocyclohexyl and the like can be mentioned. The above “optionally halogenated C _1-8
As the "alkoxy", for example, C _1-8 alkoxy (eg, methoxy, ethoxy) optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine etc.) , Propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy, etc.) and the like. Specific examples include, for example, methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy,
4,4,4-trifluorobutoxy, isobutoxy, se
Examples include c-butoxy, pentyloxy, hexyloxy and the like. The above-mentioned “optionally halogenated C _1-6 alkylthio” has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) And C _1-6 alkylthio (eg, methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec-butylthio, tert-butylthio, etc.) and the like. Specific examples include methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like.

Examples of the "5- to 7-membered aliphatic heterocyclic group" of the above-mentioned "5- to 7-membered aliphatic heterocyclic group which may have a substituent (s)" include, for example, nitrogen atom in addition to carbon atom. ,
5- to 7-membered aliphatic heterocyclic groups containing 1 or 2 kinds selected from a sulfur atom and an oxygen atom and 1 to 4 hetero atoms are mentioned, and specific examples thereof include 1-pyrrolidinyl and 2
-Pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2-
Piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 4
-Piperazinyl, morpholino, 2-morpholinyl, 3-
Morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepine-1
-Ill and the like. The "substituent" of the "5- to 7-membered aliphatic heterocyclic group which may have a substituent (s)" is, for example, C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl). , Sec-butyl, tert-butyl, pentyl, hexyl etc.), C
_6-14 aryl (eg, phenyl, 1-naphthyl, 2-
Naphthyl, 2-biphenylyl, 3-biphenylyl, 4-
Biphenylyl, 2-anthryl and the like), optionally halogenated C _1-6 alkyl-carbonyl (eg, acetyl, propionyl etc.), C _1-6 alkoxy-carbonyl (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl etc.) ) 5 to 10-membered aromatic heterocyclic group (eg, 2-thienyl, 3-thienyl, 2-pyridyl,
3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1
-Isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [B] furanyl, 3-benzo [b] furanyl, etc.),
Examples include 1 to 3 oxo and the like.

The “heterocyclic group” of the “heterocyclic group optionally having substituent (s)” represented by R ^5c is, for example, 1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom. 5 to 14 membered (monocyclic, bicyclic or tricyclic) heterocyclic ring containing two kinds or 1 to 4 heteroatoms, preferably (i) 5 to 14 membered (preferably 5 to 10 membered) aromatic heterocycle And a monovalent group formed by removing any one hydrogen atom from a ring, (ii) a 5- to 10-membered non-aromatic heterocycle or (iii) a 7- to 10-membered heterocyclic ring. Examples of the above-mentioned “5- to 14-membered (preferably 5 to 10-membered) aromatic heterocycle” include, for example, thiophene, benzo [b] thiophene, benzo [b] furan, benzimidazole, benzoxazole, benzothiazole and benziso. Thiazole, naphtho [2,3-b] thiophene,
Furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole,
Isoindole, 1H-indazole, purine, 4H-
Quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline,
Carbazole, β-carboline, phenanthridine, acridine, phenazine, thiazole, isothiazole,
An aromatic heterocycle such as phenothiazine, isoxazole, furazan, phenoxazine, or one or more (preferably 1 or 2) aromatic rings (eg, benzene ring) of these rings (preferably monocycles); Examples thereof include rings formed by condensation. The above "5- to 10-membered non-aromatic heterocycle"
Examples thereof include pyrrolidine, imidazoline, pyrazolidine, pyrazoline, piperidine, piperazine, morpholine, thiomorpholine, dioxazole, oxadiazoline, thiadiazoline, triazoline, thiadiazole, dithiazole and the like. Above "7 to 10
Examples of the “membered hetero bridge ring” include quinuclidine, 7-
Azabicyclo [2.2.1] heptane and the like can be mentioned.

The "heterocyclic group" is preferably 5 to 14-membered (1 or 2 kinds selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom, preferably 1 to 4 heteroatoms ( It is preferably a 5- to 10-membered (monocyclic or bicyclic) heterocyclic group. Specifically, for example, 2-thienyl, 3-thienyl, 2-furyl, 3-furyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-
Quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2- Imidazolyl, 3-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-indolyl, 2
An aromatic heterocyclic group such as indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b] furanyl, For example, 1-pyrrolidinyl,
2-pyrrolidinyl, 3-pyrrolidinyl, 3-oxazolidinyl, 1-imidazolinyl, 2-imidazolinyl, 4
-Non-aromatic heterocyclic group such as imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino, etc. Is. Of these, for example, a 5- or 6-membered heterocyclic group containing 1 to 3 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom is more preferable. Specifically, 2-thienyl, 3-
Thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furyl, 3-furyl, pyrazinyl, 2-pyrimidinyl, 3-pyrrolyl, 3-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-pyrrolidinyl,
2-pyrrolidinyl, 3-pyrrolidinyl, 3-oxazolidinyl, 1-imidazolinyl, 2-imidazolinyl, 4
-Imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like can be mentioned. Examples of the “substituent” of the “heterocyclic group ^optionally having substituent (s)” include the “substituent” of the “hydrocarbon group optionally having substituent (s)” for R ^5c. The same thing is mentioned. The "heterocyclic group" is
For example, the above substituents are substituted at 1 to 5 positions,
It preferably has 1 to 3 substituents, and when the number of substituents is 2 or more, each substituent may be the same or different.

"C _1-6 alkyl group" represented by R ^6c
Examples thereof include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl and the like. Examples of the "hydrocarbon group optionally having substituent (s)" and "heterocyclic group optionally having substituent (s)" represented by R ^7c include, for example, "having a substituent (s)" represented by R ⁵ above. And a "heterocyclic group which may have a substituent (s)".

The "hydrocarbon group which may have a substituent (s)" represented by R ^1c and R ^1d is, for example, R
^The "hydrocarbon group which may have a substituent" represented by ^5c is exemplified. Examples of the “heterocyclic group optionally having substituent (s)” represented by R ^1c and R ^1d include, for example,
The “heterocyclic group ^optionally having substituent (s)” represented by R ^5c can be mentioned.

The " ^optionally substituted amino group" represented by R ^1c and R ^1d includes (1) an amino group optionally having 1 or 2 substituents and (2) a substituted group. The cyclic amino group which may have a group is mentioned. Examples of the "substituent" of the above-mentioned (1) "amino group optionally having 1 or 2 substituents" include, for example, a hydrocarbon group optionally having a substituent and a substituent And a heterocyclic group which may have a substituent, an acyl group, an alkylidene group which may have a substituent and the like. These "hydrocarbon group optionally having substituent (s)" and "heterocyclic group optionally having substituent (s)" are "carbon optionally having substituent (s)" for R ^5. The same groups as the “hydrogen group” and “heterocyclic group optionally having substituent (s)” can be mentioned, respectively. Examples of the “alkylidene group” of the “alkylidene group optionally having substituent (s)” include C _1-6 alkylidene (eg, methylidene, ethylidene, propylidene, etc.) and the like. The “substituent” of the “alkylidene group optionally having substituent (s)” is the same as the “substituent” of the “hydrocarbon group optionally having substituent (s)” for R ^5c . One to five, preferably one to three, can be mentioned. When the number of “substituents” in the above “amino group optionally having 1 or 2 substituents” is 2, each substituent may be the same or different. The “cyclic amino group” of the “optionally substituted cyclic amino group” in (2) above is selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to one nitrogen atom and a carbon atom. 1 or 2 species, 1 to 4
5 to 7-membered non-aromatic cyclic amino group (saturated cyclic amino group) which may contain one hetero atom, and specific examples include 1-pyrrolidinyl, piperidino, 1-piperazinyl, morpholino, thiomorpholino, Hexahydroazepin-1-yl, imidazolidin-1-yl, 2,
3-dihydro-1 (1H) -imidazolyl, tetrahydro-1 (2H) -pyrimidinyl, 3,6-dihydro-1
(2H) -pyrimidinyl, 3,4-dihydro-1 (2
H) -pyrimidinyl and the like. The "substituent" of the "cyclic amino group which may have a substituent (s)" is, for example, "substituent" of the "hydrocarbon group which may have a substituent (s)" for R ^5c. 1 to 3 groups are the same as the "substituent" of the "5- to 7-membered aliphatic heterocyclic group which may have a substituent (s)" described in detail. Specific examples of the 5- to 7-membered non-aromatic cyclic amino group having 1 oxo include 2-oxoimidazolidin-1-yl, 2-oxo-2,3-dihydro-1H-imidazol-1-yl, 2-oxotetrahydro-1 (2H)-
Pyrimidinyl, 2-oxo-3,6-dihydro-1 (2
H) -pyrimidinyl, 2-oxo-3,4-dihydro-
1 (2H) -pyrimidinyl, 2-oxopyrrolidine-1
-Yl, 2-oxopiperidino, 2-oxopiperazin-1-yl, 3-oxopiperazin-1-yl, 2-oxo-2,3,4,5,6,7-hexahydroazepin-1-yl, etc. Can be mentioned.

R^1cOr R^1dIs preferably a substituent
May have an alkyl group, or may have a substituent
A good aryl group, an amino group which may have a substituent,
A heterocyclic group which may have a substituent,-(C = O) -R
^5c(In the formula, R^5cHas the same meaning as above. )
Acyl group,-(C = O) -OR^5c(In the formula, R^5cIs before
The same meaning as described above. ) Is an acyl group or the like. The
Preferred as "alkyl group optionally having substituent (s)"
Is, for example, a halogen atom, carboxy, hydroxy,
C_1-6Alkoxy, C_1-6Alkoxy-Carbonii
Le, C_1-6Alkylthio, C_1-6Alkyl sulfi
Nil, C_1-6Substitution selected from alkylsulfonyl, etc.
C optionally having 1 to 5 groups_{1 -6}Alkyl group
(Preferably methyl, ethyl, propyl, butyl, etc.)
Etc. The “aryl group which may have a substituent”
Is preferably, for example, a halogen atom, C_1-6Al
Kircio, C_6-14Arylthio, C_1-6Alkyl
Sulfinyl, C_6-14Arylsulfinyl, C
_1-6Alkylsulfonyl, C_6-14Aryl sulfo
1 to 5 substituents selected from nyl, carboxy, etc.
C which may have_6-14Aryl group (preferably
Phenyl etc.) and the like. The "may have a substituent
As the "amino group", the formula:-(C = O)-is preferable.
R^5c,-(C = O) -OR^5c,-(C = O) -NR^5c
R^6c,-(C = S) -NHR^5c,-(C = O) -N
(OR^5c) R^6c,-(C = S) -NHOR^5cOr
-SO_Two-R^7c[In the formula, each symbol has the same meaning as described above.
You ] It may have 1 or 2 acyls represented by
An amino group and the like. More preferably, R^1cHas the formula: −
(C = O) -R^5cOr- (C = O) -NR ^5cR
^6c[In the formula, each symbol has the same meaning as described above. ]]
An amino group which may have 1 or 2 acyl groups
It The “heterocycle” of the “heterocyclic group optionally having substituent (s)”
Examples of the “ring group” include, in addition to carbon atoms, nitrogen atoms and sulfur atoms.
1 or 2 kinds selected from yellow atom and oxygen atom, 1 to
5-14 membered containing 4 heteroatoms (monocyclic, bicyclic or
Is a tricyclic) heterocyclic group, etc., among which 5 to
7-membered aromatic heterocyclic group and 5- to 10-membered non-aromatic heterocyclic group
A cyclic group or the like is preferable. The “complex optionally having substituent (s)
Examples of the “substituent” of the “ring group” include oxo and C_1-6
Alkyl group (eg, methyl, ethyl, etc.), C_6-14A
Reel group (eg, phenyl, etc.), C_1-6Alkyl-Mo
Rubonyl group (eg acetyl), C_{1 -6}Alkoxy-ca
Rubonyl group (eg, methoxycarbonyl, ethoxycarbo
And the number of substituents is 1 to 3.
It The "-(C = O) -R^5cR of "acyl group represented by"
^5cAs a hydrogen atom, optionally substituted hydrocarbon
Elementary groups and optionally substituted 5- to 7-membered aromatic compounds
A cyclic group is preferred, especially a hydrogen atom or halogenated
May be C_{1- 6}Alkyl group (eg, methyl, ethyl
, Propyl, trifluoromethyl, etc.), halogen
C which may be converted_6-14Aryl groups (eg, phenyl
Ru, naphthyl, fluorophenyl, chlorophenyl
Etc., halogen atoms (eg, fluorine, chlorine, bromine, etc.)
Etc.), optionally halogenated C_1-6Alkyl
(Eg methyl, ethyl, propyl, trifluoromethyl
Etc.), C_1-6Alkoxy (eg methoxy, etoki
, Propoxy, butoxy, etc.)
A 5- to 7-membered aromatic heterocyclic group (eg, pyridyl,
Enyl, pyrrolyl, furyl, pyridazinyl, pyrimidini
And the like) are preferred. The "-(C = O) -OR^5cso
R of "acyl group represented"^5cAs a hydrogen atom, substitution
Optionally hydrocarbon groups are preferred, especially hydrogen
Child, C_1-6Alkyl groups (eg methyl, ethyl, propyl
And the like) are preferred.

R^1cOr R^1dAs (i) hydrogen
Atom, (ii) halogen atom, C_{1- 6}Alkoxy-Cal
Bonyl, carboxy, cyano, C_1-6Alkylthio,
C_{1 -6}Alkylsulfinyl, C_1-6Alkylsul
Honyl, hydroxy, C_{1- 6}Alkoxy and C
_1-6A device selected from the group consisting of alkyl-carbonyl
C optionally substituted with a substituent_1-6An alkyl group, (ii
i) Halogen atom and formula -S (O)_n-R^1f(R
^1fIs C_1-6Alkyl group, n is an integer of 0 to 2
A group selected from the group consisting of
C which may have_{6 -14}Aryl group, (iv) C
_7-15Aralkyl group, (v) C_1-6An alkyl group,
C_1-6Alkyl-carbonyl, halogen atom, C
_1-6Alkyl group or C_1-6Replaced by alkoxy
In addition to carbon atoms, nitrogen atoms, oxygen atoms and
1 to 4 hetees selected from the group consisting of
A 5- to 7-membered heterocycle containing a carbon atom-carbonyl, C
_6-14Aryl-carbamoyl, halogenated
May be C_1-6Alkyl-carbamoyl, halogen
C which may be converted to_1-6Alkoxy-Carbonii
Le, C_1-6Alkoxy-carbamoyl, C
_6-141 selected from aryloxy-carbamoyl
Or an amino group which may have two substituents, (v
i) oxo, C_1-6Alkyl, C_{6 -14}Aryl,
C_1-6Alkoxy-carbonyl or C_1-6Archi
Other than carbon atom, which may be substituted with ru-carbonyl
1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom
Two to five members containing 1 to 4 heteroatoms
Heterocyclic group, (vii) formula- (C = O) -R^{5d '}(R^{5d '}
Is a hydrogen atom, optionally halogenated C_1-6Al
Killyl group or optionally halogenated C_{6- 14}A
An acyl group represented by (representing a reel group), (viii) formula-
(C = O) -OR^{5d ' '}(R^{5d ' '}Is a hydrogen atom or
C_1-6An acyl group represented by (indicating an alkyl group)
It is suitable. R^1cOr R^1dC indicated by_1-6A
Examples of the alkyl group include methyl, ethyl, propyl,
Isopropyl, butyl, isobutyl, sec-butyl,
tert-butyl, pentyl, hexyl etc. are used
Among them, especially methyl, ethyl, propyl, butyl, etc.
C_1-4Alkyl groups are preferred. R^1cOr R^1dso
C shown_1-6Halogen source as a substituent of alkyl group
Examples of the child include a fluorine atom, a chlorine atom, and a bromine source.
Child, iodine atom and the like are preferable. R^1cOr R^1dso
C shown_1-6C which is a substituent of an alkyl group_1-6A
Examples of lucoxy-carbonyl include methoxycarboxyl
Bonyl, ethoxycarbonyl and the like are preferred. R^1cWell
Or R^1dC indicated by_1-6A substituent of an alkyl group
C_1-6Examples of alkylthio include methylthio.
O, ethylthio and the like are preferable. R^1cOr R^1dso
C shown_1-6C which is a substituent of an alkyl group_1-6A
Examples of rukylsulfinyl include methylsulfi
Nyl, ethylsulfinyl and the like are preferable. R^1cAlso
Is R^1dC indicated by_1-6It is a substituent of an alkyl group
C_1-6Alkylsulfonyl includes, for example, methyl
Sulfonyl, ethylsulfonyl and the like are preferable. R^1c
Or R^1dC indicated by_1-6With a substituent of an alkyl group
Some C_1-6As alkoxy, for example, methoxy,
Ethoxy, propoxy and the like are preferred. R^1cOr R
^1dC indicated by_1-6C which is a substituent of an alkyl group
_1-6Alkyl-carbonyl includes, for example, acetyl
Preferred are propionyl and propionyl. R^1fC indicated by
_1-6Examples of the alkyl group include methyl, ethyl and propyl.
Ropil, isopropyl, butyl, isobutyl, sec-
Butyl, tert-butyl, pentyl, hexyl etc.
Used, especially methyl, ethyl, propyl, butyl
Such as C_1-4Alkyl groups are preferred, especially methyl.
Good R^1cOr R^1dC indicated by_6-14Ants
Preferred examples of the aryl group include phenyl and naphthyl.
Of these, phenyl is preferred. R^1cOr R
^1dC indicated by_6-14Ha which is a substituent of an aryl group
Rogen atoms include fluorine, chlorine, and bromine
Child, iodine atom is used. R^1cOr R^1dIndicated by
C_7-15Examples of the aralkyl group include benzyl
Phenyl such as phenyl, phenylethyl, phenylpropyl
-C_1-3Alkyl groups are preferred.

Examples of the C _1-6 alkyl group which is a substituent of the amino group represented by R ^1c or R ^1d include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl,
Hexyl and the like are used, and among them, a C _1-3 alkyl group such as methyl, ethyl and propyl is preferable, and methyl is particularly preferable. As C _1-6 alkyl-carbonyl which is a substituent of the amino group represented by R ^1c or R ^1d , for example, C _1-3 alkyl-carbonyl group such as acetyl and propionyl is preferable. A 5- to 7-membered heterocyclic ring containing 1 to 4 heteroatoms selected from the group consisting of nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom, which is a substituent of the amino group represented by R ^1c or R ^1d.
“Carbonyl” includes, for example, a 5- to 7-membered heterocycle containing 1 or 2 heteroatoms selected from the group consisting of nitrogen atom, oxygen atom and sulfur atom (eg, furyl, thienyl, pyrrolyl, pyridyl, pyrimidinyl, pyridazinyl). Etc.)-Carbonyl group and the like are preferable. This heterocycle-
The substituent of the heterocyclic group of the carbonyl group is preferably a halogen atom such as chlorine atom, a C _1-6 alkyl group such as methyl and ethyl, and a C _1-6 alkoxy such as methoxy and ethoxy. As the C _6-14 aryl-carbamoyl which is the substituent of the amino group represented by R ^1c or R ^1d , for example, phenyl-carbamoyl and the like are preferable. R
Examples of the optionally halogenated C _1-6 alkyl-carbamoyl which is a substituent of the amino group represented by ^1c or R ^1d include, for example, a halogen atom (eg, chlorine atom).
Preferred are methylcarbamoyl, ethylcarbamoyl, propylcarbamoyl and the like, which may be substituted with. R
Examples of the optionally halogenated C _1-6 alkoxy-carbonyl which is a substituent of the amino group represented by ^1c or R ^1d include a halogen atom (eg, chlorine atom).
Preferred are methoxycarbonyl, ethoxycarbonyl, and propoxycarbonyl which may be substituted with. R
^1c or C which is a substituent of the amino group represented by R ^1d
_{As 1-6} alkoxy-carbamoyl, for example, methoxycarbamoyl, ethoxycarbamoyl, propoxycarbamoyl and the like are preferable. As the C _6-14 aryloxy-carbamoyl which is the substituent of the amino group represented by R ^1c or R ^1d , phenyloxy-carbamoyl and the like are preferable. 5 represented by R ^1c or R ^1d
As the 10-membered non-aromatic heterocyclic group, for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 3
-Oxazolidinyl, 1-imidazolidinyl, 2-imidazolidinyl, 4-imidazolidinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino , Thiomorpholino and the like are used, among which 4-piperidyl, 1-piperazinyl, 3-oxazolidinyl, 1
-Imidazolidinyl and the like are preferred. R ^1c or R
^1d: oxo, C _1-6 alkyl (preferably methyl, ethyl), C _6-14 aryl (preferably phenyl), C _1-6 alkyl-carbonyl (preferably acetyl), C _1-6 The 5- to 10-membered non-aromatic heterocyclic group optionally substituted with alkoxy-carbonyl (preferably methoxycarbonyl, ethoxycarbonyl) includes 1-methyl-4-piperidyl, 4-methyl-1-piperazinyl, 2 -Oxo-3-oxazolidinyl, 2-oxo-1-imidazolidinyl, 2-oxo-3-phenyl-1-imidazolidinyl and the like are preferable. The formula represented by R ^1c or R ^1d:-( C = O) -R
The ^{'R 5d of' 5d,} a hydrogen atom, a fluorine atom, etc. chlorine atom optionally halogenated C _1-6 alkyl group (methyl, ethyl, trifluoromethyl, etc.),
A C _6-14 aryl group which may be halogenated with a fluorine atom, a chlorine atom or the like (phenyl, naphthyl, fluorophenyl, chlorophenyl etc.) is preferable. R ^{1c
Alternatively} , as R ^{5d ′ ′} of the formula — (C═O) —OR ^{5d ′ ′ represented} by R ^1d , a hydrogen atom or a C _1-3 alkyl group (such as methyl or ethyl) is preferable.

4-pyridyl substituted at the 5-position of compound (Ia)
"Substituent that does not contain aromatic group" possessed by dil group, compound
Next to the nitrogen atom of the pyridyl group substituting at the 5-position of (Ib)
"Substituent not containing an aromatic group" which substitutes at the position
Of the 4-pyridyl group substituted at the 5-position of the compound (Ic)
Substituting at the position next to "Substitution without an aromatic group
Group ", R^2cIs a substituent that does not contain an aromatic group
"4-pyridyl group" having "substitution not containing an aromatic group"
Group "and R^2d"Substitution without aromatic groups"
Having a group next to the nitrogen atom of the pyridyl group
For example, the “substituent not containing an aromatic group” of the “ru group” is, for example,
For example, halogen atom (eg, fluorine, chlorine, bromine, iodine
Etc.), C_1-3Alkylenedioxy (eg methylenedio
Xy, ethylenedioxy, etc.), nitro, cyano, halogen
C which may be converted to_1-6Alkyl, halogenated
May be C_2-6Alkenyl, carboxy C
_2-6Alkenyl (eg, 2-carboxyethenyl, 2-
Carboxy-2-methylethenyl etc.), halogenated
May be C_2-6Alkynyl, halogenated
May be C _3-8Cycloalkyl, C_3-8Cycloal
Kill-C_1-6Alkyl, optionally halogenated
C_1-8Alkoxy, C_1-6Alkoxy-carbonyl
-C _1-6Alkoxy (eg, ethoxycarbonylmethyl
Oxy, etc.), hydroxy, mercapto, halogenated
May be C_1-6Alkylthio, amino, mono-C
_1-6Alkylamino (eg, methylamino, ethylami
No)), Di-C_1-6Alkylamino (eg, dimethyl
Mino, diethylamino, ethylmethylamino, etc.), C
_3-8Cycloalkylamino (eg cyclopentylami)
No, cyclohexylamino, etc.), C_3-8Cycloalk
R-C_1-6Alkylamino (eg cyclopentylmethyi)
Luamino, cyclohexylmethylamino, cyclopentyl
Ruethylamino, cyclohexylethylamino, etc.), N
-C_3-8Cycloalkyl-N-C _1-6Alkylami
No (eg, N-cyclopentyl-N-methylamino, N-
Cyclohexyl-N-methylamino, N-cyclopentyl
L-N-ethylamino, N-cyclohexyl-N-ethyl
Luamino etc.), formyl, carboxy, carboxy-C
_2-6Alkenyl, carboxy-C_1-6Alkyl, ha
C which may be rogenated_1-6Alkyl-carboni
(Eg acetyl, propionyl, 2,2,2-trif)
Luoroacetyl, 3,3,3-trifluoropropioni
, 2,2-difluoropropionyl, etc.), C_1-6A
C optionally substituted with rukill_3-8Cycloalkyl
-Carbonyl (eg, cyclopropylcarbonyl, cyclo
Pentyl carbonyl, cyclohexyl carbonyl, 1-
Methyl-cyclohexyl-carbonyl etc.), C_1-6A
Lucoxy-carbonyl (eg, methoxycarbonyl, eth
Xycarbonyl, propoxycarbonyl, tert-butoxy
Cicarbonyl etc.), carbamoyl, thiocarbamoyl,
Mono-C_1-6Alkyl-carbamoyl (eg, methyl carb
Luvamoyl, ethylcarbamoyl, etc.), di-C_1-6A
Rukyl-carbamoyl (eg, dimethylcarbamoyl, di-
Ethylcarbamoyl, ethylmethylcarbamoyl, etc.),
C_1-6Alkylsulfonyl (eg, methylsulfonyl,
Ethylsulfonyl, etc.), C_1-6Alkylsulfinyl
(Eg, methylsulfinyl, ethylsulfinyl, etc.),
Formylamino, C_1-6Alkyl-carbonylamino
(Eg acetylamino, propionylamino, pivalloy
Luamino etc.), C_1-6May be substituted with alkyl
I C_3-8Cycloalkyl-carbonylamino (eg,
Chloropropylcarbonylamino, cyclopentylcarbo
Nylamino, cyclohexylcarbonylamino, 1-me
Cyl-cyclohexylcarbonylamino etc.), C _1-6
Alkoxy-carbonylamino (eg, methoxycarbonyl
Luamino, ethoxycarbonylamino, propoxyl
Bonylamino, butoxycarbonylamino, etc.), C
_1-6Alkylsulfonylamino (eg, methylsulfoni
Luamino, ethylsulfonylamino, etc.), C_1-6Al
Kill-carbonyloxy (eg acetoxy, propioni
Luoxy, etc.), C_1-6Alkoxy-carbonyloxy
(Eg, methoxycarbonyloxy, ethoxycarbonyl
Oxy, propoxycarbonyloxy, butoxycarbo
Nyloxy, etc.), Mono-C_1-6Alkyl-carbamoy
Luoxy (eg, methylcarbamoyloxy, ethylcal
Vamoyloxy, etc.), di-C_1-6Alkyl-carbamo
Iloxy (eg, dimethylcarbamoyloxy, diet
Rucarbamoyloxy, etc.), which may have a substituent
5- to 7-membered aliphatic heterocyclic group, sulfo, sulfamoy
Le, sulfinamoyl, sulfenamoyl, these
A group in which two or more (for example, 2 to 3) substituents are bonded (for example,
Halogen atom, cyano, hydroxy, C_1-6Arcoki
Shi, C_1-6Alkylthio, C_1-6Alkyl sulfi
Nil, C_1-6Alkylsulfonyl, C_3-8Cycloa
In addition to rutile and carbon atom, nitrogen atom, sulfur atom and oxygen source
1 to 4 heteroatoms of 1 or 2 kinds selected from child
5- to 7-membered aliphatic heterocyclic groups, including C_1-6Alkyl-
Besides carbonyl and carbon atom, nitrogen atom, sulfur atom and acid
1 or 2 heteroatoms selected from elementary atoms
5 to 7-membered aliphatic heterocycle-carbonyl containing 4, C
_3-8Cycloalkoxy, nitrogen atom in addition to carbon atom, sulfur
1 or 2 heteroatoms selected from yellow atom and oxygen atom
5- to 7-membered aliphatic heterocycles containing 1 to 4 offspring-Oki
Shi, C_1-6Alkylamino, C_1-6Alkoxy-ca
Lubonyl, C _3-8Cycloalkoxy-carbonyl, charcoal
Other than elementary atom, selected from nitrogen atom, sulfur atom and oxygen atom
5 containing 1 to 4 1 or 2 heteroatoms
A group consisting of 7-membered aliphatic heterocycle-oxycarbonyl, etc.
(I) C which may be substituted with a substituent selected from
_1-6Alkyl, (ii) amino, (iii) C_1-6Al
Kiramino, (iv) C_3-8Cycloalkylamino,
(V) In addition to carbon atom, nitrogen atom, sulfur atom and oxygen atom
Containing 1 to 4 1 or 2 heteroatoms selected from
A 5- to 7-membered aliphatic heterocycle-amino, (vi) C_1-6
Alkyl-carbonylamino, (vii) C_3-8Cyclo
Alkyl-carbonylamino, other than (viii) carbon atom
1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom
5 to 7 membered aliphatic containing 1 to 4 heteroatoms of the species
Heterocycle-carbonylamino etc.) and the like.

The above-mentioned "optionally halogenated C
_{As the} " _1-6 alkyl", for example, C _1-6 alkyl optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) (eg, Methyl, ethyl, propyl, isopropyl,
Butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.) and the like. As a specific example,
Methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoropropyl, isopropyl, butyl , 4,4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6-trifluorohexyl, etc. Can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkenyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg,
C, which may have (fluorine, chlorine, bromine, iodine, etc.)
_2-6 alkenyl (eg vinyl, propenyl, isopropenyl, 2-buten-1-yl, 4-penten-1-yl, 5-hexen-1-yl) and the like can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkynyl" is, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.)
C _2-6 alkynyl which may have (eg, 2-butyn-1-yl, 4-pentyn-1-yl, 5-hexyn-1-yl, etc.) and the like can be mentioned.

The above-mentioned "optionally halogenated C
" _3-8 cycloalkyl" includes, for example, 1 to 5
C, which may have 1 or preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.)
_3-8 cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like can be mentioned. Specific examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4,4-dichlorocyclohexyl, 2,2,3,3-tetrafluorocyclopentyl, 4-chlorocyclohexyl and the like. The above-mentioned "optionally halogenated C _1-8 alkoxy" has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) _May be C _1-8 alkoxy (eg,
Methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy and the like). Specific examples include, for example, methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy, 4,
4,4-trifluorobutoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy and the like can be mentioned. The above-mentioned "optionally halogenated C _1-6 alkylthio" is, for example, 1 to 5, preferably 1
To 3 halogen atoms (eg, fluorine, chlorine, bromine,
A C _1-6 alkylthio (eg have a iodine), methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec- butylthio, tert- butylthio, etc.) and the like. Specific examples include methylthio, difluoromethylthio, trifluoromethylthio,
Examples thereof include ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like.

Examples of the "5- to 7-membered aliphatic heterocyclic group" of the "5- to 7-membered aliphatic heterocyclic group which may have a substituent (s)" include, for example, nitrogen atom in addition to carbon atom. ,
5- to 7-membered aliphatic heterocyclic groups containing 1 or 2 kinds selected from a sulfur atom and an oxygen atom and 1 to 4 hetero atoms are mentioned, and specific examples thereof include 1-pyrrolidinyl and 2
-Pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2-
Piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 4
-Piperazinyl, morpholino, 2-morpholinyl, 3-
Morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepine-1
-Ill and the like. The "substituent" of the "5- to 7-membered aliphatic heterocyclic group which may have a substituent (s)" is, for example, C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl). , Sec-butyl, tert-butyl, pentyl, hexyl, etc.), C _1-6
1 to 3 alkyl-carbonyl (eg, acetyl, propionyl, etc.), oxo and the like can be mentioned.

However, when (i) R ^1c or R ^1d is an acetylamino group and R ^3c or R ^3d is a 3,5-dimethylphenyl group, (ii) R ^1c or R ^1d is C
_{A 1-6} alkyl-carbonylamino group, wherein R ^3c or R ^3d is a C _6-14 aryl group substituted with C _1-6 alkyl, or (iii) R ^1c or R ^1d has a substituent An optionally substituted amino group, R ^3c or R
^{When 3d} is an aromatic hydrocarbon group which may have a substituent, the "substituent not containing an aromatic group" is a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), C
_1-3 alkylenedioxy (eg, methylenedioxy, ethylenedioxy, etc.), nitro, cyano, optionally halogenated C _1-6 alkyl, optionally halogenated C _2-6 alkenyl, carboxy C _2-6 alkenyl (eg, 2-carboxyethenyl, 2-carboxy-
2-methylethenyl, etc.), optionally halogenated C _2-6 alkynyl, optionally halogenated C
_3-8 cycloalkyl, C _3-8 cycloalkyl-C
_1-6 alkyl, optionally halogenated C _1-8
Alkoxy, C _1-6 alkoxy-carbonyl-C
_1-6 alkoxy (eg, ethoxycarbonylmethyloxy, etc.), mercapto, optionally halogenated C
_1-6 alkylthio, amino, _{mono--C 1 -6} alkylamino (e.g., methylamino, ethylamino, etc.), di -C
_1-6 alkylamino (eg, dimethylamino, diethylamino, ethylmethylamino, etc.), C _3-8 cycloalkylamino (eg, cyclopentylamino, cyclohexylamino, etc.), C _3-8 cycloalkyl-C _1-6 alkylamino (Eg, cyclopentylmethylamino, cyclohexylmethylamino, cyclopentylethylamino,
Cyclohexylethylamino etc.), _{N-C 3-8} cycloalkyl _{-N-C 1- 6} alkylamino (e.g., N- cyclopentyl -N- methylamino, N- cyclohexyl -
N- methylamino, N- cyclopentyl -N- ethylamino, N- cyclohexyl -N- ethylamino, etc.), formyl, carboxy, carboxy _{-C 2 -6} alkenyl, carboxy _{-C 1-6 alkyl, C 1-6} alkyl -Carbonyl (eg, acetyl, propionyl, etc.), C
C _3-8 cycloalkyl-carbonyl _optionally substituted with _1-6 alkyl (eg, cyclopropylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, 1-methyl-cyclohexylcarbonyl, etc.), C
_1-6 alkoxy-carbonyl (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert
-Butoxycarbonyl etc.), carbamoyl, thiocarbamoyl, mono-C _1-6 alkyl-carbamoyl (eg,
Methylcarbamoyl, ethylcarbamoyl, etc.), di-C
_1-6 alkyl-carbamoyl (eg, dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.), C _1-6 alkylsulfonyl (eg, methylsulfonyl, ethylsulfonyl, etc.), C _1-6 alkylsulfinyl (eg, methylsulfinyl, Ethylsulfinyl, etc.), formylamino, C _1-6 alkyl-carbonylamino (eg, acetylamino, propionylamino,
Pivaloylamino, _{etc.), C 1-6} alkyl optionally substituted _{C 3-8} cycloalkyl - carbonylamino (e.g., cyclopropylcarbonylamino, cyclopentyl carbonylamino, cyclohexylcarbonylamino, _{etc.), C 1-6} alkoxy - carbonyl Amino (eg, methoxycarbonylamino, ethoxycarbonylamino,
Propoxycarbonylamino, butoxycarbonylamino, etc.), C _1-6 alkylsulfonylamino (eg, methylsulfonylamino, ethylsulfonylamino, etc.), C
_1-6 alkoxy-carbonyloxy (eg, methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.),
Mono-C _1-6 alkyl-carbamoyloxy (eg, methylcarbamoyloxy, ethylcarbamoyloxy, etc.), di-C _1-6 alkyl-carbamoyloxy (eg, dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), having a substituent May be 5 to 7
Membered aliphatic heterocyclic group (preferably a 5 to 7 membered aliphatic heterocyclic group containing 1 to 4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom),
Examples thereof include sulfo, sulfamoyl, sulfinamoyl, sulfenamoyl and the like. Furthermore, if these substituents are 2
Or more (eg, 2-3) bonded groups (eg, halogen atom, cyano, hydroxy, C _1-6 alkoxy, C
_1-6 alkylthio, C _1-6 alkylsulfinyl,
C _1-6 alkylsulfonyl, C _3-8 cycloalkyl, a 5- to 7-membered aliphatic heterocycle containing 1 to 4 1 or 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom Group, C _1-6 alkyl-carbonyl, 5 to 7-membered aliphatic heterocycle-carbonyl containing 1 to 4 1 or 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom, C _3-8
1 or 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to cycloalkoxy and carbon atom
5 to 7 membered aliphatic heterocycle-oxy, including 4 to 4, C
_1-6 alkylamino, C _1-6 alkoxy-carbonyl, C _3-8 cycloalkoxy-carbonyl, 1 selected from nitrogen atom other than carbon atom, sulfur atom and oxygen atom
Or (i) C _1-6 , which may be substituted with a substituent selected from the group consisting of 5 to 7-membered aliphatic heterocycle-oxycarbonyl having 1 to 4 heteroatoms.
Alkyl, (ii) amino, (iii) C _1-6 alkylamino, (iv) C _3-8 cycloalkylamino, (v) 1 or 2 types selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom A 5- to 7-membered aliphatic heterocycle-amino containing 1 to 4 heteroatoms, (vi) C _1-6 alkyl-carbonylamino, (vii) C _3-8 cycloalkyl-carbonylamino, (viii) carbon atom Besides, a 5- to 7-membered aliphatic heterocycle-carbonylamino etc. containing 1 to 4 1 or 2 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom) can also be used as the substituent.

Among these substituents, specifically, 1 to 3 substituents, preferably 1 or 2 substituents selected from the following (1) to (6), especially (1) to (4), etc. Is preferably used. (1) C _1-6 alkyl group (for example, methyl, ethyl,
Propyl, isopropyl, butyl, isobutyl, sec
-Butyl, tert-butyl, pentyl, hexyl, etc., preferably a C _1-4 alkyl group such as methyl, ethyl, propyl, butyl, etc.), wherein this C _1-6 alkyl group is
Halogen atom, cyano, hydroxy, C _{3- 8} cycloalkyl, nitrogen atom in addition to carbon atoms, of 5 to contain 1 to 4 hetero atoms selected from oxygen atom and sulfur atom 7-membered aliphatic Hajime Tamaki (e.g., 1-pyrrolidinyl,
2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2
-Piperidyl, 3-piperidyl, 4-piperidyl, 1-
Piperazinyl, 2-piperazinyl, 3-piperazinyl,
4-piperazinyl, morpholino, 2-morpholinyl, 3
-Morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepine-1
-2) a halogen atom (for example, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom), or (3) a substituent selected from the group consisting of _Optionally an amino group C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl,
Butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc., preferably C _1-3 alkyl groups such as methyl, ethyl, propyl, etc., and C _1
-6 alkyl represents a halogen atom, cyano, hydroxy,
C _3-8 cycloalkyl, a 5- to 7-membered aliphatic heterocyclic group containing 1 to 4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom (for example, 1
-Pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4
-Piperidyl, 1-piperazinyl, 2-piperazinyl,
3-piperazinyl, 4-piperazinyl, morpholino, 2
-Morpholinyl, 3-morpholinyl, thiomorpholino,
2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepin-1-yl etc.) optionally substituted C _3-8 cycloalkyl (eg cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl etc.), C _1-6 alkyl - carbonyl (e.g., acetyl, propionyl, butyryl, valeryl, isovaleryl, 2-methyl - propionyl, etc. Hibaroiru), the _{C 1-6} alkyl - carbonyl, halogen atom, cyano, _{hydroxy, C 3 -8} cycloalkyl, carbon 5 to 7-membered aliphatic heterocyclic group containing 1 to 4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom in addition to atoms (for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2 -Piperidyl,
3-piperidyl, 4-piperidyl, 1-piperazinyl,
2-Piperazinyl, 3-piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepin-1-yl, etc.)
Optionally substituted with C _1-6 alkoxy-carbonyl (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, butoxycarbonyl, isobutoxycarbonyl, sec-butoxycarbonyl, t
ert-butoxycarbonyl etc.), C _1-6 alkyl (eg, methyl, ethyl) optionally substituted C
_3-8 cycloalkyl-carbonyl (eg, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, 1-methyl-cyclohexylcarbonyl, etc.), a heteroatom selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom A 5- to 7-membered aliphatic heterocyclic group containing 1 to 4 of (for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-
Pyrrolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3 -Thiomorpholinyl, hexahydroazepin-1-yl, etc.). This aliphatic heterocyclic group may have 1 to 4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom other than carbon atom, which may be substituted with C _1-6 alkyl (eg, methyl, ethyl) and the like. 5- to 7-membered aliphatic heterocycles containing (for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3- Piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl,
Hexahydroazepin-1-yl etc.)-Carbonyl group. This aliphatic heterocyclic-carbonyl group may be substituted with C _1-6 alkyl (eg, methyl, ethyl), etc. (4) In addition to the carbon atom and one nitrogen atom, a nitrogen atom and an oxygen atom are further added. And a 5- to 7-membered saturated cyclic amino group optionally containing 1 to 4 heteroatoms selected from sulfur atoms (for example, 1-pyrrolidinyl, piperidino, morpholino, 1-piperazinyl, etc.). The saturated cyclic amino group may be substituted with C _1-6 alkyl (eg, methyl, ethyl) and the like. (5) Hydroxy group, (6) C _1-6 alkyl-carbonyloxy group (eg, acetyloxy, propionyloxy, butyryloxy and the like).

The "pyridyl group" represented by R ^2c and R ^2d may have, for example, 1 to 5, preferably 1 to 3 substituents at the substitutable position, and the number of substituents is 2 In the case of one or more, each substituent may be the same or different. Moreover, the nitrogen atom in the ring of the "pyridyl group" may be N-oxidized. The "pyridyl group" of the "pyridyl group having a substituent not containing an aromatic group and adjacent to the nitrogen atom of the pyridyl group" represented by R ^2d includes 1-, 2-, 3- or 4-pyridyl. Examples of the group include 4-pyridyl group.

The "aromatic group" of the "aromatic group which may have a substituent" represented by R ^3c and R ^3d is:
Examples thereof include aromatic hydrocarbon groups and aromatic heterocyclic groups. Examples of the "aromatic hydrocarbon group" include monocyclic or condensed polycyclic (2 or 3 ring) aromatic hydrocarbon groups having 6 to 14 carbon atoms. Specific examples thereof include C _6-14 aryl such as phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like. Examples of the "aromatic heterocyclic group" include 1 or 2 kinds selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom,
A 5- to 14-membered (preferably 5- to 10-membered) (monocyclic or bicyclic) aromatic heterocyclic group containing 1 to 4 heteroatoms is preferable. Specifically, for example, 2-thienyl, 3-thienyl, 2-furyl, 3-furyl, 2-
Pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-
Quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-
Isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, 3-pyridazinyl, 3-isothiazolyl,
3-isoxazolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b]. An aromatic heterocyclic group such as furanyl can be mentioned. The "substituent" of the "aromatic group which may have a substituent (s)" is, for example, R mentioned above.
Examples of the “substituent” of the “hydrocarbon group optionally having substituent (s)” represented by ^5c include 1 to 5, and preferably 1 to 3. When the number of substituents is 2 or more, each substituent may be the same or different. Also, two adjacent substituents may form a 4- to 7-membered non-aromatic carbocycle. It is preferably a 5- or 6-membered non-aromatic carbocycle.

R ^3c and R ^3d are preferably a C _6-14 aryl group which may have a substituent, one or two kinds selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom, preferably, 5 containing 1 to 4 heteroatoms
To 14-membered aromatic heterocyclic groups. A phenyl group which may have a substituent or a thienyl group which may have a substituent is more preferable, and a phenyl group which may have a substituent is particularly preferable. These C
_As a substituent of the _6-10 aryl group, the phenyl group, the 5- to 14-membered aromatic heterocyclic group, and the thienyl group, a halogen atom, C _1-3 alkylenedioxy, or optionally halogenated C _1-6 Alkyl, carboxy C _2-6 alkenyl, C _3-8 cycloalkyl, optionally halogenated C _1-8 alkoxy, hydroxy, C _7-16
1 to 3 substituents selected from aralkyloxy, C _1-6 alkyl-carbonyloxy, carboxy, C _1-6 alkoxy-carbonyl, cyano, C _1-6 alkylthio and C _1-6 alkylsulfonyl are preferable, and particularly, , A halogen atom, an optionally halogenated C _1-6 alkyl (eg, C _1-3 alkyl such as methyl, ethyl and propyl), an optionally halogenated C
_1-8 alkoxy (eg, C such as methoxy and ethoxy)
_1-3 alkoxy), carboxy, C _1-6 alkoxy-carbonyl, cyano, C _1-6 alkylthio (eg, methylthio, ethylthio), C _1-6 alkylsulfonyl (eg, methylsulfonyl, ethylsulfonyl) are preferable. In addition, two adjacent alkyl groups may be bonded as a substituent to form a 5-membered non-aromatic carbocycle.

Specific examples of the compound (Va) include compounds represented by the formula:

[Chemical 38] [In the formula, R^1eIs (i) hydrogen atom, (ii) halogen source
Child, C_1-6Alkoxy-carbonyl, carboxy, si
Ano, C_1-6Alkylthio, C_1-6Alkylsulf
Inyl, C_1-6Alkylsulfonyl, hydroxy, C
_1-6Alkoxy and C_1-6Alkyl-carbonyl
C optionally substituted with a substituent selected from_1-6A
Alkyl group, (iii) halogen atom and formula -S (O)_n
-R^1f(R ^1fIs C_1-6Alkyl group, n is not 0
A group selected from the group consisting of groups represented by
C which may have a substituent_6-14Aryl group, (iv)
C_{7- 15}Aralkyl group, (v) C_1-6Alkyl,
C_1-6Alkyl-carbonyl, C_1-6Arcoki
Si-carbonyl, halogen atom, C_1-6Alkyl group
Or C_1-6Charcoal, optionally substituted with alkoxy
In addition to elementary atoms, it must be composed of nitrogen, oxygen and sulfur atoms
5 containing 1 to 4 heteroatoms selected from the group
Ishi 7-membered heterocycle-carbonyl, C_6-14Aryl-
Carbamoyl, optionally halogenated C_1-6
Alkyl-carbamoyl, optionally halogenated
I C_1-6Alkoxy-carbonyl, C_1-6Arco
Xy-carbamoyl, C_6-14Aryloxy-ca
Having 1 or 2 substituents selected from luvamoyl
Optional amino group, (vi) oxo, C_1-6Archi
Le, C _6-14Aryl, C_1-6Alkyl-carboni
Le, C_1-6Alkoxy-carbonyl or C_1-6A
A carbon atom, optionally substituted by rukyi-carbonyl
Other than nitrogen atom, sulfur atom and oxygen atom 1
Or 2 to 5, 5 to 1 containing 1 to 4 heteroatoms
0-membered heterocyclic group, (vii) formula- (C = O) -R^{5d '}(R
^{5d '}Is a hydrogen atom, optionally halogenated C
_1-6Alkyl group or optionally halogenated C
_6-14Represents an aryl group), an acyl group represented by
Is the formula (viii)-(C = O) -OR^{5d ' '}(R^{5d ' '}Is
Hydrogen atom or C _1-6Represents an alkyl group)
Acyl group, R^2eIs (1) C_1-6Alkyl group (this C
_1-6Alkyl is a halogen atom, cyano, hydroxy,
C_3-8Nitrogen atom other than cycloalkyl or carbon atom
A heteroatom selected from a child, an oxygen atom and a sulfur atom
Substituted with 5 to 7 membered aliphatic heterocyclic groups, including 1 to 4
Optional), (2) halogen atom, (3)
May have a substituent selected from the group consisting of
Amino group: C_1-6Alkyl (this C_1-6Archi
Is a halogen atom, cyano, hydroxy, C_3-8Shiku
In addition to alkyl or carbon atoms, nitrogen and oxygen atoms
And 1 to 4 heteroatoms selected from sulfur atoms
May be substituted with a 5- to 7-membered aliphatic heterocyclic group
I), C_3-8Cycloalkyl, C_1-6Alkyl
-Carbonyl (this C_1-6Alkyl-carbonyl is
Rogen atom, cyano, hydroxy, C_3-8Cycloal
Kills or carbon atoms other than nitrogen, oxygen and sulfur
May contain 1 to 4 heteroatoms selected from yellow atoms
May be substituted with a 5 to 7 membered aliphatic heterocyclic group
I), C_1-6Alkoxy-carbonyl, C_1-6
C optionally substituted with alkyl_3-8Cycloalk
In addition to le-carbonyl and carbon atom, nitrogen atom and oxygen atom
And 1 to 4 heteroatoms selected from sulfur atoms
5- to 7-membered aliphatic heterocyclic groups including (this aliphatic heterocyclic group
The base is C_{1- 6}Alkyl or C_1-6Alkyl-carbo
Optionally substituted with nyl), nitrogen in addition to carbon atoms
Hetero atom selected from atom, oxygen atom and sulfur atom
5- to 7-membered aliphatic heterocycle-Cal containing 1 to 4
Bonyl group (This aliphatic heterocycle-carbonyl group is C_1-6
Alkyl or C_1-6Alkyl-carbonyl substituted
Optional), (4) carbon atom and one nitrogen source
In addition to the child, from nitrogen atom, oxygen atom and sulfur atom
May contain 1 to 4 heteroatoms selected 5
To 7-membered saturated cyclic amino group (this saturated cyclic amino group
Is C_1-6Alkyl or C_1-6Alkyl-carboni
May be substituted with a hydroxyl group), (5) a hydroxy group,
And (6) C_1-6From an alkyl-carbonyloxy group
Selected from the group consisting of (especially, the group consisting of (1) to (4))
With a substituent next to the nitrogen atom of the pyridyl group
A pyridyl group (preferably a 4-pyridyl group,
The lysyl group may be N-oxidized), and R
^3eIs an optionally halogenated C_1-6Alkyl,
C_1-6Alkoxy, halogen atom, carboxy, C
_1-6Alkoxy-carbonyl, cyano, C_{1 -6}Al
Kirthio and C_1-6Group consisting of alkylsulfonyl
C which may have a substituent selected from_6-14
Nitrogen atom, sulfur atom other than aryl group or carbon atom
And 1 or 2 kinds selected from oxygen atoms, preferably 1
A 5- to 14-membered aromatic containing from 4 to 4 heteroatoms
Indicates a heterocyclic group. ] The compound represented by
Be done.

Examples of the C _1-6 alkyl group represented by R ^1e include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl and tert-butyl.
Butyl, pentyl, hexyl and the like are used, and among them, a C _1-4 alkyl group such as methyl, ethyl, propyl and butyl is preferable, and a C _1-3 alkyl group such as methyl, ethyl and propyl is particularly preferable. C represented by R ^1e
_As the halogen atom which is a substituent of the _1-6 alkyl group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom or the like is used. As the C _1-6 alkoxy-carbonyl which is the substituent of the C _1-6 alkyl group represented by R ^1e , for example, methoxycarbonyl, ethoxycarbonyl and the like are preferable. As the C _1-6 alkylthio which is a substituent of the C _1-6 alkyl group represented by R ^1e , for example, methylthio, ethylthio and the like are preferable. As the C _1-6 alkylsulfinyl which is the substituent of the C _1-6 alkyl group represented by R ^1e , for example, methylsulfinyl, ethylsulfinyl and the like are preferable. Examples of the C _1-6 alkylsulfonyl which is the substituent of the C _1-6 alkyl group represented by R ^1e include methylsulfonyl,
Ethylsulfonyl and the like are preferable. C represented by R ^1e
_As C _1-6 alkoxy which is a substituent of the _1-6 alkyl group, for example, methoxy, ethoxy, propoxy and the like are preferable. As the C _1-6 alkyl-carbonyl which is the substituent of the C _1-6 alkyl group represented by R ^1e , for example, acetyl, propionyl and the like are preferable. R ^1f
Examples of the C _1-6 alkyl group represented by are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl,
Hexyl and the like are used, and among them, a C _1-3 alkyl group such as methyl, ethyl and propyl is preferable, and methyl is particularly preferable. As the C _6-14 aryl group represented by R ^1e , for example, phenyl, naphthyl and the like are preferable, and phenyl is particularly preferable. C represented by R ^1e
_As the halogen atom which is a substituent of the _6-14 aryl group, a fluorine atom, a chlorine atom, a bromine atom or an iodine atom is used. The C _7-15 aralkyl group represented by R ^1e is preferably a phenyl-C _1-3 alkyl group such as benzyl, phenylethyl, phenylpropyl and the like.

Examples of the C _1-6 alkyl group which is a substituent of the amino group represented by R ^1e include methyl, ethyl,
Propyl, isopropyl, butyl, isobutyl, sec
-Butyl, tert-butyl, pentyl, hexyl and the like are used, and among them, a C _1-3 alkyl group such as methyl, ethyl and propyl is preferable, and methyl is particularly preferable. C _1-6 which is a substituent of the amino group represented by R ^1e
As the alkyl-carbonyl, for example, a C _1-3 alkyl-carbonyl group such as acetyl and propionyl is preferable. As a "5- to 7-membered heterocycle-carbonyl containing 1 to 4 heteroatoms selected from the group consisting of nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom" which is a substituent of the amino group represented by R ^1e Is, for example, 1 selected from the group consisting of nitrogen atom, oxygen atom and sulfur atom.
Alternatively, a 5- to 7-membered heterocycle (eg, pyridyl etc.)-Carbonyl group containing 2 heteroatoms is preferable.
Examples of the substituent of the heterocyclic group of the heterocyclic-carbonyl group include a halogen atom such as chlorine atom, a C _1-6 alkyl group such as methyl and ethyl, a C _1-6 such as methoxy and ethoxy.
_1-6 alkoxy is preferred. As the C _6-14 aryl-carbamoyl which is the substituent of the amino group represented by R ^1e , for example, phenyl-carbamoyl and the like are preferable. Optionally halogenated C _1-6 alkyl optionally substituted group of the amino group represented by R ^1e - carbamoyl, for example, a halogen atom (e.g., chlorine atom) methylcarbamoyl may be substituted with carbamoyl, ethyl Carbamoyl, propylcarbamoyl and the like are preferable. Which may be halogenated is a substituent of an amino group represented by R ^1e C _{1- 6} alkoxy - as carbonyl, for example, a halogen atom (e.g., chlorine atom) may methoxycarbonyl be substituted by, ethoxy Carbonyl, propoxycarbonyl and the like are preferred. As the C _1-6 alkoxy-carbamoyl which is the substituent of the amino group represented by R ^1e , for example, methoxycarbamoyl, ethoxycarbamoyl, propoxycarbamoyl and the like are preferable. R
^As the C _6-14 aryloxy-carbamoyl which is the substituent of the amino group represented by ^1e , phenyloxycarbamoyl and the like are preferable. Examples of the 5- to 10-membered non-aromatic heterocyclic group represented by R ^1e include 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 3-oxazolidinyl, 1-imidazolinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl. , 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-
Piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like are used, among which 4-piperidyl, 1-
Preferred is piperazinyl, 3-oxazolidinyl, 1-imidazolidinyl and the like. Oxo represented by R ^1e , C
_1-6 alkyl (preferably methyl, ethyl), C
_6-14 aryl (preferably phenyl), C _1-6
Alkyl-carbonyl (preferably acetyl, propionyl, etc.), C _1-6 alkoxy-carbonyl (preferably methoxycarbonyl, ethoxycarbonyl, te
Examples of the 5- to 10-membered non-aromatic heterocyclic group which may be substituted with (rt-butoxycarbonyl etc.) include 1-methyl-4-piperidyl, 4-methyl-1-piperazinyl, 2
-Oxo-3-oxazolidinyl, 2-oxo-1-imidazolidinyl, 2-oxo-3-phenyl-1-imidazolidinyl and the like are preferable. Formula represented by R ^1e −
The ^{'R 5d of' (C = O) -R 5d} , a hydrogen atom, optionally halogenated _{C 1-6} alkyl group (methyl, ethyl, trifluoromethyl, etc.), may be halogenated A _C6-14 alkyl group (phenyl, naphthyl, fluorophenyl, chlorophenyl, etc.) is preferable. Formula represented by R ^1e - as (C = O) ^{'R 5d of' -OR 5d ''} is a hydrogen _{atom, C 1-3} alkyl group (methyl, ethyl, etc.) are preferable. As R ^1e ,
C _1-6 alkyl group (eg, methyl, ethyl, propyl,
Isopropyl, butyl, isobutyl, sec-butyl,
(tert-butyl, pentyl, hexyl and the like) are preferable, and C _1-3 alkyl groups such as methyl, ethyl and propyl are particularly preferable.

Specific examples of the substituent of the pyridyl group represented by R ^2e include the following (1) to (6), especially (1) to
1 to 3 substituents selected from (4), preferably 1 or 2 substituents are used. (1) C _1-6 alkyl group (for example, methyl, ethyl,
Propyl, isopropyl, butyl, isobutyl, sec
-Butyl, tert-butyl, pentyl, hexyl, etc., preferably a C _1-4 alkyl group such as methyl, ethyl, propyl, butyl, etc.), wherein C _1-6 alkyl is a halogen atom, cyano, hydroxy, C _3-8. Cycloalkyl, a 5- to 7-membered aliphatic heterocyclic group containing a hetero atom selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom (for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2 -Piperidyl,
3-piperidyl, 4-piperidyl, 1-piperazinyl,
2-Piperazinyl, 3-piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepin-1-yl, etc.)
(2) a halogen atom (eg, fluorine atom, chlorine atom, bromine atom, iodine atom), which may be substituted with
(3) An amino group C _1-6 alkyl which may have a substituent selected from the group consisting of (e.g., methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl). , pentyl, hexyl, preferably _{C 1-3} alkyl group), the _{C 1 -6} alkyl such as methyl, ethyl, propyl, halogen atom, cyano, _{hydroxy, C 3-8} cycloalkyl, nitrogen in addition to carbon atoms 5 containing 1 to 4 heteroatoms selected from atom, oxygen atom and sulfur atom
To 7-membered aliphatic heterocyclic group (for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepin-1-yl, etc.), C
_3-8 cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.),
C _1-6 alkyl-carbonyl (eg acetyl, propionyl, butyryl, valeryl, isovaleryl, 2-
Butyryl, pivaloyl, etc.), the C _{1 -6} alkyl - carbonyl, halogen atom, cyano, hydroxy, C _3-8 cycloalkyl, a nitrogen atom in addition to carbon atoms, to 1 heteroatoms selected from oxygen atom and a sulfur atom 5 to 7-membered aliphatic heterocyclic group containing 4 (for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl,
Hexahydroazepin-1-yl and the like) optionally substituted C _1-6 alkoxy-carbonyl (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, butoxycarbonyl, isobutoxycarbonyl, sec-butoxycarbonyl, tert-). Butoxycarbonyl, etc.), C _1-6 alkyl (eg, methyl,
C _3-8 cycloalkyl-carbonyl (eg, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, 1-methyl-cyclohexylcarbonyl, etc.) which may be substituted with ethyl), a nitrogen atom in addition to the carbon atom, 5- to 7-membered aliphatic heterocyclic group containing 1 to 4 heteroatoms selected from oxygen atom and sulfur atom (for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, piperidino, 2-piperidyl, 3-piperidyl) , 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepin-1-yl. Do). This aliphatic heterocyclic group is C
_1-6 alkyl (eg, methyl, ethyl, etc.) or C
5 to 7 membered 1 to 4 hetero atom selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom, which may be substituted with _1-6 alkyl-carbonyl (eg, acetyl, propionyl, etc.) Aliphatic heterocycles (eg, 1-pyrrolidinyl, 2-pyrrolidinyl, 3
-Pyrrolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 4-piperazinyl, morpholino, 2-morpholinyl, 3-morpholinyl, thiomorpholino, 2-thiomorpholinyl, 3-thiomorpholinyl, hexahydroazepin-1-yl, etc.)-Carbonyl group. This aliphatic heterocycle-carbonyl group has C _1-6.
(4) A nitrogen atom other than the carbon atom and one nitrogen atom, which may be substituted with alkyl (eg, methyl, ethyl, etc.) or C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, etc.) , A 5- to 7-membered saturated cyclic amino group optionally containing 1 to 4 heteroatoms selected from oxygen atom and sulfur atom (for example, 1-pyrrolidinyl, piperidino, morpholino, 1-
Such as piperazinyl). This saturated cyclic amino group is C
_It may be substituted with _1-6 alkyl (eg, methyl, ethyl) and the like. (5) Hydroxy group, (6) C _1-6 alkyl-carbonyloxy group (eg, acetyloxy, propionyloxy, butyryloxy and the like). Among them, as the substituent of the pyridyl group represented by R ^2b ,
A C _1-6 alkyl-carbonyl-amino group (eg, acetylamino, propionylamino, butyrylamino, valerylamino, isovalerylamino, 2-methylbutyrylamino, pivaloylamino) is preferable, and particularly C ₁ such as acetylamino and propionylamino. _-3 alkyl-
A carbonyl-amino group is preferred.

The C _6-14 aryl group represented by R ^3e is preferably, for example, phenyl or naphthyl,
Among them, phenyl is preferable. As the 5- to 14-membered aromatic heterocyclic group containing 1 or 2 kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to the carbon atom represented by R ^3e , preferably 1 to 4 hetero atoms, For example, 1 or 2 kinds selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom such as thienyl, preferably 1
A 5- to 6-membered aromatic heterocyclic group containing 4 to 4 heteroatoms is preferred. The optionally halogenated C _1-6 alkyl which is a substituent of the C _6-14 aryl group or the aromatic heterocyclic group is, for example, substituted with a halogen atom (eg, fluorine, chlorine, etc.). Optionally methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl,
Hexyl and the like are used, and among them, an optionally halogenated C _1-3 alkyl group such as methyl, ethyl, propyl and trifluoromethyl is preferable. The C _6-14
C which is a substituent of the aryl group or the aromatic heterocyclic group
_{As 1-6} alkoxy, for example, methoxy, ethoxy, propoxy and the like are used, and among them, methoxy is preferable. The halogen atom which is a substituent of the C _6-14 aryl group or the aromatic heterocyclic group is a fluorine atom,
A chlorine atom, a bromine atom and an iodine atom are used, and among them, a fluorine atom and a chlorine atom are preferable. C which is a substituent of the C _6-14 aryl group or the aromatic heterocyclic group
_{As 1-6} alkoxy-carbonyl, methoxycarbonyl, ethoxycarbonyl and the like are preferable. The C
_As C _1-6 alkylthio which is a substituent of the _6-14 aryl group or the aromatic heterocyclic group, methylthio, ethylthio and the like are preferable. As the C _1-6 alkylsulfonyl which is a substituent of the C _6-14 aryl group, methylsulfonyl, ethylsulfonyl and the like are preferable. R ^3e
Is C _{6-14 optionally} having a substituent selected from the group consisting of C _1-6 alkyl and halogen atom.
Aryl groups are preferred, and phenyl groups optionally substituted with methyl or chlorine atoms are preferred. Compound (VIa)
^Are , for example, (1) R ^1e is a halogen atom, hydroxy, C _1-6 alkoxy, C _1-6 alkylthio,
C _1-6 alkylsulfinyl and _{C 1-6} alkylsulfonyl _{C 1-6} alkyl group optionally having a substituent selected from the group consisting ^{of, R 2e} is _{C 1-6} alkyl - carbonyl - amino group or a C _{A 3-8} cycloalkylamino group, and C in which R ^3e may have a substituent selected from the group consisting of C _1-6 alkyl and a halogen atom.
Compound (VIa) which is a _6-14 aryl group, (2) R
^1e is a halogen atom, _{hydroxy, C 1-6 alkoxy, C 1-6} alkylthio which _may have a substituent selected from the group consisting of _{C 1-6} alkylsulfinyl and _{C 1-6} alkylsulfonyl _{C 1- A} compound in which ₃ alkyl group, R ^2e is a C _1-3 alkyl-carbonyl-amino group or a C _3-8 cycloalkylamino group, and R ^3e is a phenyl group which may have a substituent on a methyl or chlorine atom ( VIa) and the like are preferable.

Specific preferred examples of the compound (VIa) include the compounds produced in Reference Examples H1-113 described later, and among them, 5- [2- (tert-butoxycarbonylamino) -4-pyridyl]- 2-ethyl-4-
(3-Methylphenyl) -1,3-thiazole (Reference Example H3), [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] Amine (Reference Example H7-4), 2-ethyl-5- (2
-Fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole (Reference Example H11), 5- (2
-Fluoro-4-pyridyl) -4- (3-methylphenyl) -2- [4- (methylthio) phenyl] -1,3-
Thiazole (Reference Example H15), 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -2- [4-
(Methylthio) phenyl] -1,3-thiazole (Reference Example H16-1), 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine (Reference Example H22), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide (Reference Example H22)
29-2), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] propionamide (Reference Example H29-4), N
-[4- [4- (3-chlorophenyl) -2-methyl-
1,3-thiazol-5-yl] -2-pyridyl] acetamide (Reference Example H30-1), N- [4- [4- (3
-Chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridyl] acetamide (Reference Example H
30-2), N- [4- [4- (3-chlorophenyl)
-2-Propyl-1,3-thiazol-5-yl] -2
-Pyridyl] acetamide (Reference Example H30-3), N-
[4- [4- (3-chlorophenyl) -2-methyl-
1,3-thiazol-5-yl] -2-pyridyl] propionamide (Reference Example H30-7), N- [4- [4-
(3-Chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide (Reference Example H30-8), N- [4- [4- (3-chlorophenyl) -2] -Propyl-1,3-thiazole-5-
Il] -2-pyridyl] propionamide (Reference Example H3
0-9), N-cyclohexyl-4- [2-ethyl-4]
-(3-Methylphenyl) -1,3-thiazole-5-
Il] -2-pyridylamine (Reference Example H36-4), N
-Cyclohexyl-4- [4- (3-methylphenyl)
-2- (4-Methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine (Reference Example H
36-5), N-cyclopentyl-4- [2-ethyl-
4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridylamine (Reference Example H36-6),
N-cyclopentyl-4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3
-Thiazol-5-yl] -2-pyridylamine (Reference Example H36-7), 4- [4- (3-chlorophenyl)-
2-Ethyl-1,3-thiazol-5-yl] -N-cyclohexyl-2-pyridylamine (Reference Example H36-1
0), 4- [4- (3-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -N-cyclopentyl-2-pyridylamine (Reference Example H36-11), N-
[4- (3-methylphenyl) -5- (2-methyl-4)
-Pyridyl) -1,3-thiazol-2-yl] acetamide (Reference Example H39), N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl)-
1,3-Thiazol-2-yl] nicotinamide (Reference Example H42-1), 6-chloro-N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl)
-1,3-Thiazol-2-yl] nicotinamide (Reference Example H44-3), N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3 −
Thiazol-2-yl] -6-methylnicotinamide (Reference Example H46-3), N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,
3-Thiazol-2-yl] -6-methoxynicotinamide (Reference Example H48-3), 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -2- (4-
Methylsulfinylphenyl) -1,3-thiazole (Reference Example H54), 4- (3-methylphenyl) -5-
(2-Methyl-4-pyridyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole (Reference Example H5
7), 5- (2-fluoro-4-pyridyl) -4- (3
-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole (Reference Example H58-4), N
-[4- [4- (3-chlorophenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] acetamide (Reference Example H58-
6), N- [4- [4- (3-chlorophenyl) -2-
(4-Methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide (Reference Example H58-7), N- [4- [4- (3-chlorophenyl) -2- ( 4-methylsulfonylphenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] pivalamide (Reference Example H58-8) and the like are preferable. The compound (IV), (V) or (VI) of the present invention contains N- [4- (3,
5-Dimethylphenyl) -5- (2-hydroxy-4-pyridyl) -1,
3-thiazol-2-yl] acetamide and 4- [2- (acetylamino) -4- (3,5-dimethylphenyl) -1,3-thiazole-
5-yl] -2-pyridyl acetate is not included.

The compound (IV), (V) or (V of the present invention
Examples of the salt of I) include metal salts, ammonium salts, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids and the like. Preferable examples of the metal salt include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt, magnesium salt and barium salt; aluminum salt and the like. Preferable examples of salts with organic bases include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N'-dibenzylethylenediamine. And the like. Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like. Preferable examples of salts with organic acids include formic acid, acetic acid, trifluoroacetic acid,
Phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid,
Examples thereof include salts with citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like. Suitable examples of salts with basic amino acids include, for example, salts with arginine, lysine, ornithine, and suitable examples of salts with acidic amino acids include, for example, salts with aspartic acid, glutamic acid, etc. To be Of these, pharmaceutically acceptable salts are preferable. For example, when the compound has an acidic functional group, an inorganic salt such as an alkali metal salt (eg, sodium salt, potassium salt, etc.), an alkaline earth metal salt (eg, calcium salt, magnesium salt, barium salt, etc.), Ammonium salts and the like, when having a basic functional group in the compound, for example, salts with inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, or acetic acid, phthalic acid, fumaric acid, Salts with organic acids such as oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid and p-toluenesulfonic acid are preferable.

The compounds (IV), (V), and
The method for producing (VI) or a salt thereof will be described. Hereinafter, the compound (I ′) means the compounds (IV), (V), (VI), (V
Compounds containing a) and (VIa) are shown. The compound (I) of the present invention can be obtained by the method represented by the following reaction scheme 1 or a method analogous thereto, and, for example, JP-A-60-
58981, JP 61-10580 A, JP 7-503023 A, WO 93/1507.
1, DE-A-3601411, JP-A-5-70446.
It can be obtained by the method described in Japanese Patent Publication or the like or a method similar thereto. Each symbol of the compounds in the following reaction formulas 1 and 2 has the same meaning as described above. The compound in the reaction formula includes a case of forming a salt, and the salt includes, for example, the compound (I
Examples thereof include those similar to the salt of V).

Reaction formula 1

[Chemical Formula 39]

Compounds (II '), (III'), (V '),
When (VII '), (XI'), (XIII ') and (XIV') are commercially available, commercially available products can be used as they are, and they are produced according to a method known per se or a method analogous thereto. You can also Compound (IV ') is compound (II')
And compound (III ′) are condensed in the presence of a base. In the compound (III ′), R ^8c is, for example, C _1-6 alkoxy (eg, methoxy, ethoxy, etc.),
Di-C _1-6 alkylamino (eg, dimethylamino,
Diethylamino etc.), N- _C6-10 aryl-N-
C _1-6 alkylamino (eg, N-phenyl-N-methylamino, etc.), C _6-10 aryl and / or C ₁
3 to 7 membered saturated cyclic amino optionally substituted with _-6 alkyl (eg, pyrrolidin-1-yl, morpholino,
Methylaziridin-1-yl etc.) and the like. Compound (II
The amount of I ′) used is approximately 0.5 to approximately 3.0 mol, preferably approximately 0.8 to approximately 2.0 mol, with respect to 1 mol of the compound (II ′). The amount of the base used is the compound (II ')
It is about 1.0 to about 30 moles, preferably about 1.0 to about 10 moles, relative to 1 mole. Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate and cesium carbonate, inorganic bases such as sodium hydroxide and potassium hydroxide, aromatic amines such as pyridine and lutidine, triethylamine and tripropyl. Amine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-
Tertiary amines such as methylpiperidine, N-methylpyrrolidine and N-methylmorpholine, alkali metal hydrides such as sodium hydride and potassium hydride, sodium amide, lithium diisopropylamide, lithium hexamethyldisilazide and the like. Examples thereof include metal amides, metal alkoxides such as sodium methoxide, sodium ethoxide, potassium tert-butoxide, and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, water or a mixture of two or more thereof. Etc. are used. The reaction temperature is generally about −5 to about 200 ° C., preferably about 5 to about 150 ° C. The reaction time is usually about 5 minutes to about 72 hours, preferably about 0.5 to about 3
It's 0 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (VIII ') can be obtained by treating the compound (IV') with an acid. The amount of the acid used is about 1.0 to about 100 mol, based on 1 mol of the compound (IV ′),
It is preferably about 1.0 to about 30 mol. The "acid"
As such, for example, mineral acids such as hydrochloric acid, hydrobromic acid and sulfuric acid are used. This reaction is carried out in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, water, a mixture of water and amides, a mixture of water and alcohols, etc. are used. The reaction temperature is usually 20
To about 200 ° C, preferably about 60 to about 150 ° C
Is. The reaction time is usually about 30 minutes to about 72 hours,
It is preferably about 1 to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (VIII ') is obtained by treating the compound (V') with a base, and the compound (VI ') and the compound (VI).
It can also be obtained by condensing with I '). Compound (V
In I '), M represents an alkali metal such as lithium, sodium or potassium. R ^{9 in the} compound (VII ′)
Examples of the same include those similar to the above R ⁸ .
The amount of the base used is about 1.0 with respect to 1 mol of the compound (V ′).
To about 30 mol, preferably about 1.0 to about 10 mol. Examples of the "base" include metal amides such as sodium amide, lithium diisopropylamide, lithium hexamethyldisilazide, and alkyl metal compounds such as alkyllithium. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, or a mixture of two or more of these and the like are used. The reaction temperature is generally about -78 to about 60 ° C, preferably about -78 to about 20 ° C. The reaction time is
It is usually about 5 minutes to about 24 hours, preferably about 0.5 to about 3 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (IX ') can be obtained by treating the compound (VIII') with halogens. This reaction is carried out in the presence of a base or a basic salt, if desired. Compound (I
In X '), Hal represents halogens. The amount of halogens used is approximately 1.0 to approximately 5.0 mol, preferably approximately 1.0 to approximately 2.0 mol, with respect to 1 mol of the compound (VIII ′). Examples of the "halogens" include bromine, chlorine, iodine and the like. The amount of the base used is compound (VIII ') 1
The amount is about 1.0 to about 10.0 mol, preferably about 1.0 to about 3.0 mol, per mol. Examples of the "base" include aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine and N. Examples include tertiary amines such as -methylpyrrolidine and N-methylmorpholine. The amount of the basic salt used is approximately 1.0 to approximately 10.0 mol, preferably approximately 1.0 to approximately 3.0 mol, with respect to 1 mol of the compound (VIII ′). Examples of the "basic salt" include sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogen carbonate, sodium acetate, potassium acetate and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but examples thereof include ethers, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, organic acids, and aromatics. Group amines or mixtures of two or more of these are used. The reaction temperature is about −20 to about 150 ° C., preferably about 0.
To about 100 ° C. The reaction time is generally 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (I ') can be obtained by condensing the compound (IX') and the compound (X '). This reaction is carried out in the presence of a base, if desired. Compound (X ')
When commercially available, commercially available products may be used as they are, or a method known per se or a method analogous thereto,
Further, it can be obtained by the method represented by the following reaction formula 2. The amount of the compound (X ′) used is approximately 0.5 to approximately 3.0 mol, preferably approximately 0.8 to approximately 2.0 mol, with respect to 1 mol of the compound (IX ′). The amount of the base used is approximately 1.0 to approximately 30 mol, preferably approximately 1.0 to approximately 10 mol, with respect to 1 mol of the compound (IX ′). Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate, cesium carbonate and sodium hydrogen carbonate, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, and And tertiary amines such as dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine and N-methylmorpholine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction.
The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols,
Nitriles or a mixture of two or more of these are used. The reaction temperature is about −5 to about 200 ° C., preferably about 5 to about 150 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

Reaction formula 2

[Chemical 40]

The compound (XII ') has the same structure as the compound (XI'):
It is obtained by condensing with an amine represented by R ^1c H. In the compound (XI ′), R ^10c represents an aromatic hydrocarbon group or alkoxy. The "aromatic hydrocarbon group"
Examples thereof include a phenyl group which may have a substituent and the like. Examples of the “alkoxy” include C _1-6 alkoxy such as methoxy, ethoxy, propoxy, isopropoxy, butoxy and the like. The amount of the “amines” used is about 1. per mol of the compound (XI ′).
0 to about 30 mol, preferably about 1.0 to about 10
It is a mole. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitriles, ketones or these A mixture of two or more kinds is used. The reaction temperature is about −5 to about 200 ° C., preferably about 5 to about 120 ° C. The reaction time is usually about 5 minutes to about 7
It is 2 hours, preferably about 0.5 to about 30 hours.
The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (X ') can be obtained by hydrolyzing the compound (XII') with an acid or a base. The amount of the acid and base used is approximately 0.1 to approximately 50 mol, preferably approximately 1 to approximately 20 mol, with respect to 1 mol of the compound (XII ′). Examples of the “acid” include hydrochloric acid,
Mineral acids such as hydrobromic acid and sulfuric acid, Lewis acids such as boron trichloride and boron tribromide, combined use of Lewis acid and thiols or sulfides, organic acids such as trifluoroacetic acid and p-toluenesulfonic acid Is used. Examples of the “base” include metal hydroxides such as sodium hydroxide, potassium hydroxide and barium hydroxide, basic salts such as sodium carbonate and potassium carbonate, sodium methoxide, sodium ethoxide, potassium tert-butoxide. And metal bases such as triethylamine, imidazole, and formamidine. This reaction is
It is advantageous to carry out in the absence of a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, alcohols, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons,
Sulfoxides, water, or a mixture of two or more thereof are used. The reaction time is generally about 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is usually about 0 to about 200 ° C., preferably about 20.
To about 120 ° C.

The compound (X ') can also be obtained by treating the compound (XIII') with hydrogen sulfide in the presence of a base. The amount of hydrogen sulfide used is approximately 1 to approximately 30 mol with respect to 1 mol of the compound (XIII ′). The amount of the base used is about 1.0 to about 30 with respect to 1 mol of the compound (XIII ′).
The molar amount is preferably about 1.0 to about 10 mol. Examples of the "base" include aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine,
Tributylamine, cyclohexyldimethylamine, 4
-Dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N
And tertiary amines such as methylmorpholine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, aromatic amines, or a mixture of two or more thereof, etc. Used. This reaction is carried out under normal pressure or increased pressure. The reaction temperature is generally about −20 to about 80 ° C., preferably about −
10 to about 30 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do. The compound (X ′) can also be obtained by treating the compound (XIII ′) with O, O-diethyl dithiophosphate in the presence of an acid. The amount of O, O-diethyl dithiophosphate used is approximately 0.9 to approximately 2 mol with respect to 1 mol of the compound (XIII ′). The amount of the acid used is the amount of compound (XIII ′) 1
The amount is about 3.0 to about 30 mol, preferably about 3.0 to about 10 mol, based on mol. Examples of the "acid" include hydrogen halides such as hydrogen chloride and hydrogen bromide, and mineral acids such as hydrochloric acid and hydrobromic acid. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, alcohols, amides, ethers, esters, water, or a mixture of two or more of these and the like can be used. The reaction temperature is generally about 0 to about 80 ° C, preferably about 0 to about 30 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (X ') can also be obtained by treating the compound (XIV') with phosphorus pentasulfide or Lawesson's reagent. The amount of phosphorus pentasulfide or Lawesson's reagent used is approximately 0.5 to approximately 10 mol, preferably approximately 0.5 to approximately 3 mol, with respect to 1 mol of the compound (XIV ′). This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, or a mixture of two or more thereof or the like is used. The reaction time is generally 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is generally about 0 to about 150 ° C, preferably about 20 to about 120 ° C. The product (X ′) can be used as it is in the reaction solution or as a crude product in the next reaction, or can be isolated from the reaction mixture by a conventional method, and can be separated by recrystallization, distillation, chromatography or the like. Can be easily purified.

When the compound (I ') is an acylamino compound, the corresponding amine compound can be subjected to an acylation reaction known per se to give the desired product. For example, in the compound (I ′), the compound in which the substituent at the 2-position of the thiazole ring is an acylamino which may have a substituent is a compound in which a corresponding 2-thiazole amine and an acylating agent are optionally combined with a base or It is obtained by reacting in the presence of an acid. The amount of the acylating agent used is the same as that of the corresponding 2-thiazole amine 1
The amount is about 1.0 to about 5.0 mol, preferably about 1.0 to about 2.0 mol, per mol. Examples of the “acylating agent” include a carboxylic acid corresponding to the acyl group of the target compound or a reactive derivative thereof (eg, acid halide, acid anhydride, ester, etc.) and the like. The amount of the base or acid used is about 0.8 to about 5.0 mol, preferably about 1.0 to about 2.0 mol, based on 1 mol of the corresponding 2-thiazoleamine. Examples of the "base" include triethylamine, pyridine, 4-dimethylaminopyridine and the like. Examples of the “acid” include methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, amides,
Halogenated hydrocarbons, nitriles, sulfoxides,
Aromatic amines or mixtures of two or more of these are used. The reaction temperature is about -20 to about 150 ° C, preferably about 0 to about 100 ° C. The reaction time is usually about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

In the compound (I ′), the compound in which the 5-position of the thiazole ring is an acylaminopyridyl which may have a substituent is the corresponding 5- (2-aminopyridyl).
It can be obtained by reacting a thiazole with an acylating agent in the presence of a base or an acid, if desired. The amount of the acylating agent used is about 1.0 to about 5.0 mol, preferably about 1.0 to about 2.0 mol, per 1 mol of the corresponding 5- (2-aminopyridyl) thiazole. Examples of the “acylating agent” include a carboxylic acid corresponding to an acyl group of a target compound or a reactive derivative thereof (eg, an acid halide,
Acid anhydrides, esters, etc.) and the like. The amount of the base or acid used is about 0.8 to about 5.0 mol, preferably about 1.0 to about 2.0 mol, per 1 mol of the corresponding 5- (2-aminopyridyl) thiazole. Examples of the "base" include triethylamine, pyridine, 4-dimethylaminopyridine and the like. As the “acid”,
Examples thereof include methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, and examples thereof include ethers, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, aromatic amines. Alternatively, a mixture of two or more of these is used. The reaction temperature is about -20 to about 150 ° C, preferably about 0 to about 100 ° C.
The reaction time is usually about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product remains the reaction solution,
Alternatively, it can be used as a crude product in the next reaction, or can be isolated from the reaction mixture according to a conventional method,
It can be easily purified by separation means such as recrystallization, distillation and chromatography.

In the compound (I '), the compound in which the 5-position of the thiazole ring is an alkylaminopyridyl which may have a substituent can also be obtained by reducing the corresponding acylaminopyridine with a reducing agent. The amount of reducing agent used is approximately 1.0 to approximately 5.0 mol, preferably approximately 1.0 to approximately 3.0 mol, with respect to 1 mol of the corresponding acylaminopyridine. Examples of the “reducing agent” include metal hydrides such as aluminum hydride and diisobutylaluminum hydride, metal hydrogen complex compounds such as lithium aluminum hydride and sodium borohydride, borane tetrahydrofuran complex, borane dimethyl sulfide complex, and the like. And borane complexes, alkylboranes such as thexylborane and disiamilborane. In this reaction, an acid may be added together with a reducing agent if desired. The amount of the acid used is about 0.8 to about 5.0 mol, preferably about 1.0 to about 3.0 mol, based on 1 mol of the corresponding acylaminopyridine. Examples of the "acid" include Lewis acids such as aluminum chloride. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, or a mixture of two or more thereof or the like is used. The reaction temperature is about -78 to about 1.
It is 50 ° C, preferably about 0 to about 100 ° C. The reaction time is usually about 5 minutes to about 24 hours, preferably about 10 minutes.
Minutes to about 5 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

In the compound (I '), the compound in which the 5-position of the thiazole ring is an alkylaminopyridyl which may have a substituent may be used as the corresponding 5- (2-halogenopyridyl) thiazole with amines. Obtained by condensation. The amount of amine used is about 1.0 to about 1 per 1 mol of the corresponding 5- (2-halogenopyridyl) thiazole.
The amount is 0.0 mol, preferably about 1.0 to about 20.0 mol. Examples of the halogen of the "5- (2-halogenopyridyl) thiazole" include fluorine, chlorine, bromine, iodine and the like. Examples of the "amines" include aliphatic amines and cyclic amines corresponding to the target alkylamine. This reaction is carried out in the presence of a base or a basic salt, if desired. The amount of base used is the corresponding 5- (2
-Halogenopyridyl) thiazole to about 1 mol per mol.
It is 0 to about 10.0 moles, preferably about 1.0 to about 3.0 moles. Examples of the "base" include aromatic amines such as pyridine and lutidine, triethylamine,
Tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N,
Examples thereof include tertiary amines such as N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine and N-methylmorpholine. The amount of basic salt used is 5
About 1.0 to about 10.0 moles, preferably about 1.0 mole, per mole of-(2-halogenopyridyl) thiazole.
It is 0 to about 3.0 mol. Examples of the "basic salt" include sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogen carbonate, sodium acetate, potassium acetate and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, water, or two or more kinds of these. A mixture or the like is used. The reaction temperature is about 0 to about 300 ° C, preferably about 20 to about 200 ° C. The reaction time is usually about 5 minutes to about 48 hours, preferably about 10 minutes to about 15 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

When the compound (I ') is an N-oxide, it can be obtained by treating the corresponding pyridyl with an organic peracid. The amount of the organic peracid used is approximately 0.8 to approximately 10 mol, preferably approximately 1.0 to approximately 3.0 mol, with respect to 1 mol of the corresponding pyridyl derivative. The "organic peracid"
Examples thereof include peracetic acid, pertrifluoroacetic acid, and metachloroperbenzoic acid. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction.
The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids, ethers, amides, sulfoxides, alcohols, nitriles. And ketones, or a mixture of two or more thereof. The reaction temperature is
It is about -20 ° C to about 130 ° C, preferably about 0 ° C to about 100 ° C. The reaction time is usually about 5 minutes to about 7
It is 2 hours, preferably about 0.5 to about 12 hours.
The N-oxide form can also be obtained by treating the corresponding pyridyl form with hydrogen peroxide or an alkylhydroperoxide, optionally in the presence of a base, an acid or a metal oxide. The amount of hydrogen peroxide or alkyl hydroperoxide used is about 0.8 to about 10 mol, preferably about 1.0 to about 3.0 mol, per mol of the corresponding pyridyl derivative. The "alkyl hydroperoxide"
Examples thereof include tert-butyl hydroperoxide and cumene hydroperoxide. The amount of the base, acid or metal oxide used is approximately 0.1 to approximately 30 mol, preferably approximately 0.8 to approximately 5 mol, with respect to 1 mol of the corresponding pyridyl derivative. Examples of the "base" include inorganic bases such as sodium hydroxide and potassium hydroxide, basic salts such as sodium carbonate and potassium carbonate, and the like.
Examples of the “acid” include mineral acids such as hydrochloric acid, sulfuric acid and perchloric acid, Lewis acids such as boron trifluoride, aluminum chloride and titanium tetrachloride, and organic acids such as formic acid and acetic acid. Examples of the “metal oxide” include vanadium oxide (V ₂ O ₅ ), osmium tetroxide (OsO ₄ ), tungsten oxide (WO ₃ ), molybdenum oxide (Mo).
O ₃ ), selenium dioxide (SeO ₂ ), chromium oxide (Cr
O ₃ ) and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example,
Halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids, ethers, amides, sulfoxides, alcohols, nitrites, ketones, or a mixture of two or more thereof is used. The reaction temperature is about -2.
0 ° C to about 130 ° C, preferably about 0 ° C to about 10
It is 0 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 12 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, or can be isolated according to a conventional method,
It can be easily purified by separation means such as recrystallization, distillation and chromatography.

When the compound (I ') is an S-oxide, it can be obtained by treating the corresponding sulfide with a peroxide. The amount of the peroxide used is about 0.8 to about 10 mol, preferably about 1.0 to about 3.0 mol, based on 1 mol of the corresponding sulfide. Examples of the “peroxide” include peracetic acid, pertrifluoroacetic acid, metachloroperbenzoic acid, potassium persulfate, metaperiodic acid and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons,
Organic acids, ethers, amides, sulfoxides, alcohols, nitriles, ketones, or a mixture of two or more of these are used. The reaction temperature is about −20 ° C. to about 130 ° C., preferably about 0 ° C. to about 100 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 12 hours.

The S-oxide form can also be obtained by treating the corresponding sulfide form with hydrogen peroxide or an alkylhydroperoxide, optionally in the presence of a base, an acid or a metal oxide. The amount of hydrogen peroxide or alkyl hydroperoxide used is about 0.8 to about 10 mol, preferably about 1.0 to about 3.0 mol, per mol of the corresponding sulfide. Examples of the “alkyl hydroperoxide” include tert-butyl hydroperoxide, cumene hydroperoxide and the like. The amount of the "base, acid or metal oxide" used is about 0.1 to about 30 mol, preferably about 0.8 to about 5 mol, per 1 mol of the corresponding sulfide. Examples of the "base" include inorganic bases such as sodium hydroxide and potassium hydroxide, basic salts such as sodium carbonate and potassium carbonate, and the like. Examples of the "acid" include mineral acids such as hydrochloric acid, sulfuric acid and perchloric acid, Lewis acids such as boron trifluoride, aluminum chloride and titanium tetrachloride, formic acid,
Examples thereof include organic acids such as acetic acid. Examples of the “metal oxide” include vanadium oxide (V ₂ O ₅ ), osmium tetroxide (OsO ₄ ), tungsten oxide (WO ₃ ),
Molybdenum oxide (MoO ₃ ), selenium dioxide (Se)
O _2), and the like chromium oxide (CrO ₃₎ it is. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids, ethers, amides, sulfoxides, alcohols, nitriles. And ketones, or a mixture of two or more thereof. The reaction temperature is about −20 ° C. to about 130 ° C., preferably about 0 ° C. to about 100 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 12 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated according to a conventional method and easily purified by a separation means such as recrystallization, distillation, and chromatography. it can.

In each of the above reactions, when the starting compound has amino, carboxy or hydroxy as a substituent,
A protecting group generally used in peptide chemistry and the like may be introduced into these groups, and the target compound can be obtained by removing the protecting group as necessary after the reaction. Examples of the amino-protecting group include formyl or optionally substituted C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, etc.), phenylcarbonyl, C _1-6 alkoxy-carbonyl (eg, methoxy). Carbonyl, ethoxycarbonyl etc.), phenyloxycarbonyl, C _7-10 aralkyloxy-carbonyl (eg benzyloxycarbonyl etc.), trityl, phthaloyl etc. are used.
As these substituents, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, valeryl, etc.), nitro, etc. are used, and the number of substituents is Is 1 to 3. As the protective group of carboxy, such as optionally C _{1 -6} alkyl optionally having a substituent (e.g.,
Methyl, ethyl, propyl, isopropyl, butyl, te
(rt-butyl etc.), phenyl, trityl, silyl and the like are used. As these substituents, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), formyl, C
_1-6 alkyl-carbonyl (eg acetyl, propionyl, butylcarbonyl etc.), nitro, C _1-6 alkyl (eg methyl, ethyl, tert-butyl etc.),
C _6-10 aryl (eg, phenyl, naphthyl, etc.)
Etc. are used, and the number of substituents is 1 to 3. As the protective group for hydroxy, e.g. each substituent which may _{C 1 -6} alkyl optionally having (e.g., methyl, ethyl, propyl, isopropyl, butyl, tert- butyl, etc.), _{phenyl, C 7-11} aralkyl ( For example, benzyl etc.), formyl, C _1-6 alkyl-carbonyl (eg acetyl, propionyl etc.), phenyloxycarbonyl, C _7-11 aralkyloxy-carbonyl (eg benzyloxycarbonyl etc.), tetrahydropyranyl, tetrahydrofuran. Nil, silyl and the like are used. As these substituents, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), C _1-6 alkyl (eg, methyl, ethyl, tert-butyl, etc.), C
_7-11 aralkyl (eg, benzyl etc.), C _6-
10 aryl (eg, phenyl, naphthyl, etc.), nitro, etc. are used, and the number of substituents is 1 to 4. Further, as a method for removing the protecting group, a method known per se or a method analogous thereto is used, and examples thereof include acid, base, ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate and the like. Treatment methods or reduction reactions are used. In any case, if desired, a known deprotection reaction, acylation reaction, alkylation reaction, hydrogenation reaction, oxidation reaction, reduction reaction, carbon chain extension reaction, or substituent exchange reaction may be carried out individually or in combination. Compound (I ′) can be synthesized by combining two or more. These reactions are described in, for example, New Experimental Chemistry Course 14, 1
Volume 5, 1977 (Maruzen Publishing), etc. are used.

Examples of the above-mentioned "alcohols" include:
Examples include methanol, ethanol, propanol, isopropanol, tert-butanol and the like. Examples of the "ethers" include diethyl ether, diisopropyl ether, diphenyl ether, tetrahydrofuran, dioxane, 1,2-dimethoxyethane and the like. Examples of the above-mentioned "halogenated hydrocarbons" include dichloromethane, chloroform, 1,2-dichloroethane, carbon tetrachloride and the like. Examples of the "aliphatic hydrocarbons" include hexane, pentane, cyclohexane and the like. "Aromatic hydrocarbons"
Examples thereof include benzene, toluene, xylene, chlorobenzene and the like. "Aromatic amines"
Examples thereof include pyridine, lutidine, quinoline and the like. Examples of the “amides” include N,
Examples include N-dimethylformamide, N, N-dimethylacetamide, hexamethylphosphoric triamide, and the like. Examples of the “ketones” include acetone,
Methyl ethyl ketone and the like can be mentioned. Examples of the “sulfoxides” include dimethyl sulfoxide and the like. Examples of the above-mentioned "nitriles" include acetonitrile, propionitrile and the like. Examples of the “organic acids” include acetic acid, propionic acid,
Examples thereof include trifluoroacetic acid. The "esters"
Examples thereof include methyl acetate, ethyl acetate, amyl acetate, ethyl propionate and the like.

When the desired product is obtained in a free state by the above reaction, it may be converted into a salt according to a conventional method, and when it is obtained as a salt, it is converted into a free form or another salt according to a conventional method. It can also be converted. The compound (I ′) of the present invention thus obtained can be obtained by known means such as phase transfer, concentration,
It can be isolated and purified from the reaction solution by solvent extraction, fractional distillation, crystallization, recrystallization, chromatography and the like. The compound (I ′) of the present invention is
When present as isomers (configurational isomers), diastereomers, conformers, etc., each can be isolated by the above-mentioned separation and purification means, if desired. When the compound (I ′) of the present invention is a racemate, it can be separated into S-form and R-form by a usual optical resolution means. When stereoisomers exist in the compound (I ′) of the present invention, the present invention also includes the case where these isomers are used alone and the mixture thereof. In addition, the compound (I ′) of the present invention may be a hydrate or non-hydrate. The compound (I ′) of the present invention is an isotope (eg, ³ H,
¹⁴ C, ³⁵ S) or the like.

[Compound (VII)] [1] Formula that may be N-oxidized

[Chemical 41] [In the formula, C ring represents a 4-pyrimidinyl group which may have a substituent, R ^1m represents a hydrogen atom, a hydrocarbon group which may have a substituent, and a substituent which may have a substituent. A heterocyclic group, an optionally substituted amino group or an acyl group is replaced by R ^2m
Represents an aromatic group which may have a substituent. ] The compound or its salt represented by these, [2] compound (Im),
Formula that may be N-oxidized

[Chemical 42] [In the formula, Z ⁿ is a bond, —NR ⁴ⁿ — (R ⁴ⁿ is a hydrogen atom,
Represents a hydrocarbon group which may have a substituent), an oxygen atom or a sulfur atom which may be oxidized, and W ⁿ represents a bond or a divalent hydrocarbon group which may have a substituent. R ¹ⁿ represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group, R ²ⁿ represents an aromatic group which may have a substituent, R ³ⁿ represents a hydrogen atom, a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent. . [3] The compound according to item [1], [3] the compound according to item [2], wherein W ⁿ and Z ⁿ are both bonds, [4] compound (Im)
Is an optionally N-oxidized formula

[Chemical 43] [In the formula, W ^f represents a divalent hydrocarbon group which may have a bond or a substituent, and R ^1f represents a hydrogen atom, a hydrocarbon group which may have a substituent, or a substituent. A heterocyclic group which may be substituted, an amino group or an acyl group which may have a substituent, R ^2f represents an aromatic group which may have a substituent, R ^2f
3f represents a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, and R ^4f represents a hydrogen atom or a hydrocarbon group which may have a substituent. ] [5] compound (I
f ′) is an N-oxidized formula

[0094]

[Chemical 44] [In the formula, R ^1g represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. R ^2g is an aromatic group which may have a substituent, R ^3g is a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, ^{4 g} represents a hydrogen atom or a hydrocarbon group which may have a substituent. ] [4] represented by
[6] the compound (If ′), which may be N-oxidized,

[Chemical formula 45] [In the formula, R ^1h represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. R ^2h is an aromatic group which may have a substituent, R ^3h is a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, ^4h represents a hydrogen atom or a hydrocarbon group which may have a substituent. ] [4] represented by
The compound according to the item. [7] A prodrug of the compound according to the item [1].

Formulas (Im), (In), (If '), (I
Examples of the “hydrocarbon group” of the “hydrocarbon group optionally having substituent (s)” in the compounds represented by g ′) and (Ih ′) include, for example, a chain or cyclic hydrocarbon group (eg, Alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, etc.) and the like. Of these, a chain or cyclic hydrocarbon group having 1 to 16 carbon atoms is preferable. As the “alkyl”, for example, C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl etc.) and the like are preferable. Examples of the “alkenyl” include C _2-6 alkenyl (eg, vinyl, allyl, isopropenyl, 1-butenyl, 2-butenyl, 3
-Butenyl, 2-methyl-2-propenyl, 1-methyl-2-propenyl, 2-methyl-1-propenyl and the like) and the like are preferable. As the “alkynyl”, for example, C _2-6 alkynyl (eg, ethynyl, propargyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-hexynyl etc.) and the like are preferable. As the “cycloalkyl”, for example, C _3-8 cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl etc.) and the like are preferable. Examples of the “aryl” include C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl,
3-biphenylyl, 4-biphenylyl, 2-anthryl and the like) and the like are preferable. Examples of “aralkyl” include C
_7-16 aralkyl (eg, benzyl, phenethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, 5-phenylpentyl, etc.) is preferable. .

“Hydrocarbon group which may have a substituent (s)”
Examples of the “substituent” include oxo, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), C _1-3 alkylenedioxy (eg, methylenedioxy, ethylenedioxy, etc.), nitro, cyano, C _1-6 alkyl which may be halogenated, C _2-6 alkenyl which may be halogenated, carboxy C _2-6 alkenyl (eg, 2-carboxyethenyl, 2-carboxy-2-methylethenyl, etc.) An optionally halogenated C _2-6 alkynyl,
Optionally halogenated C _3-8 cycloalkyl, C
_6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl, etc.), optionally halogenated C _1-8 alkoxy, C _{1 -6} alkoxy-carbonyl-C _1-6 alkoxy (eg, ethoxycarbonylmethyloxy etc.), hydroxy, C _6-14 aryloxy (eg, phenyloxy, 1-naphthyloxy, 2-naphthyloxy etc.), C _{7- 16} aralkyloxy (eg, benzyloxy, phenethyloxy, etc.), mercapto, optionally halogenated C _1-6 alkylthio, C _6-14 arylthio (eg, phenylthio, 1-naphthylthio, 2-naphthylthio, etc.), C _7-16 aralkylthio (e.g., benzylthio, phenethylthio, etc.), amino, mono--C _1-6 alkylamino (e.g., methyl Amino, ethylamino, etc.),
Mono-C _6-14 arylamino (eg, phenylamino, 1
-Naphthylamino, 2-naphthylamino, etc.), di-C
_1-6 alkylamino (e.g., dimethylamino, diethylamino, ethylmethylamino, etc.), C _{3- 8} cycloalkylamino (e.g., cyclopentylamino, cyclohexylamino, etc.), di -C _6-14 arylamino (e.g., diphenylamino Etc.), formyl, carboxy, carboxy-C
_1-6 alkyl (eg, carboxymethyl, carboxyethyl, etc.), C _1-6 alkyl-carbonyl (eg, acetyl,
Propionyl, pivaloyl etc.), C _3-8 cycloalkyl-carbonyl (eg cyclopropylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl etc.),
C _1-6 alkoxy-carbonyl (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert
-Butoxycarbonyl etc.), C _6-14 aryl-carbonyl (eg benzoyl, 1-naphthoyl, 2-naphthoyl etc.), C _7-16 aralkyl-carbonyl (eg phenylacetyl, 3-phenylpropionyl etc.), C _{6 -14} aryloxy-carbonyl (eg, phenoxycarbonyl etc.), C _7-16 aralkyloxy-carbonyl (eg, benzyloxycarbonyl, phenethyloxycarbonyl etc.), 5 or 6 membered heterocycle-carbonyl (eg, nicotinoyl, isonicotinoyl, Thenoyl, furoyl, morpholinocarbonyl, thiomorpholinocarbonyl, piperazin-1-ylcarbonyl, pyrrolidin-1-ylcarbonyl, etc.), carbamoyl, thiocarbamoyl, mono-C
_1-6 alkyl-carbamoyl (eg, methylcarbamoyl, ethylcarbamoyl, etc.), di-C _1-6 alkyl-carbamoyl (eg, dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.), mono- or di-C _6-14 Aryl-carbamoyl (eg, phenylcarbamoyl, 1-naphthylcarbamoyl, 2-naphthylcarbamoyl, etc.), mono- or di-5 or 6-membered heterocyclic carbamoyl (eg, 2-pyridylcarbamoyl, 3-pyridylcarbamoyl, 4-pyridylcarbamoyl) , 2-thienylcarbamoyl, 3-thienylcarbamoyl, etc.), C
_1-6 alkylsulfonyl (eg, methylsulfonyl, ethylsulfonyl, etc.), C _1-6 alkylsulfinyl (eg,
Methylsulfinyl, ethylsulfinyl, etc.), C _6-14
Arylsulfonyl (eg, phenylsulfonyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl, etc.), C
_6-14 arylsulfinyl (eg, phenylsulfinyl, 1-naphthylsulfinyl, 2-naphthylsulfinyl, etc.), formylamino, C _1-6 alkyl-carbonylamino (eg, acetylamino, propionylamino,
Pivaloylamino, etc.), C _3-8 cycloalkyl-carbonylamino (eg, cyclopentylcarbonylamino, cyclohexylcarbonylamino, etc.), C _6-14 aryl-
Carbonylamino (eg, benzoylamino, naphthoylamino, etc.), C _1-6 alkoxy-carbonylamino (eg, methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino, butoxycarbonylamino, etc.), C _1-6 alkylsulfonylamino (Eg, methylsulfonylamino, ethylsulfonylamino, etc.), C _6-14 arylsulfonylamino (eg, phenylsulfonylamino, 2-naphthylsulfonylamino,
1-naphthylsulfonylamino, etc.), C _1-6 alkyl-
Carbonyloxy (eg, acetoxy, propionyloxy, etc.), C _6-14 aryl-carbonyloxy (eg, benzoyloxy, naphthylcarbonyloxy, etc.), C _1-6
Alkoxy-carbonyloxy (eg, methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.), mono-
C _1-6 alkyl-carbamoyloxy (eg, methylcarbamoyloxy, ethylcarbamoyloxy, etc.), di-
C _1-6 alkyl-carbamoyloxy (eg, dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.),
Mono- or di-C _6-14 aryl-carbamoyloxy (eg, phenylcarbamoyloxy, naphthylcarbamoyloxy, etc.), nicotinoyloxy, isonicotinoyloxy, optionally substituted 5- to 7-membered saturated ring Amino, 5- to 10-membered aromatic heterocyclic group (eg, 2-
Thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-
Quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b] furanyl, etc.), sulfo, sulfamoyl, sulfinamoyl, sulfenamoyl or two or more of these substituents (eg, 2-3) And the like. The "hydrocarbon group" may have, for example, 1 to 5, preferably 1 to 3 substituents at the substitutable position, and when the number of substituents is 2 or more, each substituent is It may be the same or different.

The above-mentioned "optionally halogenated C _1-6
As the "alkyl", for example, C _1-6 alkyl optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) (eg, methyl, ethyl , Propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.) and the like. Specific examples include methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoro. Propyl, isopropyl, butyl, 4,4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6- Trifluorohexyl and the like can be mentioned. The above-mentioned "optionally halogenated C _2-6 alkenyl" has, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) Good C
_2-6 alkenyl (eg, vinyl, propenyl, isopropenyl, 2-buten-1-yl, 4-penten-1-yl, 5-hexen-1-yl etc.) and the like can be mentioned. Specific examples include vinyl, propenyl, 3,3,3-trifluoropropenyl, 2-buten-1-yl, 4,4,4.
-Trifluoro-2-buten-1-yl, 4-penten-1-yl, 5-hexen-1-yl and the like can be mentioned.
The above “optionally halogenated C _2-6 alkynyl”
Is, for example, 1 to 5, preferably 1 to 3
C _2-6 alkynyl optionally having 1 halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.) (eg, 2-butyn-1-yl, 4-pentyn-1-yl, 5-to) (Xin-1-yl etc.) and the like. Specific examples include propargyl, 2-butyn-1-yl, 4,4,4-trifluoro-2-butyn-1-yl, 4-pentyn-1-.
Ill, 5,5,5-trifluoro-4-pentyn-1-
And 5-hexyn-1-yl. The above “optionally halogenated C _3-8 cycloalkyl”
Is, for example, 1 to 5, preferably 1 to 3
C _3-8 cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl etc.) which may have one halogen atom (eg fluorine, chlorine, bromine, iodine etc.), etc. Can be mentioned. Specific examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 4,4-dichlorocyclohexyl, 2,2,3,3-tetrafluorocyclopentyl,
4-chlorocyclohexyl etc. are mentioned. As the above-mentioned “optionally halogenated C _1-8 alkoxy”,
For example, C _1-8 alkoxy which may have 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine etc.) (eg, methoxy, ethoxy, propoxy, isopropoxy). , Butoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy, etc.) and the like. Specific examples include, for example, methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy, 4,4,4-trifluorobutoxy, isobutoxy, sec-butoxy, Examples include pentyloxy and hexyloxy. As the above-mentioned “optionally halogenated C _1-6 alkylthio”,
For example, C _1-6 alkylthio optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine etc.) (eg, methylthio, ethylthio, propylthio, isopropylthio). , Butylthio, sec-butylthio, tert-butylthio, etc.) and the like. Specific examples include methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like. Examples of the “5- to 7-membered saturated cyclic amino” of the “optionally substituted 5- to 7-membered saturated cyclic amino” include, for example, a nitrogen atom and a sulfur atom in addition to one nitrogen atom and a carbon atom. And 5 to 7-membered saturated cyclic amino which may contain 1 or 2 kinds of oxygen atoms and 1 to 4 heteroatoms, and specific examples thereof include pyrrolidin-1-yl, piperidino, piperazine-
1-yl, morpholino, thiomorpholino, hexahydroazepin-1-yl and the like can be mentioned. Examples of the “substituent” of the “5- to 7-membered saturated cyclic amino optionally having substituent (s)” include C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl,
sec-butyl, tert-butyl, pentyl, hexyl etc.),
C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl etc.), C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, Pivaloyl, etc.) 5- to 10-membered aromatic heterocyclic group (eg, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-
Pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl,
3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b]. 1 to 3 furanyl, 3-benzo [b] furanyl and the like, oxo and the like.

The “divalent hydrocarbon group” of the “divalent hydrocarbon group which may have a substituent (s)” in the compounds represented by the formulas (In) and (If ′) is as defined above. A divalent group derived from “hydrocarbon group” of “hydrocarbon group optionally having substituent (s)” is shown, for example, divalent group derived from alkylene, alkenylene, alkynylene, cycloalkane, cyclo Examples thereof include a divalent group derived from an alkene and a divalent group derived from an aromatic hydrocarbon ring.
Examples of the “alkylene” include a C _1-15 alkylene group (eg, methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, heptamethylene, octamethylene, etc., preferably C _1-6 alkylene, etc.) and the like. . Examples of the “alkenylene” include C _2-16 alkenylene groups (for example, vinylene, propenylene, 1-butenylene, 2-butenylene, 1-pentenylene, 2-pentenylene, 3-pentenylene, etc.) and the like. Examples of the “alkynylene” include C _2-16 alkynylene groups (ethynylene, propynylene, 1-butynylene, 2-butynylene, 1-pentynylene, 2-pentynylene, 3-pentynylene, etc.). Examples of the “cycloalkane” include C _3-7 cycloalkane such as cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane and cyclooctane. Examples of the “cycloalkene” include C _3-8 cycloalkene such as cyclopropene, cyclobutene, cyclopentene, cyclohexene, cycloheptene and cyclooctene. "Aromatic hydrocarbon ring"
Examples thereof include a hydrocarbon ring having 6 to 14 carbon atoms such as a benzene ring and a naphthalene ring.

“Cycloalkane”, “cycloalkene”
Or, as the divalent group derived from "aromatic hydrocarbon ring", two hydrogen atoms from one carbon atom of "cycloalkane", "cycloalkene" or "aromatic hydrocarbon ring" are Or 1 from 2 different carbon atoms
It means a divalent group or the like from which individual hydrogen atoms have been removed. Specifically, for example,

[Chemical formula 46] Are used, and preferably,

[Chemical 47] And more preferably

[Chemical 48] And so on. "Substituent" of "divalent hydrocarbon group"
Examples of the substituent include the same as the "substituent" of the above-mentioned "hydrocarbon group optionally having substituent (s)". The "divalent hydrocarbon group" may have, for example, 1 to 4, preferably 1 to 3 substituents at the substitutable position, and when the number of substituents is 2 or more, each substituent is substituted. The groups may be the same or different. The divalent hydrocarbon group which may have a substituent is preferably a C _1-15 alkylene group which may be substituted with an oxo group. Particularly, C _1-6 alkylene optionally substituted with an oxo group and the like are preferable.

Formulas (Im), (In), (If '), (I
Examples of the “heterocyclic group” of the “heterocyclic group optionally having a substituent” in the compounds represented by g ′) and (Ih ′) include, in addition to carbon atoms, nitrogen atom, sulfur atom and 5 to 14 membered (monocyclic, bicyclic or tricyclic) heterocyclic ring containing 1 or 2 kinds selected from oxygen atom and 1 to 4 heteroatoms, preferably (i) 5 to 14 membered (preferably 5 ring)
To a 10-membered) aromatic heterocycle, (ii) a 5- to 10-membered non-aromatic heterocycle or (iii) a monovalent group formed by removing any one hydrogen atom from a 7- to 10-membered bridged heterocycle. Can be mentioned. Examples of the "5- to 14-membered (preferably 5- to 10-membered) aromatic heterocycle" include, for example, thiophene, benzo [b] thiophene, benzo [b] furan, benzimidazole, benzoxazole, benzothiazole and benziso. Thiazole, naphtho [2,3-b] thiophene, furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole, isoindole, 1H-indazole, purine, 4H-quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine. Aroma such as quinoxaline, quinazoline, cinnoline, carbazole, β-carboline, phenanthridine, acridine, phenazine, thiazole, isothiazole, phenothiazine, isoxazole, furazan, and phenoxazine Heterocycle, or any of these rings (preferably monocyclic) and the like with one or more (preferably 1 or 2) aromatic rings (e.g., benzene ring) condensed ring or the like formed by the. Examples of the above-mentioned “5- to 10-membered non-aromatic heterocycle” include pyrrolidine, imidazoline, pyrazolidine, pyrazoline, piperidine, piperazine, morpholine, thiomorpholine, dioxazole, oxadiazoline, thiadiazoline, triazoline, thiadiazole, dithiazole and the like. Can be mentioned. Examples of the “7 to 10-membered hetero bridge ring” include quinuclidine, 7-azabicyclo [2.2.1] heptane and the like. The "heterocyclic group" is preferably a 5- to 14-membered (preferably 5-membered) containing 1 or 2 kinds, preferably 1 to 4 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom. To 10-membered) (monocyclic or bicyclic) heterocyclic groups. Specifically, for example, 2-
Thienyl, 3-thienyl, 2-furyl, 3-furyl, 2
-Pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-
Quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-
Isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, 3-pyridazinyl, 3-isothiazolyl,
3-isoxazolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b]. An aromatic heterocyclic group such as furanyl, for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-piperidyl, 3- Examples thereof include non-aromatic heterocyclic groups such as piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino and thiomorpholino. Of these, for example, a 5- or 6-membered heterocyclic group containing 1 to 3 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom is more preferable. Specifically, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl,
2-furyl, 3-furyl, pyrazinyl, 2-pyrimidinyl, 3-pyrrolyl, 3-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-pyrrolidinyl, 2-
Pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-
Examples thereof include piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like. As the "substituent" of the "heterocyclic group optionally having substituent (s)", the same "substituent" as the above-mentioned "hydrocarbon group optionally having substituent (s)" can be mentioned. The “heterocyclic group” may have, for example, 1 to 5, preferably 1 to 3 substituents at the substitutable position, and when the number of substituents is 2 or more, each substituent is the same. Or it may be different.

Formulas (Im), (In), (If '), (I
Examples of the “acyl group” in the compounds represented by g ′) and (Ih ′) include the formula: — (C═O) —R ⁷ , — (C═
^{O) -OR 7, - (C} = O) -NR 7 R 8, - (C = S) -NH
R ⁷ or -SO ₂ -R ⁹ (wherein, R ⁷ is a hydrogen atom may be an optionally substituted hydrocarbon group or optionally substituted heterocyclic group, R ⁸ is a hydrogen atom Or a C _1-6 alkyl group,
R ⁹ represents a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent. ) And the like. "A hydrocarbon group which may have a substituent" and "a heterocyclic group which may have a substituent"
As the above, the same ones as described above are used. _{Examples of the} "C _1-6 alkyl group" include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl and the like.

Formulas (Im), (In), (If '), (I
Examples of the “amino group which may have a substituent (s)” in the compounds represented by g ′) and (Ih ′) include (1) an amino group which may have 1 or 2 substituents and (2) Examples thereof include a cyclic amino group which may have a substituent. Examples of the "substituent" of the above-mentioned (1) "amino group optionally having 1 or 2 substituents" include, for example, a hydrocarbon group optionally having a substituent and a substituent And a heterocyclic group which may have a substituent, an acyl group, an alkylidene group which may have a substituent and the like. These "hydrocarbon group optionally having substituent (s)", "heterocyclic group optionally having substituent (s)"
As examples of the “acyl group”, the same ones as mentioned above can be mentioned. Examples of the “alkylidene group” in the “alkylidene group optionally having substituent (s)” include C _1-6
Alkylidene (eg, methylidene, ethylidene, propylidene, etc.) and the like can be mentioned. As the “substituent” of the “alkylidene group optionally having substituent (s)”, the same “substituent” as the above “hydrocarbon group optionally having substituent (s)” can be mentioned. The “alkylidene group” may be substituted with 1 to 5, preferably 1 to 3 of these substituents. When the number of “substituents” in the above “amino group optionally having 1 or 2 substituents” is 2, each substituent may be the same or different.

The "cyclic amino group" of the above-mentioned "cyclic amino group which may have a substituent (s)" includes, in addition to one nitrogen atom and a carbon atom, a nitrogen atom, a sulfur atom and an oxygen atom. 5 to 7 membered non-aromatic cyclic amino group which may contain 1 or 2 kinds of 1 to 4 heteroatoms selected from the following, and specific examples thereof include pyrrolidin-1-yl, piperidino, piperazine- 1-yl, morpholino,
Thiomorpholino, hexahydroazepin-1-yl, imidazolidin-1-yl, 2,3-dihydro-1H-imidazol-1-yl, tetrahydro-1 (2H) -pyrimidinyl, 3,6-dihydro-1 (2H ) -Pyrimidinyl, 3,4-dihydro-1 (2H) -pyrimidinyl and the like. The "substituent" of the "cyclic amino group which may have a substituent (s)" is, for example, "substituent" described in detail above as the "substituent" of the "hydrocarbon group which may have a substituent (s)". Examples of the “substituent” of the “5- to 7-membered saturated cyclic amino which may have a group” and the like, and the “cyclic amino group” is substituted with 1 to 3 of these substituents. Is preferably provided. Specific examples of the 5- to 7-membered non-aromatic cyclic amino group having 1 oxo include 2-
Oxoimidazolidin-1-yl, 2-oxo-2,3
-Dihydro-1H-imidazol-1-yl, 2-oxotetrahydro-1 (2H) -pyrimidinyl, 2-oxo-3,6-dihydro-1 (2H) -pyrimidinyl, 2
-Oxo-3,4-dihydro-1 (2H) -pyrimidinyl, 2-oxopyrrolidin-1-yl, 2-oxopiperidino, 2-oxopiperazin-1-yl, 3-oxopiperazin-1-yl, 2-oxo -2,3,4,5,6,7
-Hexahydroazepin-1-yl and the like.

Formulas (Im), (In), (If '), (I
"Substituent in the compound represented by g ') and (Ih')
As "aromatic group" of "aromatic group which may have"
Examples include aromatic hydrocarbon groups and aromatic heterocyclic groups.
To be Examples of the "aromatic hydrocarbon group" include carbon
Number 6 to 14 monocyclic or condensed polycyclic (2 or 3 rings
Formula) aromatic hydrocarbon groups and the like. As a specific example
Such as phenyl, 1-naphthyl, 2-naphthyl, 2
-Biphenylyl, 3-biphenylyl, 4-biphenylyl
C such as le, 2-anthryl_6-14Aryl and the like, preferably
C_6-10Aryl and the like (eg phenyl, 1-naphthyl, 2
-Naphthyl and the like, preferably phenyl and the like).
The “aromatic heterocyclic group” includes nitrogen atoms in addition to carbon atoms.
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5 to 14 members (preferably 1 to 4 terror atoms)
Is 5 to 10 members) any one hydrogen from an aromatic heterocycle
Examples include monovalent groups formed by removing atoms. There is no "5
A 14-membered (preferably 5- to 10-membered) aromatic complex
Examples of the “ring” include thiophene and benzo [b] thio.
Phen, benzo [b] furan, benzimidazole,
Indoxazole, benzothiazole, benzisothia
Zole, naphtho [2,3-b] thiophene, furan, pi
Roll, imidazole, pyrazole, pyridine, pyrazi
, Pyrimidine, pyridazine, indole, isoindo
, 1H-indazole, purine, 4H-quinolidi
, Isoquinoline, quinoline, phthalazine, naphthyridine
, Quinoxaline, quinazoline, cinnoline, carbazo
, Β-carboline, phenanthridine, acridi
Phenazine, phenazine, thiazole, isothiazole, pheno
Thiazine, isoxazole, furazane, phenoxazi
Aromatic heterocycles such as
One or more (preferably one or two) fragrances
Rings formed by condensation with rings (eg, benzene rings, etc.)
You can The "aromatic heterocyclic group" is preferably charcoal.
Other than elementary atom, selected from nitrogen atom, sulfur atom and oxygen atom
1 or 2 heteroatoms, preferably 1 to 4
5 to 14 members (preferably 5 to 10 members)
(Monocyclic or bicyclic) aromatic heterocyclic group, etc., specifically, examples
For example, 2-thienyl, 3-thienyl, 2-furyl, 3-furyl.
Ryl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2
-Quinolyl, 3-quinolyl, 4-quinolyl, 5-quinoli
8-quinolyl, 1-isoquinolyl, 3-isoquinolyl
L, 4-isoquinolyl, 5-isoquinolyl, pyrazini
2-pyrimidinyl, 4-pyrimidinyl, 3-pyrroli
L, 2-imidazolyl, 3-pyridazinyl, 3-isothiyl
Azolyl, 3-isoxazolyl, 1-indolyl, 2
-Indolyl, 3-indolyl, 2-benzothiazoli
2-benzo [b] thienyl, 3-benzo [b] thiele
Nyl, 2-benzo [b] furanyl, 3-benzo [b] furan
Examples thereof include aromatic heterocyclic groups such as lanyl. "Has a substituent
The "substituent" of the "optionally substituted aromatic group" is as described above.
"Substitution of" hydrocarbon group which may have a substituent (s) "
1 to 5, preferably 1 to 5 same as "group"
There are three. When the number of substituents is 2 or more, each
The substituents may be the same or different. Indicated by the C ring
“4-Pyrimidinyl group optionally having substituent (s)”
As the “substituent”, for example, formula-Zⁿ-Wⁿ-R³ⁿ
[The symbols in the formulas have the same meanings as described above. ] Of the group represented by
Other halogen atoms (eg, fluorine, chlorine, bromine, iodine)
Etc.), C_1-3Alkylenedioxy (eg methylene dioxy)
Si, ethylenedioxy, etc.), nitro, cyano, halogen
C which may be converted_1-6Alkyl, halogenated
May be C_2-6Alkenyl, carboxy C_2-6Archeni
(Eg, 2-carboxyethenyl, 2-carboxy-2
-Methylethenyl), optionally halogenated C
_2-6Alkynyl, optionally halogenated C_3-8Shiku
Lower alkyl, C_{6- 14}Aryl (eg, phenyl, 1-naphth
Chill, 2-naphthyl, 2-biphenylyl, 3-biphenyl
Ril, 4-biphenylyl, 2-anthryl, etc.), halogen
C which may be converted to_1-8Alkoxy, C_1-6Arcoki
Sicarbonyl-C_1-6Alkoxy (eg, ethoxycarl
Bonylmethyloxy, etc.), hydroxy, C_6-14Aryl
Oxy (eg, phenyloxy, 1-naphthyloxy, 2
-Naphthyloxy, etc.), C_{7- 16}Aralkyloxy (eg
Benzyloxy, phenethyloxy, etc.), mercap
G, optionally halogenated C_1-6Alkylthio,
C_6-14Arylthio (eg, phenylthio, 1-naphthyl
Thio, 2-naphthylthio, etc.), C_7-16Aralkylthio
(Eg, benzylthio, phenethylthio, etc.), ami
No, Mono-C_1-6Alkylamino (eg, methylamino,
Ethylamino, etc.), Mono-C_6-14Arylamino (eg,
Phenylamino, 1-naphthylamino, 2-naphthyla
Mino etc.), Di-C_1-6Alkylamino (eg, dimethyl
Mino, diethylamino, ethylmethylamino, etc.), C
_3-8Cycloalkylamino (eg cyclopentylami)
No, cyclohexylamino, etc.), di-C_6-14Arylua
Mino (eg, diphenylamino), formyl, carboxy
Ci, carboxy-C_1-6Alkyl (eg, carboxymethyi
, Carboxyethyl, etc.), C_1-6Alkyl-carboni
(Eg, acetyl, propionyl, pivaloyl, etc.), C
_3-8Cycloalkyl-carbonyl (eg, cyclopropyl
Carbonyl, cyclopentylcarbonyl, cyclohexyl
Lecarbonyl, etc.), C _1-6Alkoxy-carbonyl
(Eg methoxycarbonyl, ethoxycarbonyl, pro
Poxycarbonyl, tert-butoxycarbonyl, etc.), C
_6-14Aryl-carbonyl (eg, benzoyl, 1-naphtho
Toy, 2-naphthoyl, etc.), C_7-16Aralkyl-Cal
Bonyl (eg, phenylacetyl, 3-phenylpropio
Nil), C _6-14Aryloxy-carbonyl (eg, phenol
Enoxycarbonyl etc.), C_7-16Aralkyl Oxy-ca
Lubonyl (eg, benzyloxycarbonyl, phenethyl
Oxycarbonyl, etc.) 5- or 6-membered heterocycle-carbonyl
(Eg nicotinoyl, isonicotinoyl, tenoyl, fu
Royl, morpholinocarbonyl, thiomorpholinocarbo
Nyl, piperazin-1-ylcarbonyl, pyrrolidine-
1-ylcarbonyl etc.), carbamoyl, thiocarbamo
Il, Mono-C_1-6Alkyl-carbamoyl (eg, methyl
Lucarbamoyl, ethylcarbamoyl, etc.), di-C_1-6
Alkyl-carbamoyl (eg, dimethylcarbamoyl,
Diethylcarbamoyl, ethylmethylcarbamoyl
Etc.), mono- or di-C_6-14Aryl-carbamoyl
(Eg, phenylcarbamoyl, 1-naphthylcarbamoy
, 2-naphthylcarbamoyl, etc.), mono- or di-5
Or 6-membered heterocyclic carbamoyl (eg, 2-pyridylcarba
Moyl, 3-pyridylcarbamoyl, 4-pyridylcar
Vamoyl, 2-thienylcarbamoyl, 3-thienylca
Lubamoyl etc.), C_1-6Alkylsulfonyl (eg, methyl
Lesulfonyl, ethylsulfonyl, etc.), C_1-6Alkyl
Sulfinyl (eg, methylsulfinyl, ethylsulfin
Inyl, etc.), C_6-14Arylsulfonyl (eg, phenyl
Sulfonyl, 1-naphthylsulfonyl, 2-naphthyl
Lefonyl, etc.), C_6-14Arylsulfinyl (eg, fe
Nylsulfinyl, 1-naphthylsulfinyl, 2-na
Futylsulfinyl), formylamino, C_1-6Al
Kill-carbonylamino (eg, acetylamino, propylamino
Onylamino, pivaloylamino, etc.), C_3-8Cycloa
Rukyl-carbonylamino (eg cyclopentylcarbo
Nylamino, cyclohexylcarbonylamino, etc.), C
_6-14Aryl-carbonylamino (eg, benzoylami)
No, naphthoylamino, etc.), C_1-6Alkoxy-carbo
Nylamino (eg, methoxycarbonylamino, ethoxy
Carbonylamino, propoxycarbonylamino, buto
Xycarbonylamino, etc.), C_1-6Alkylsulfonyl
Amino (eg, methylsulfonylamino, ethylsulfoni
Luamino etc.), C_{6- 14}Arylsulfonylamino (eg,
Phenylsulfonylamino, 2-naphthylsulfonyla
Mino, 1-naphthylsulfonylamino, etc.), C_1-6Al
Kill-carbonyloxy (eg acetoxy, propioni
Luoxy, etc.), C_6-14Aryl-carbonyloxy
(Eg benzoyloxy, naphthylcarbonyloxy
Etc.), C_1-6Alkoxy-carbonyloxy (eg, meth
Xycarbonyloxy, ethoxycarbonyloxy,
Ropoxycarbonyloxy, butoxycarbonyloxy
Etc.), Mono-C_1-6Alkyl-carbamoyloxy
(Eg, methylcarbamoyloxy, ethylcarbamoyl
Oxy), di-C_1-6Alkyl-carbamoyloxy
(Eg, dimethylcarbamoyloxy, diethylcarbamo
Iloxy), mono- or di-C_6-14Aryl-Ca
Lubamoyloxy (eg, phenylcarbamoyloxy,
Naphthylcarbamoyloxy, etc.), nicotinoyloxy
Ci, isonicotinoyloxy, may have a substituent
5- to 7-membered saturated cyclic amino, 5- to 10-membered aromatic
Heterocyclic groups (eg, 2-thienyl, 3-thienyl, 2-pyrenyl)
Dill, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3
-Quinolyl, 4-quinolyl, 5-quinolyl, 8-quinoli
, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinol
Noryl, 5-isoquinolyl, 1-indolyl, 2-yne
Drill, 3-indolyl, 2-benzothiazolyl, 2-
Benzo [b] thienyl, 3-benzo [b] thienyl, 2
-Benzo [b] furanyl, 3-benzo [b] furanyl
Etc.), sulfo, sulfamoyl, sulfinamoyl, su
Ruphenamoyl or two or more of these substituents (eg,
2 to 3) are bonded to each other, and particularly a group of the formula -Zⁿ−
Wⁿ-R³ⁿThe group represented by is preferable.

Compounds (Im), (In), (If '),
Examples of the salt of (Ig ′) or (Ih ′) include metal salts, ammonium salts, salts with organic bases, salts with inorganic acids,
Examples thereof include salts with organic acids, salts with basic or acidic amino acids, and the like. Preferable examples of the metal salt include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt, magnesium salt and barium salt; aluminum salt and the like. Preferable examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine,
Examples thereof include salts with N, N′-dibenzylethylenediamine and the like. Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like. Suitable examples of salts with organic acids include, for example, formic acid,
Examples thereof include salts with acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid and p-toluenesulfonic acid. Suitable examples of salts with basic amino acids include, for example, salts with arginine, lysine, ornithine, and suitable examples of salts with acidic amino acids include, for example, salts with aspartic acid, glutamic acid, etc. To be Of these, pharmaceutically acceptable salts are preferable. For example, when the compound has an acidic functional group, an inorganic salt such as an alkali metal salt (eg, sodium salt, potassium salt, etc.), an alkaline earth metal salt (eg, calcium salt, magnesium salt, barium salt, etc.), Ammonium salts and the like, when having a basic functional group in the compound, for example, salts with inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, or acetic acid, phthalic acid, fumaric acid,
Oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid,
Salts with organic acids such as methanesulfonic acid and p-toluenesulfonic acid are preferable.

Compound (Im) ((In), (If '),
A method for producing (Ig ′), (Ih ′)) or a salt thereof will be described below. Compound (Im) is described in JP-A-60-5.
8981, JP 61-10580 A, JP 5-70446 A, JP 7-503023 A, DE-A-3601411, WO 93/1507.
1, the method described in WO00 / 64894 or a method similar thereto, and the following reaction formula 1,
It can be obtained by the methods shown in 2 and 3 or methods equivalent thereto. Here, a method for producing the compound (Im) will be briefly described. The compound (Im) or a salt thereof has the formula

[Chemical 49]

[Wherein, C ring represents a 4-pyrimidinyl group which may have a substituent, Hal represents a halogen, and R ^2m represents an aromatic group which may have a substituent] Or a salt thereof and a formula R ^1m CSNH ₂ [wherein R ^1m represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, a substituent Represents an amino group or an acyl group which may have a group] [Compound R ^1m CS
NH ₂ can be produced by a method characterized by reacting with a compound represented by the following formula (VII) or a salt thereof (see the following. See Schemes 1, 2, 3 and 4). Each symbol of the compounds in reaction formulas 1, 2, 3 and 4 has the same meaning as described above. The compound in the reaction formula includes a case where it forms a salt, and examples of the salt include the same as the salt of compound (I). Also the compound
(II), (III), (IV), (X), (XI), (XV), (XVI), (XVIII)
When (XIX) is commercially available, commercially available products can be used as they are, or can be produced according to a method known per se or a method analogous thereto.

Reaction formula 1

[Chemical 50] Below, L¹, L²And L³(Scheme 2) shows a leaving group.
You L¹, L²And L³As a "leaving group"
Is, for example, (1) C_1-6Alkoxy (eg methoxy, etoki
Etc.), (2) J-C_1-6Alkylamino (eg, dimethyl
Mino, diethylamino, etc.), (3) NC_6-10Aryl-
N-C_1-6Alkylamino (eg, N-phenyl-N-me
(Tilamino, etc.), (4) C_6-10Aryl and / or C_1-6
3- to 7-membered cyclic amine optionally substituted with alkyl
(Eg, pyrrolidino, morpholino, methylaziridine-
1-yl etc.), (5) NC_1-6Alkyl-NC_1-6Al
Coxyamino (N-methoxy-N-methylamino etc.),
(6) hydroxy, (7) halogen atom (eg, fluorine, chlorine,
(Bromine, iodine, etc.), (8) optionally halogenated C
_1-5Alkylsulfonyloxy (eg, methanesulfonyl)
Oxy, ethanesulfonyloxy, trifluoromethane
Sulfonyloxy etc.), (9) may have a substituent
C_6-10Arylsulfonyloxy, (10) halogenated
May be C_1-5Alkylsulfonyl (eg methans
Rufonyl, ethanesulfonyl, trifluoromethanesul
(Honyl etc.), (11) C which may have a substituent_6-10Ants
And the like. "Has a substituent
Good C_6-10Examples of "arylsulfonyloxy" include
Speaking of C_1-6Alkyl, C_1-6Select from alkoxy and nitro
C optionally having 1 to 3 substituents_6-10A
Reel sulfonyloxy (eg, phenylsulfonyloxy)
, Naphthylsulfonyloxy, etc.) and the like.
Examples include benzenesulfonyloxy, m-nitrobe.
Benzenesulfonyloxy, p-toluenesulfonyloxy
Shi and the like. "C which may have a substituent_6-10
"Arylsulfonyl" is, for example, C _1-6Archi
Le, C_1-6A substituent selected from alkoxy and nitro
1 to 3 optionally have C_6-10Aryl sulfoni
(Eg, phenylsulfonyl, naphthylsulfonyl, etc.)
Etc., and specific examples include benzenesulfonyl,
m-nitrobenzenesulfonyl, p-toluenesulfoni
And the like.

Compound (III) is prepared by converting Compound (II) into di-t-carbonate.
-Obtained by protection with butyl. The amount of di-t-butyl dicarbonate used is approximately 0.8 to approximately 5 mol, preferably approximately 1 to approximately 1.5 mol, with respect to 1 mol of the compound (II). This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aromatic hydrocarbons, ethers, alcohols, esters, or a mixture of two or more kinds thereof or the like is used. The reaction temperature is generally about 0 to about 100 ° C, preferably about 0 to about 60 ° C.
The reaction time is generally about 5 minutes to about 48 hours, preferably about 1 hour to about 24 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (V) can be obtained by treating the compound (III) with a base and then condensing the compound (IV). The amount of the base used is approximately 0.8 to approximately 5 mol, preferably approximately 2 to approximately 2.5, with respect to 1 mol of the compound (III).
It is a mole. Examples of the "base" include alkyllithium such as n-butyllithium and metal amides such as sodium amide, lithium diisopropylamide and lithium hexamethyldisilazide. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aliphatic hydrocarbons, aromatic hydrocarbons,
Ethers or a mixture of two or more thereof are used. The reaction temperature is generally about -78 to about 60 ° C, preferably about -78 to about 20 ° C. The reaction time is generally about 5 minutes to about 24 hours, preferably about 0.5 hours to about 3 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (VI) can be obtained by treating the compound (V) with a halogen or a metal halide. This reaction is carried out in the presence of a base or a basic salt, if desired. Examples of the “halogens” include chlorine, bromine, iodine and the like. Examples of the “metal halide” include copper halides such as copper (II) bromide and copper (II) chloride. Therefore, in the compound (VI), Hal represents halogen such as chlorine, bromine and iodine. The amount of halogens or metal halides used is approximately 1 to approximately 5 mol, preferably approximately 1 to approximately 2 mol, with respect to 1 mol of the compound (V). The amount of the base used is approximately 1 to approximately 10 mol, preferably approximately 1 to approximately 3 mol, with respect to 1 mol of the compound (V). Examples of the "base" include metal hydroxides such as sodium hydroxide, potassium hydroxide and lithium hydroxide, basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogen carbonate and sodium acetate, pyridine, Aromatic amines such as lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine, etc. Examples thereof include tertiary amines. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, ethers,
Esters, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitrites, sulfoxides, organic acids, aromatic amines, or a mixture of two or more thereof are used. The reaction temperature is about −20 to about 150 ° C., preferably about 0 to about 100 ° C.
The reaction time is generally about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

Compound (VIII) can be obtained by condensing compound (VI) with compound (VII). This reaction is
If desired, it is performed in the presence of a base. Compound (VII) is
When it is commercially available, the commercially available product may be used as it is, or it may be obtained by a method known per se or a method analogous thereto, and further, a method represented by the following reaction formula 4. The amount of the compound (VII) used is 1 mol of the compound (VI),
It is about 0.5 to about 3 mol, preferably about 0.8 to about 2 mol. The amount of the base used is approximately 1 to approximately 30 mol, preferably approximately 1 to approximately 10 mol, with respect to 1 mol of the compound (VI). Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogen carbonate and sodium acetate, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine and cyclohexyldimethyl. Examples include tertiary amines such as amine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, and N-methylmorpholine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitrites or two or more of these. And the like are used. The reaction temperature is about −
5 to about 200 ° C, preferably about 5 to about 150 ° C
Is. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

Compound (IX) can be obtained by deprotecting compound (VIII) with an acid or a base. The amount of acid and base used is about 0.1 to about 50 mol, preferably about 1 to about 2 mol, relative to 1 mol of compound (VIII).
It is 0 mol. Examples of the “acid” include mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, boron trichloride, Lewis acids such as boron tribromide, a combination of Lewis acid and thiols or sulfides, trifluoroacetic acid, Organic acids such as p-toluenesulfonic acid are used. Examples of the “base” include metal hydroxides such as sodium hydroxide, potassium hydroxide and barium hydroxide, basic salts such as sodium carbonate and potassium carbonate, sodium methoxide, sodium ethoxide, potassium tert-butoxide. And metal bases such as triethylamine, imidazole, and formamidine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, alcohols, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, sulfoxides, water, or two or more of these may be used. A mixture or the like is used. The reaction time is generally about 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is generally about 0 to about 200 ° C, preferably about 20 to about 120 ° C. Compound (Io) can be obtained by condensing compound (IX) and compound (X) in the presence of a base, if desired. The amount of compound (XVIII) used is approximately 0.8 to approximately 5 mol, preferably approximately 1 to approximately 3 mol, with respect to 1 mol of the compound (XVII). The amount of the base used is approximately 0.1 to approximately 5 mol with respect to 1 mol of the compound (XVII),
It is preferably about 0.8 to about 2.5 mol. Examples of the "base" include sodium carbonate, potassium carbonate,
Basic salts such as cesium carbonate and sodium acetate, metal hydroxides such as sodium hydroxide and potassium hydroxide, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4 -Dimethylaminopyridine,
N, N-dimethylaniline, N-methylpiperidine, N
-Tertiary amines such as methylpyrrolidine and N-methylmorpholine, alkali metal hydrides such as sodium hydride and potassium hydride, metal amides such as sodium amide, lithium diisopropylamide and lithium hexamethyldisilazide, Examples thereof include metal alkoxides such as sodium methoxide, sodium ethoxide and potassium tert-butoxide. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example,
Aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, or a mixture of two or more thereof are used. The reaction temperature is generally about -78 to about 100 ° C, preferably about -78 to about 70 ° C. The reaction time is usually about 5
Minutes to about 24 hours, preferably about 0.5 to about 20
It's time. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do. Thereafter, if desired, a compound in which R ⁴ is other than a hydrogen atom can be synthesized by performing alkylation, acylation or the like.

Reaction formula 2

[Chemical 51] Compound (XII) is obtained by treating Compound (XI) with a base,
It is obtained by condensing the compound (IV). The amount of the base used is approximately 0.8 to approximately 3 mol, preferably approximately 1 to approximately 1.2 mol, with respect to 1 mol of the compound (XI).
As the "base", metal amides such as sodium amide, lithium diisopropylamide, lithium hexamethyldisilazide, etc. are used. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, or a mixture of two or more of these and the like are used.
The reaction temperature is generally about -78 to about 60 ° C, preferably about -78 to about 20 ° C. The reaction time is usually about 5
Minutes to about 24 hours, preferably about 0.5 to about 3 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (XIII) can be obtained by treating the compound (XII) with a halogen or a metal halide. This reaction is carried out in the presence of a base or a basic salt, if desired. Examples of the “halogens” include chlorine, bromine, iodine and the like. As the "metal halide",
Copper halides such as copper (II) bromide and copper (II) chloride are mentioned. Therefore, in the compound (XIII), Hal represents halogen such as chlorine, bromine and iodine. The amount of halogens or metal halides used is 1 mol of compound (XIII),
It is about 1 to about 5 mol, preferably about 1 to about 2 mol. The amount of the base used is 1 mol of the compound (XII),
It is about 1 to about 10 mol, preferably about 1 to about 3 mol. Examples of the "base" include metal hydroxides such as sodium hydroxide, potassium hydroxide, lithium hydroxide and barium hydroxide, sodium carbonate, potassium carbonate,
Basic salts such as cesium carbonate, sodium hydrogen carbonate and sodium acetate, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline , Tertiary amines such as N-methylpiperidine, N-methylpyrrolidine, and N-methylmorpholine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, and examples thereof include ethers, esters, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, and organic compounds. Acids,
Aromatic amines or mixtures of two or more of these are used. The reaction temperature is about −20 to about 150 ° C., preferably about 0 to about 100 ° C. The reaction time is usually about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours.
It's time. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (XIV) can be obtained by condensing the compound (XIII) and the compound (VII). This reaction is carried out in the presence of a base, if desired. Compound (VII)
Is used in an amount of about 0.5 to about 3 mol, preferably about 0.8 to about 2 mol, relative to 1 mol of compound (XIII). The amount of the base used is approximately 1 to approximately 30 mol, preferably approximately 1 to approximately 10 mol, with respect to 1 mol of the compound (XIII). Examples of the "base" include sodium carbonate,
Basic salts such as potassium carbonate, cesium carbonate, sodium hydrogen carbonate and sodium acetate, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N Examples include tertiary amines such as dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, and N-methylmorpholine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitrites or two or more of these. And the like are used. The reaction temperature is about −5 to about 200 ° C., preferably about 5 to about 150 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

The compound (Ip) is the same as the compound (XIV)
Obtained by condensing (XV). This reaction is carried out in the presence of a base, if desired. The amount of compound (XV) used is approximately 1 to approximately 100 mol, preferably approximately 1 to approximately 30 mol, with respect to 1 mol of the compound (XIV). Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogen carbonate and sodium acetate, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine and cyclohexyldimethyl. Tertiary amines such as amines, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine and N-methylmorpholine, alkali metal hydrides such as sodium hydride and potassium hydride And metal amides such as sodium amide, lithium diisopropylamide and lithium hexamethyldisilazide, and metal alkoxides such as sodium methoxide, sodium ethoxide and potassium tert-butoxide. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, sulfoxides, alcohols, nitriles, ketones or these A mixture of two or more kinds is used. The reaction temperature is about -5 to about 200.
C., preferably about 5 to about 120.degree. The reaction time is usually about 5 minutes to about 72 hours, preferably about 0.5.
Hours to about 30 hours. The product remains the reaction solution,
Alternatively, it can be used as a crude product in the next reaction, or can be isolated from the reaction mixture according to a conventional method,
It can be easily purified by separation means such as recrystallization, distillation and chromatography.

Reaction formula 3

[Chemical 52] Compound (XXI) is prepared by treating Compound (XX) with a base,
It is obtained by condensing the compound (IV). The amount of the base used is approximately 0.8 to approximately 3 mol, preferably approximately 1 to approximately 1.2 mol, with respect to 1 mol of the compound (XX).
As the "base", metal amides such as sodium amide, lithium diisopropylamide, lithium hexamethyldisilazide, etc. are used. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, or a mixture of two or more of these and the like are used.
The reaction temperature is generally about -78 to about 60 ° C, preferably about -78 to about 20 ° C. The reaction time is usually about 5
Minutes to about 24 hours, preferably about 0.5 to about 3 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do. Compound (XXII) can be obtained by treating compound (XXI) with a halogen or a metal halide. This reaction is carried out in the presence of a base or a basic salt, if desired. Examples of the “halogens” include chlorine, bromine, iodine and the like. Examples of the “metal halide” include copper halides such as copper (II) bromide and copper (II) chloride. Therefore, in the compound (XXII), Hal is chlorine, bromine,
Indicates halogen such as iodine. The amount of halogens or metal halides used is about 1 per 1 mol of compound (XXI).
To about 5 mol, preferably about 1 to about 2 mol. The amount of the base used is approximately 1 to approximately 10 mol, preferably approximately 1 to approximately 3 mol, with respect to 1 mol of the compound (XXI). Examples of the "base" include sodium hydroxide,
Metal hydroxides such as potassium hydroxide, lithium hydroxide and barium hydroxide, basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogen carbonate and sodium acetate, aromatic amines such as pyridine and lutidine, Tertiary amines such as triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, and N-methylmorpholine. To be This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, and examples thereof include ethers, esters, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, and organic compounds. Acids, aromatic amines, mixtures of two or more of these, and the like are used. The reaction temperature is about −20 to about 150 ° C., preferably about 0.
To about 100 ° C. The reaction time is generally about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do. Compound (Iq) is compound (XXII) and compound (VII)
It is obtained by condensing and. This reaction is carried out in the presence of a base, if desired. The amount of compound (VII) used is
It is about 0.5 to about 3 mol, preferably about 0.8 to about 2 mol, relative to 1 mol of compound (XXII). The amount of the base used is approximately 1 to approximately 30 mol, preferably approximately 1 to approximately 10 mol, with respect to 1 mol of the compound (XXII). Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogen carbonate and sodium acetate, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine and cyclohexyldimethyl. Amine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-
Examples include tertiary amines such as methylpiperidine, N-methylpyrrolidine and N-methylmorpholine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides,
Alcohols, nitriles, or a mixture of two or more of these are used. The reaction temperature is about -5 to about 200.
C., preferably about 5 to about 150.degree. The reaction time is usually about 5 minutes to about 72 hours, preferably about 0.5.
Hours to about 30 hours. The product remains the reaction solution,
Alternatively, it can be used as a crude product in the next reaction, or can be isolated from the reaction mixture according to a conventional method,
It can be easily purified by separation means such as recrystallization, distillation and chromatography.

Reaction formula 4

[Chemical 53] [R ¹⁰ represents an amino group which may have a substituent, and other symbols have the same meanings as described above. The compound (XVII) includes the compound (XVI) and amines represented by the formula R ¹⁰ H (for example, 1-propylamine, 1-butylamine, pyrrolidine, piperidine, piperazine, 4-methylpiperazine, 4-phenylpiperidine, etc. , Preferably pyrrolidine, piperidine, piperazine, 4-methylpiperazine and the like). In the compound (XVII), R ⁹ represents an aromatic hydrocarbon group or alkoxy. Examples of the "aromatic hydrocarbon group" include a phenyl group which may have a substituent and the like. Examples of the "alkoxy" include C _1-6 alkoxy such as methoxy, ethoxy, propoxy, isopropoxy, butoxy and the like. The amount of the “amines” used is approximately 1.0 to approximately 30 mol, preferably approximately 1.0 to approximately 10 mol, with respect to 1 mol of the compound (XVI). This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitriles, ketones or these A mixture of two or more kinds is used. The reaction temperature is about -5 to about 20.
It is 0 ° C, preferably about 5 to about 120 ° C. The reaction time is usually about 5 minutes to about 72 hours, preferably about 0.
5 to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction,
It can also be isolated from the reaction mixture according to a conventional method, and can be easily purified by a separation means such as recrystallization, distillation and chromatography.

Compound (VII) can be obtained by hydrolyzing compound (XVII) with an acid or a base. The amount of the acid and base used is approximately 0.1 to approximately 50 mol, preferably approximately 1 to approximately 20 mol, with respect to 1 mol of the compound (XVII). Examples of the “acid” include mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, boron trichloride, Lewis acids such as boron tribromide, a combination of Lewis acid and thiols or sulfides, trifluoroacetic acid, Organic acids such as p-toluenesulfonic acid are used. Examples of the “base” include metal hydroxides such as sodium hydroxide, potassium hydroxide and barium hydroxide, basic salts such as sodium carbonate and potassium carbonate, sodium methoxide, sodium ethoxide, potassium tert-butoxide. And metal bases such as triethylamine, imidazole, and formamidine. This reaction is
It is advantageous to carry out in the absence of a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, alcohols, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons,
Sulfoxides, water, or a mixture of two or more thereof are used. The reaction time is generally about 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is usually about 0 to about 200 ° C., preferably about 20.
To about 120 ° C.

Compound (VII) can also be obtained by treating compound (XVIII) with hydrogen sulfide in the presence of a base. The amount of hydrogen sulfide used is approximately 1 to approximately 30 mol with respect to 1 mol of the compound (XVIII). The amount of the base used is approximately 1.0 to approximately 30 mol, preferably approximately 1.0 to approximately 10 mol, with respect to 1 mol of the compound (XVIII). Examples of the "base" include aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine,
Tributylamine, cyclohexyldimethylamine, 4
-Dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N
And tertiary amines such as methylmorpholine. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, aromatic amines, or a mixture of two or more thereof, etc. Used. This reaction is carried out under normal pressure or increased pressure. The reaction temperature is generally about −20 to about 80 ° C., preferably about −
10 to about 30 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour to about 30 hours.
It's time. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

Further, the compound (VII) is the compound (XVIII)
Can also be obtained by treatment of with dithiophosphate-O, O-diethyl in the presence of an acid. The amount of di-thiophosphate-O, O-diethyl used is approximately 0.9 to approximately 2 mol with respect to 1 mol of the compound (XVIII). The amount of the acid used is approximately 3.0 to approximately 30 mol, preferably approximately 3.0 to approximately 10 mol, with respect to 1 mol of the compound (XVIII). Examples of the "acid" include hydrogen halides such as hydrogen chloride and hydrogen bromide, and mineral acids such as hydrochloric acid and hydrobromic acid. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, alcohols, amides, ethers, esters, water, or a mixture of two or more of these and the like can be used. The reaction temperature is generally about 0 to about 80 ° C, preferably about 0 to about 30 ° C.
Is. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour to about 30 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

Compound (VII) can also be obtained by treating compound (XIX) with phosphorus pentasulfide or Lawesson's reagent. The amount of phosphorus pentasulfide or Lawesson's reagent used is about 0.5 to about 1 per 1 mol of compound (XIX).
It is 0 mol, preferably about 0.5 to about 3 mol. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, or a mixture of two or more thereof or the like is used. The reaction time is generally 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is usually about 0 to about 150.
C., preferably about 20 to about 120.degree. The product (VII) can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture by a conventional method, and separated by recrystallization, distillation, chromatography or the like. It can be easily purified.

When the compound (Im) is an acylamino compound, the corresponding amine compound can be subjected to an acylation reaction known per se to give the desired product. For example, the compound (I
In m), the compound in which R ¹ is an acylamino which may have a substituent can be obtained by reacting the corresponding 2-thiazoleamine with an acylating agent in the presence of a base or an acid, if desired. . The amount of the acylating agent used is about 1 to about 5 with respect to 1 mol of the corresponding 2-thiazoleamine.
Mol, preferably about 1 to about 2 mol. Examples of the “acylating agent” include a carboxylic acid corresponding to the acyl group of the target compound or a reactive derivative thereof (eg, acid halide, acid anhydride, ester, etc.) and the like. The amount of the base or acid used is about 0.8 to about 5 mol, preferably about 1 to about 2 mol, based on 1 mol of the corresponding 2-thiazolamine. Examples of the "base" include triethylamine, pyridine, 4-dimethylaminopyridine and the like. Examples of the “acid” include methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, amides,
Halogenated hydrocarbons, nitriles, sulfoxides,
Aromatic amines or mixtures of two or more of these are used. The reaction temperature is about -20 to about 150 ° C, preferably about 0 to about 100 ° C. The reaction time is usually about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by a separation means such as recrystallization, distillation and chromatography. can do.

When compound (Im) is an N-oxide, it can be obtained by treating the corresponding pyrimidine with an organic peracid. The amount of the organic peracid used is approximately 0.8 to approximately 10 mol, preferably approximately 1.0 to approximately 3.0 mol, with respect to 1 mol of the corresponding pyrimidine derivative. Examples of the “organic peracid” include peracetic acid, pertrifluoroacetic acid, metachloroperbenzoic acid and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids, ethers, amides, sulfoxides, alcohols, nitriles. And ketones, or a mixture of two or more thereof. The reaction temperature is about -20 ° C to about 130 ° C, preferably about 0 ° C.
C. to about 100.degree. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour to about 12 hours.
It's time. The N-oxide form can also be obtained by treating the corresponding pyrimidine form with hydrogen peroxide or an alkylhydroperoxide, optionally in the presence of a base, an acid or a metal oxide. The amount of hydrogen peroxide or alkyl hydroperoxide used is about 0.8 to about 10 mol, preferably about 1.0 to about 3.0 mol, per 1 mol of the corresponding pyrimidine derivative. Examples of the “alkyl hydroperoxide” include tert-butyl hydroperoxide, cumene hydroperoxide and the like. The amount of the base, acid or metal oxide used is about 0.1 to about 30 mol, preferably about 0.8 to about 5 mol, relative to 1 mol of the corresponding pyrimidine derivative. Examples of the "base" include inorganic bases such as sodium hydroxide and potassium hydroxide, basic salts such as sodium carbonate and potassium carbonate, and the like. Examples of the “acid” include mineral acids such as hydrochloric acid, sulfuric acid and perchloric acid, Lewis acids such as boron trifluoride, aluminum chloride and titanium tetrachloride, and organic acids such as formic acid and acetic acid. As the “metal oxide”,
For example, vanadium oxide (eg V ₂ O ₅ etc.), osmium tetroxide (OsO ₄ ), tungsten oxide (eg WO ₃ etc.),
Molybdenum oxide (eg, MoO ₃ ), selenium dioxide (S
eO ₂ ), chromium oxide (eg, CrO ₃ etc.) and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids,
Ethers, amides, sulfoxides, alcohols, nitriles, ketones, or a mixture of two or more of these are used. The reaction temperature is about -20 ° C to about 13 ° C.
It is 0 ° C, preferably about 0 ° C to about 100 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour to about 12 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated according to a conventional method and easily purified by a separation means such as recrystallization, distillation, and chromatography. it can.

When the compound (Im) is an S-oxide, it can be obtained by treating the corresponding sulfide with a peroxide. The amount of the peroxide used is about 0.8 to about 10 mol, preferably about 1.0 to about 3.0 mol, based on 1 mol of the corresponding sulfide. Examples of the “peroxide” include peracetic acid, pertrifluoroacetic acid, metachloroperbenzoic acid, potassium persulfate, metaperiodic acid and the like. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons,
Organic acids, ethers, amides, sulfoxides, alcohols, nitriles, ketones, or a mixture of two or more of these are used. The reaction temperature is about −20 ° C. to about 130 ° C., preferably about 0 ° C. to about 100 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour to about 12 hours. Also, S-
The oxide form can also be obtained by treating the corresponding sulfide form with hydrogen peroxide or an alkylhydroperoxide, optionally in the presence of a base, an acid and / or a metal oxide. The amount of hydrogen peroxide or alkyl hydroperoxide used is about 0.8 to about 10 mol, preferably about 1.0 to about 3.0 mol, per mol of the corresponding sulfide. The "alkyl hydroperoxide"
Examples thereof include tert-butyl hydroperoxide and cumene hydroperoxide. The amount of the “base, acid or metal oxide” used is the same as the corresponding sulfide 1
It is about 0.1 to about 30 mol, preferably about 0.8 to about 5 mol, per mol. Examples of the "base" include inorganic bases such as sodium hydroxide and potassium hydroxide, basic salts such as sodium carbonate and potassium carbonate, and the like. Examples of the “acid” include mineral acids such as hydrochloric acid, sulfuric acid and perchloric acid, Lewis acids such as boron trifluoride, aluminum chloride and titanium tetrachloride, and organic acids such as formic acid and acetic acid. Examples of the “metal oxide” include vanadium oxide (eg V ₂ O ₅ etc.), osmium tetroxide (OsO ₄ ), tungsten oxide (eg WO ₃ etc.), molybdenum oxide (eg MoO ₃ etc.), Selenium dioxide (Se
O ₂ ), chromium oxide (eg, CrO ₃ etc.) and the like.
This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids, ethers, amides, sulfoxides, alcohols, nitriles. And ketones, or a mixture of two or more thereof. The reaction temperature is about −20 ° C. to about 130 ° C., preferably about 0 ° C. to about 100 ° C. The reaction time is
It is usually about 5 minutes to about 72 hours, preferably about 0.5 to about 12 hours. The product can be used as it is in the reaction solution or as a crude product in the next reaction, but it can also be isolated according to a conventional method and easily purified by a separation means such as recrystallization, distillation, and chromatography. it can.

In each of the above reactions, the starting compound is a substituent
When having amino, carboxy, hydroxy as
As these groups are commonly used in peptide chemistry etc.
A protective group may be introduced, which is essential after the reaction.
If desired, the protective group is removed to obtain the target compound.
You can Amino protecting groups include, for example,
Mil or C which may have a substituent, respectively_1-6Al
Kill-carbonyl (eg, acetyl, propionyl
Etc.), phenylcarbonyl, C_1-6Alkoxy-carbo
Nyl (eg, methoxycarbonyl, ethoxycarbonyl
, Etc.), phenyloxycarbonyl, C_7-10Aralkyl
Oxy-carbonyl (eg, benzyloxycarbonyl
), Trityl, phthaloyl, etc. are used. these
The substituent of is a halogen atom (eg, fluorine, salt
Element, bromine, iodine, etc.), C_1-6Alkyl-carbonyl
(Eg, acetyl, propionyl, valeryl, etc.),
Toro or the like is used, and the number of substituents is 1 to 3.
Examples of the carboxy-protecting group include a substituent
C which may have_{1- 6}Alkyl (eg, methyl, et
Chill, propyl, isopropyl, butyl, tert-butyl
Etc.), phenyl, trityl, silyl and the like are used. This
These substituents include halogen atoms (for example, fluorine
Elemental, chlorine, bromine, iodine, etc.), formyl, C _1-6Archi
Ru-carbonyl (eg acetyl, propionyl, bromo)
Cylcarbonyl, etc.), nitro, C_1-6Alkyl (eg
, Methyl, ethyl, tert-butyl, etc.), C_6-10Ally
(Eg, phenyl, naphthyl, etc.) is used and
The number of substituents is 1 to 3. With hydroxy protecting group
Are, for example, C, which may have a substituent, respectively._1-
6Alkyl (eg methyl, ethyl, propyl, iso
Propyl, butyl, tert-butyl etc.), phenyl, C
_7-11Aralkyl (eg, benzyl, etc.), formyl, C
_1-6Alkyl-carbonyl (eg acetyl, propyl
Onyl etc.), phenyloxycarbonyl, C_7-11Aral
Kiroxy-carbonyl (eg, benzyloxycal
Bonyl, etc.), tetrahydropyranyl, tetrahydrofura
Nil, silyl and the like are used. As these substituents
Is a halogen atom (for example, fluorine, chlorine, bromine, iodine).
), C_1-6Alkyl (eg methyl, ethyl, ter
t-butyl etc.), C_7-11Aralkyl (eg, benzyl
Etc.), C_6-10Aryl (eg phenyl, naphthyl
Etc.), nitro, etc. are used, and the number of substituents is 1 to 4
Is.

As a method for removing the protecting group, a method known per se or a method analogous thereto can be used.
A method of treatment with ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate or the like or a reduction reaction is used. In any case, if desired, a known deprotection reaction, acylation reaction, alkylation reaction, hydrogenation reaction, oxidation reaction, reduction reaction, carbon chain extension reaction, or substituent exchange reaction may be carried out individually or in combination. Compound (I) can be synthesized by combining two or more. For these reactions, for example, the methods described in Shin Jikken Kagaku Koza 14, Vol. 15, 1977 (Maruzen Publishing), etc. are adopted. Examples of the above-mentioned "alcohols" include methanol, ethanol, propanol, isopropanol, tert-butanol and the like. Examples of the "ethers" include diethyl ether, diisopropyl ether, diphenyl ether, tetrahydrofuran, dioxane, 1,2-dimethoxyethane and the like. As the above-mentioned “halogenated hydrocarbons”,
For example, dichloromethane, chloroform, 1,2-dichloroethane, carbon tetrachloride and the like can be mentioned. Examples of the "aliphatic hydrocarbons" include hexane, pentane,
Cyclohexane etc. are mentioned. Examples of the above-mentioned “aromatic hydrocarbons” include benzene, toluene, xylene, chlorobenzene and the like. Examples of the above-mentioned “aromatic amines” include pyridine, lutidine, quinoline and the like. Examples of the “amides” include N, N-dimethylformamide, N, N-dimethylacetamide, hexamethylphosphoric triamide and the like. Examples of the “ketones” include acetone and methyl ethyl ketone. Examples of the “sulfoxides” include dimethyl sulfoxide and the like. Examples of the above-mentioned "nitriles" include acetonitrile, propionitrile and the like. Examples of the above-mentioned “organic acids” include acetic acid, propionic acid, trifluoroacetic acid and the like. Examples of the above-mentioned “esters” include methyl acetate, ethyl acetate,
Amyl acetate, methyl propionate and the like can be mentioned. When the target product is obtained in a free state by the above reaction,
It may be converted into a salt according to a conventional method, and when it is obtained as a salt, it may be converted into a free form or another salt according to a conventional method. The compound (Im) thus obtained can be obtained by known means such as phase transfer, concentration, solvent extraction, fractional distillation, crystallization,
It can be isolated and purified from the reaction solution by recrystallization, chromatography and the like. When compound (Im) exists as a configurational isomer (configurational isomer), diastereomer, conformer, etc., each can be isolated by the above-mentioned separation and purification means, if desired. Further, when the compound (Im) is a racemate, it can be separated into the S form and the R form by a usual optical resolution means. In the case where the compound (Im) has stereoisomers, the present invention includes the case where these stereoisomers are alone and the case where they are a mixture thereof. In addition, compound (Im) may be a hydrate or non-hydrate.
Compound (Im) is an isotope (eg, ³ H, ¹⁴ C,
³⁵ S) or the like.

The above compounds (Ia), (II), (III),
(IVa), (Va), (VIa), (Im), (I
n), (If ′), (Ig ′) and (Ih ′) (hereinafter abbreviated as compound (A)) are prodrugs of compound (A ), That is, a compound that enzymatically oxidizes, reduces, or hydrolyzes to be converted into the compound (A), or a compound that hydrolyzes by gastric acid or the like to the compound (A). As a prodrug of compound (A), a compound in which the amino group of compound (A) is acylated, alkylated or phosphorylated (eg, amino group of compound (A) is eicosanoylated, alanylated, pentylaminocarbonylated) , (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation, tert-butylation, etc.); A compound in which the hydroxyl group of the compound (A) is acylated, alkylated, phosphorylated, or borated (eg, the hydroxyl group of the compound (A) is acetylated, palmitoylated, propanoylated, pivaloylated, succinylated, fumarylated, alanyl) Compound, etc., which is a dimethylaminomethylcarbonylated compound; the carboxyl group of compound (A) is esterified, amide Compound (eg, carboxyl group of compound (A) is ethyl esterified, phenyl esterified, carboxymethyl esterified, dimethylaminomethyl esterified, pivaloyloxymethyl esterified, ethoxycarbonyloxyethyl esterified, phthalic acid And the like. Examples thereof include compounds such as di-esterified, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methyl esterified, cyclohexyloxycarbonylethyl esterified, and methylamidated compounds); These compounds can be produced from compound (A) by a method known per se. The prodrug of compound (A) is changed to compound (A) under physiological conditions as described in Hirokawa Shoten, 1990, “Development of Pharmaceuticals,” Volume 7, Molecular Design, pages 163 to 198. It may be.

In addition, p38MAP used in the present invention
Kinase inhibitors and / or TNF-α production inhibitors include WO98 / 57966 and WO98 / 5637.
7, WO98 / 25619, WO98 / 07425, W
O98 / 06715, US5739143, WO97 /
35855, WO97 / 33883, WO97 / 325
83, WO97 / 25048, WO97 / 25046,
WO96 / 10143, WO96 / 21654, WO9
5/07922, WO2000 / 09525, and WO9
9/17776, WO99 / 01131, WO98 / 2
8292, WO97 / 25047, WO97 / 2504
5, US5658593, WO96 / 21452, WO
99/18942, US5756499, US5864
036, US 6046208, US 5716955, U
S5811549, US5670527, US5969
184, WO2000 / 31072, WO2000 / 3
1063, WO2000 / 20402, WO2000 /
18738, WO2000 / 17175, WO2000
/ 12497, WO2000 / 12074, WO200
0/07991, WO2000 / 07980, WO20
00/02561, US6096711, WO99 / 6
4400, WO99 / 61440, WO99 / 5995
9, WO99 / 58523, WO99 / 58502, W
O99 / 57101, WO99 / 32111, WO99
/ 32110, WO99 / 26657, WO99 / 20
624, WO99 / 18942, WO99 / 1516
4, WO99 / 00357, WO98 / 52940, W
O98 / 52937, WO98 / 52558, WO98
/ 06715, WO97 / 22256, WO96 / 21
452, WO2000 / 43366, WO2000 / 4
2003, WO2000 / 4002, WO2000 /
41698, WO2000 / 41505, WO2000
/ 40243, WO2000 / 34303, WO200
0/25791, WO2000 / 17204, WO20
00/10563, US6080546, WO99 / 6
1426, WO99 / 32463, WO99 / 3212
1, WO99 / 17776, WO98 / 28292, W
O98 / 27098, WO98 / 25619, WO98
/ 20868, WO97 / 35855, WO97 / 32
583, WO97 / 25048, WO97 / 2504
7, WO97 / 25046, WO97 / 25045, U
S5658903, WO96 / 40143, WO96 /
21654, WO2000 / 55153, WO2000
/ 55120, WO2000 / 26209, US604
6208, US5756499, US5864036,
JP-A-2000-86657, WO99 / 59960, W
O99 / 21859, WO99 / 03837, WO99
/ 01449, WO99 / 01136, WO /, WO9
9/01130, US5905089, WO98 / 57
966, WO98 / 52941, WO98 / 4789
9, WO98 / 07425, WO97 / 38833, W
O2000 / 42213, WO99 / 58128, WO
2000/04025, WO2000 / 40235, W
O2000 / 31106, WO97 / 46228, WO
2000/59904, WO2000 / 4003, W
O2000 / 4002, WO2000 / 41698,
WO2000 / 10563, WO99 / 61426, W
O99 / 32463, US6002008, WO98 /
43960, WO98 / 27098, WO97 / 358
56, WO97 / 35855, WO96 / 22985,
The compounds described in JP-A-61-145167 and the like are also used.

P38 MAP kinase used in the present invention
Inhibitor or (and) TNF-α production inhibitor,
A compound containing a pyridyl group or a salt thereof, wherein
A lysyl group with a substituent introduced at the α-position of the nitrogen atom,
Compounds containing ruby or pyridyl groups and aromatic hydrocarbon groups
Or a salt thereof, wherein the aromatic hydrocarbon group has a polar group
Introduced with is a P450 inhibitory action of CYP3A4 etc.
As a result, the side effects such as liver toxicity are reduced.
Therefore, it can be used in combination with other drugs, so it is preferably used.
You can "A compound containing a pyridyl group" or
“Compounds containing a pyridyl group and an aromatic hydrocarbon group”
The pyridyl group includes 1-pyridyl group and 2-pyridyl group.
Group, 3-pyridyl group, 4-pyridyl group
Of these, a 4-pyridyl group is preferred. "Piriji
Aromatic charcoal of a compound containing an aromatic group and an aromatic hydrocarbon group "
Examples of the hydrogen fluoride group include monocyclic rings having 6 to 14 carbon atoms.
Formula or fused polycyclic (2 or 3 ring) aromatic hydrocarbon group, etc.
Is mentioned. Specific examples thereof include phenyl and 1
-Naphthyl, 2-naphthyl, 2-biphenylyl, 3-bi
C such as phenylyl, 4-biphenylyl, 2-anthryl
_6-14Aryl and the like are mentioned, and phenyl is particularly preferable.
Good "Compound containing a pyridyl group" or "pyridyl
A group containing a group and an aromatic hydrocarbon group ",
The compounds (I) to (VI) and the like are used. Pyridyl
Examples of the substituent that can be introduced at the α-position of the group include, for example, those mentioned above.
R^Two“Pyridyl which may have a substituent
The same as the "substituent" of "group" and the like can be mentioned. Concrete
Specifically, 1 to 3 of the following substituents can be introduced.
(I) halogen atom, (ii) C_1-6Alkyl group, C
_2-6Alkenyl group, C_2-6Alkynyl group, C _3-6
Cycloalkyl group, C_6-14Aryl group or C
_7-16Aralkyl groups [These groups are oxo, halogen
Atom, C_1-3Alkylenedioxy, nitro, shea
C, which may be halogenated_1-6Alkyl, ha
C which may be rogenated_2-6Alkenyl, carbo
Kishi C_2-6Alkenyl, optionally halogenated
C_2-6Alkynyl, optionally halogenated C
_3-6Cycloalkyl, C_6-14Aryl, halogen
C which may be converted_1-8Alkoxy, C_1-6Al
Coxy-carbonyl-C_1-6Alkoxy, hydroxy
Shi, C_{6 -14}Aryloxy, C_7-16Aralkyl
Oxy, mercapto, optionally halogenated C
_1-6Alkylthio, C_6-14Arylthio, C
_7-16Aralkylthio, amino, mono-C_1-6Al
Kiramino, Mono-C_6-14Arylamino, di-C
_1-6Alkylamino, di-C_6-14Arylami
No, formyl, carboxy, C_1-6Alkyl-carbo
Nil, C_3-6Cycloalkyl-carbonyl, C_1-6
Alkoxy-carbonyl, C_6-14Aryl-carbo
Nil, C_7-16Aralkyl-carbonyl, C_6-14
Aryloxy-carbonyl, C_7-16Aralkillo
Xy-carbonyl, 5- or 6-membered heterocyclic carbonyl, cal
Vamoyl, Thiocarbamoyl, Mono-C_1-6Alkyl
-Carbamoyl, di-C_1-6Alkyl-carbamoy
Le, C_6-14Aryl-carbamoyl, 5- or 6-membered compound
Carbamoyl ring C, C_1-6Alkylsulfonyl, C
_6-14Arylsulfonyl, C_1-6Alkylsulf
Inyl, C_6-14Arylsulfinyl, formyla
Mino, C_1-6Alkyl-carbonylamino, C
_6-14Aryl-carbonylamino, C_1-6Arco
Xy-carbonylamino, C_1-6Alkylsulfonyl
Amino, C_6-14Arylsulfonylamino, C
_1-6Alkyl-carbonyloxy, C_6-14Ally
L-carbonyloxy, C_1-6Alkoxy-Carbonii
Roxy, Mono-C_1-6Alkyl-carbamoyl oki
Shi, C_1-6Alkyl-carbamoyloxy, C
_6-14Aryl-carbamoyloxy, nicotinoyl
Oxy, in addition to one nitrogen atom and a carbon atom, a nitrogen atom,
1 or 2 types of hetero selected from sulfur atom and oxygen atom
5 to 7 membered saturated optionally containing 1 to 4 atoms
Cyclic amino (This cyclic amino is C_1-6Alkyl, C
_6-14Aryl, C_1-6Alkyl-carbonyl, 5
To a 10-membered aromatic heterocyclic group and oxo
Other than carbon atom)
1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom
5- to 10-membered compounds containing 1 to 4 heteroatoms
Aromatic heterocyclic group, sulfo, sulfamoyl, sulfinamo
Group consisting of yl and sulfenamoyl (substituent group A)
1 to 5 substituents, preferably not 1
May have 3], (iii) selected from the group A of substituents.
Carbon atom optionally having 1 to 3 substituents
Besides nitrogen, selected from nitrogen atom, sulfur atom and oxygen atom
5 to 1 containing 1 to 4 1 or 2 heteroatoms
A 4-membered heterocyclic group, (Iv) Formula:-(C = O) -R^Five,-(C = O) -OR^Five,-
(C = O) -NR^FiveR⁶,-(C = S) -NHR^FiveOr-SO₂
-R⁷ (In the formula, R^FiveIs selected from the group consisting of hydrogen atom and substituent A
C which may have 1 to 3 substituents_1-6Archi
Lu group, C_2-6Alkenyl group, C_2-6An alkynyl group,
C_3-6Cycloalkyl group, C_6-14Aryl group
Kuha C_7-16Aralkyl group or substituent selected from group A
A carbon atom which may have 1 to 3 substituents
Other than nitrogen atom, sulfur atom and oxygen atom 1
Or 5 to 14 containing 1 to 4 heteroatoms
Membered heterocyclic group is R⁶Is a hydrogen atom or C_1-6Alkyl
The base is R⁷Does not have 1 substituent selected from Group A of substituents
C which may have 3_1-6Alkyl group, C_2-6
Alkenyl group, C_2-6Alkynyl group, C_3-6Cyclo
Alkyl group, C_6-14Aryl group or C_{7-1 6}
The aralkyl group or the substituent selected from the substituent group A is 1
To nitrogen atoms other than carbon atoms, which may have 3 to 3.
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 14-membered heterocyclic group containing 1 to 4 terror atoms
Represents an acyl group, (v) an amino group (this amino group
No group is a substituent selected from Group A of Substituents 1 to 3
C which may have_1-6Alkyl group, C_2-6Al
Kenyl group, C_2-6Alkynyl group, C_3-6Cycloal
Kill group, C_6-14Aryl group or C_{7-1 6}Ara
1 to 1 substituents selected from the group
Nitrogen atom, sulfur other than carbon atom, which may have 3
1 or 2 heteroatoms selected from atoms and oxygen atoms
A 5 to 14 membered heterocyclic group containing 1 to 4 of
Selected from the group consisting of acyl groups represented by (iv) above
(May have 1 or 2 substituents), (vi) 1
In addition to nitrogen atom and carbon atom, nitrogen atom, sulfur atom and acid
1 or 2 heteroatoms selected from elementary atoms
5 to 7-membered non-aromatic cyclic amino which may contain 4
A group (this cyclic amino group is C_1-6Alkyl, C
_6-14Aryl, C_1-6Alkyl-carbonyl, 5
To a 10-membered aromatic heterocyclic group and oxo
Which may have 1 to 3 substituents selected from the group),
Or (vii) no substituent selected from Group A of substituents
May have three, C_{1 -6}Alkoxy group, C
_6-14Aryloxy group or C_7-16Aralkyl
Oxy group. Of these, the following substituents are preferable.
Can be mentioned. (I) halogen atom, (ii) C_1-6An alkyl group, (ii
i) an amino group (this amino group is selected from the substituent group A)
C optionally having 1 to 3 substituents_{1 -6}A
Rukiru group, C_2-6Alkenyl group, C_2-6Alkynyl
Base, C_3-6Cycloalkyl group, C_6-14Aryl group
Or C_7-16Aralkyl group, selected from the substituent group A
Carbon atom optionally having 1 to 3 substituents
Besides nitrogen, selected from nitrogen atom, sulfur atom and oxygen atom
5 to 1 containing 1 to 4 1 or 2 heteroatoms
4-membered heterocyclic group, formula:-(C = O) -R^Five,-(C = O)
-OR^Five,-(C = O) -NR^FiveR⁶(In the formula, R^FiveIs hydrogen
Child, may have a substituent selected from Substituent Group A
I C_1-6Alkyl group, C_2-6Alkenyl group, C_Two
-6Alkynyl group, C_3-6Cycloalkyl group, C
_6-14Aryl group or C_7-16Aralkyl
Has 1 to 3 substituents selected from Group A of substituents
Optionally substituted heterocyclic group is R⁶Is a hydrogen atom or C_1-6
Alkyl group) selected from the group consisting of acyl groups
May have 1 or 2 substituents) or (i
v) In addition to one nitrogen atom and carbon atom, nitrogen atom, sulfur source
1 or 2 heteroatoms selected from a child and an oxygen atom
5 to 7 membered non-aromatic ring which may contain 1 to 4
-Like amino group (this cyclic amino group is C_1-6Alkyl,
C_{6-1 Four}Aryl, C_1-6Alkyl-carbonyl,
Group consisting of 5- to 10-membered aromatic heterocyclic groups and oxo
May have 1 to 3 substituents selected from
I). "A compound containing a pyridyl group and an aromatic hydrocarbon group
Which can be introduced into the aromatic hydrocarbon group of the "compound or its salt"
Examples of the group include (1) halogen atom and (2) hydroxy group.
A substituent selected from the group (3) Substituent group A and the above (iv)
Having 1 or 2 substituents selected from the acyls represented by
Optional amino, (4) nitro, (5) carboxy
Substitution selected from group A, group (6) formyl, and group (7) substituent
C optionally having 1 to 3 groups_1-6Arcoki
A substituent selected from the group (8) Substituent A is 1 to 3
C which may have_1-6Alkoxy-carbonyl,
(9) cyano and (10) these polar groups (from (1) to
Having 1 to 3 substituents (group represented by (9))
C_1-6Alkyl or C_6-14Select from Aryl etc.
There are 1 to 3 of them, among which (1) Carbo
Xy, (2) hydroxy, (3) carboxy and hydro
C having 1 to 3 substituents selected from xy_1-6A
Rukiru or C_6-14Aryl and the like are preferable. P4
As 50, CYP1A1, CYP1A2, CYP2
A1, CYP2A2, CYP2A4, CYP2A5, C
YP2A6, CYP2B1, CYP2B2, CYP2B
4, CYP2B5, CYP2B6, CYP2B9, CY
P2C2, CYP2C3, CYP2C4, CYP2C
5, CYP2C6, CYP2C7, CYP2C8, CY
P2C9, CYP2C11, CYP2C12, CYP2
C14, CYP2C19, CYP2C29, CYP2D
1, CYP2D2, CYP2D6, CYP2D9, CY
P2E1, CYP2F1, CYP2F2, CYP2G
1, CYP3A1, CYP3A2, CYP3A3, CY
P3A4, CYP3A6, CYP3A7, CYP4A
1, CYP4B1 and the like. Among them, CYP2C
9, CYP2D6 or CYP3A4 are preferred.

In the present specification, the p38 MAP kinase inhibitor and / or TNF-α inhibitor described above may be abbreviated as the compound of the present invention. The compound of the present invention has excellent p38MAP kinase inhibitory activity and TNF.
-Α inhibitory action (TNF-α production inhibitory action, TNF-α action inhibitory action), phosphodiesterase IV (PDE I
V) It has an inhibitory action, etc., is excellent in (oral) absorbability, (metabolism) stability, etc., has low toxicity, and has few side effects, and thus can be used as a safe pharmaceutical product. The pharmaceutical composition comprising the compound of the present invention is a mammal (for example, mouse, rat, hamster, rabbit, cat, dog, cow,
It can be used as a prophylactic / therapeutic agent for the following various pains for sheep, monkeys, humans, etc.). Cancer pain, acute pain due to inflammation, pain associated with chronic inflammation, postoperative pain (incision wound pain, deep pain, visceral pain, postoperative chronic pain, etc.), muscle pain (muscle pain associated with chronic pain disease, stiff neck, etc.) ), Joint pain, toothache,
Temporomandibular joint pain, headache (migraine, tension-type headache, headache associated with fever, headache associated with high blood pressure), visceral pain (heartache, anginal pain, abdominal pain, kidney pain, ureteral pain, bladder pain, maternal pain) Departmental pain (intermediate pain, dysmenorrhea, labor), neuralgia (disc herniation, nerve root pain, postherpetic neuralgia, trigeminal neuralgia), reflex sympathetic atrophy, complex local pain syndrome, etc. Further, a pharmaceutical composition comprising the compound of the present invention is a mammal (for example, mouse, rat, hamster,
Rabbits, cats, dogs, cows, sheep, monkeys, humans, etc.), they can also be used as osteoclast activation inhibitors and osteoclast formation inhibitors. Osteoclasts are cells that have a bone matrix degrading ability in which hematopoietic cells are differentiated and fused to become multinucleated,
In bone metabolism, it plays a role in bone resorption to osteoblasts that newly form bone. The maintenance of bone mass and morphology is based on the balance between the formation and resorption of these cells, and when osteoclasts are activated and bone resorption is enhanced, this equilibrium breaks down and bone loss decreases. Morphological destruction and deformation occur. In addition, since osteoclasts are involved in the regulation of blood calcium concentration through the absorption of bone, which is a calcium storage organ,
When the osteoclasts are extremely activated, the blood calcium concentration rises. Since the compound of the present invention can suppress the activation of osteoclasts and inhibit the formation of osteoclasts, for example, postmenopausal or senile primary osteoporosis, inflammation (rheumatism, etc.), hematological malignancy Diseases (malignant lymphoma, leukemia, etc.), endocrine abnormalities (hyperthyroidism, diabetes mellitus, etc.) or secondary osteoporosis resulting from administration of drugs such as corticosteroids, bone metastases of tumors or destruction of bone / joint tissue associated with rheumatism or It can be used as a prophylactic / therapeutic agent for deformity, Paget's disease or hypercalcemia. Among the compounds of the present invention, a compound that has both a pain preventive / therapeutic effect and an osteoclast activation suppressive effect and / or an inhibitory effect on formation can reduce pain such as joint pain and at the same time destroy or deform bone / joint tissue. It is useful in that it has the effect of preventing and treating diseases associated with osteoclasts such as.

The pharmaceutical composition containing the compound of the present invention has low toxicity, and the compound of the present invention can be used as it is or as a pharmacological agent according to a method known per se generally used in the production method of pharmaceutical preparations. Mixed with an acceptable carrier, for example, tablets (including sugar-coated tablets and film-coated tablets),
Safely orally or parenterally (eg, topical, rectal, intravenous administration, etc.) as a pharmaceutical preparation such as powder, granules, capsules (including soft capsules), solutions, injections, suppositories, sustained release agents, etc. Can be administered to. The content of the compound of the present invention in the pharmaceutical composition of the present invention is about 0.0 in the whole preparation.
1 to about 100% by weight. Examples of the pharmacologically acceptable carrier that may be used in the production of the pharmaceutical composition of the present invention include various organic or inorganic carrier substances conventionally used as a formulation material, for example, an excipient in a solid formulation, a lubricant. Examples include agents, binders and disintegrants, or solvents for liquid preparations, solubilizing agents, suspending agents, isotonic agents, buffering agents, soothing agents, and the like. Further, if necessary, a conventional preservative,
Additives such as antioxidants, colorants, sweeteners, adsorbents, wetting agents and the like can be appropriately used in appropriate amounts. Examples of the excipient include lactose, sucrose, D-mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid and the like. Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like. Examples of the binder include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose and the like. Examples of the disintegrant include starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, sodium carboxymethyl starch, L-hydroxypropyl cellulose and the like. Examples of the solvent include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like. Examples of the solubilizing agent include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like. Examples of the suspending agent include stearyl triethanolamine, sodium lauryl sulfate, lauryl aminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glycerin monostearate, and other surfactants; for example, polyvinyl alcohol,
Hydrophilic polymers such as polyvinylpyrrolidone, sodium carboxymethyl cellulose, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose and the like can be mentioned. Examples of the tonicity agent include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol and the like. Examples of the buffer include phosphate buffer, acetate buffer, carbonate buffer, citrate buffer, and the like. Examples of soothing agents include benzyl alcohol and the like.
Examples of the preservative include parahydroxybenzoic acid esters, chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic acid, sorbic acid and the like. Examples of the antioxidant include sulfite, ascorbic acid, α-tocopherol and the like. The content of additives such as a carrier in the pharmaceutical composition of the present invention varies depending on the form of the preparation, but is usually about 1 to 99.99% by weight, preferably about 10 to 90% by weight, based on the whole preparation. is there. Although the dose of the pharmaceutical composition of the present invention varies depending on the administration subject, administration route, disease, symptom, etc., for example, for a patient with pain (body weight of about 60 kg), as an active ingredient [compound of the present invention] About 0.01 to about 30 mg / kg body weight, preferably about 0.1 to about 20
mg / kg body weight, more preferably about 1 to about 20 mg / kg
The body weight may be orally administered once to several times daily.
In addition, for example, patients with primary osteoporosis (body weight of about 60 k
Also for g), the daily dose of the active ingredient [the compound of the present invention] is about 0.01 to about 30 mg / kg body weight, preferably about 0.1 to about 20 mg / kg body weight, more preferably about 1 to about 20 mg / kg body weight. About 20 mg / kg body weight may be orally administered once to several times a day.

Drugs that can be used in combination with the compounds of the present invention (hereinafter
(In some cases, it may be abbreviated as a concomitant drug), and examples thereof include the following. (1) Non-steroidal anti-inflammatory drugs (NSAIDs) (i) Classical NSAIDs Alcofenac, Aceclofenac, Sulindac, Tolmethine, Etodolac, Fenoprofen, Thiaprofenic acid, Meclofenamic acid, Meloxicam, Teoxicam, Lornoxicam, Nabumethine, Acetaminophen, Fenathenaphene, Fenathenaphene, Fenaprofen. , Etenzamid, sulpirine, antipyrine, miglenin, aspirin, mefenamic acid, flufenamic acid, diclofenac sodium, loxoprofen sodium, phenylbutazone, indomethacin, ibuprofen, ketoprofen, naproxen,
Oxaprozin, flurbiprofen, fenbufen, pranoprofen, floctafenin, piroxicam, epirizole, tiaramide hydrochloride, zaltoprofen, gabexate mesylate, camostat mesilate, ulinastatin, colchicine, probenesed, sulfinpyrazone, benzbromarone, allopurinol, gold thioapple Sodium acid salt, sodium hyaluronate, sodium salicylate, morphine hydrochloride, salicylic acid, atropine, scopolamine, morphine, pethidine, levorfinol, oxymorphone or a salt thereof. (Ii) Cyclooxygenase inhibitor (COX-1 selective inhibitor, COX-2 selective inhibitor, etc.) Salicylic acid derivative (eg, celecoxib, rofecoxib, aspirin), MK-663, valdecoxib, SC-5766
6, Tilacoxib, S-2474, Diclofenac, Indomethacin, Loxoprofen etc. (Iii) Drugs having both COX inhibition and 5-lipoxygenase inhibition, such as ML-3000 and p54 (COX inhibition & 5-lipoxygenase inhibition). (Iv) Nitric oxide free NSAIDs

(2) Disease-modifying antirheumatic drug (DMAR
Ds) (i) Auranofin gold preparation and the like. (Ii) penicillamine D-penicillamine (iii) sulfasalazine (iv) antimalarial drug chloroquine and the like. (V) Pyrimidine synthesis inhibitor leflunomide, etc. (Vi) Prograph

(3) Anti-cytokine drug (I) protein preparation (i) TNF inhibitor etanercept, infliximab, D2E7, CDP-571, P
ASSTNF-α, soluble TNF-α receptor, TNF-α binding protein, anti-T
NF-α antibody etc. (Ii) Interleukin-1 inhibitor Anakinra (interleukin-1 receptor antagonist), soluble interleukin-1 receptor, etc. (Iii) Interleukin-6 inhibitor MRA (anti-interleukin-6 receptor antibody), anti-interleukin-6 antibody, etc. (Iv) Interleukin-10 drug Interleukin-10 and the like. (V) Interleukin-12 inhibitor Anti-interleukin-12 antibody and the like. (V) Interferon-α and -γ inhibition, and T
Drugs that also have NF-α inhibition (polyclonal antibody) AGT-1 (II) non-protein preparation (i) MAP kinase inhibitor PD-98059 and the like. (Ii) Gene regulator SP-100030, NF-κ, NF-κB, IKK-1,
Inhibitors of molecules related to signal transduction such as IKK-2 and AP-1. (Iii) Cytokine production inhibitors T-614, SR-31747, sonatimod, etc. (Iv) TNF-α converting enzyme inhibitor (v) interleukin-1β converting enzyme inhibitor HMR3480 / VX-740 and the like. (Vi) Interleukin-6 antagonist SANT-7 and the like. (Vii) Interleukin-8 inhibitor IL-8 antagonist, CXCR1 & CXCR2 antagonist, etc. (Viii) Chemokine antagonist MCP-1 antagonist and the like. (Ix) Interleukin-2 receptor antagonist denileukin, diftitox and the like. (X) Therapeutic vaccines TNF-α vaccine and the like. (Xi) Gene therapy drug Gene therapy drug for the purpose of enhancing expression of genes having anti-inflammatory action such as interleukin-4, interleukin-10, soluble interleukin-1 receptor, soluble TNF-α receptor . (Xii) Antisense compound ISIS-104838 and the like.

(4) Immunomodulator (immunosuppressant) (i) T cell differentiation regulator 6,7-dimethoxy-4- (3,4-dimethoxyphenyl) -2- (1,2,4-triazole-) 1-ylmethyl) quinoline-3-carboxylic acid ethyl ester (JP-A-7-118266) (ii) Other methotrexate, cyclophosphamide, MX-68, achiprimmod dihydrochloride, BMS-188667, CKD
-461, rimexolone, cyclosporine, tacrolimus,
Gusperimus, azathioprine, anti-lymph serum, dried sulfonated immunoglobulin, erythropoietin, colony stimulating factor, interleukin, interferon, etc.

(5) Steroid drug dexamethasone, hexestrol, methimazole, betamethasone, triamcinolone, triamcinolone acetonide, fluocinonide, fluocinolone acetonide,
Prednisolone, methylprednisolone, cortisone acetate, hydrocortisone, fluorometholone, beclomethasone propionate, estriol, etc. (6) c-Jun N-terminal kinase (JNK) inhibitor WO00 / 35906, WO00 / 35909, WO0
0/35921, WO00 / 64872 or WO00
/ 75118 and the like.

(7) Angiotensin converting enzyme inhibitor enalapril, captopril, ramipril, lisinopril, cilazapril, perindopril and the like. (8) Angiotensin II receptor antagonist candesartan, cilexetil (TCV-116), valsartan, irbesartan, olmesartan, eprosartan, etc. (9) Diuretics Hydrochlorothiazide, spironolactone, furosemide, indapamide, bendrofluazide, cyclopenthiazide and the like. (10) Cardiotonic drugs such as digoxin and dobutamine. (11) β-receptor antagonists carvedilol, metoprolol, atenolol and the like. (12) Ca sensitizer MCC-135 and the like. (13) Ca channel antagonists nifedipine, diltiazem, verapamil and the like. (14) Antiplatelet drug, anticoagulant heparin, aspirin, warfarin and the like. (15) HMG-CoA reductase inhibitors atorvastatin, simvastatin and the like. (16) Contraceptives (i) Sex hormones or their derivatives Progesterone or its derivatives (progesterone, 17α
-Hydroxyprogesterone, medroxyprogesterone, medroxyprogesterone acetate, norethisterone, norethisterone enanthate, norethindrone, norethindrone acetate, norethinodrel, levonorgestrel, norgestrel, etinodiol diacetate, desogestrel, norgestimate, gestodene,
Progestin, etonogestrel, drospirenone, dienogest, trimegestone, nestron, clomadinone acetate, mifepristone, nomegestrol acetate, Org-
30659, TX-525, EMM-310525) or luteinizing hormone or its derivative and estrogen or its derivative (estradiol, estradiol benzoate, estradiol cypionate, estradiol dipropionate, estradiol enanthate, estradiol hexahydrobenzoate, estradiol) Phenyl propionate, estradiol undecanoate,
Combination with estradiol valerate, estrone, ethinyl estradiol, mestranol). (Ii) Anti-follicle hormone drugs such as olmeroxifene, mifepristone and Org-33628. (Iii) The spermicidal agent Uchelcell etc. (17) Others (i) T cell inhibitor IR-501 (T cell receptor peptide) and the like. (Ii) Inosine monophosphate dehydrogenase (IMPDH) inhibitor mycophenolate mofetil, VX-497 and the like. (Iii) Adhesion molecule inhibitor ISIS-2302, selectin inhibitor, ELAM-1, VCAM-1, ICAM-
1 and so on. (Iv) Thalidomide (v) Cathepsin inhibitor (vi) Matrix metalloproteinase (MMPs) inhibitor BB-3644, CGS-27023A, Bay-12-9566, KB-R7785, L-7583
54, POL-641, etc. (Vii) Glucose-6-phosphate dehydrogenase inhibitor CBF-BS2 and the like. (Viii) Hydroortate dehydrogenase (DHODH) inhibitor (ix) phosphodiesterase IV (PDE IV) inhibitor CG-1088 and the like. (X) Phospholipase A ₂ inhibitor (xi) iNOS inhibitor NOX-200 and the like. (Xii) Microtuble stimulant such as paclitaxel. (Xiii) Microtuble inhibitors such as Rumacon. (Xiv) MHC class II antagonist ZD-2315 and the like. (Xv) Prostacyclin agonist Iloprost etc. (Xvi) CD4 antagonist 4162W94, keriximab, etc. (Xvii) CD23 antagonist (xviii) LTB4 receptor antagonist CGS-25019C and the like. (Xix) 5-lipoxygenase inhibitor zileuton and the like. (Xx) Cholinesterase inhibitor galantamine, etc. (Xxi) Tyrosine kinase inhibitor YT-146 and the like. (Xxii) Calepsin B inhibitor (xxiii) Adenosine deaminase inhibitor pentostatin and the like. (Xxiv) Bone formation stimulant (2R, 4S)-(-)-N- [4- (diethoxyphosphorylmethyl) phenyl] -1,2,4,5-tetrahydro-4-methyl-7,8-methylene Dioxy-5-oxo-3-benzothiepine-2-carboxamide or a salt thereof (JP-A-8-231659) and the like. (Xxv) dipeptidyl peptidase inhibitor TMC-2A and the like. (Xxvi) TRK-530, TOK-8801 (xxvii) collagen agonist AI-200 and the like. (Xxviii) Capsaicin cream (xxix) hyaluronic acid derivative symbisque (hylan GF 20), orthobisque and the like. (Xxx) Glucosamine sulfate (xxxi) Amiprirose

Examples of concomitant drugs other than the above include, for example, antibacterial drugs, antifungal drugs, antiprotozoal drugs, antibiotics, antitussives / painless drugs,
Sedatives, anesthetics, antiulcers, antiarrhythmics, antihypertensive diuretics, anticoagulants, tranquilizers, antipsychotics, antitumor agents, antihyperlipidemic agents, muscle relaxants, antiepileptic agents, Antidepressants, antiallergic agents, cardiotonics, antiarrhythmic agents, vasodilators, vasoconstrictors, antihypertensive diuretics, antidiabetic agents, opiate antagonists, vitamins, vitamin derivatives, antiasthmatics, urinary incontinence Therapeutic agent, atopic dermatitis therapeutic agent, allergic rhinitis therapeutic agent, pressor agent, endotoxin antagonist or antibody, signal transduction inhibitor, inflammatory mediator action inhibitor, inflammatory mediator action inhibitor antibody, anti-inflammatory mediator action inhibitor Examples thereof include drugs and anti-inflammatory mediator action suppressing antibodies. Specifically, the following are mentioned.

(1) Antibacterial agents Sulfa drugs sulfamethizole, sulfisoxazole, sulfamonomethoxine, sulfamethizole, salazosulfapyridine, silver sulfadiazine and the like. Quinoline antibacterial agents nalidixic acid, pipemidic acid trihydrate, enoxacin, norfloxacin, ofloxacin, tosufloxacin tosylate, ciprofloxacin hydrochloride, lomefloxacin hydrochloride, sparfloxacin, fleroxacin, etc. Antituberculosis drug isoniazid, ethambutol (ethambutol hydrochloride), paraaminosalicylic acid (calcium paraaminosalicylate), pyrazinamide, ethionamide, prothionamide, rifampicin, streptomycin sulfate, kanamycin sulfate, cycloserine, etc. Anti-mycobacterial agents such as diaphenyl sulfone and rifampicillin Antiviral drugs idoxuridine, acyclovir, vitarabine, ganciclovir etc. Anti-HIV drugs zidovudine, didanosine, zalcitabine, indinavir sulfate ethanol adduct, ritonavir, etc. Anti-spirochete drugs antibiotics tetracycline hydrochloride, ampicillin, piperacillin,
Gentamicin, dibekacin, kanendomycin, lividomycin, tobramycin, amikacin, fradiomycin, sisomicin, tetracycline, oxytetracycline, rolitetracycline, doxycycline, ampicillin, piperacillin, ticarcillin, cephalothin, cephapirin, cephaloridine, cefaclor, cephalexin, Sefurokisajin, cefadroxil , Cefamandor, Cephtoam, Cefuroxime,
Cefotiam, cefotiam hexetyl, cefuroxime axetil, cefdinir, cefditoren pivoxil, ceftazidime, cefpyramide, cefthrozine, cefmenoxime, cefpodoxime proxetil, cefpirom, cefazoplan, cefepime, cefthrozine, cefmeznom, cefmeznom, cefepoxim
Cefbuperazone, ratamokinasef, flomoxef, cefazolin, cefotaxime, cefoperazone, ceftizoxime, moxalactam, thienamycin, sulfazecin, aztreonam or salts thereof, griseofulvin, lancasidins [Journal of Antibiotics (88, 38, Antibiotics).
5 (1985)], azole compounds [2-[(1R,
2R) -2- (2,4-Difluorophenyl) -2-hydroxy-1-methyl-3- (1H-1,2,4-triazol-1-yl) propyl] -4- [4- (2,
2,3,3-Tetrafluoropropoxy) phenyl-3
-(2H, 4H) -1,2,4-triazolone, fluconazole, itraconazole, etc.] and the like. (2) Antifungal Polyethylene antibiotics (eg, amphotericin B, nystatin, tricomycin) Griseofulvin, pyrrolenitrin and other cytosine antimetabolites (eg, flucytosine) Imidazole derivatives (eg, econazole, clotrimazole, miconazole nitrate, bifonazole) , Croconazole) Triazole derivatives (eg fluconazole, itraconazole) Thiocarbamic acid derivatives (eg trinaphthol), etc.

(3) Antiprotozoal agents Metronidazole, tinidazole, diethylcarbamazine citrate, quinine hydrochloride, quinine sulfate and the like. (4) Antitussive and evacuation drug Ephedrine hydrochloride, noscapine hydrochloride, codeine phosphate,
Dihydrocodeine phosphate, Isoproterenol hydrochloride, Ephedrine hydrochloride, Methylephedrine hydrochloride, Noscapine hydrochloride, Alloclamide, Chlorphedianol, Picoperidamine, Cloperastine, Protoxylol, Isoproterenol, Salbutamol, Tereptaline, Oxypetebanol, Morphine hydrochloride, Bromide Dextropetorphan hydrochloride, oxycodone hydrochloride, dimorphan phosphate, tipepidine hibenzate, pentoxyberine citrate, clofedanol hydrochloride, benzonate, guaifenesin, bromhexine hydrochloride, ambroxol hydrochloride, acetylcysteine, ethylcysteine, carbocysteine, etc. . (5) sedatives chlorpromazine hydrochloride, atropine sulfate, phenobarbital, barbital, amobarbital, pentobarbital, thiopental sodium, thiamiral sodium, nitrazepam, estazolam, flurazapam, haloxazolam, triazolam, flunitrazepam, bromovalerylurea, chlorphosphine chloral, trihydrate. Sodium and so on. (6) Anesthetic (6-1) Local Anesthetic Cocaine hydrochloride, procaine hydrochloride, lidocaine, dibucaine hydrochloride, tetracaine hydrochloride, mepivacaine hydrochloride, bupivacaine hydrochloride, oxybuprocaine hydrochloride, ethyl aminobenzoate, oxesazein) and the like. (6-2) General anesthetic Inhalation anesthetic (eg, ether, halothane, nitrous oxide,
Influrane, enflurane), intravenous anesthetics (eg, ketamine hydrochloride, droperidol, thiopental sodium, thiamylal sodium, pentobarbital), etc. (7) anti-ulcer drug histidine hydrochloride, lansoprazole, metoclopramide, pirenzepine, cimetidine, ranitidine, famotidine, urogastrin, oxesazein, proglumide, omeprazole, sucralfate, sulpiride,
Cetraxate, gefarnate, aldioxa, teprenone, prostaglandin etc. (8) Antiarrhythmic agents Sodium channel blockers (eg, quinidine, procainamide, disopyramide, azimarine, lidocaine,
(Mexiletine, phenytoin), β-blockers (eg, propranolol, alprenolol, pufetolol, oxprenolol, atenolol, acebutolol, metoprolol, bisoprolol, pindolol, carteolol, arotinolol hydrochloride), potassium channel blockers (eg, amiodarone) ), Calcium channel blockers (eg, verapamil, diltiazem), etc.

(9) Antihypertensive diuretic hexamethonium bromide, clonidine hydrochloride, hydrochlorothiazide, trichlormethiazide, furosemide, ethacrynic acid, bumetanide, mefluside, azosemide, spironolactone, potassium canrenoate, triamterene, amiloride, acetazolamide, D-mannitol,
Isosorbide, aminophylline, etc. (10) anticoagulant heparin sodium, sodium citrate, activated protein C, tissue factor pathway inhibitor, antithrombin III,
Dalteparin sodium, warfarin potassium, argatroban, gabexate, sodium citrate, ozacrel sodium, ethyl icosapentaate, beraprost sodium, alprostadil, ticlopidine hydrochloride,
Pentoxifylline, dipyridamole, tisokinase,
Urokinase, streptokinase, etc. (11) The tranquilizers diazepam, lorazepam, oxazepam, chlordiazepoxide, medazepam, oxazolam, cloxazolam, clothiazepam, bromazepam, etizolam, fludiazepam, hydroxyzine and the like. (12) Antipsychotic drug chlorpromazine hydrochloride, prochlorperazine, trifluoperazine, thioridazine hydrochloride, perphenazine maleate, fluphenazine enanthate, prochlorperazine maleate, levomepromazine maleate, promethazine hydrochloride, haloperidol, bromperidol. , Spiperone, reserpine, clocapramine hydrochloride, sulpiride, zotepine, etc. (13) Antitumor drug 6-O- (N-chloroacetylcarbamoyl) fumagillol, bleomycin, methotrexate, actinomycin D, mitomycin C, daunorubicin, adriamycin, neocarzinostatin, cytosine arabinoside, fluorouracil, tetrahydrofuryl-5. -Fluorouracil, picibanil, lentinan, levamisole, bestatin, azimexone, glycyrrhizin, doxorubicin hydrochloride, aclarubicin hydrochloride, bleomycin hydrochloride, hepromycin sulfate, vincristine sulfate, vinblastine sulfate, irinotecan hydrochloride, cyclophosphamide, melphalan, dusulfan, thiotepa, procarbazine hydrochloride. , Cisplatin, azathioprine, mercaptopurine, tegafur, carmofur, cytarabine Methyltestosterone, testosterone propionate, testosterone enanthate, mepitiostane, fosfestrol, chlormadinone acetate, leuprorelin acetate, etc. buserelin acetate.

(14) Antihyperlipidemic agent clofibrate, ethyl 2-chloro-3- [4- (2-methyl-2-phenylpropoxy) phenyl] propionate [Chemical and Pharmaceuticals]
Bulletin (Chem. Pharm. Bull), 38, 2792
-2796 (1990)], pravastatin, simvastatin, probucol, bezafibrate, clinofibrate, nicomol, cholestyramine, sodium dextran sulfate and the like. (15) Muscle relaxants Pridinol, tubocurarine, pancuronium, tolperisone hydrochloride, chlorphenesin carbamate, baclofen, chlormezanone, mephenesin, clozoxazone, eperisone, tizanidine, etc. (16) antiepileptic drug phenytoin, ethosuximide, acetazolamide, chlordiazepoxide, tripetadione, carbamazepine,
Phenobarbital, primidone, sultiam, sodium valproate, clonazepam, diazepam, nitrazepam, etc. (17) Antidepressants imipramine, clomipramine, noxiptiline, phenelzine, amitriptyline hydrochloride, nortriptyline hydrochloride, amoxapine, mianserin hydrochloride, maprotiline hydrochloride, sulpiride, fluvoxamine maleate, trazodone hydrochloride and the like. (18) Antiallergic drug diphenhydramine, chlorpheniramine, tripelenamine, metdilamine, clemizole, diphenylpyraline, methoxyphenamine, sodium cromoglycate,
Tranilast, repirinast, amlexanox, ibudilast, ketotifen, terfenadine, mequitazine, azelastine hydrochloride, epinastine, ozagrel hydrochloride, pranlukast hydrate, seratrodast, etc. (19) Cardiotonics transbioxocamphor, terephyllol, aminophylline, etilefrine, dopamine, dobutamine, denopamine, aminophylline, becinaline, amrinone,
Pimobendan, ubidecarenone, digitoxin, digoxin, methyldigoxin, lanatoside C, G-strophanthin and the like. (20) Vasodilator oxyfedrine, diltiazem, tolazoline, hexobenzine, bamethan, clonidine, methyldopa, guanabenz and the like.

(21) Vasoconstrictors dopamine, dobutamine denopamine and the like. (22) Antihypertensive diuretics Hexamethonium bromide, pentolinium, mecamylamine, ecarazine, clonidine, diltiazem, nifedipine and the like. (23) Antidiabetic drug tolbutamide, chlorpropamide, acetohexamide,
Glibenclamide, tolazamide, acarbose, epalrestat, troglitazone, glucagon, glymidine, glipzide, phenformin, pformin, metformin, etc. (24) Narcotic antagonist levallorphan, nalorphine, naloxone or a salt thereof and the like. (25) Fat-soluble vitamin drug Vitamin A's: vitamin A ₁ , vitamin A ₂ and retinol palmitate Vitamin D's: vitamin D ₁ , D ₂ , D ₃ , D ₄ and D ₅ vitamin E's: α-tocopherol, β -Tocopherol, γ-tocopherol, δ-tocopherol, nicotinic acid dl-α-tocopherol vitamin Ks: vitamins K ₁ , K ₂ , K ₃ and K ₄ folic acid (vitamin M) and the like. (26) Vitamin derivatives Various derivatives of vitamins, for example, vitamin D ₃ derivatives such as 5,6-trans-cholecalciferol, 2,5-hydroxycholecalciferol, 1-α-hydroxycholecalciferol, 5,6- Vitamin D ₂ derivatives such as trans-ergocalciferol.

(27) Antiasthma drug Isoprenaline hydrochloride, salbutamol sulfate, procaterol hydrochloride, terbutaline sulfate, trimethoquinol hydrochloride,
Tulobuterol hydrochloride, orciprenaline sulfate, fenoterol hydrobromide, ephedrine hydrochloride, iprotropium bromide, oxitropium bromide, flutropium bromide,
Theophylline, aminophylline, sodium cromoglycate, tranilast, repirinast, amlexanone,
Ibudilast, ketotifen, terfenadine, mequitazine, azelastine, epinastine, ozagrel hydrochloride,
Pranlukast hydrate, seratrodast, dexamethasone, prednisolone, hydrocortisone, sodium hydrocortisone succinate, beclomethasone propionate, etc. (28) Frequent urinary / urinary incontinence drug flavoxate hydrochloride, etc. (29) Atopic dermatitis therapeutic agent sodium cromoglycate, etc. (30) Remedies for allergic rhinitis Sodium cromoglycate, chlorpheniramine maleate, alimemazine tartrate, clemastine fumarate, homochlorcyclidine hydrochloride, terfenadine, mequitazine and the like. (31) Pressor drugs dopamine, dobutamine, denopamine, digitoxin, digoxin, methyldigoxin, lanatoside C, G-strophanthin and the like. (32) Other hydroxycam, diacerine, megestrol acetic acid,
False groins, prostaglandins, etc.

By combining the compound of the present invention with a concomitant drug, (1) the dose can be reduced compared to the case where the compound of the present invention or the concomitant drug is administered alone. (2) Patient The drug to be used in combination with the compound of the present invention can be selected according to the symptom (mildness, seriousness, etc.). (4) The therapeutic effect can be sustained by selecting a concomitant drug having a different mechanism of action from the compound of the present invention. (5) The compound of the present invention and the concomitant drug When used in combination, excellent effects such as a synergistic effect can be obtained. In the use of the concomitant drug of the present invention, the administration timing of the compound of the present invention and the concomitant drug is not limited, and the compound of the present invention or a pharmaceutical composition thereof and a concomitant drug or a pharmaceutical composition thereof,
It may be administered to the administration subject at the same time or may be administered with a time lag. Also, after synovectomy, Prosorba c
The combination agent can also be used after the treatment with olumn, the mononuclear cell treatment method, or the like. The dose of the concomitant drug may be in accordance with the dose clinically used, and can be appropriately selected depending on the administration subject, administration route, disease, combination and the like. The administration form of the concomitant drug of the present invention is not particularly limited as long as the compound of the present invention and the concomitant drug are combined at the time of administration. Examples of such a dosage form include (1) administration of a single preparation obtained by simultaneously formulating the compound of the present invention and a concomitant drug, and (2) preparation of the compound of the present invention and a concomitant drug separately. Administration of two types of preparations obtained by the formulation, (3) two formulations obtained by separately formulating the compound of the present invention and a concomitant drug, with a time difference between the same administration routes Administration, (4) simultaneous administration of two formulations obtained by separately formulating the compound of the present invention and a concomitant drug via different administration routes, (5) formulation of the compound of the present invention and a concomitant drug separately 2 obtained by converting
Administration of different formulations of different formulations at different times (for example, the compound of the present invention; administration in the order of concomitant drugs,
Or administration in the reverse order) and the like.

The concomitant drug of the present invention has low toxicity.
The compound of the present invention or (and) the above-mentioned concomitant drug are mixed with a pharmaceutically acceptable carrier according to a method known per se, to obtain a pharmaceutical composition such as tablets (including sugar-coated tablets and film-coated tablets), powders and granules. It can be safely administered orally or parenterally (eg, topical, rectal, intravenous administration, etc.), as a capsule, (including soft capsule), solution, injection, suppository, sustained-release agent and the like. The injection can be administered intravenously, intramuscularly, subcutaneously or intra-organly, or directly to the lesion. Examples of the pharmacologically acceptable carrier that may be used in the production of the concomitant drug of the present invention include various organic or inorganic carrier substances conventionally used as a formulation material, for example, an excipient in a solid formulation, a lubricant. , Binders and disintegrants, or solvents for liquid preparations, solubilizers, suspending agents, isotonic agents, buffering agents, soothing agents and the like. Further, if necessary, conventional additives such as antiseptics, antioxidants, colorants, sweeteners, adsorbents, wetting agents and the like can be appropriately used in appropriate amounts.

As the excipient, for example, lactose, sucrose, D-
Mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid and the like can be mentioned. Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like. Examples of the binder include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose and the like. Examples of the disintegrant include starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, sodium carboxymethyl starch, L-hydroxypropyl cellulose and the like. Examples of the solvent include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like. Examples of the solubilizing agent include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like. As the suspending agent, for example, stearyl triethanolamine, sodium lauryl sulfate, lauryl aminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glycerin monostearate, surface active agents such as polyvinyl alcohol, polyvinyl pyrrolidone, Hydrophilic polymers such as sodium carboxymethyl cellulose, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose and the like can be mentioned. Examples of the tonicity agent include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol and the like. Examples of the buffer include phosphate buffer, acetate buffer, carbonate buffer, citrate buffer, and the like. Examples of soothing agents include benzyl alcohol and the like. Examples of preservatives include paraoxybenzoic acid esters, chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic acid, sorbic acid and the like. Examples of the antioxidant include sulfite, ascorbic acid, α-tocopherol and the like.

The compounding ratio of the compound of the present invention to the concomitant drug in the combination agent of the present invention can be appropriately selected depending on the administration subject, administration route, disease and the like. For example, the content of the compound of the present invention in the combination agent of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight based on the whole preparation. And more preferably about 0.5 to 20% by weight. The content of the concomitant drug in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight, more preferably It is about 0.5 to 20% by weight. The content of additives such as a carrier in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 1 to 99.99% by weight, preferably about 10 to 90% by weight, based on the whole preparation. . Also, when the compound of the present invention and the concomitant drug are separately formulated, the same content may be used.

These formulations can be produced by a method known per se which is generally used in the formulation process. For example, the compound of the present invention or a concomitant drug is a dispersant (eg, Tween 80 (manufactured by Atlas Powder, USA), HCO 60 (manufactured by Nikko Chemicals), polyethylene glycol, carboxymethyl cellulose, sodium alginate, hydroxypropyl methyl cellulose). ,
Dextrin, etc.), stabilizers (eg, ascorbic acid,
Sodium pyrosulfite etc.), surfactants (eg polysorbate 80, macrogol etc.), solubilizers (eg glycerin, ethanol etc.), buffers (eg phosphoric acid and its alkali metal salts, citric acid and its alkali metals) Salt, etc.), isotonicity agent (eg, sodium chloride, potassium chloride, mannitol, sorbitol, glucose, etc.), pH adjuster (eg,
Hydrochloric acid, sodium hydroxide, etc.), preservatives (eg, ethyl paraoxybenzoate, benzoic acid, methylparaben, propylparaben, benzyl alcohol, etc.), solubilizers (eg, concentrated glycerin, meglumine, etc.), solubilizing agents (eg, propylene) Glycols, sucrose, etc.), soothing agents (eg, glucose, benzyl alcohol, etc.) in aqueous injections, or vegetable oils such as olive oil, sesame oil, cottonseed oil, corn oil, etc., and solubilizing agents such as propylene glycol. Alternatively, it can be emulsified and molded into an oil-based injection to prepare an injection.

In order to prepare a preparation for oral administration, according to a method known per se, the compound of the present invention or the concomitant drug is used, for example, an excipient (eg, lactose, sucrose, starch, etc.), a disintegrant (eg,
Add starch (calcium carbonate, etc.), binder (eg starch, gum arabic, carboxymethylcellulose, polyvinylpyrrolidone, hydroxypropylcellulose etc.) or lubricant (eg talc, magnesium stearate, polyethylene glycol 6000 etc.) etc. Then, the composition can be compression-molded, and then, if necessary, coated by a method known per se for the purpose of taste masking, enteric coating or sustainability, to give an oral administration preparation. As the coating agent, for example, hydroxypropylmethyl cellulose, ethyl cellulose,
Hydroxymethyl cellulose, hydroxypropyl cellulose, polyoxyethylene glycol, Tween 8
0, Pluronic F68, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, hydroxymethylcellulose acetate succinate, Eudragit (manufactured by Rohm, Germany, methacrylic acid / acrylic acid copolymerization) and dye (eg, red iron oxide,
Titanium dioxide etc.) is used. The preparation for oral administration may be either an immediate release preparation or a sustained release preparation.

For example, in the case of a suppository, the compound of the present invention or the concomitant drug can be made into an oily or aqueous solid, semisolid or liquid suppository according to a method known per se. Examples of the oily base used in the composition include higher fatty acid glycerides [eg, cacao butter, witepsols (Dynamite Nobel, Germany), etc.], intermediate fatty acids [eg, miglyols (Dynamite Nobel, Germany) ) And the like], or vegetable oil (eg, sesame oil, soybean oil, cottonseed oil, etc.) and the like. Examples of the aqueous base include polyethylene glycols and propylene glycol, and examples of the aqueous gel base include natural gums, cellulose derivatives, vinyl polymers and acrylic acid polymers. Examples of the sustained-release preparation include sustained-release microcapsules. The sustained-release microcapsules can be prepared by a method known per se, but for example, it is preferable that the sustained-release microcapsules are molded into a sustained-release preparation and administered. The compound of the present invention is preferably formed into a preparation for oral administration such as a solid preparation (eg, powder, granules, tablets, capsules) or a preparation for rectal administration such as a suppository. Particularly preferred is a preparation for oral administration.
The concomitant drug can be made into the dosage forms described above depending on the type of drug.

In the following, [1] an injection of the compound of the present invention or a concomitant drug and its preparation, [2] a sustained release preparation or an immediate release preparation of the compound of the present invention or a concomitant drug and its preparation, [3] The sublingual tablet, buccal or buccal disintegrant of the compound of the present invention or the concomitant drug and its preparation will be specifically described. [1] Injection and preparation thereof An injection prepared by dissolving the compound of the present invention or the concomitant drug in water is preferable. The injection may contain benzoate and / or salicylate. The injection can be obtained by dissolving both the compound of the present invention or the concomitant drug and optionally a benzoate and / or a salicylate in water. Examples of the salts of benzoic acid and salicylic acid include alkali metal salts such as sodium and potassium, alkaline earth metal salts such as calcium and magnesium, ammonium salts, meglumine salts, and other organic acid salts such as trometamol. The concentration of the compound of the present invention or the concomitant drug in the injection is 0.5 to 50 w / v%, preferably about 3 to 20 w / v%. Benzoate or /
The salicylate concentration is preferably 0.5 to 50 w / v%, more preferably 3 to 20 w / v%.

In addition, additives generally used for injection such as stabilizers (ascorbic acid, sodium pyrosulfite, etc.), surfactants (polysorbate 80, macrogol, etc.), solubilizers (glycerin, Ethanol, etc.), buffers (phosphoric acid and its alkali metal salts, citric acid and its alkali metal salts, etc.), isotonic agents (sodium chloride, potassium chloride, etc.), dispersants (hydroxypropyl methylcellulose, dextrin), pH adjustment Agents (hydrochloric acid, sodium hydroxide, etc.), preservatives (ethyl paraoxybenzoate, benzoic acid, etc.), solubilizers (concentrated glycerin, meglumine, etc.), solubilizers (propylene glycol, sucrose, etc.), soothing agents (glucose, Benzyl alcohol etc.) can be appropriately blended. These additives are generally added in the proportions usually used for injections. The injection is 2 to 12, preferably 2.5 by adding a pH adjusting agent.
It is better to adjust it to 8.0. The injectable preparation can be obtained by dissolving both the compound of the present invention or the concomitant drug and optionally the benzoate and / or salicylate, and optionally the above-mentioned additive in water. These may be dissolved in any order, and can be appropriately performed in the same manner as in the conventional method for producing an injectable solution. It is better to heat the aqueous solution for injection,
Further, it can be provided as an injection by subjecting it to filtration sterilization, high-pressure heat sterilization, etc. in the same manner as a usual injection. The aqueous solution for injection is preferably subjected to high-pressure heat sterilization at 100 ° C. to 121 ° C. for 5 minutes to 30 minutes. Furthermore, it may be a preparation in which the solution has antibacterial properties so that it can be used as a multiple-dose preparation.

[2] Sustained-release preparation or immediate-release preparation and preparation thereof A sustained-release preparation obtained by coating a core containing the compound of the present invention or a concomitant drug with a film-forming agent such as a water-insoluble substance or a swelling polymer, if desired. Release formulations are preferred. For example, a once-daily type sustained release preparation for oral administration is preferable. As the water-insoluble substance used for the film forming agent, for example, ethyl cellulose,
Cellulose ethers such as butyl cellulose, cellulose acetates such as cellulose acetate and cellulose propionate, polyvinyl esters such as polyvinyl acetate and polyvinyl butyrate, acrylic acid /
Methacrylic acid copolymer, methyl methacrylate copolymer, ethoxyethyl methacrylate / cinnamoethyl methacrylate / aminoalkyl methacrylate copolymer, polyacrylic acid, polymethacrylic acid, methacrylic acid alkylamide copolymer, poly (methyl methacrylate) , Polymethacrylate, polymethacrylamide, aminoalkylmethacrylate copolymer, poly (methacrylic acid anhydride), glycidylmethacrylate copolymer, especially Eudragit RS-100, RL-10.
0, RS-30D, RL-30D, RL-PO, RS-
Eudragits such as PO (ethyl acrylate / methyl methacrylate / trimethyl methacrylate / ethyl ammonium acrylate copolymer) and Eudragit NE-30D (methyl methacrylate / ethyl acrylate copolymer) (Rohm Pharma Co., Ltd.) ) And the like, hardened oils such as hydrogenated castor oil (eg, Lovely wax (Freund Industries), etc.), carnauba wax, fatty acid glycerin ester, waxes such as paraffin, and polyglycerin fatty acid ester.

As the swelling polymer, a polymer having an acidic dissociative group and exhibiting pH-dependent swelling is preferable. Swelling is small in an acidic region such as the stomach and swelling in a neutral region such as the small intestine or the large intestine. Polymers having acidic dissociative groups that increase It has an acidic dissociative group like this
Examples of polymers exhibiting dependent swelling include Carbomer 934P, 940, 941, 974P,
980, 1342, etc., polycarbophi
l), calcium polycarbo fill (carcium polycarbo
phil) (all of which are manufactured by BF Goodrich Co., Ltd.) and Hibiswako 103, 104, 105, 304 (all manufactured by Wako Pure Chemical Industries, Ltd.) and the like.

The film forming agent used in the sustained release preparation may further contain a hydrophilic substance. As the hydrophilic substance,
For example, pullulan, dextrin, polysaccharides that may have a sulfate group such as alkali metal alginate, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, polysaccharides having a hydroxyalkyl group or a carboxyalkyl group such as sodium carboxymethyl cellulose, methyl cellulose, Polyvinylpyrrolidone,
Examples thereof include polyvinyl alcohol and polyethylene glycol. The content of the water-insoluble substance in the film preparation of the sustained-release preparation is about 30 to about 90% (w / w), preferably about 35 to about 80% (w / w), more preferably about 4%.
0 to 75% (w / w), the content of swellable polymer is about 3 to about 30% (w / w), preferably about 3 to about 1
It is 5% (w / w). The coating agent may further contain a hydrophilic substance, in which case the content of the hydrophilic substance in the coating agent is about 50% (w / w) or less, preferably about 5 to about 40% (w.
/ w), more preferably about 5 to about 35% (w / w).
Here, the above-mentioned% (w / w) indicates the weight% with respect to the coating agent composition obtained by removing the solvent (eg, water, lower alcohols such as methanol and ethanol) from the coating agent liquid.

The sustained-release preparation is a film prepared by preparing a core containing a drug as illustrated below, and then dissolving the obtained core with a water-insoluble substance, a swelling polymer or the like by heating or dissolving or dispersing it in a solvent. It is manufactured by coating with a chemical solution. I. Preparation of drug-containing nuclei. The form of the core containing the drug to be coated with the coating agent (hereinafter sometimes simply referred to as the core) is not particularly limited, but is preferably formed into particles such as granules or fine particles. When the core is a granule or a fine granule, its average particle size is preferably about 150 to 2,000 μ.
m, more preferably about 500 to about 1,400 μm
Is. The core can be prepared by an ordinary manufacturing method. For example, suitable excipients, binders, disintegrants for drugs,
A lubricant, a stabilizer and the like are mixed and prepared by a wet extrusion granulation method, a fluidized bed granulation method or the like. The drug content of the nucleus is about 0.5 to about 95% (w / w), preferably about 5.0 to about 80% (w / w), more preferably about 30 to about 70% (w / w). Is.

As the excipient contained in the core, for example, sugars such as sucrose, lactose, mannitol and glucose, starch, crystalline cellulose, calcium phosphate, corn starch and the like are used. Among them, crystalline cellulose and corn starch are preferable. As the binder, for example, polyvinyl alcohol, hydroxypropylcellulose, polyethylene glycol, polyvinylpyrrolidone, Pluronic F68, gum arabic, gelatin, starch and the like are used. As the disintegrant, for example, carboxymethylcellulose calcium (ECG505), croscarmellose sodium (Ac-Di-Sol), cross-linked polyvinylpyrrolidone (crospovidone), low-substituted hydroxypropylcellulose (L-HPC) and the like are used. Of these, hydroxypropyl cellulose, polyvinylpyrrolidone, and low-substituted hydroxypropyl cellulose are preferable. Examples of lubricants and anti-agglomeration agents include talc, magnesium stearate and its inorganic salts, and lubricants such as polyethylene glycol. Acids such as tartaric acid, citric acid, succinic acid, fumaric acid and maleic acid are used as the stabilizer.

In addition to the above-mentioned production method, the core is sprayed with a binder dissolved in a suitable solvent such as water or a lower alcohol (eg, methanol, ethanol, etc.) on the inert carrier particles which are the core of the core. It can also be prepared by a tumbling granulation method, a pan coating method, a fluidized bed coating method or a melt granulation method, in which a drug or a mixture thereof with an excipient, a lubricant or the like is added little by little. As the inert carrier particles, for example, those produced from sucrose, lactose, starch, crystalline cellulose, waxes can be used, and the average particle diameter thereof is preferably about 100 μm to about 1,500 μm. The surface of the core may be coated with a protective agent in order to separate the drug contained in the core from the coating agent. As the protective agent, for example, the hydrophilic substance, the water-insoluble substance or the like is used. The protective agent is preferably polyethylene glycol or a polysaccharide having a hydroxyalkyl group or a carboxyalkyl group, more preferably hydroxypropylmethyl cellulose or hydroxypropyl cellulose. The protective agent may contain an acid such as tartaric acid, citric acid, succinic acid, fumaric acid or maleic acid as a stabilizer, and a lubricant such as talc. When a protective agent is used, its coverage is about 1 to about 15% (w /
w), preferably about 1 to about 10% (w / w), more preferably about 2 to about 8% (w / w). The protective agent can be coated by a conventional coating method, and specifically, the core can be spray-coated with the protective agent by, for example, a fluidized bed coating method, a pan coating method or the like.

II. Coating of the core with a coating agent The core obtained in the above I is coated with a coating agent solution in which the water-insoluble substance, the pH-dependent swelling polymer, and the hydrophilic substance are dissolved by heating or dissolved or dispersed in a solvent. To produce a sustained release formulation. Examples of the method for coating the core with the coating agent liquid include a spray coating method. The composition ratio of the water-insoluble substance, the swelling polymer or the hydrophilic substance in the coating agent liquid is appropriately selected so that the content of each component in the coating is the above content.
The coating amount of the coating agent is about 1 to about 90% (w / w), preferably about 5 to about 50% (w / w), and more preferably to the core (excluding the coating amount of the protective agent). About 5 to 3
It is 5% (w / w).

As the solvent for the coating agent solution, water or an organic solvent may be used alone or a mixture of both may be used. Mixing ratio of water and organic solvent (water / organic solvent:
The weight ratio can vary from 1 to 100%, preferably 1 to about 30%. The organic solvent is not particularly limited as long as it dissolves a water-insoluble substance, for example, lower alcohols such as methyl alcohol, ethyl alcohol, isopropyl alcohol, n-butyl alcohol, lower alkanones such as acetone,
Acetonitrile, chloroform, methylene chloride, etc. are used. Of these, lower alcohols are preferred,
Ethyl alcohol and isopropyl alcohol are particularly preferable. Water and a mixed liquid of water and an organic solvent are preferably used as the solvent of the film forming agent. At this time, if necessary, an acid such as tartaric acid, citric acid, succinic acid, fumaric acid or maleic acid may be added to the coating agent solution for stabilizing the coating agent solution. The operation in the case of coating by spray coating can be carried out by a usual coating method, and specifically, it is carried out by spray coating the core with a coating agent solution by, for example, a fluidized bed coating method, a pan coating method or the like. You can If necessary at this time, talc, titanium oxide, magnesium stearate, calcium stearate, light anhydrous silicic acid, etc. are used as lubricants, and glycerin fatty acid ester, hydrogenated castor oil, triethyl citrate, cetyl alcohol, stearyl alcohol, etc. are plasticized. You may add as an agent. After coating with the coating agent, an antistatic agent such as talc may be mixed if necessary.

The immediate release preparation may be liquid (solution, suspension, emulsion, etc.) or solid (particle, pill, tablet, etc.)
May be Oral administration agents, parenteral administration agents such as injection agents are used, and oral administration agents are preferred. The immediate-release preparation may usually contain, in addition to the active ingredient drug, a carrier, an additive or an excipient (hereinafter sometimes abbreviated as an excipient) commonly used in the field of formulation. . The formulation excipient used is not particularly limited as long as it is an excipient that is commonly used as a formulation excipient. For example, as an excipient for an oral solid preparation, lactose, starch, corn starch, crystalline cellulose (Asahi Kasei Co., Ltd., Avicel PH101, etc.), powdered sugar,
Granulose sugar, mannitol, light anhydrous silicic acid, magnesium carbonate, calcium carbonate, L-cysteine and the like can be mentioned, preferably corn starch and mannitol and the like. These excipients can be used alone or in combination of two or more. The content of the excipient is, for example, about 4.5 to about 99.4 w / w based on the total amount of the immediate release preparation.
%, Preferably about 20 to about 98.5 w / w%, more preferably about 30 to about 97 w / w%. The content of the drug in the immediate-release preparation was about 0.
It can be appropriately selected from the range of 5 to about 95%, preferably about 1 to about 60%.

When the immediate release preparation is an oral solid preparation, it usually contains a disintegrant in addition to the above components. As such a disintegrant, for example, carboxymethyl cellulose calcium (manufactured by Gotoku Yakuhin, ECG-505), croscarmellose sodium (for example, Asdi Kasei Co., Ltd., Acdisol), crospovidone (for example, BASF, Kollidon CL). , Low-substituted hydroxypropyl cellulose (Shin-Etsu Chemical Co., Ltd.), carboxymethyl starch (Matsuya Chemical Co., Ltd.), sodium carboxymethyl starch (Kimura Sangyo, Explotab), partially pregelatinized starch (Asahi Kasei Co., Ltd., PCS) or the like is used, and for example, one that disintegrates the granules by absorbing water, swelling by contact with water, or forming a channel between the active ingredient forming the core and the excipient can be used. These disintegrants can be used alone or in combination of two or more. It is appropriately selected depending on the type and amount of product, design of release formulation, etc.
For example, about 0.05 to about 30 w / w%, preferably about 0.
5 to about 15 w / w%.

When the immediate-release preparation is an oral solid preparation, the oral solid preparation may further contain, if desired, an additive conventionally used in the solid preparation, in addition to the above composition. Examples of such additives include binders (for example, sucrose, gelatin, gum arabic powder, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose,
Polyvinylpyrrolidone, pullulan, dextrin, etc., lubricants (eg, polyethylene glycol, magnesium stearate, talc, light anhydrous silicic acid (eg, Aerosil (Nippon Aerosil)), surfactants (eg, anions such as sodium alkylsulfate) -Based surfactants, polyoxyethylene fatty acid esters and polyoxyethylene sorbitan fatty acid esters, nonionic surfactants such as polyoxyethylene castor oil derivatives), colorants (for example, tar dyes, caramel, red iron oxide, titanium oxide) , Riboflavins), if necessary, cross-linking agents (eg, sweeteners, flavors, etc.), adsorbents, preservatives,
Wetting agents, antistatic agents, etc. are used. Further, an organic acid such as tartaric acid, citric acid, succinic acid or fumaric acid may be added as a stabilizer. As the binder, hydroxypropyl cellulose, polyethylene glycol, polyvinylpyrrolidone and the like are preferably used. The quick-release preparation can be prepared by mixing the above-mentioned components, and if necessary, further kneading and molding, based on the usual manufacturing technology for preparations. The above-mentioned mixing is performed by a generally used method such as mixing and kneading. Specifically, for example, when forming an immediate release preparation in the form of particles, by the same method as the method for preparing the core of the sustained release preparation, a vertical granulator, a universal kneader (manufactured by Hata Tekko Co., Ltd.), a flower It can be prepared by mixing using a layer granulator FD-5S (manufactured by Powrex) or the like, and then granulating by a wet extrusion granulation method, a fluidized bed granulation method or the like. The immediate-release preparation and the sustained-release preparation thus obtained are formulated as they are or separately separately with a formulation excipient by a conventional method, and then administered simultaneously or in combination with an arbitrary administration interval interposed. Alternatively, both may be directly or appropriately formulated into one orally-administered preparation (eg, granules, fine granules, tablets, capsules, etc.) together with a preparation excipient and the like. Both preparations may be made into granules or fine granules and filled in the same capsule or the like to give a preparation for oral administration.

[3] Sublingual tablet, buccal or intraoral quick disintegrating agent and preparation thereof The sublingual tablet, buccal preparation, orally rapid disintegrating agent may be a solid preparation such as a tablet, or an oral mucosa adhesive tablet ( the film)
May be As the sublingual tablet, buccal or buccal disintegrant, a formulation containing the compound of the present invention or the concomitant drug and an excipient is preferable. Further, an auxiliary agent such as a lubricant, a tonicity agent, a hydrophilic carrier, a water-dispersible polymer and a stabilizer may be contained. In addition, in order to facilitate absorption and increase bioavailability, β-cyclodextrin or β-cyclodextrin derivative (eg, hydroxypropyl-β
-Cyclodextrin, etc.) and the like. Examples of the above-mentioned excipients include lactose, sucrose, D-mannitol, starch, crystalline cellulose, light anhydrous silicic acid and the like. Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like, and magnesium stearate and colloidal silica are particularly preferable. Examples of the isotonicity agent include sodium chloride, glucose, fructose, mannitol, sorbitol, lactose, saccharose, glycerin, urea and the like, with mannitol being particularly preferred. Examples of the hydrophilic carrier include swelling hydrophilic carriers such as crystalline cellulose, ethyl cellulose, crosslinkable polyvinylpyrrolidone, light anhydrous silicic acid, silicic acid, dicalcium phosphate, and calcium carbonate, and particularly crystalline cellulose (eg, microcrystalline cellulose). Is preferred. Examples of the water-dispersible polymer include gum (eg, tragacanth gum, acacia gum, guar gum), alginate (eg, sodium alginate), cellulose derivative (eg, methyl cellulose, carboxymethyl cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose), gelatin. , Water-soluble starch, polyacrylic acid (eg carbomer), polymethacrylic acid, polyvinyl alcohol, polyethylene glycol, polyvinylpyrrolidone, polycarbophil, ascorbic acid palmitate, and the like, hydroxypropyl methylcellulose, polyacrylic acid, alginate. , Gelatin, carboxymethylcellulose, polyvinylpyrrolidone, polyethylene glycol and the like are preferable. Hydroxypropyl methylcellulose is particularly preferred. Examples of the stabilizer include cysteine, thiosorbitol, tartaric acid, citric acid, sodium carbonate, ascorbic acid, glycine, sodium sulfite and the like, and citric acid and ascorbic acid are particularly preferable.

Sublingual tablets, buccal or buccal disintegrants are
It can be produced by mixing the compound of the present invention or the concomitant drug and an excipient by a method known per se.
Furthermore, if desired, the above-mentioned lubricant, isotonicity agent, hydrophilic carrier, water-dispersible polymer, stabilizer, colorant, sweetener,
You may mix auxiliary agents, such as a preservative. Sublingual tablets, buccal tablets, or rapidly disintegrating buccal tablets can be obtained by mixing the above components at the same time or with a time lag and compression molding. In order to obtain an appropriate hardness, it may be produced by moistening / wetting with a solvent such as water or alcohol as needed before and after the tableting process, followed by molding and drying. When forming into a mucous membrane-attached tablet (film), the compound of the present invention or the concomitant drug and the above-mentioned water-dispersible polymer (preferably hydroxypropylcellulose, hydroxypropylmethylcellulose), excipient, etc. are dissolved in a solvent such as water. And cast the resulting solution (cast)
The film. Further, additives such as a plasticizer, a stabilizer, an antioxidant, a preservative, a coloring agent, a buffer, a sweetener and the like may be added. Contains glycols such as polyethylene glycol and propylene glycol to give the film an appropriate elasticity, and bioadhesive polymers (eg, polycarbophil, carbopol) to enhance adhesion of the film to the mucosal lining of the oral cavity You may let me. Casting is performed by pouring the solution onto a non-adhesive surface and applying a uniform thickness (preferably 10 to 1000) with a coating tool such as a doctor blade.
This is accomplished by spreading it to the micron range) and then drying the solution to form a film. The film thus formed may be dried at room temperature or under heating and cut into a desired surface area.

As a preferable intraoral quick disintegrating agent, a solid form consisting of a reticulated body of the compound of the present invention or the concomitant drug and a water-soluble or water-diffusible carrier which is inactive with the compound of the present invention or the concomitant drug Examples include rapid diffusion administration agents. The reticulate body is obtained by sublimating a solvent from the solid composition composed of a solution of the compound of the present invention or a concomitant drug in a suitable solvent. It is preferable that, in addition to the compound of the present invention or the concomitant drug, the composition of the quick disintegrating agent in the oral cavity contains a matrix forming agent and a secondary component. Examples of the matrix-forming agent include gelatins, dextrins, animal proteins such as soybeans, wheat and psyllium seed proteins or vegetable proteins; gum substances such as gum arabic, guar gum, agar and xanthan; polysaccharides. Alginic acids; Carboxymethyl celluloses; Carrageenans; Dextranes; Pectins; Synthetic polymers such as polyvinylpyrrolidone; Substances derived from gelatin-Arabic gum complex; Furthermore, sugars such as mannitol, dextrose, lactose, galactose and trehalose; cyclic sugars such as cyclodextrin; sodium phosphate;
Inorganic salts such as sodium chloride and aluminum silicate; glycine, L-alanine, L-aspartic acid,
It includes amino acids having 2 to 12 carbon atoms such as L-glutamic acid, L-hydrocycloproline, L-isoleucine, L-leucine and L-phenylalanine. One or more matrix forming agents may be introduced into the solution or suspension prior to solidification. Such a matrix forming agent may be present in addition to the surfactant, or the surfactant may be excluded. In addition to forming the matrix, the matrix-forming agent can help maintain the diffusional state of the compound of the present invention or the concomitant drug in its solution or suspension.

The composition may contain secondary components such as preservatives, antioxidants, surfactants, thickeners, colorants, pH adjusters, flavors, sweeteners or taste masking agents. Suitable colorants include red, black and yellow iron oxides and FD & Eberd & Eberard FD &
FD such as C Blue No. 2 and FD & C Red No. 40
& C dye. Suitable flavoring agents include mint, raspberry, licorice, orange, lemon, grapefruit, caramel, vanilla, terry and grape flavors and combinations thereof. Suitable pH
Modifiers include citric acid, tartaric acid, phosphoric acid, hydrochloric acid and maleic acid. Suitable sweeteners include aspartame, acesulfame K and thaumatin. Suitable taste-masking agents include sodium bicarbonate, ion exchange resins, cyclodextrin inclusion compounds, adsorbent materials and microencapsulated apomorphine. The formulation usually contains about 0.1 to about 50% by weight, preferably about 0.1 to about 30% by weight of the compound of the present invention or the concomitant drug, and the period of about 1 minute to about 60 minutes, preferably about 1 minute. Minutes to about 15 minutes, more preferably about 2 minutes to
A formulation capable of dissolving 90% or more of the compound of the present invention or a concomitant drug (in water) in about 5 minutes (above sublingual tablet, buccal, etc.) or 1 to 6 when placed in the oral cavity
An intraoral quick disintegrating agent which disintegrates within 0 seconds, preferably within 1 to 30 seconds, and more preferably within 1 to 10 seconds is preferable.

The content of the above-mentioned excipient in the whole preparation is
It is about 10 to about 99% by weight, preferably about 30 to about 90% by weight. The content of β-cyclodextrin or β-cyclodextrin derivative in the whole preparation is 0 to about 30.
% By weight. The content of the lubricant in the whole preparation is about 0.01 to about 10% by weight, preferably about 1 to about 5% by weight.
Is. The content of the isotonicity agent in the whole preparation is about 0.
1 to about 90% by weight, preferably about 10 to about 70% by weight
Is. The content of the hydrophilic carrier in the whole preparation is about 0.
1 to about 50% by weight, preferably about 10 to about 30% by weight. The content of the water-dispersible polymer in the whole preparation is
It is about 0.1 to about 30% by weight, preferably about 10 to about 25% by weight. The content of the stabilizer in the whole preparation is about 0.1 to about 10% by weight, preferably about 1 to about 5% by weight. The above-mentioned preparation may further contain additives such as a coloring agent, a sweetening agent and a preservative, if necessary.

The dose of the concomitant drug of the present invention is the compound (I)
Type, age, weight, symptom, dosage form, administration method, administration period, etc.
(Body weight: about 60 kg) Usually, as a compound of the present invention and a concomitant drug, about 0.01 to about 10 each per day.
00 mg / kg, preferably about 0.01 to about 100 mg / kg,
More preferably about 0.1 to about 100 mg / kg, especially about 0.1 to about 50 mg / kg, especially about 1.5 to
About 30 mg / kg is intravenously administered once a day or divided into several times. Of course, since the dose varies depending on various conditions as described above, a dose smaller than the above dose may be sufficient in some cases, or a dose exceeding the range may be required in some cases.
It is possible to set any amount of the concomitant drug as long as side effects do not pose a problem. The daily dose as a concomitant drug depends on the degree of symptoms, age of the subject, sex, body weight,
Sensitivity difference, timing of administration, interval, properties of pharmaceutical preparation, preparation,
It depends on the type, the type of active ingredient, etc., and is not particularly limited, but the amount of the drug is usually about 0.001 to 2000 mg per kg body weight of the mammal by oral administration,
The amount is preferably about 0.01 to 500 mg, more preferably about 0.1 to 100 mg, and this is usually administered in 1 to 4 divided doses per day.

When administering the pharmaceutical agent of the present invention, it may be administered at the same time, but the compound of the present invention may be administered after the concomitant drug is administered first, or the compound of the present invention may be administered first. It is also possible to administer the concomitant drug after that. When administered at a time lag, the time lag varies depending on the active ingredient to be administered, the dosage form, and the administration method. For example, when the concomitant drug is administered first, within 1 minute to 3 days after the administration of the concomitant drug,
Preferably 10 minutes to within 1 day, more preferably 15 minutes to
Methods include administering the compounds of the invention within 1 hour. When the compound of the present invention is administered first, the compound of the present invention is administered within 1 minute to 1 day, preferably 10 minutes to
A method of administering the concomitant drug within 6 hours, more preferably within 15 minutes to 1 hour, can be mentioned. As a preferable administration method, for example, about 0.001 to 200 mg / kg of a concomitant drug formed into an orally administered preparation is orally administered, and about 15
The compound of the present invention, which is formed into an orally administered formulation after a minute, is about 0.1
Oral administration of 005 to 100 mg / kg as a daily dose.

[0174]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be further described in detail by the following Reference Examples and Examples, which are merely examples and do not limit the present invention and the scope of the present invention. You may change within the range which does not deviate.
"Room temperature" in the following reference examples is usually about 10 ° C to about 35 ° C.
Indicates ° C. "%" Indicates percent by weight unless otherwise specified. However, the yield shows mol / mol%. Abbreviations used in other texts have the following meanings. s: singlet d: doublet t: triplet q: quartet dd: double doublet ddd: double double double
t) dt: double triplet br: broad J: coupling constant Hz: Hertz CDCl ₃ : deuterated chloroform ¹ H-NMR: proton nuclear magnetic resonance Me: methyl

[0175]

EXAMPLES Reference Example A1 A solution of 1- (4-methoxyphenyl) -2- (3-pyridyl) ethanonediisopropylamine (33.2 mL) in anhydrous tetrahydrofuran (300 mL) was cooled to −78 ° C. with stirring.
A 1.6 M n-butyllithium hexane solution (148 mL) was added dropwise. After the dropping, stir at the same temperature for 10 minutes, and then β-
Picoline (20 g) was added dropwise. After raising the temperature to -10 to 0 ° C and stirring for 20 minutes, ethyl p-anisate (19.4
A solution of g) in anhydrous tetrahydrofuran (40 mL) was added dropwise.
After completion of dropping, the mixture was stirred at room temperature for 1 hour, and water (100 mL) was added. The organic solvent was distilled off under reduced pressure, and the oily product was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off.
The remaining crude crystals were recrystallized from ethyl acetate-isopropyl ether to give the title compound (20.8 g, yield 85%). Melting point 71-72 ° C. Reference Example A2 According to the above Reference Example A1, instead of ethyl p-anisate,
Ethyl benzoate, 3,4-dimethoxyethyl benzoate, 3,4,
Ethyl 5-trimethoxybenzoate, 4- (methoxymethoxy)
Ethyl benzoate, ethyl 4-fluorobenzoate, ethyl 4-ethylbenzoate, ethyl 3,4-methylenedioxybenzoate, methyl 5-indanylcarboxylate, 5,6,7,8-tetrahydro-2-naphthoate The following Reference Example A compounds 2-1 to 2-11 were synthesized using methyl acid salt, methyl 1,4-benzodioxane-6-carboxylate, and methyl 2-naphthoate, respectively. Reference Example A compound 2-1: 1-phenyl-2- (3-pyridyl) ethanone, melting point 44.5-45.5 ° C. Reference Example A compound 2-2: 1- (3,4-dimethoxyphenyl) -2
-(3-Pyridyl) ethanone melting point 114-115 ° C. Reference Example A Compound 2-3: 2- (3-pyridyl) -1- (3,4,5-trimethoxyphenyl) ethanone Melting point 104-105 ° C. Reference Example A compound 2-4: 1- (4-methoxymethoxyphenyl) -2- (3-pyridyl) ethanone, melting point 43-44 ° C. Reference Example A compound 2-5: 1- (4-fluorophenyl) -2- (3-
Pyridyl) ethanone oil. Reference Example A compound 2-6: 1- (4-ethylphenyl) -2- (3-pyridyl) ethanone, melting point 80-81 ° C. Reference Example A Compound 2-7: 1- (3,4-methylenedioxyphenyl) -2- (3-pyridyl) ethanone Melting point 98-99 ° C. Reference Example A compound 2-8: 1- (5-indanyl) -2- (3-pyridyl) ethanone, melting point 55-56 ° C. Reference Example A Compound 2-9: 2- (3-pyridyl) -1- (5,6,7,8-tetrahydro-2-naphthyl) ethanone Melting point 65-66 ° C. Reference Example A Compound 2-10: 1- (1,4-benzodioxane-6-
Yl) -2- (3-pyridyl) ethanone melting point 89-90 ° C. Reference Example A compound 2-11: 1- (2-naphthyl) -2- (3-pyridyl) ethanone, melting point 69-70 ° C. Reference Example A3 According to the above Reference Example A2, the following Reference Example A compounds 3-1 to 3-3 were synthesized by using α-picoline, γ-picoline and 3,5-lutidine in place of β-picoline. . Reference Example A compound 3-1: 1-phenyl-2- (2-pyridyl) ethanone, melting point 59-60 ° C. Reference Example A compound 3-2: 1- (4-methoxyphenyl) -2- (2-
Pyridyl) ethanone Melting point 77-78 ° C. Reference Example A compound 3-3: 1-phenyl-2- (4-pyridyl) ethanone, melting point 109-110 ° C. Reference Example A4 1- (4-Methoxyphenyl) -2- (4-pyridyl) ethanone Diisopropylamine (33.2 mL) in anhydrous tetrahydrofuran (300 mL) was cooled to -78 ° C with stirring.
A 1.6 M n-butyllithium hexane solution (148 mL) was added dropwise. After the dropping, stir at the same temperature for 10 minutes, and then γ-
Picoline (20 g) was added dropwise. After raising the temperature to -10 to 0 ° C and stirring for 20 minutes, ethyl p-anisate (19.4
A solution of g) in anhydrous tetrahydrofuran (40 mL) was added dropwise.
After completion of dropping, the mixture was stirred at room temperature for 1 hour, and water (100 mL) was added. The organic solvent was distilled off under reduced pressure, and the oily product was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off.
The remaining crude crystals were recrystallized from ethyl acetate-isopropyl ether to give the title compound (16.2 g, yield 66%). Melting point 103-104 ° C. Reference Example A5 A solution of 2- (5-methyl-3-pyridyl) -1-phenylethanonediisopropylamine (20.2 mL) in anhydrous tetrahydrofuran (180 mL) was cooled to −78 ° C. with stirring.
A 1.6 M n-butyllithium hexane solution (90 mL) was added dropwise. After the dropping, stir for 10 minutes at the same temperature, then
5-lutidine (14 g) was added dropwise. After raising the temperature to -10 to 0 ° C and stirring for 20 minutes, ethyl benzoate (9.8
A solution of g) in anhydrous tetrahydrofuran (20 mL) was added dropwise.
After completion of dropping, the mixture was stirred at room temperature for 1 hour, and water (100 mL) was added. The organic solvent was distilled off under reduced pressure, and the oily product was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off.
The remaining crude crystals were recrystallized from ethyl acetate-isopropyl ether to give the title compound (10 g, yield 70%). Melting point 53-54 ° C.

Reference Example A6 2-Bromo-1- (4-methoxyphenyl) -2- (3-pyridyl) ethanone hydrobromide 1- (4-methoxyphenyl) -2- (3-pyridyl) ethanone ( 6.9
g) in acetic acid (36 mL), add bromine (1.7 mL) and
Stir at 3 ° C. for 3 hours. The reaction solution was cooled with ice water, and the precipitated crude crystals were collected by filtration. The crude crystals were recrystallized from ethanol-ethyl ether to give the title compound (10 g, yield 89%). Melting point 188-195 ° C. Reference Example A7 According to the above Reference Example A6, 1- (4-methoxyphenyl) -2- (3-
Instead of (pyridyl) ethanone, 1-phenyl-2- (3-pyridyl) ethanone, 1- (3,4-dimethoxyphenyl) -2- (3-pyridyl) ethanone, 2- (3-pyridyl) -1- (3,4,5-trimethoxyphenyl) ethanone, 1- (4-methoxymethoxyphenyl) -2- (3-pyridyl) ethanone, 1- (4-fluorophenyl) -2- (3-pyridyl) ethanone, 1-phenyl-2- (2-pyridyl) ethanone, 1- (4-methoxyphenyl) -2- (2-pyridyl)
Ethanone, 1-phenyl-2- (4-pyridyl) ethanone, 1- (4-
Methoxyphenyl) -2- (4-pyridyl) ethanone, 2- (5-methyl-3-pyridyl) -1-phenylethanone, 1- (4-ethylphenyl) -2- (3-pyridyl) ethanone, 1 -(3,4-Methylenedioxyphenyl) -2- (3-pyridyl) ethanone, 1- (5-indanyl) -2- (3-pyridyl) ethanone, 2- (3-pyridyl) -1-
(5,6,7,8-Tetrahydro-2-naphthyl) ethanone, 1- (1,4-
Benzodioxan-6-yl) -2- (3-pyridyl) ethanone, 1
-(2-naphthyl) -2- (3-pyridyl) ethanone and 1- (4-methoxyphenyl) -2- (2-pyridyl) ethanone, respectively, were used to prepare the following Reference Example A compounds 7-1 to 7- 17 was synthesized. Reference Example A Compound 7-1: 2-Bromo-1-phenyl-2- (3-pyridyl) ethanone hydrobromide, melting point 208-215 ° C. Reference Example A Compound 7-2: 2-bromo-1- (3,4-dimethoxyphenyl) -2- (3-pyridyl) ethanone hydrobromide Melting point
191-193 ° C. Reference Example A Compound 7-3: 2-Bromo-2- (3-pyridyl) -1-
(3,4,5-Trimethoxyphenyl) ethanone hydrobromide
Melting point 184-186 ° C. Reference Example A Compound 7-4: 2-Bromo-1- (4-hydroxyphenyl) -2- (3-pyridyl) ethanone hydrobromide Used in the next reaction without purification. Reference Example A Compound 7-5: 2-Bromo-1- (4-fluorophenyl) -2- (3-pyridyl) ethanone hydrobromide Melting point 189-
191 ° C. Reference Example A compound 7-6: 2-bromo-1-phenyl-2- (2-pyridyl) ethanone hydrobromide, melting point 180-181 ° C. Reference Example A compound 7-7: 2-bromo-1- (4-methoxyphenyl) -2- (2-pyridyl) ethanone hydrobromide, melting point 170-
171 ° C. Reference Example A compound 7-8: 2-bromo-1-phenyl-2- (4-pyridyl) ethanone hydrobromide, melting point 230-232 ° C. Reference Example A Compound 7-9: 2-Bromo-1- (4-methoxyphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 207-
209 ℃. Reference Example A Compound 7-10: 2-Bromo-2- (5-methyl-3-pyridyl) -1-phenylethanone hydrobromide Melting point 189-
193 ° C. Reference Example A Compound 7-11: 2-Bromo-1- (4-ethylphenyl) -2- (3-pyridyl) ethanone hydrobromide Melting point 145-
146 ° C. Reference Example A compound 7-12: 2-bromo-1- (3,4-methylenedioxyphenyl) -2- (3-pyridyl) ethanone hydrobromide, melting point 174-175 ° C. Reference Example A Compound 7-13: 2-Bromo-1- (5-indanyl)-
2- (3-pyridyl) ethanone hydrobromide Melting point 177-178
° C. Reference Example A compound 7-14: 2-bromo-2- (3-pyridyl) -1-
(5,6,7,8-Tetrahydro-2-naphthyl) ethanone hydrobromide, melting point 160-162 ° C. Reference Example A Compound 7-15: 1- (1,4-benzodioxane-6-
Yl) -2-bromo-2- (3-pyridyl) ethanone hydrobromide oil. Reference Example A compound 7-16: 2-bromo-1- (2-naphthyl) -2-
(3-Pyridyl) ethanone hydrobromide Melting point 197-199
° C. Reference Example A Compound 7-17: 2-Bromo-1- (4-methoxyphenyl) -2- (2-pyridyl) ethanone hydrobromide Melting point 17
0-171 ° C. Reference Example A8 [4- (4-Methoxyphenyl) -5- (3-pyridyl) -1,3-thiazol-2-yl] amine Thiourea (0.52 g) in acetonitrile (40 mL) suspension was treated with 2- Bromo-1- (4-methoxyphenyl)
-2- (3-pyridyl) ethanone hydrobromide (2.5 g) was added,
Triethylamine (0.95 mL) was slowly added dropwise with stirring. After the completion of dropping, the mixture was stirred at reflux temperature for 3 hours, allowed to cool, and the precipitated crystals were collected by filtration. The crystals are washed with saturated aqueous sodium hydrogen carbonate, water, ethanol and ethyl ether in this order,
Dried. The obtained crude crystals were recrystallized from tetrahydrofuran to give the title compound (1.5 g, yield 90%). Melting point 265-266 ° C.

Reference Example A9 N-methyl [4- (4-methoxyphenyl) -5- (3-pyridyl) -1,3
-Thiazol-2-yl] amine N-methylthiourea (0.24 g) in acetonitrile (18 mL)
2-Bromo-1- (4-methoxyphenyl) -2- (3-pyridyl) ethanone hydrobromide (1.0 g) was added to the suspension, and triethylamine (0.4 mL) was slowly added dropwise while stirring.
After the completion of dropping, the mixture was stirred at reflux temperature for 3 hours, and the solvent was distilled off. Saturated aqueous sodium hydrogencarbonate was added to the residue and the mixture was extracted with ethyl acetate. The extract was washed with water and dried, and the solvent was evaporated.
The remaining crude crystals were recrystallized from ethyl acetate-isopropyl ether to give the title compound (0.65 g, yield 85%). Melting point 158-159 [deg.] C. Reference Example A10 N- [4- (4-methoxyphenyl) -5- (3-pyridyl) -1,3-thiazol-2-yl] acetamide [(4-methoxyphenyl) -5- (3- Pyridyl)-
Using 1,3-thiazol-2-yl] amine, reference example A below
The title compound was obtained in the same manner as in 23-128. yield
82%. Melting point 208-210 ° C. Reference Example A11 2- (4-Acetylpiperazin-1-yl) -4- (4-methoxyphenyl) -5- (3-pyridyl) -1,3-thiazole 1-piperazinecarbothioamide (0.39 g) in acetonitrile ( 15 mL) solution, 2-bromo-1- (4-methoxyphenyl) -2
-Suspending (3-pyridyl) ethanone hydrobromide (1.0 g),
Triethylamine (0.4 mL) was slowly added dropwise with stirring. After the completion of dropping, the mixture was stirred at reflux temperature for 3 hours, and the solvent was distilled off. Saturated sodium hydrogen carbonate water is added to the residue,
The mixture was extracted with ethyl acetate, the extract was washed with water, dried and the solvent was distilled off. The residue was dissolved in pyridine (2 mL), ice-cooled, acetyl chloride (0.3 mL) was added, and the mixture was left at room temperature for 1 hr. The reaction solution was poured into ice water, and the product was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off. The residue was purified by silica gel column chromatography (ethyl acetate-methanol = 9: 1) to obtain 0.30 g of the title compound (yield 28%). Oil. Reference Example A12 [4- (4-methoxyphenyl) -5- (3-pyridyl) -1,3-thiazol-2-yl] amine hydrochloride [4- (4-methoxyphenyl) -5- (3-pyridyl ) -1,3-Thiazol-2-yl] amine (200 mg) was added to 1% hydrochloric acid methanol (3.2
mL) and the solvent was distilled off. The obtained crude crystals were recrystallized from methanol-ethyl acetate to give the title compound (180 mg)
(Yield 80%) was obtained. Melting point 145-150 ° C.

The chemical structural formulas of the compounds obtained in Reference Examples A8 to 12 are shown in Table 1 below.

[Table 1]

Reference Example A13 Reference Example A Compounds 13-1 to 13-1 shown in Tables 2 to 7 below.
3-102 is referred to as Reference Examples A8 to 12, JP-A-61-105.
It was synthesized according to the method described in Japanese Patent Publication No. 80 and USP 4,612,321.

[Table 2]

[0180]

[Table 3]

[0181]

[Table 4]

[0182]

[Table 5]

[0183]

[Table 6]

[0184]

[Table 7] Reference Example A14 N- (4-chlorobenzoyl) propyleneimine Propyleneimine (12.3 mL) in tetrahydrofuran (160
(mL) solution was added to a 1N-sodium hydroxide aqueous solution. 4-Chlorobenzoyl chloride (25 g) was added dropwise to this mixture at 0 ° C. After completion of dropping, the mixture was further stirred for 30 minutes. The reaction mixture was extracted with ethyl acetate. The extract is dried, the solvent is distilled off,
24.9 g (yield 89%) of the title compound was obtained. Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.15
(1H, d, J = 2.9 Hz), 2.51-2.66 (2H, m), 7.39-7.47
(2H, m), 7.93-8.01 (2H, m).

Reference Example A15 According to Reference Example A14, instead of 4-chlorobenzoyl chloride, 3-chlorobenzoyl chloride, 2-chlorobenzoyl chloride, 2-methylbenzoyl chloride, 3-methylbenzoyl chloride, 4-methylbenzoyl chloride. , 2-
Methoxybenzoyl chloride, 3-methoxybenzoyl chloride, 4-ethylbenzoyl chloride, 4- (1-methylethyl) benzoyl chloride, 4- (1,1-dimethylethyl) benzoyl chloride, 4-propylbenzoyl chloride, 4-
Butylbenzoyl chloride, 4-hexylbenzoyl chloride, 4-trifluoromethoxybenzoyl chloride, 4-
Trifluoromethylbenzoyl chloride, 3,4-dimethoxybenzoyl chloride, 3,4-dimethylbenzoyl chloride, 3,5-dimethylbenzoyl chloride, 3,4-methylenedioxybenzoyl chloride, 2-naphthoyl chloride, 4-
Fluorobenzoyl chloride, 3-cyclopentyloxy
The following Reference Example A compounds 15-1 to 15-22 were synthesized using 4-methoxybenzoyl chloride, respectively. Reference Example A Compound 15-1: N- (3-chlorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.1 Hz), 2.17
(1H, d, J = 3.3 Hz), 2.53-2.68 (2H, m), 7.40 (1H, d
d, J = 8.1, 7.7 Hz), 7.53 (1H, ddd, J = 8.1, 2.2, 1.
5 Hz), 7.90 (1H, dt, J = 7.7, 1.5 Hz), 8.00 (1H, d
d, J = 2.2, 1.5 Hz). Reference Example A compound 15-2: N- (2-chlorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.30 (3H, d, J = 5.1 Hz), 2.12
(1H, d, J = 3.3 Hz), 2.53 (1H, d, J = 5.5 Hz), 2.56-
2.68 (1H, m), 7.28-7.48 (3H, m), 7.75-7.81 (1H,
m). Reference Example A compound 15-3: N- (2-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.30 (3H, d, J = 5.5 Hz), 2.08
(1H, d, J = 3.3 Hz), 2.43-2.57 (5H, m), 7.20-7.31
(2H, m), 7.33-7.43 (1H, m), 7.89 (1H, d, J = 7.7 H
z). Reference Example A compound 15-4: N- (3-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.14
(1H, d, J = 3.3 Hz), 2.41 (3H, s), 2.51-2.66 (2H,
m), 7.32-7.39 (2H, m), 7.79-7.87 (2H, m). Reference Example A compound 15-5: N- (4-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.12
(1H, d, J = 2.9 Hz), 2.42 (3H, s), 2.50-2.62 (2H,
m), 7.25 (2H, d, J = 8.1 Hz), 7.92 (2H, d, J = 8.1 H
z). Reference Example A Compound 15-6: N- (2-methoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.30 (3H, d, J = 5.5 Hz), 2.10
(1H, d, J = 3.3 Hz), 2.50 (1H, d, J = 5.9Hz), 2.53-
2.65 (1H, m), 3.90 (3H, s), 6.95-7.05 (2H, m), 7.4
1-7.52 (1H, m), 7.81-7.88 (1H, m). Reference Example A Compound 15-7: N- (3-methoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.9 Hz), 2.14
(1H, d, J = 2.9 Hz), 2.52-2.65 (2H, m), 3.86 (3H,
s), 7.10 (1H, ddd, J = 8.4, 2.6, 1.1 Hz), 7.37 (1H,
dd, J = 8.4, 7.3 Hz), 7.55 (1H, dd, J = 2.6, 1.5 H
z), 7.63 (1H, ddd, J = 7.3, 1.5, 1.1 Hz). Reference Example A compound 15-8: N- (4-ethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.27 (3H, t, J = 7.6 Hz), 1.39
(3H, d, J = 5.5 Hz), 2.13 (1H, d, J = 3.3 Hz), 2.50-
2.61 (2H, m), 2.71 (2H, q, J = 7.6 Hz), 7.28 (2H, d,
J = 7.7 Hz), 7.95 (2H, d, J = 7.7 Hz). Reference Example A compound 15-9: N- [4- (1-methylethyl) benzoyl] propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.28 (6H, d, J = 7.0 Hz), 1.40
(3H, d, J = 5.5 Hz), 2.13 (1H, d, J = 3.3 Hz), 2.50-
2.64 (2H, m), 2.90-3.05 (1H, m), 7.31 (2H, d, J =
8.2 Hz), 7.96 (2H, d, J = 8.2 Hz). Reference Example A compound 15-10: N- [4- (1,1-dimethylethyl) benzoyl] propyleneimine Propyleneimine (11 mL, 0.14 mol) Tetrahydrofuran solution (160 mL) in 2N-sodium hydroxide aqueous solution (70 mL)
Added to. 4- (1,1-dimethylethyl) was added to this mixture at 0 ° C.
Benzoyl chloride (25 g, 0.13 mol) was added dropwise. After completion of dropping, the mixture was further stirred for 30 minutes. The reaction mixture was extracted with ethyl acetate. The extract was dried and the solvent was distilled off to give the title compound.
27 g (0.13 mol, 99% yield) was obtained. Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.35 (9H, s), 1.41 (3H, d, J = 5.
5 Hz), 2.12 (1H, d, J = 2.9 Hz), 2.51-2.64 (2H, m),
7.47 (2H, d, J = 8.8 Hz), 7.96 (2H, d, J = 8.8 Hz). Reference Example A compound 15-11: N- (4-propylbenzoyl)
Propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 0.96 (3H, t, J = 7.3 Hz), 1.39
(3H, d, J = 5.5 Hz), 1.57-1.75 (2H, m), 2.12 (1H,
d, J = 3.3 Hz), 2.50-2.59 (2H, m), 2.65 (2H, t, J =
7.7 Hz), 7.26 (2H, d, J = 8.1 Hz), 7.94 (2H, d, J =
8.1 Hz). Reference Example A compound 15-12: N- (4-butylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 0.94 (3H, t, J = 7.1 Hz), 1.26-
1.47 (5H, m), 1.54-1.73 (2H, m), 2.12 (1H, d, J =
2.9 Hz), 2.51-2.62 (2H, m), 2.67 (2H, t, J = 7.7 H
z), 7.26 (2H, d, J = 8.1 Hz), 7.94 (2H, d, J = 8.1 H
z). Reference Example A compound 15-13: N- (4-hexylbenzoyl)
Propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 0.89 (3H, t, J = 6.6 Hz), 1.24-
1.38 (6H, m), 1.39 (3H, d, J = 5.5 Hz), 1.56-1.68
(2H, m), 2.12 (1H, d, J = 3.3 Hz), 2.51-2.61 (2H,
m), 2.66 (2H, t, J = 7.7 Hz), 7.26 (2H, d, J = 8.1 H
z), 7.94 (2H, d, J = 8.1 Hz). Reference Example A compound 15-14: N- (4-trifluoromethoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.5 Hz), 2.16
(1H, d, J = 3.3 Hz), 2.53-2.68 (2H, m), 7.29 (2H,
d, J = 9.0 Hz), 8.08 (2H, d, J = 9.0 Hz). Reference Example A compound 15-15: N- (4-trifluoromethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.5 Hz), 2.19
(1H, d, J = 3.7 Hz), 2.54-2.70 (2H, m), 7.73 (2H,
d, J = 8.0 Hz), 8.13 (2H, d, J = 8.0 Hz). Reference Example A compound 15-16: N- (3,4-dimethoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.41 (3H, d, J = 5.5 Hz), 2.12
(1H, d, J = 3.3 Hz), 2.51-2.63 (2H, m), 3.94 (3H,
s), 3.95 (3H, s), 6.92 (1H, d, J = 8.5 Hz), 7.56 (1
H, d, J = 2.2 Hz), 7.69 (1H, dd, J = 8.5, 2.2 Hz). Reference Example A compound 15-17: N- (3,4-dimethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.12
(1H, d, J = 3.3 Hz), 2.32 (6H, s), 2.49-2.61 (2H,
m), 7.21 (1H, d, J = 7.7 Hz), 7.77 (1H, dd, J = 7.7,
1.8 Hz), 7.80 (1H, d, J = 1.8 Hz). Reference Example A compound 15-18: N- (3,5-dimethylbenzoyl) propyleneimine 3,5-dimethylbenzoic acid (25 g, 0.17 mol) And dimethylformamide (0.1 mL) were added to thionyl chloride (50 mL) at 0 ° C. The mixture was heated to reflux for 2 hours. Excess thionyl chloride was distilled off under reduced pressure, and toluene (50 mL) was added to the residue. Toluene was distilled off under reduced pressure to obtain oily 3,5-dimethylbenzoyl chloride. Propyleneimine (14 mL, 0.
A solution of 18 mol) in tetrahydrofuran (160 mL) was added to a 1N-sodium hydroxide aqueous solution (180 mL). 0 ° C for this mixture
At this time, 3,5-dimethylbenzoyl chloride was added dropwise. After completion of dropping, the mixture was further stirred for 30 minutes. The reaction mixture was extracted with ethyl acetate. The extract was dried and the solvent was evaporated to give the title compound 3
1 g (0.16 mol, yield 99%) was obtained. Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.13 (1
H, d, J = 3.7 Hz), 2.37 (6H, s), 2.47-2.62 (2H, m),
7.19 (1H, s), 7.64 (2H, s). Reference Example A Compound 15-19: N- (3,4-methylenedioxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.38 (3H, d, J = 4.9 Hz), 2.11
(1H, d, J = 3.1 Hz), 2.48-2.64 (2H, m), 6.05 (2H,
s), 6.86 (1H, d, J = 8.2 Hz), 7.48 (1H, d, J = 1.7 H
z), 7.65 (1H, dd, J = 8.2, 1.7 Hz). Reference Example A compound 15-20: N- (2-naphthoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.44 (3H, d, J = 5.5 Hz), 2.22
(1H, d, J = 3.3 Hz), 2.57-2.84 (2H, m), 7.50-7.65
(2H, m), 7.85-8.00 (3H, m), 8.06 (1H, dd, J = 8.6,
1.5 Hz), 8.59 (1H, s). Reference Example A compound 15-21: N- (4-fluorobenzoyl)
Propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.2 Hz), 2.14-
2.15 (1H, m), 2.52-2.63 (2H, m), 7.08-7.19 (2H,
m), 8.00-8.10 (2H, m). Reference Example A Compound 15-22: N- (3-cyclopentyloxy-4-methoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.1 Hz), 1.54-
1.68 (2H, m), 1.73-2.06 (6H, m), 2.11 (1H, d, J =
3.3 Hz), 2.51-2.63 (2H, m), 3.91 (3H, s), 4.79-4.9
0 (1H, m), 6.90 (1H, d, J = 8.4 Hz), 7.55 (1H, d, J
= 1.8 Hz), 7.65 (1H, dd, J = 8.4, 1.8 Hz). Reference Example A16 1- (2-chlorophenyl) -2- (4-pyridyl) ethanone diisopropylamine (15 mL) in anhydrous tetrahydrofuran (100 mL) (mL) solution cooled to -50 ° C and stirred at 1.6 M
A n-butyllithium hexane solution (69 mL) was added dropwise. After completion of dropping, the mixture was stirred for 10 minutes, and then a solution of γ-picoline (20 g) in anhydrous tetrahydrofuran (10 mL) was added dropwise at -30 ° C. After stirring for 1 hour, N- (2-chlorobenzoyl) propyleneimine (20 g) in anhydrous tetrahydrofuran (10 mL)
The solution was added dropwise at -10 ° C. After completion of dropping, the mixture was stirred at room temperature for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1) to give the title compound (16 g, yield 71%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 4.28 (2H, s), 7.20 (2H, d, J =
6.2 Hz), 7.28-7.39 (1H, m), 7.41-7.48 (3H, m), 8.5
6 (2H, d, J = 6.2 Hz).

Reference Example A17 According to Reference Example A16, instead of N- (2-chlorobenzoyl) propyleneimine, N- (3-chlorobenzoyl) propyleneimine, N- (4-chlorobenzoyl) propyleneimine, N-
(2-Methylbenzoyl) propyleneimine, N- (3-methylbenzoyl) propyleneimine, N- (4-methylbenzoyl) propyleneimine, N- (2-methoxybenzoyl) propyleneimine, N- (3-methoxybenzoyl) Propyleneimine, N- (4-ethylbenzoyl) propyleneimine, N- [4
-(1-Methylethyl) benzoyl] propyleneimine, N- [4
-(1,1-dimethylethyl) benzoyl] propyleneimine,
N- (4-propylbenzoyl) propyleneimine, N- (4-butylbenzoyl) propyleneimine, N- (4-hexylbenzoyl) propyleneimine, N- (4-trifluoromethoxybenzoyl) propyleneimine, N- (4 -Trifluoromethylbenzoyl) propyleneimine, N- (3,4-dimethoxybenzoyl) propyleneimine, N- (3,4-dimethylbenzoyl) propyleneimine, N- (3,5-dimethylbenzoyl) propyleneimine, N- (3,4-methylenedioxybenzoyl)
The following Reference Example A compounds 17-1 to 17-21 were synthesized using propyleneimine, N- (2-naphthoyl) propyleneimine, and N- (3-cyclopentyloxy-4-methoxybenzoyl) propyleneimine, respectively. Reference Example A Compound 17-1: 1- (3-chlorophenyl) -2- (4-
Pyridyl) ethanone melting point 79-80 ° C. Reference Example A Compound 17-2: 1- (4-chlorophenyl) -2- (4-
Pyridyl) ethanone melting point 93-94 ° C. Reference Example A compound 17-3: 1- (2-methylphenyl) -2- (4-
Pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 2.48 (3H, s), 4.23 (2H, s), 7.
19 (2H, d, J = 6.2 Hz), 7.24-7.47 (3H, m), 7.73 (1H,
d, J = 7.7 Hz), 8.56 (2H, d, J = 6.2 Hz). Reference Example A compound 17-4: 1- (3-methylphenyl) -2- (4-
Pyridyl) ethanone melting point 115-116 ° C. Reference Example A Compound 17-5: 1- (4-methylphenyl) -2- (4-
Pyridyl) ethanone melting point 110-111 ° C. Reference Example A compound 17-6: 1- (2-methoxyphenyl) -2-
(4-pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 3.92 (3H, s), 4.30 (2H, s), 6.
95-7.07 (2H, m), 7.17 (2H, d, J = 5.9 Hz), 7.50 (1H,
ddd, J = 8.4, 7.3, 1.8 Hz), 7.73 (1H, dd, J = 7.7,
1.8 Hz), 8.53 (2H, d, J = 5.9 Hz). Reference Example A compound 17-7: 1- (3-methoxyphenyl) -2-
(4-pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 3.86 (3H, s), 4.28 (2H, s), 7.
14 (1H, ddd, J = 8.1, 2.6, 1.1 Hz), 7.20 (2H, d, J =
6.2 Hz), 7.36 (1H, dd, J = 8.1, 7.7 Hz), 7.51 (1
H, dd, J = 2.6, 1.5 Hz), 7.58 (1H, ddd, J = 7.7, 1.
5, 1.1 Hz), 8.57 (2H, d, J = 6.2 Hz). Reference Example A compound 17-8: 1- (4-ethylphenyl) -2- (4-
Pyridyl) ethanone melting point 87-89 ° C. Reference Example A Compound 17-9: 1- [4- (1-methylethyl) phenyl] -2- (4-pyridyl) ethanone Melting point 86-88 ° C. Reference Example A Compound 17-10: 1- [4- (1,1-dimethylethyl) phenyl] -2- (4-pyridyl) ethanone diisopropylamine (15 mL, 0.11 mol) in anhydrous tetrahydrofuran (100 mL) Cooled to -50 ° C and stirred with 1.6 M n-butyllithium hexane solution (69 mL, 0.
11 mol) was added dropwise. After completion of dropping, the mixture was stirred for 10 minutes, and then a solution of γ-picoline (9.3 g, 0.10 mol) in anhydrous tetrahydrofuran (10 mL) was added dropwise at -30 ° C. After stirring for 1 hour, N- [4- (1,1-dimethylethyl) benzoyl] propyleneimine (22 g, 0.10 mol) in anhydrous tetrahydrofuran (10 m
L) solution was added dropwise at -30 ° C. After the dropping was completed, the temperature was gradually raised to room temperature and the mixture was stirred for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. After washing the extract with water and drying,
The solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate, 1: 1) and recrystallized from diisopropyl ether-hexane to give the title compound 11
g (yield 43%) was obtained. Melting point 75-76 ° C. Reference Example A compound 17-11: 1- (4-propylphenyl) -2
-(4-Pyridyl) ethanone melting point 71-72 ° C. Reference Example A compound 17-12: 1- (4-butylphenyl) -2-
(4-Pyridyl) ethanone Melting point 41-43 ° C. Reference Example A Compound 17-13: 1- (4-hexylphenyl) -2
-(4-pyridyl) ethanone melting point 57-58 ° C. Reference Example A Compound 17-14: 2- (4-pyridyl) -1- (4-trifluoromethoxyphenyl) ethanone Melting point 65-66 ° C. Reference Example A Compound 17-15: 2- (4-pyridyl) -1- (4-trifluoromethylphenyl) ethanone Melting point 94-95 ° C. Reference Example A compound 17-16: 1- (3,4-dimethoxyphenyl) -2- (4-pyridyl) ethanone melting point 110-111 ° C. Reference Example A Compound 17-17: 1- (3,4-dimethylphenyl)
-2- (4-pyridyl) ethanone melting point 81-83 ° C. Reference Example A Compound 17-18 1- (3,5-Dimethylphenyl) -2- (4-pyridyl) ethanone Diisopropylamine (15 mL, 0.11 mol) in anhydrous tetrahydrofuran (100 mL) was cooled to -50 ° C. And stir with stirring to obtain a 1.6 M n-butyllithium hexane solution (69 mL, 0.1
1 mol) was added dropwise. After completion of dropping, the mixture was stirred for 10 minutes, and then a solution of γ-picoline (9.3 g, 0.10 mol) in anhydrous tetrahydrofuran (10 mL) was added dropwise at -30 ° C. After stirring for 1 hour, N- (3,5-dimethylbenzoyl) propyleneimine (19
g, 0.10 mol) in anhydrous tetrahydrofuran (10 mL)-
It was added dropwise at 30 ° C. After the dropping is completed, gradually raise the temperature to room temperature, and
Stir for hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off. The residue was crystallized from diisopropyl ether-hexane to give the title compound (13 g, yield 58%). Melting point 90-91 ° C. Reference Example A Compound 17-19: 1- (3,4-methylenedioxyphenyl) -2- (4-pyridyl) ethanone Melting point 126-127 ° C. Reference Example A Compound 17-20: 1- (2-naphthyl) -2- (4-pyridyl) ethanone Melting point 114-115 ° C. Reference Example A Compound 17-21: 1- (3-Cyclopentyloxy-4-methoxyphenyl) -2- (4-pyridyl) ethanone Melting point 87-89 ° C.

Reference Example A18 According to Reference Example A17, using β-picoline instead of γ-picoline, the following Reference Example A compounds 18-1 to 18-9
Was synthesized. Reference Example A Compound 18-1: 1- (2-chlorophenyl) -2- (3-
Pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 4.28 (2H, s), 7.18-7.49 (5H,
m), 7.59-7.67 (1H, m), 8.47-8.56 (2H, m). Reference Example A compound 18-2: 1- (3-chlorophenyl) -2- (3-
Pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 4.29 (2H, s), 7.25-7.34 (1H,
m), 7.44 (1H, t, J = 7.7Hz), 7.54-7.63 (2H, m), 7.9
0 (1H, dt, J = 7.7, 1.5 Hz), 8.00 (1H, dd, J = 1.8,
1.5 Hz), 8.49-8.57 (2H, m). Reference Example A compound 18-3: 1- (4-chlorophenyl) -2- (3-
Pyridyl) ethanone ¹ H-NMR (CDCl ₃ ) δ: 4.27 (2H, s), 7.24-7.31 (1H,
m), 7.47 (2H, d, J = 8.8Hz), 7.55-7.63 (1H, m), 7.9
6 (2H, d, J = 8.8 Hz), 8.46-8.53 (2H, m). Reference Example A compound 18-4: 1- (2-methylphenyl) -2- (3-
Pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 2.47 (3H, s), 4.23 (2H, s), 7.
18-7.47 (5H, m), 7.73 (1H, d, J = 7.7 Hz), 8.47-8.56
(2H, m). Reference Example A compound 18-5: 1- (3-methylphenyl) -2- (3-
Pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 2.43 (3H, s), 4.29 (2H, s), 7.
17-7.36 (1H, m), 7.36-7.46 (2H, m), 7.58-7.65 (1H,
m), 7.78-7.86 (2H, m), 8.50-8.56 (2H, m). Reference Example A compound 18-6: 1- (4-methylphenyl) -2- (3-
Pyridyl) ethanone melting point 72-74 ° C. Reference Example A compound 18-7: 1- (3-methoxyphenyl) -2-
(3-pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 3.86 (3H, s), 4.29 (2H, s), 7.
14 (1H, ddd, J = 8.1, 2.6, 1.8 Hz), 7.28 (1H, dd, J
= 7.3, 4.8 Hz), 7.40 (1H, dd, J = 8.1, 7.7 Hz), 7.5
3 (1H, dd, J = 2.6, 1.8 Hz), 7.58-7.65 (2H, m), 8.5
0-8.55 (2H, m). Reference Example A compound 18-8: 1- [4- (1,1-dimethylethyl)
Phenyl] -2- (3-pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 1.34 (9H, s), 4.28 (2H, s), 7.
22-7.31 (1H, m), 7.50 (2H, d, J = 8.4 Hz), 7.56-7.65
(1H, m), 7.96 (2H, d, J = 8.4 Hz), 8.48-8.55 (2H,
m). Reference Example A compound 18-9: 1- (3,5-dimethylphenyl) -2
-(3-Pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 2.38 (6H, s), 4.27 (2
H, s), 7.24-7.30 (2H, m), 7.58-7.63 (3H, m), 8.50-
8.52 (2H, m). Reference Example A19 According to Reference Example A1, the following Reference Example A compound 19 was synthesized by using ethyl 4-dimethylaminobenzoate instead of ethyl p-anisate. Reference Example A compound 19: 1- (4-dimethylaminophenyl) -2
-(4-Pyridyl) ethanone melting point 189-192 ° C. Reference Example A20 1- (4-Fluorophenyl) -2- (4-pyridyl) ethanone Diisopropylamine (29 mL) in anhydrous tetrahydrofuran (300 mL) was cooled to -78 ° C with stirring.
A 1.6 M n-butyllithium hexane solution (140 mL) was added dropwise. After completion of dropping, the mixture was stirred for 10 minutes, and then a solution of γ-picoline (21 g) in anhydrous tetrahydrofuran (50 mL) was added. The reaction mixture was stirred at -10 ° C for 30 minutes. The reaction solution was cooled to −78 ° C., and a solution of N- (4-fluorobenzoyl) propyleneimine (36 g) in anhydrous tetrahydrofuran (50 mL) was added dropwise. After the dropping was completed, the mixture was stirred at room temperature for 3 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off. The title compound 2 was obtained by recrystallizing the residue from diisopropyl ether.
8 g (yield 66%) was obtained. Melting point 90-91 ° C.

Reference Example A21 4- (Methylthio) thiobenzamide 4-Methylthiobenzonitrile (12 g) was dissolved in a 4N hydrogen chloride solution in ethyl acetate (130 mL). O, O-diethyl dithiophosphate (15 mL) was added to this solution, and the mixture was stirred at room temperature for 22 hr. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. After filtering the insoluble matter, the filtrate was washed with saturated saline and dried, and then the solvent was distilled off. 10 g of the title compound was obtained by recrystallizing the residue from ethyl acetate.
(Yield 67%) was obtained. Melting point 176-178 ° C. Reference Example A22 According to Reference Example A6, instead of 1- (4-methoxyphenyl) -2- (3-pyridyl) ethanone, 1- (2-chlorophenyl) -2- (3
-Pyridyl) ethanone, 1- (3-chlorophenyl) -2- (3-pyridyl) ethanone, 1- (4-chlorophenyl) -2- (3-pyridyl)
Ethanone, 1- (2-methylphenyl) -2- (3-pyridyl) ethanone, 1- (3-methylphenyl) -2- (3-pyridyl) ethanone, 1- (4-methylphenyl) -2- ( 3-pyridyl) ethanone, 1
-(3-Methoxyphenyl) -2- (3-pyridyl) ethanone, 1- [4
-(1,1-Dimethylethyl) phenyl] -2- (3-pyridyl) ethanone, 1- (3,5-dimethylphenyl) -2- (3-pyridyl) ethanone, 1- (2-chlorophenyl) -2 -(4-pyridyl) ethanone, 1- (3-chlorophenyl) -2- (4-pyridyl) ethanone, 1
-(4-chlorophenyl) -2- (4-pyridyl) ethanone, 1- (2-
Methylphenyl) -2- (4-pyridyl) ethanone, 1- (3-methylphenyl) -2- (4-pyridyl) ethanone, 1- (4-methylphenyl) -2- (4-pyridyl) ethanone, 1 -(2-Methoxyphenyl) -2- (4-pyridyl) ethanone, 1- (3-methoxyphenyl) -2- (4-pyridyl) ethanone, 1- (4-ethylphenyl) -2
-(4-pyridyl) ethanone, 1- [4- (1-methylethyl) phenyl] -2- (4-pyridyl) ethanone, 1- [4- (1,1-dimethylethyl) phenyl] -2- ( 4-pyridyl) ethanone, 1- (4-propylphenyl) -2- (4-pyridyl) ethanone, 1- (4-butylphenyl) -2- (4-pyridyl) ethanone, 1- (4-hexylphenyl) -2- (4-pyridyl) ethanone, 2- (4-pyridyl) -1- (4-trifluoromethoxyphenyl) ethanone, 2- (4-pyridyl) -1- (4-trifluoromethylphenyl) ethanone, 1- (4
-Dimethylaminophenyl) -2- (4-pyridyl) ethanone hydrobromide, 1- (3,4-dimethoxyphenyl) -2- (4-pyridyl) ethanone, 1- (3,4-dimethylphenyl) -2- (4-pyridyl) ethanone, 1- (3,5-dimethylphenyl) -2- (4-pyridyl) ethanone, 1- (3,4-methylenedioxyphenyl) -2- (4
-Pyridyl) ethanone, 1- (2-naphthyl) -2- (4-pyridyl)
Ethanone, 1- (4-fluorophenyl) -2- (4-pyridyl) ethanone, 1- (3-cyclopentyloxy-4-methoxyphenyl) -2- (4-pyridyl) ethanone Example A Compounds 22-1 to 22-33 were synthesized. Reference Example A compound 22-1: 2-bromo-1- (2-chlorophenyl)-
2- (3-Pyridyl) ethanone hydrobromide melting point 88-90 ° C. Reference Example A Compound 22-2: 2-Bromo-1- (3-chlorophenyl) -2- (3-pyridyl) ethanone hydrobromide Melting point 164-166 ° C Reference Example A Compound 22-3: 2-Bromo- 1- (4-Chlorophenyl) -2- (3-pyridyl) ethanone hydrobromide It was used in the next reaction without purification. Reference Example A Compound 22-4: 2-Bromo-1- (2-methylphenyl) -2- (3-pyridyl) ethanone hydrobromide Used in the next reaction without purification. Reference Example A Compound 22-5: 2-Bromo-1- (3-methylphenyl) -2- (3-pyridyl) ethanone hydrobromide salt Used in the next reaction without purification. Reference Example A compound 22-6: 2-bromo-1- (4-methylphenyl) -2- (3-pyridyl) ethanone hydrobromide melting point 96-98 ° C. Reference Example A Compound 22-7: 2-Bromo-1- (3-methoxyphenyl) -2- (3-pyridyl) ethanone hydrobromide salt Used in the next reaction without purification. Reference Example A compound 22-8: 2-bromo-1- [4- (1,1-dimethylethyl) phenyl] -2- (3-pyridyl) ethanone hydrobromide melting point 190-194 ° C. Reference Example A Compound 22-9: 2-Bromo-1- (3,5-dimethylphenyl) -2- (3-pyridyl) ethanone hydrobromide Melting point 195-197 ° C. Reference Example A Compound 22-10: 2-Bromo-1- (2-chlorophenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 157-159 ° C. Reference Example A Compound 22-11: 2-Bromo-1- (3-chlorophenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 178-181 ° C. Reference Example A Compound 22-12: 2-Bromo-1- (4-chlorophenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 189-193 ° C. Reference Example A Compound 22-13: 2-Bromo-1- (2-methylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 183-186 ° C. Reference Example A Compound 22-14: 2-Bromo-1- (3-methylphenyl) -2- (4-pyridyl) ethanone hydrobromide salt Used in the next reaction without purification. Reference Example A Compound 22-15: 2-Bromo-1- (4-methylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 111-113 ° C. Reference Example A Compound 22-16: 2-Bromo-1- (2-methoxyphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 168-171 ° C. Reference Example A Compound 22-17: 2-Bromo-1- (3-methoxyphenyl) -2- (4-pyridyl) ethanone hydrobromide salt Used in the next reaction without purification. Reference Example A Compound 22-18: 2-Bromo-1- (4-ethylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 170-173 ° C. Reference Example A Compound 22-19: 2-Bromo-1- [4- (1-methylethyl) phenyl] -2- (4-pyridyl) ethanone hydrobromide Melting point 185-188 ° C. Reference Example A Compound 22-20: 2-Bromo-1- [4- (1,1-dimethylethyl) phenyl] -2- (4-pyridyl) ethanone hydrobromide 1- [4- (1,1 -Dimethylethyl) phenyl] -2- (4-pyridyl)
Dissolve ethanone (10 g, 39 mmol) in acetic acid (40 mL) and add bromine.
(2.0 mL, 39 mmol) was added, and the mixture was stirred at 80 ° C. for 3 hr. The reaction solution was cooled with ice water, and the precipitated crude crystals were collected by filtration. The crude crystals were washed with ethyl acetate to give the title compound (9.6 g, yield 81%).
Got Melting point 209-212 ° C. Reference Example A Compound 22-21: 2-Bromo-1- (4-propylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 167-170 ° C. Reference Example A Compound 22-22: 2-Bromo-1- (4-butylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 158-161 ° C. Reference Example A Compound 22-23: 2-Bromo-1- (4-hexylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 153-155 ° C. Reference Example A compound 22-24: 2-bromo-2- (4-pyridyl)-
1- (4-Trifluoromethoxyphenyl) ethanone hydrobromide was used for the next reaction without purification. Reference Example A Compound 22-25: 2-Bromo-2- (4-pyridyl)-
1- (4-trifluoromethylphenyl) ethanone hydrobromide melting point 190-194 ° C. Reference Example A compound 22-26: 2-bromo-1- (4-dimethylaminophenyl) -2- (4-pyridyl) ethanone dihydrobromide melting point 163-167 ° C. Reference Example A Compound 22-27: 2-Bromo-1- (3,4-dimethoxyphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 174-175 ° C. Reference Example A Compound 22-28: 2-Bromo-1- (3,4-dimethylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 196-199 ° C. Reference Example A compound 22-29: 2-bromo-1- (3,5-dimethylphenyl) -2- (4-pyridyl) ethanone hydrobromide 1- (3,5-dimethylphenyl) -2- ( 4-pyridyl) ethanone (7.
0 g, 31 mmol) in acetic acid (35 mL) and bromine (1.6 mL, 31 mmol).
mmol) was added and the mixture was stirred at 80 ° C for 3 hr. Ethyl acetate was added to the residue, and the precipitated crude crystals were collected by filtration. The crude crystals were washed with ethyl acetate to give the title compound (16 g, yield 96%). Melting point 216-219 ° C. Reference Example A compound 22-30: 2-bromo-1- (3,4-methylenedioxyphenyl) -2- (4-pyridyl) ethanone hydrobromide melting point 211-214 ° C. Reference Example A compound 22-31: 2-bromo-1- (2-naphthyl)-
2- (4-pyridyl) ethanone hydrobromide melting point 149-152 ° C. Reference Example A Compound 22-32: 2-Bromo-1- (4-fluorophenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 185-189 ° C. Reference Example A Compound 22-33: 2-Bromo-1- (3-cyclopentyloxy-4-methoxyphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 168-170 ° C.

Reference Example A23 Reference Example A compounds 23-1 to 23-1 described in Tables 8 to 31 below.
23-294 and 23-295-23-349, Reference Examples A8-12, JP-A-61-1580, and US
It was synthesized according to the method described in P 4,612,321.

[Table 8]

[0190]

[Table 9]

[0191]

[Table 10]

[0192]

[Table 11]

[0193]

[Table 12]

[0194]

[Table 13]

[0195]

[Table 14]

[0196]

[Table 15]

[0197]

[Table 16]

[0198]

[Table 17]

[0199]

[Table 18]

[0200]

[Table 19]

[0201]

[Table 20]

[0202]

[Table 21]

[0203]

[Table 22]

[0204]

[Table 23]

[0205]

[Table 24]

[0206]

[Table 25]

[0207]

[Table 26]

[0208]

[Table 27]

[0209]

[Table 28]

[0210]

[Table 29]

[0211]

[Table 30]

[0212]

[Table 31]

Reference Example A23-128 N- [4- (3,5-Dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] acetamide [4- (3,5-dimethyl) Phenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] amine (0.50 g, 1.78 mmol) and 4-dimethylaminopyridine (0.06 g, 0.51 mmol) in N, N-dimethylacetamide ( 5 mL) solution, add acetyl chloride (0.21
g, 2.67 mmol) was added and the mixture was stirred at 80 ° C. for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to give the title compound 0.17 g (yield 29%). Melting point 284-286 ° C. Reference Example A23-133 [4- (3,5-Dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] amine 2-bromo-1- (3,5-dimethylphenyl) -2- (4-pyridyl) ethanone hydrobromide (5.0 g, 13
mmol) and thiourea (1.0 g, 14 mmol) in acetonitrile
(60 mL) solution, triethylamine (1.9 ml, 14 mmo
l) was added dropwise, and the mixture was stirred at room temperature for 3 hours. The solvent was concentrated under reduced pressure, saturated aqueous sodium hydrogen carbonate solution was added to the residue, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, dried and the solvent was distilled off. The obtained crude crystals were recrystallized from ethyl acetate to obtain 2.0 g (7.2 mmol, yield 55%) of the title compound. Melting point 242-244 ° C. Reference Example A23-137 N- [4- [4- (1,1-Dimethylethyl) phenyl] -5- (4-pyridyl) -1,3-thiazol-2-yl] acetamide [4- [4- ( 1,1-Dimethylethyl) phenyl] -5- (4-pyridyl)
-1,3-Thiazol-2-yl] amine (0.40 g, 1.29 mmol)
And 4-dimethylaminopyridine (0.05 g, 0.39 mmol)
Acetyl chloride (0.15 g, 1.94 mmol) was added to the N, N-dimethylacetamide (4 mL) solution, and the mixture was stirred at 80 ° C. for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystal was recrystallized from ethanol to give the title compound.
0.23 g (yield 50%) was obtained. Melting point 280-281 ° C. Reference Example A23-143 [4- [4- (1,1-dimethylethyl) phenyl] -5- (4-pyridyl)
-1,3-thiazol-2-yl] amine 2-bromo-1- [4- (1,1-dimethylethyl) phenyl] -2- (4-
Pyridyl) ethanone hydrobromide (5.0 g, 12 mmol) and thiourea (0.95 g, 13 mmol) in acetonitrile (60 mL)
Triethylamine (1.8 ml, 13 mmol) was added dropwise to the solution, and the mixture was refluxed for 3 hours. The solvent was evaporated under reduced pressure, saturated aqueous sodium hydrogen carbonate solution was added to the residue, and the precipitated solid was collected by filtration. The obtained crude crystals were recrystallized from ethanol to obtain 2.6 g (8.4 mmol, yield 69%) of the title compound. Melting point 254-257 ° C. Reference Example A23-164 N- [4- [4- (1,1-Dimethylethyl) phenyl] -5- (4-pyridyl) -1,3-thiazol-2-yl] benzamide [4- [4- ( 1,1-Dimethylethyl) phenyl] -5- (4-pyridyl)
-1,3-Thiazol-2-yl] amine (0.50 g, 1.62 mmol)
And 4-dimethylaminopyridine (0.05 g, 0.39 mmol)
Benzoyl chloride (0.15 g, 1.94 mmol) was added to the N, N-dimethylacetamide (5 mL) solution, and the mixture was stirred at 80 ° C. for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystal was recrystallized from ethanol to give the title compound.
0.44 g (yield 66%) was obtained. Melting point 292-294 ° C. Reference Example A23-165 N- [4- [4- (1,1-Dimethylethyl) phenyl] -5- (4-pyridyl) -1,3-thiazol-2-yl] nicotinamide [4- [4- (1,1-Dimethylethyl) phenyl] -5- (4-pyridyl)
-1,3-Thiazol-2-yl] amine (0.50 g, 1.62 mmol)
And 4-dimethylaminopyridine (0.06 g, 0.49 mmol)
To the N, N-dimethylacetamide (5 mL) solution was added nicotinoyl chloride hydrochloride (0.43 g, 2.42 mmol), and the mixture was stirred at 70 ° C for 14
Stir for hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to obtain 0.49 g (yield 73%) of the title compound. Melting point 326-328 [deg.] C. Reference Example A23-168 N- [4- [4- (1,1-Dimethylethyl) phenyl] -5- (4-pyridyl) -1,3-thiazol-2-yl] cyclopentanecarboxamide [4- [4 -(1,1-Dimethylethyl) phenyl] -5- (4-pyridyl)
-1,3-Thiazol-2-yl] amine (0.50 g, 1.62 mmol)
And 4-dimethylaminopyridine (0.06 g, 0.49 mmol)
To the N, N-dimethylacetamide (5 mL) solution was added cyclopentanecarbonyl chloride (0.32 g, 2.42 mmol),
The mixture was stirred at ℃ for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to obtain 0.43 g (yield 66%) of the title compound. Melting point 309-311 ° C. Reference Example A23-194 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] propionamide [4- (3,5-dimethylphenyl) -5- (4-Pyridyl) -1,3-thiazol-2-yl] amine (0.51 g, 1.8 mmol) and 4-dimethylaminopyridine (0.06 g, 0.52 mmol) in N, N-dimethylacetamide (20 mL ) Solution, propionyl chloride (0.1
8 g, 1.96 mmol) was added, and the mixture was stirred at 80 ° C. for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to give the title compound 0.41 g
(Yield 67%) was obtained. Melting point 291-293 ° C. Reference Example A23-195 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] -2-methylpropionamide [4- (3,5 -Dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] amine (0.50 g, 1.8 mmol) and 4-dimethylaminopyridine (0.06 g, 0.53 mmol) in N, N-dimethyl 2-Methylpropionyl chloride (0.20 g, 1.91 mmol) was added to the acetamide (20 mL) solution, and the mixture was stirred at 80 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystal was recrystallized from ethanol to give the title compound.
0.52 g (yield 83%) was obtained. Melting point 270-272 ° C.

Reference Example A23-196 N- [4- (3,5-Dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] -2-phenylacetamide [4- (3 , 5-Dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] amine (0.51 g, 1.8 mmol) and 4-dimethylaminopyridine (0.06 g, 0.52 mmol) in N, N -2-Phenylacetyl chloride (0.32 g, 2.0 mmol) was added to the dimethylacetamide (15 mL) solution, and the mixture was stirred at 80 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystal was recrystallized from ethanol to give the title compound.
0.33 g (yield 46%) was obtained. Melting point 226-229 ° C. Reference Example A23-197 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] benzamide [4- (3,5-dimethylphenyl)- 5- (4-pyridyl) -1,3-thiazol-2-yl] amine (0.51 g, 1.8 mmol) and 4-dimethylaminopyridine (0.06 g, 0.52 mmol) in N, N-dimethylacetamide (20 mL) Add benzoyl chloride (0.30
g, 2.15 mmol) was added and the mixture was stirred at 80 ° C. for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to give the title compound 0.18 g (yield 26%). Melting point 285-286 ° C. Reference example A23-198 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] cyclopentanecarboxamide [4- (3,5-dimethylphenyl) ) -5- (4-Pyridyl) -1,3-thiazol-2-yl] amine (0.51 g, 1.8 mmol) and 4-dimethylaminopyridine (0.07 g, 0.56 mmol) in N, N-dimethylacetamide (10 Cyclopentanecarbonyl chloride (0.33 g, 2.47 mmol) was added to the solution), and the mixture was stirred at 70 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. After washing the obtained solid with water,
Dried. The crude crystals were recrystallized from ethanol to obtain 0.41 g (yield 59%) of the title compound. Melting point 275-278 ° C. Reference Example A23-199 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] nicotinamide [4- (3,5-dimethylphenyl) -5- (4-Pyridyl) -1,3-thiazol-2-yl] amine (0.52 g, 1.9 mmol) and 4-dimethylaminopyridine (0.07 g, 0.56 mmol) in N, N-dimethylacetamide (10 mL) ) To the solution was added nicotinoyl chloride hydrochloride (0.51 g, 2.86 mmol), and the mixture was stirred at 80 ° C for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystal was recrystallized from ethanol to give the title compound.
0.44 g (61% yield) was obtained. Melting point 267-270 ° C. Reference Example A23-200 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] isonicotinamide [4- (3,5-dimethylphenyl) ) -5- (4-Pyridyl) -1,3-thiazol-2-yl] amine (0.51 g, 1.8 mmol) and 4-dimethylaminopyridine (0.07 g, 0.56 mmol) in N, N-dimethylacetamide (10 (mL) solution, isonicotinoyl chloride hydrochloride (0.48 g, 2.72 mmol) was added, and the mixture was stirred at 80 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystal was recrystallized from ethanol to give the title compound.
0.22 g (yield 32%) was obtained. Melting point 302-304 ° C. Reference Example A23-201 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] -N'-ethylurea [4- (3,5- Dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] amine (0.51 g, 1.8 mmol) in N, N-dimethylacetamide (10 mL) was added with ethyl isocyanate.
(0.20 g, 2.8 mmol) was added, and the mixture was stirred at 80 ° C for 14 hr.
Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to give the title compound 0.2
7 g (yield 42%) was obtained. Melting point 202-203 ° C. Reference Example A23-202 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] -N'-propylurea [4- (3,5 To a solution of -dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] amine (0.51 g, 1.8 mmol) in N, N-dimethylacetamide (15 mL), propyl isocyanate (0.23 g, 2.67 mmol) was added and the mixture was stirred at 80 ° C. for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystal was recrystallized from ethanol to give the title compound.
0.23 g (yield 33%) was obtained. Melting point 128-130 ° C. Reference Example A23-246 N- [4- (3,5-dimethylphenyl) -5- (4-pyridyl) -1,3-thiazol-2-yl] pyrazinecarboxamide [4- (3,5-dimethylphenyl) -5- (4-Pyridyl) -1,3-thiazol-2-yl] amine (0.50 g, 1.8 mmol) and 4-dimethylaminopyridine (0.06 g, 0.53 mmol) in N, N-dimethylacetamide (5 mL ) In solution, pyrazine carbonyl chloride
(0.44 g, 2.7 mmol) was added, and the mixture was stirred at 70 ° C for 14 hr.
Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to give the title compound 0.4
1 g (yield 59%) was obtained. Melting point 269-270 ° C.

Reference Example A24 1-Bromo-3-ethylbenzene 3-ethylaniline (10.0 g, 82.5 mmol) in 50% sulfuric acid solution
Sodium nitrite (6.83 g, 99.0 mmol) in (43.6 g) at 0 ° C
Aqueous solution (16.5 mL) was added dropwise over 30 minutes. The resulting reaction mixture was stirred at 0 ° C for 45 minutes. A solution of this diazonium salt is slowly heated to reflux with copper (I) bromide (1)
2.4 g, 86.6 mmol) of 48% hydrobromic acid solution (82.5 mL) was added little by little. After the addition, the reaction mixture was heated to reflux for 30 minutes. The reaction mixture was cooled to room temperature and extracted with ether. The extract was washed successively with 1N-sodium hydroxide aqueous solution and saturated brine, filtered, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate =
Purification by 20: 1) gave 6.13 g (yield 40%) of the title compound. Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.23 (3H, t, J = 7.5 Hz), 2.63
(2H, q, J = 7.5 Hz), 7.11-7.20 (2H, m), 7.28-7.38
(2H, m). Reference Example A25 According to Reference Example A24, 3-ethylaniline was replaced with 3-
The following Reference Example A compound 25 was synthesized using (1-methylethyl) aniline. Reference Example A Compound 25: 1-Bromo-3- (1-methylethyl) benzene oil. ¹ H-NMR (CDCl ₃ ) δ: 1.24 (6H, d, J = 7.0 Hz), 2.77-
2.99 (1H, m), 7.03-7.16 (2H, m), 7.27-7.34 (1H, m),
7.37 (1H, s). Reference Example A26 3-Ethylbenzoic acid 1-Bromo-3-ethylbenzene (5.1 g,
A tetrahydrofuran solution (45 mL) of 28 mmol) was added dropwise to a tetrahydrofuran mixture (5.0 mL) of magnesium pieces (0.74 g, 31 mmol), and the mixture was stirred for 30 minutes as it was. The reaction mixture was added to crushed dry ice, and the mixture was stirred as it was for 1 hour. 1N-hydrochloric acid was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried, filtered and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 5: 1) to give the title compound (3.87 g, yield 93%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.28 (3H, t, J = 7.5 Hz), 2.73
(2H, q, J = 7.5 Hz), 7.34-7.50 (2H, m), 7.92-7.98
(2H, m). Reference Example A27 According to Reference Example A26, instead of 1-bromo-3-ethylbenzene, 1-bromo-3- (1-methylethyl) benzene, 1-bromo-4-fluoro-3- The following Reference Example A compounds 27-1 and 27-2 were synthesized using methylbenzene. Reference Example A Compound 27-1: 3- (1-methylethyl) benzoic acid oil. ¹ H-NMR (CDCl ₃ ) δ: 1.29 (6H, d, J = 7.0 Hz), 2.98-
3.06 (1H, m), 7.38-7.54 (2H, m), 7.90-8.02 (2H, m). Reference Example A Compound 27-2: 4-Fluoro-3-methylbenzoic acid Melting point 165-167 ° C. Reference Example A28 3-Ethylbenzoyl chloride 3-Ethylbenzoic acid (9.40 g, 62.6 mmol) was slowly added to thionyl chloride (45 mL) at 0 ° C., and N, N-dimethylformamide (3 drops) was added dropwise. The reaction mixture obtained is used as is for 2
Heated to reflux for hours. The reaction mixture was concentrated and used in the next reaction without purification. Reference Example A29 According to Reference Example A28, 3-ethylbenzoic acid was used in place of 3-ethylbenzoic acid.
The following Reference Example A compounds 29-1 to 29-3 were synthesized using (1-methylethyl) benzoic acid, 4-fluoro-3-methylbenzoic acid and 4-cyclohexylbenzoic acid. Reference Example A Compound 29-1: 3- (1-methylethyl) benzoyl chloride Used in the next reaction without purification. Reference Example A Compound 29-2: 4-Fluoro-3-methylbenzoyl chloride Used in the next reaction without purification. Reference Example A Compound 29-3: 4-Cyclohexylbenzoyl chloride Used in the next reaction without purification.

Reference Example A30 According to Reference Example A14, instead of 4-chlorobenzoyl chloride, 3-trifluoromethylbenzoyl chloride, 3,
Using 5-dichlorobenzoyl chloride, 3-ethylbenzoyl chloride, 3- (1-methylethyl) benzoyl chloride, 4-fluoro-3-methylbenzoyl chloride, 4-cyclohexylbenzoyl chloride, 3-fluorobenzoyl chloride, respectively, the following Reference Example A Compounds 30-1 to 30-3
0-7 was synthesized. Reference Example A Compound 30-1: N- (3-trifluoromethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (3H, d, J = 5.5 Hz), 2.20
(1H, d, J = 3.3 Hz), 2.56-2.67 (2H, m), 7.61 (1H,
t, J = 7.7 Hz), 7.81 (1H, d, J = 7.7 Hz), 8.21 (1H,
d, J = 7.7 Hz), 8.30 (1H, s). Reference Example A compound 30-2: N- (3,5-dichlorobenzoyl)
Propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.1 Hz), 2.19
(1H, d, J = 3.3 Hz), 2.57 (1H, t, J = 5.5 Hz), 2.57-
2.70 (1H, m), 7.54 (1H, t, J = 1.8 Hz), 7.88 (2H,
d, J = 1.8 Hz). Reference Example A compound 30-3: N- (3-ethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.27 (3H, t, J = 7.5 Hz), 1.40
(3H, d, J = 5.5 Hz), 2.14 (1H, d, J = 2.9 Hz), 2.52-
2.61 (2H, m), 2.71 (2H, q, J = 7.5 Hz), 7.32-7.41
(2H, m), 7.81-7.89 (2H, m). Reference Example A Compound 30-4: N- [3- (1-methylethyl) benzoyl] propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.29 (6H, d, J = 7.0 Hz), 1.40
(3H, d, J = 5.9 Hz), 2.14 (1H, d, J = 3.7 Hz), 2.51-
2.64 (2H, m), 2.87-3.10 (1H, m), 7.33-7.46 (2H,
m), 7.84 (1H, dt, J = 7.0, 1.8 Hz), 7.91 (1H, s). Reference Example A compound 30-5: N- (4-fluoro-3-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.4 Hz), 2.14
(1H, d, J = 3.4 Hz), 2.33 (s, 3H), 2.51-2.61 (2H,
m), 7.06 (1H, t, J = 8.8 Hz), 7.81-7.90 (2H, m). Reference Example A compound 30-6: N- (4-cyclohexylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.22-1.54 (7H, m), 1.67-1.89 (6
H, m), 2.12 (1H, d, J = 3.2 Hz), 2.52-2.60 (3H, m),
7.28 (2H, d, J = 8.3 Hz), 7.95 (2H, d, J = 8.3 Hz). Reference Example A compound 30-7: N- (3-fluorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.5 Hz), 2.16
(1H, d, J = 3.3 Hz), 2.52-2.68 (2H, m), 7.25 (1H, d
dd, J = 8.4, 2.6, 1.1 Hz), 7.43 (1H, ddd, J = 8.1,
7.7, 5.5 Hz), 7.69 (1H, ddd, J = 8.1, 2.6, 1.5 Hz),
7.81 (1H, ddd, J = 7.7, 1.5, 1.1 Hz). Reference Example A31 According to Reference Example A16, instead of N- (2-chlorobenzoyl) propyleneimine, N- (3-trifluoromethylbenzoyl) propyleneimine. , N- (3,5-dichlorobenzoyl) propyleneimine, N- (3-ethylbenzoyl) propyleneimine, N- [3- (1-methylethyl) benzoyl] propyleneimine, N- (4-fluoro-3- Methylbenzoyl) propyleneimine, N- (4-cyclohexylbenzoyl) propyleneimine, and N- (3-fluorobenzoyl) propyleneimine, respectively, were used to prepare the following Reference Example A compounds 31-1 to 31-31.
7 was synthesized. Reference Example A compound 31-1: 2- (4-pyridyl) -1- (3-trifluoromethylphenyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 4.33 (2H, s), 7.21 (2H, d, J =
6.0 Hz), 7.65 (1H, dd, J = 8.4, 7.7 Hz), 7.87 (1H,
d, J = 7.7 Hz), 8.18 (1H, d, J = 8.4 Hz), 8.26 (1H,
s), 8.59 (2H, d, J = 6.0 Hz). Reference Example A compound 31-2: 1- (3,5-dichlorophenyl) -2
-(4-pyridyl) ethanone melting point 163-164 ° C. Reference Example A compound 31-3: 1- (3-ethylphenyl) -2- (4-
Pyridyl) ethanone melting point 102-103 ° C. Reference Example A compound 31-4: 1- [3- (1-methylethyl) phenyl] -2- (4-pyridyl) ethanone melting point 50-52 ° C. Reference Example A compound 31-5: 1- (4-fluoro-3-methylphenyl) -2- (4-pyridyl) ethanone melting point 86-88 ° C. Reference Example A Compound 31-6: 1- (4-cyclohexylphenyl) -2- (4-pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 1.32-1.52 (5H, m), 1.77-1.89 (5
H, m), 2.58 (1H, m), 4.26 (2H, s), 7.20 (2H, d, J =
6.3 Hz), 7.32 (2H, d, J = 8.4 Hz), 7.93 (2H, d, J =
8.4 Hz), 8.56 (2H, d, J = 6.3 Hz). Reference Example A compound 31-7: 1- (3-fluorophenyl) -2-
(4-pyridyl) ethanone amorphous powder. ¹ H-NMR (CDCl ₃ ) δ: 4.28 (2H, s), 7.20 (2H, d, J =
6.2 Hz), 7.33 (1H, ddd, J = 8.1, 2.6, 1.1 Hz), 7.49
(1H, ddd, J = 8.1, 7.7, 5.5 Hz), 7.68 (1H, ddd, J =
9.5, 2.6, 1.5 Hz), 7.79 (1H, ddd, J = 7.7, 1.5, 1.1
Hz), 8.58 (2H, d, J = 6.2 Hz).

Reference Example A32 According to Reference Example A17, using 2,4-lutidine and γ-collidine in place of γ-picoline, the following Reference Example A compound 3
2-1 to 32-4 were synthesized. Reference Example A compound 32-1: 1- (3-methylphenyl) -2- (2-
Methyl-4-pyridyl) ethanone melting point 56-57 ° C. Reference Example A compound 32-2: 1- (3,5-dimethylphenyl) -2
-(2-Methyl-4-pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 2.38 (6H, s), 2.54 (3H, s), 4.2
1 (2H, s), 6.98-7.10 (1H, m), 7.01 (1H, m), 7.06
(1H, s), 7.23 (1H, s), 7.60 (2H, s), 8.42-8.45 (1
H, m). Reference Example A Compound 32-3: 2- (2,6-Dimethyl-4-pyridyl) -1- (3-methylphenyl) ethanone Melting point 46-48 ° C. Reference Example A Compound 32-4: 1- (3,5-dimethylphenyl) -2
-(2,6-Dimethyl-4-pyridyl) ethanone melting point 135-136 ° C. Reference Example A33 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-
(4-Methoxyphenyl) ethanone 2-tert-butoxycarbonylamino-4-methylpyridine (2
A solution of 0 g, 97 mmol) in anhydrous tetrahydrofuran (300 mL) was cooled to −78 ° C., and 1.6 M n-butyllithium hexane solution (140 mL, 0.23 mol) was added dropwise with stirring. After completion of dropping, the mixture was stirred at room temperature for 30 minutes and then cooled to -78 ° C. N
-(4-Methoxybenzoyl) propyleneimine (25 g, 0.13
Anhydrous tetrahydrofuran (50 mL) solution of (mol) was added dropwise. After completion of dropping, the mixture was stirred at room temperature for 2 hours. Water (100 mL) and isopropyl ether (300 mL) were added to the reaction mixture,
The obtained crude crystal was collected by filtration. The crude compound was recrystallized from tetrahydrofuran-hexane to give the title compound 2
3 g (yield 69%) was obtained. Melting point 187-190 ° C. Reference Example A34 According to Reference Example A33, N- (3-methylbenzoyl) propyleneimine and N- (3,5-dimethylbenzoyl) propyleneimine were used instead of N- (4-methoxybenzoyl) propyleneimine, respectively, The following Reference Example A compounds 34-1 and 34-2 were synthesized. Reference Example A compound 34-1: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone melting point 144-146 ° C. Reference Example A compound 34-2: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3,5-dimethylphenyl) ethanone melting point 133-136 ° C. Reference Example A35 2-Fluoro-4-methylpyridine Journal of Medicinal Chemistry (J
individual of Medicinal Chemi
st.), 33, pp. 1667-1675, 1990.
It was synthesized according to the method described in the year. Boiling point 82-86 ° C (10 kPa). Reference Example A36 2- (2-Fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone Under argon atmosphere, diisopropylamine (44 mL, 0.31
A solution of (mol) in anhydrous tetrahydrofuran (300 mL) was cooled to -78 ° C, and 1.6 M n-butyllithium hexane solution (190 mL, 0.31 mol) was added dropwise with stirring. After the dropping, stir for 10 minutes, and then 2-fluoro-4-methylpyridine (34.5
A solution of g, 0.31 mol) in anhydrous tetrahydrofuran (30 mL) was added. The reaction mixture was stirred at -10 ° C for 30 minutes. The reaction solution was cooled to -78 ° C and N- (3-methylbenzoyl) propyleneimine (52 g, 0.30 mol) in anhydrous tetrahydrofuran (3
0 mL) solution was added dropwise. After completion of dropping, the mixture was stirred at room temperature for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was recrystallized from isopropyl ether to give the title compound (35 g, yield 52%). Melting point 66-67 ° C. Reference Example A37 According to Reference Example A36, the following Reference Example A compound 37 was synthesized using N- (3-methoxybenzoyl) propyleneimine instead of N- (3-methylbenzoyl) propyleneimine. Reference Example A compound 37: 2- (2-fluoro-4-pyridyl) -1- (3
-Methoxyphenyl) ethanone oil ¹ H-NMR (CDCl ₃ ) δ: 3.86 (3H, s), 4.31 (2H, s), 6.8
6 (1H, s), 7.03-7.19 (2H, m), 7.31-7.59 (3H, m),
8.18 (1H, d, J = 5.6 Hz).

Reference Example A38 According to Reference Example A21, instead of 4-methylthiobenzonitrile, 2-methylbenzonitrile, 3-methylbenzonitrile, 4-methylbenzonitrile, 2-chlorobenzonitrile, 3-chlorobenzonitrile. , 4-chlorobenzonitrile, 3-methoxybenzonitrile, 4-methoxybenzonitrile, 2-fluorobenzonitrile, 3-fluorobenzonitrile, 4-fluorobenzonitrile, 4-nitrobenzonitrile, piperonylonitrile, 3- Methoxycarbonylbenzonitrile, 4-methoxycarbonylbenzonitrile,
Butyronitrile, isobutyronitrile, valeronitrile, hexanenitrile, 3-phenylpropionitrile,
The following Reference Example A compounds 38-1 to 38-21 were synthesized using 4-phenylbutyronitrile, respectively. Reference Example A compound 38-1: 2-methyl (thiobenzamide) oily substance ¹ H-NMR (CDCl ₃ ) δ: 2.37 (3H, s), 6.88 (1H, br s),
7.06-7.23 (3H, m), 7.24-7.31 (1H, m), 7.88 (1H, br
s). Reference Example A compound 38-2: 3-methyl (thiobenzamide) melting point 88-89 ° C. Reference Example A compound 38-3: 4-methyl (thiobenzamide) melting point 172-174 ° C. Reference Example A compound 38-4: 2-chlorothiobenzamide melting point 58-59 ° C. Reference Example A compound 38-5: 3-chlorothiobenzamide melting point 114-115 ° C. Reference Example A compound 38-6: 4-chlorothiobenzamide melting point 130-131 ° C. Reference Example A Compound 38-7: 3-methoxythiobenzamide oil ¹ H-NMR (CDCl ₃ ) δ: 3.86 (3H, s), 7.02-7.08 (1H,
m), 7.31-7.36 (3H, m), 7.46-7.49 (1H, m), 7.76 (1
H, br s). Reference Example A compound 38-8: 4-methoxythiobenzamide melting point 148-149 ° C. Reference Example A compound 38-9: 2-fluorothiobenzamide melting point 113-114 ° C. Reference Example A compound 38-10: 3-fluorothiobenzamide melting point 151-152 ° C. Reference Example A compound 38-11: 4-fluorothiobenzamide melting point 156-157 ° C. Reference Example A compound 38-12: 4-nitrothiobenzamide melting point 159-160 ° C. Reference Example A compound 38-13: thiopiperonylamide melting point 188-189 ° C. Reference Example A compound 38-14: 3-methoxycarbonylthiobenzamide melting point 140-141 ° C. Reference Example A compound 38-15: 4-methoxycarbonylthiobenzamide melting point 191-192 ° C. Reference Example A Compound 38-16: Thiobutyramide oily substance ¹ H-NMR (CDCl ₃ ) δ: 0.99 (3H, t, J = 7.6 Hz), 1.72-
1.93 (2H, m), 2.64 (2H, t, J = 7.6 Hz), 7.02 (1H, br
s), 7.77 (1H, br s). Reference Example A Compound 38-17: Thioisobutyramide oil ¹ H-NMR (CDCl ₃ ) δ: 1.28 (6H, d, J = 5.8 Hz), 2.79-
2.96 (1H, m), 6.99 (1H, br s), 7.71 (1H, br s). Reference Example A compound 38-18: thiovaleramide oil ¹ H-NMR (CDCl ₃ ) δ: 0.94 (3H, t, J = 7.3 Hz), 1.31-
1.49 (2H, m), 1.68-1.83 (2H, m), 2.67 (2H, t, J = 7.
7 Hz), 6.92 (1H, br s), 7.73 (1H, br s). Reference Example A compound 38-19: hexanethioamide oil ¹ H-NMR (CDCl ₃ ) δ: 0.90 (3H, t, J = 6.9 Hz), 1.22-
1.45 (4H, m), 1.70-1.84 (2H, m), 2.66 (2H, t, J = 7.
5 Hz), 7.05 (1H, br s), 7.91 (1H, br s). Reference Example A Compound 38-20: 3-phenyl (thiopropionamide) Melting point 83-84 ° C. Reference Example A compound 38-21: 4-phenyl (thiobutyramide) melting point 60-61 ° C.

Reference Example A39 According to Reference Example A6, 2- (4-pyridyl) -1- (3-trifluoromethylphenyl was used instead of 1- (4-methoxyphenyl) -2- (3-pyridyl) ethanone. ) Ethanone, 1- (3,5-dichlorophenyl) -2- (4-pyridyl) ethanone, 1- (3-ethylphenyl) -2- (4-pyridyl) ethanone, 1- [3- (1-methylethyl )
Phenyl] -2- (4-pyridyl) ethanone, 1- (4-fluoro-3-
Methylphenyl) -2- (4-pyridyl) ethanone, 1- (4-cyclohexylphenyl) -2- (4-pyridyl) ethanone, 1- (3-
Fluorophenyl) -2- (4-pyridyl) ethanone, 2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone, 2
-(2-Fluoro-4-pyridyl) -1- (3-methoxyphenyl) ethanone, 1- (3-methylphenyl) -2- (2-methyl-4-pyridyl) ethanone, 1- (3,5- Dimethylphenyl) -2- (2-methyl-
4-pyridyl) ethanone, 2- (2,6-dimethyl-4-pyridyl) -1
-(3-Methylphenyl) ethanone and 1- (3,5-dimethylphenyl) -2- (2,6-dimethyl-4-pyridyl) ethanone were used respectively to prepare the following Reference Example A compounds 39-1 to 39: -13 was synthesized. Reference Example A Compound 39-1: 2-Bromo-2- (4-pyridyl) -1- (3-trifluoromethylphenyl) ethanone hydrobromide Used in the next reaction without purification. Reference Example A Compound 39-2: 2-Bromo-1- (3,5-dichlorophenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 253-254 ° C. Reference Example A Compound 39-3: 2- Bromo-1- (3-ethylphenyl) -2- (4-pyridyl) ethanone hydrobromide melting point 146-148 ° C. Reference Example A compound 39-4: 2-bromo-1- [3- (1-methylethyl) phenyl] -2- (4-pyridyl) ethanone hydrobromide melting point 143-144 ° C. Reference Example A compound 39-5: 2-bromo-1- (4-fluoro-3-)
Methylphenyl) -2- (4-pyridyl) ethanone hydrobromide melting point 211-214 ° C. Reference Example A Compound 39-6: 2-Bromo-1- (4-cyclohexylphenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 189-191 ° C. Reference Example A Compound 39-7: 2-Bromo-1- (3-fluorophenyl) -2- (4-pyridyl) ethanone hydrobromide Melting point 191-194 ° C. Reference Example A compound 39-8: 2-bromo-2- (2-fluoro-4-)
Pyridyl) -1- (3-methylphenyl) ethanone hydrobromide salt was used in the next reaction without purification. Reference Example A Compound 39-9: 2-Bromo-2- (2-fluoro-4-)
Pyridyl) -1- (3-methoxyphenyl) ethanone hydrobromide salt was used in the next reaction without purification. Reference Example A compound 39-10: 2-bromo-1- (3-methylphenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide melting point 144-146 ° C. Reference Example A Compound 39-11: 2-Bromo-1- (3,5-dimethylphenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide Used in the next reaction without purification. . Reference Example A Compound 39-12: 2-Bromo-2- (2,6-dimethyl)
-4-Pyridyl) -1- (3-methylphenyl) ethanone hydrobromide was used in the next reaction without purification. Reference Example A Compound 39-13: 2-Bromo-1- (3,5-dimethylphenyl) -2- (2,6-dimethyl-4-pyridyl) ethanone hydrobromide Melting point 208-212 ° C.

Reference Example A40 2-Bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-methoxyphenyl) ethanone hydrobromide 2- (2-tert-butoxycarbonylamino) -4-pyridyl) -1-
Bromine (0.058 mL, 1.1 mmol) was added to a solution of (4-methoxyphenyl) ethanone (0.36 g, 1.1 mmol) in acetic acid (5 mL), and the mixture was stirred at room temperature for 1 hr. The reaction mixture was concentrated and the residue was washed with isopropyl ether to give the title compound 0.4
4 g (yield 82%) was obtained. Amorphous powder ¹ H-NMR (CDCl ₃ ) δ: 1.55 (6H, s), 3.92 (3H, s), 6.3
5 (1H, s), 6.99-7.03 (2H, m), 7.66 (1H, dd, J = 6.
6, 1.8 Hz), 8.02-8.07 (2H, m), 8.20 (1H, d, J = 6.6
Hz), 8.70 (2H, d, J = 1.8 Hz), 11.02 (1H, br s). Reference Example A41 According to Reference Example A40, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- Instead of (4-methoxyphenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone and 2- (2-tert-
The following Reference Example A compounds 41-1 and 41-2 were synthesized using butoxycarbonylamino-4-pyridyl) -1- (3,5-dimethylphenyl) ethanone, respectively. Reference Example A Compound 41-1: 2-Bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide For the next reaction without purification. Using. Reference Example A Compound 41-2: 2-Bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3,5-dimethylphenyl) ethanone hydrobromide Used in the reaction. Reference Example A42 Ethyl (4-phenyl-1-piperazinyl) carbothioyl carbamate Ethyl isothiocyanatoformate (8.1 g, 62 mmol)
Solution of 1-phenylpiperazine (10 g,
62 mmol) was added and the mixture was heated to reflux for 1 hour. The reaction mixture was concentrated, and the crude crystals were recrystallized from ethyl acetate to give the title compound (13 g, yield 73%). Melting point 134-135 ° C. Reference Example A43 4-Phenyl-1-piperazinecarbothioamidoethyl (4-phenyl-1-piperazinyl) carbothioyl carbamate (13 g, 44 mmol) was added to concentrated hydrochloric acid (44 mL),
The mixture was stirred at 80 ° C. for 2 hours. The reaction mixture was made basic with 8N-sodium hydroxide aqueous solution, and the crystals were collected by filtration. The crystals were washed with water and dried to give the title compound (6.1 g, yield 63%).
Got Melting point 178-179 ° C.

Reference Example A44 Reference Example A compound 44-1 described in Tables 32 to 42 below.
~ 44-129, Reference Examples A8-12, Reference Example A44-
1, JP-A-61-158080 and USP 4,61
It was synthesized according to the method described in 2,321.

[Table 32]

[0222]

[Table 33]

[0223]

[Table 34]

[0224]

[Table 35]

[0225]

[Table 36]

[0226]

[Table 37]

[0227]

[Table 38]

[0228]

[Table 39]

[0229]

[Table 40]

[0230]

[Table 41]

[0231]

[Table 42]

Reference Example A44-1 4- (4-Fluorophenyl) -2-phenyl-5- (4-pyridyl)-
1,3-thiazole 2-bromo-1- (4-fluorophenyl) -2- (4
A solution of -pyridyl) ethanone hydrobromide (1.6 g, 4.1 mmol) and thiobenzamide (0.57 g, 4.2 mmol) in N, N-dimethylformamide (5 mL) was stirred at room temperature for 14 hours. Aqueous sodium hydrogen carbonate was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethyl acetate to give the title compound 0.27 g (yield
19%). Melting point 135-137 ° C. The proton nuclear magnetic resonance spectrum of Reference Example A44 listed above is shown in Table 43 below.

[Table 43] Reference Example A45 According to Reference Example A21, the following Reference Example A compound 45 was synthesized using pivalonitrile instead of 4-methylthiobenzonitrile. Reference Example A Compound 45: Thiopivaloamide Melting point 117-119 ° C. Reference Example A46 Reference Example A Compounds 46-1 to 46- shown in Table 44 below.
7 is referred to as Reference Examples A8 to 12, Reference Example A44-1, and JP-A-Sho-6.
It was synthesized according to the method described in JP 1-10580 A and USP 4,612,321.

[Table 44]

Reference Example B1 (1) Reference Example A Compound 23-313 10.0 mg (2) Lactose 60.0 mg (3) Corn Starch 35.0 mg (4) Gelatin 3.0 mg (5) Magnesium Stearate 2.0 mg Reference Example A Compound 23-313 10.0 mg and lactose 60.0
A mixture of 3 mg of corn starch and 35.0 mg of corn starch was granulated with 0.03 ml of 10% aqueous gelatin solution (3.0 mg as gelatin) through a 1 mm mesh sieve, dried at 40 ° C. and sieved again. The granules thus obtained are mixed with 2.0 mg of magnesium stearate and compressed. The resulting core tablets are sugar-coated with a suspension of sucrose, titanium dioxide, talc and gum arabic. The coated tablets are polished with beeswax to obtain coated tablets. Reference Example B2 (1) Reference Example A Compound 23-313 10.0 mg (2) Lactose 70.0 mg (3) Corn starch 50.0 mg (4) Soluble starch 7.0 mg (5) Magnesium stearate 3.0 mg Reference Example A Compound 23-313 (10.0 mg) and magnesium stearate (3.0 mg) were added to a soluble starch aqueous solution (0.0).
Granulated with 7 ml (7.0 mg as soluble starch), dried and lactose 70.0 mg and corn starch 50.0.
Mix with mg. The mixture is compressed to give tablets. Reference Example B3 (1) Reference Example A Compound 23-313 5.0 mg (2) Salt 20.0 mg (3) Distilled water Total amount 2 ml Reference Example A Compound 23-313 5.0 mg and salt 20.0
Dissolve mg in distilled water and add water to bring the total volume to 2.0 ml. The solution is filtered and filled under aseptic conditions into 2 ml ampoules. After sterilizing the ampoule, it is sealed to obtain a solution for injection. Reference Example B4 (1) Reference Example A Compound 23-331 10.0 mg (2) Lactose 60.0 mg (3) Corn Starch 35.0 mg (4) Gelatin 3.0 mg (5) Magnesium Stearate 2.0 mg Reference Example A Compound 23-331 10.0 mg and lactose 60.0
A mixture of 3 mg of corn starch and 35.0 mg of corn starch was granulated with 0.03 ml of 10% aqueous gelatin solution (3.0 mg as gelatin) through a 1 mm mesh sieve, dried at 40 ° C. and sieved again. The granules thus obtained are mixed with 2.0 mg of magnesium stearate and compressed. The resulting core tablets are sugar-coated with a suspension of sucrose, titanium dioxide, talc and gum arabic. The coated tablets are polished with beeswax to obtain coated tablets. Reference Example B5 (1) Reference Example A Compound 23-331 10.0 mg (2) Lactose 70.0 mg (3) Corn starch 50.0 mg (4) Soluble starch 7.0 mg (5) Magnesium stearate 3.0 mg Reference Example A Compound 23-331 (10.0 mg) and magnesium stearate (3.0 mg) were added to a soluble starch aqueous solution (0.0).
Granulated with 7 ml (7.0 mg as soluble starch), dried and lactose 70.0 mg and corn starch 50.0.
Mix with mg. The mixture is compressed to give tablets. Reference Example B6 (1) Reference Example A Compound 23-331 5.0 mg (2) Salt 20.0 mg (3) Distilled water Total amount 2 ml Reference Example A Compound 23-331 5.0 mg and salt 20.0
Dissolve mg in distilled water and add water to bring the total volume to 2.0 ml. The solution is filtered and filled under aseptic conditions into 2 ml ampoules. After sterilizing the ampoule, it is sealed to obtain a solution for injection.

Reference Example C1 The gene manipulation method described below is based on the literature (Maniatis et al., Molecular Cloning, Cold Spring Harbor Laborato).
ry, 1989) or the method described in the attached protocol of reagents. (1) Cloning of Human p38MAP Kinase Gene and Preparation of Recombinant Baculovirus To clone the human p38MAP kinase gene, kidney cDNA (Toyobo, QUICK-Clone cDNA) was used as a template, and
A primer set P38-U: 5'-ACCACT prepared with reference to the nucleotide sequence of the p38MAP kinase gene reported by an et al. (Science 265 (5173), 808-811 (1994)).
CGAGATGGGACTACAAGGACGACGAT
GACAAGTCTCAGGAGAGGGCCCACGT
TCTACC-3 ′ [SEQ ID NO: 1] and PAG-L:
5'-ACCCGGTACCACAGGGTGCTCA
It was performed by the PCR method using GGACTCCATCTCT-3 ′ [SEQ ID NO: 2]. PCR reaction is AmpliW
Hot using ax PCR Gem 100 (Takara Shuzo)
It was performed by the Start method. 10xLA as the lower layer mixture
PCR Buffer 2 μL, 2.5 mM dNTP
Solution 3 μL, 12.5 μM Primer solution 2.5 μ each
L and 10 μL of sterile distilled water were mixed. As the upper layer mixture, 1 human heart cDNA (1 ng / mL) was used as a template.
μL, 10 × LA PCR Buffer 3 μL,
2.5 mM dNTP solution 1 μL, TaKaRa LA
Taq DNA po1zyme (Takara Shuzo) 0.5
μL and 24.5 μL of sterile distilled water were mixed. One AmpliWax PCR Gem 100 (Takara Shuzo) was added to the prepared lower layer mixture, and the mixture was treated at 70 ° C. for 5 minutes and on ice for 5 minutes, and then the upper layer mixture was added to prepare a PCR reaction solution.
The tube containing the reaction solution was set in a thermal cycler (Perkin Elmer) and then treated at 95 ° C for 2 minutes. Further, a cycle of 95 ° C. for 15 seconds and 68 ° C. for 2 minutes was repeated 35 times and then treated at 72 ° C. for 8 minutes.
The obtained PCR product was electrophoresed on agarose gel (1%), and a 1.1 kb D containing the p38 MAP kinase gene was electrophoresed.
After recovering the NA fragment from the gel, pT7Blue-T
The plasmid pHP38 was prepared by inserting into vector (Takara Shuzo). Plasmid pFASTBAC
1 (CIBCOBRL) 4.8 kb XhoI-Kp
nI fragment and 1.1 kb X of the above plasmid pHP38
ligated with the hoI-Kpn fragment to obtain plasmid pFBHP
38 was produced. Plasmids pFBHP38 and BAC
-TO-BAC Baculovirus Expre
Recombinant baculovirus virus stock BAC- using the Sion System (GIBCOBRL).
HP38 was prepared. (2) Cloning of the human MKK3 gene and preparation of recombinant baculovirus
(Toyobo, QUICK-Clone cDNA) was used as a template, and Derijard, B.
(Science 267 (5198), 682-685 (1995))
Primer set prepared with reference to the nucleotide sequence of KK3 gene MKK-U: 5'-ACAAGAATTCATA
ACATATGGCTCATCATCATCATCAT
CATTCCAAGCCACCCGCACCCAA-
3 '[SEQ ID NO: 3] and MKK-L: 5'-TCCC
GTCTAGACTATGAGTCTTCTCCCAG
It was performed by the PCR method using GAT-3 ′ [SEQ ID NO: 4]. PCR reaction is AmpliWax PCR Gem
It was performed by the Hot Start method using 100 (Takara Shuzo). As a lower layer mixture, 10xLA PCR Buffer
r 2 μL, 2.5 mM dNTP solution 3 μL, 12.
2.5 μL each of 5 μM primer solution, 10 μ of sterile distilled water
L was mixed. As the upper mixture, 1 μL of human kidney cDNA (1 ng / mL) was used as a template, 10 × LA PC
R Buffer 3 μL, 2.5 mM dNTP solution 1 μL, TaKaRa LA Taq DNA po1ym
erase (Takara Shuzo) 0.5 μL, sterile distilled water 24.5
μL was mixed. AmpliWax is added to the prepared lower layer mixture.
Add one PCR Gem 100 (Takara Shuzo), 70
After treating for 5 minutes at ℃ and 5 minutes on ice, add the upper mixture to PC
An R reaction solution was prepared. The tube containing the reaction solution was set in a thermal cycler (Perkin Elmer) and then treated at 95 ° C for 2 minutes. Furthermore, after repeating a cycle of 95 ° C. for 15 seconds and 68 ° C. for 2 minutes 35 times,
It was treated at 72 ° C. for 8 minutes. The obtained PCR product was subjected to agarose gel (1%) electrophoresis, and a 1.0 kb DNA fragment containing the MKK3 gene was recovered from the gel.
It was inserted into Blue-T vector (Takara Shuzo) to obtain a plasmid pHMKK3. Primer set SER to mutate MKK3 into a constitutively active form (Ser at position 189 is Glu, Thr at position 193 is Glu)
-U: 5'-GGCTACTTGGTGGACGAGG
TGGCCAAGGAGATGGATGCCGGCTG
C-3 '[SEQ ID NO: 5] and SER-L: 5'-GC
AGCCGGCATCCATCTCCTTGGCCAC
Using CTCGTCCACAAGTAGCC-3 ′ [SEQ ID NO: 6], QuikChange Site-
Directed Mutagenesis Kit
(Stratagene) to introduce a mutation, pca
MKK3 was obtained. Plasmid pFASTBAC1 (CI
BCOBRL) 4.8 kb EcoRI-XbaI fragment and the above plasmid pcaMKK3 1.0 kb Ec.
The oRI-XbaI fragment was ligated and the plasmid pFBca
MKK3 was produced. Plasmids pFBcaMKK3 and BAC-TO-BAC Baculovirus Ex
compression system (GIBCOBRL)
Recombinant baculovirus virus stock B using
AC-caMKK3 was prepared. (3) Preparation of active p38 MAP kinase Sf-21 cells were treated with 100 mL Sf-900II SFM medium (G) at 1 × 10 ⁶ cells / mL.
(IBCOBRL) and then cultured at 27 ° C. for 24 hours. Recombinant baculovirus virus stock BA
C-HP38 and BAC-caMKK3 are each 0.2
After adding mL, the cells were further cultured for 48 hours. The cells were separated from the culture solution by centrifugation (3000 rpm, 10 min), and then washed twice with PBS. 10 cells
mL Lysis buffer (25 mM HEPE
S (pH 7.5), 1% TritonX, 130 mM
NaCl, 1 mM EDTA, 1 mM DTT, 25 m
M β-glycerophosphate, 20 mM
leupeptin, 1 mM APMSF, 1 mM
After suspending in Sodium orthovanadate), 2000 with a homogenizer (POLYTRON)
The cells were disrupted by performing the treatment twice at 0 rpm for 2 minutes. From the supernatant obtained by centrifugation (40000 rpm, 45 minutes), Anti-FLAG M2 Affinity
The active p38MAP kinase was purified using Gel (Eastman Chemical Co.). (4) Measurement of enzyme inhibitory activity 37. Containing 260 ng of active p38MAP kinase and 1 µg of Myelin Basic Protein.
5 μL reaction solution (25 mM HEPES (pH 7.
5), 10 mM Magnesium Acetat
After 2.5 μL of the test compound dissolved in DMSO was added to e), the mixture was incubated at 30 ° C. for 5 minutes. ATP solution (2.5
The reaction was started by adding 10 μL of μM ATP, 0.1 μCi [g- ³² P] ATP). After reacting at 30 ° C. for 60 minutes, 50 μL of 20% TCA solution was added to stop the reaction. After leaving the reaction solution at 0 ° C. for 20 minutes, the acid-insoluble fraction was transferred to GF / C filter (Packard Japan) using a cell harvester (Packard Japan), and 250 mM was added.
Washed with H ₃ PO ₄ . After drying at 45 ° C. for 60 minutes, 40 μL of Microscint0 (Packard Japan) was added, and the radioactivity was measured by Top Count (Packard Japan). The concentration (IC ₅₀ value) of the test compound required to inhibit the incorporation of ³² P into the acid-insoluble fraction by 50% was determined by PRISM 2.01 (Graph Pad).
Software company) calculated. The results are shown in Table 45.

[Table 45]

Reference Example C2 Measurement of TNFα production inhibitory activity 1% inactivated fetal bovine serum (Life Technology (Li
fe Technologies, Inc. ), Country name: USA) and 10 mM HEPES (pH 7.
5) containing PRMI1640 medium (Life Technologies, Inc.)
The THP-1 cells cultivated in (1) were seeded in a 96-well plate at 1 × 10 ⁵ cells / well, and 1 μL of the test compound dissolved in DMSO was added.
After culturing in a carbon dioxide gas incubator at 37 ° C. for 1 hour, LPS (Wako Pure Chemical Industries, Ltd.) was added to a final concentration of 5 μg / mL. After culturing at 37 ° C. for 4 hours in a carbon dioxide gas incubator, a supernatant was obtained by centrifugation. The TNF-α concentration in the supernatant was measured by ELISA (R & D System).
It was measured by a Quantine Kit, manufactured by ms. The concentration (IC ₅₀ value) of the test compound required to inhibit TNF-α production by 50% was calculated by PRISM 2.01 (Graph Pad Software). The results are shown in Table 4.
6 shows.

[Table 46] From the above results, it can be seen that the compound (I) has an excellent p38MAP kinase inhibitory action and TNF-α production inhibitory action.

Reference Example D below is WO 00/64894
It can be manufactured according to the examples of the publication. Reference Example D1 [4- (3,5-dimethylphenyl) -5- (2-phenylmethyloxy-4-pyridyl) -1,3-thiazol-2-yl]
Amine Reference Example D2 N- [4- [2-benzoylamino-4- (4-methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D3 N- [4- (4 -Methoxyphenyl) -5- [2-
[(3-Pyridylcarbonylamino)]-4-pyridyl] -1,3-
Thiazol-2-yl] nicotinamide Reference Example D4 N- [4- [2-amino-4- (4-methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D5 N -[4- [2-Amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D6 N- [4- [2-amino-4 -(3,5-Dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzylamine Reference Example D7 N- [4- [2-amino-4- (3,5-dimethylphenyl)] -1,3-thiazol-5-yl] -2-pyridyl] benzamide hydrochloride Reference Example D8 N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazole-5 -Yl] -2-pyridyl] benzylamine dihydrochloride

Structural formulas of the compounds obtained in Reference Examples D1 to 6 are shown below. Reference example D1

[Chemical 54] Reference example D2

[Chemical 55] Reference example D3

[Chemical 56] Reference example D4

[Chemical 57] Reference example D5

[Chemical 58] Reference example D6

[Chemical 59]

Reference Example D9 N- [5- (2-benzoylamino
-4-Pyridyl) -4- (3,5-dimethylphenyl) -1,3-thiazol-2-yl] acetamide Reference Example D10 N- [5- (2-benzylamino-4-pyridyl) -4- ( 3,5-Dimethylphenyl) -1,3-thiazole-2-
Il] acetamide Reference Example D11 N- [4- [4- (4-methoxyphenyl) -2-
Methylamino-1,3-thiazol-5-yl] -2-pyridyl]
Benzamide Reference Example D12 N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D13 N- [4- [4- (4-methoxyphenyl) -2-
Methyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D14 N- [4- [2- (4-fluorophenyl) -4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide Reference Example D15 Reference Example D Compound 15-1: N- [4- [4- (4-methoxyphenyl)- 2-Methyl-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide Reference Example D Compound 15-2: N- [4- [2-Ethyl-4- (3-methylphenyl) -1, 3-Thiazol-5-yl] -2-pyridyl] phenylacetamide Reference Example D Compound 15-3: N- [4- [4- (3-Methylphenyl) -2-propyl-1,3-thiazol-5- Il] -2-pyridyl] phenylacetamide Reference Example D Compound 15-4: N- [4- [2-Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl ] Phenylacetamide Reference Example D Compound 15-5: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenyl Acetamide Reference Example D Compound 15-6: N- [4- [4- (3- methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5
Il] -2-pyridyl] phenylacetamide Reference Example D16 Reference Example D Compound 16-1: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl]- 2-Pyridyl] benzamide Reference Example D Compound 16-2: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3- Phenylpropionamide Reference Example D Compound 16-3: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3- (4 -Methoxyphenyl) propionamide Reference Example D Compound 16-4: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3 -(4-Fluorophenyl) propionamide Reference Example D Compound 16-5: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl ] -4-Phenylbutyramide Reference Example D Compound 16-6: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -5-phenylvaleramide Reference Example D Compound 16- 7: N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D Compound 16-8: N- [4- [4- (3-Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide Reference Example D Compound 16-9: N- [4- [2 -Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D Compound 16-10: N- [4- [2-Butyl-4- (3 -
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide Reference Example D Compound 16-11: N- [4- [2- (4-fluorophenyl) -4- (3-Methylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] benzamide Reference Example D Compound 16-12: N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] -3-phenylpropionamide Reference Example D Compound 16-13: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazole- 5-yl] -2-pyridyl] benzamide Reference Example D Compound 16-14: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl ] -2-Pyridyl] -3-phenylpropionamide Reference Example D Compound 16-15: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole- Five
-Yl] -2-pyridyl] benzamide Reference Example D Compound 16-16: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -3-phenylpropionamide Reference Example D Compound 16-17: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3- Thiazole-5
-Yl] -2-pyridyl] -2-thiophenecarboxamide Reference Example D Compound 16-18: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole -Five
-Yl] -2-pyridyl] -2-naphthamide

Reference Example D17 N- [4- [2-ethyl-4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-methylphenylacetamide Reference Example D18 N- [4- [2-ethyl-4- (3-methylphenyl) -1,3 -Thiazol-5-yl] -2-pyridyl] -N-methyl
-3-Phenylpropionamide Reference Example D19 Reference Example D Compound 19-1: N-benzyl-N- [4- [4- (4-
Methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl] amine Reference Example D Compound 19-2: N-benzyl-N- [4- [2-ethyl-4- (3 -Methylphenyl) -1,3-thiazol-5-yl]-
2-Pyridyl] amine Reference Example D Compound 19-3: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-Phenylethyl) amine Reference Example D Compound 19-4: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]- N- (3-phenylpropyl) amine Reference Example D Compound 19-5: N-benzyl-N- [4- [4- (3-
Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] amine Reference Example D Compound 19-6: N- [4- [4- (3-methylphenyl) -2-propyl -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine Reference Example D Compound 19-7: N- [4- [4- (3-methylphenyl) -2 -Propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine Reference Example D Compound 19-8: N-benzyl-N- [4- [2-butyl- 4- (3-Methylphenyl) -1,3-thiazol-5-yl]-
2-Pyridyl] amine Reference Example D Compound 19-9: N- [4- [2-Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-Phenylethyl) amine Reference Example D Compound 19-10: N- [4- [2-Butyl-4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine Reference Example D Compound 19-11: N-benzyl-N- [4- [2- ( Four
-Fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine Reference Example D Compound 19-12: N- [4- [2- (4-fluoro Phenyl) -4- (3-methylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] -N- (2-phenylethyl) amine Reference Example D Compound 19-13: N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1 , 3-thiazole-5-
Il] -2-pyridyl] -N- (3-phenylpropyl) amine Reference Example D Compound 19-14: N-benzyl-N- [4- [2- (2
-Chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine Reference Example D Compound 19-15: N- [4- [2- (2-chlorophenyl) -4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine Reference Example D Compound 19-16: N- [4- [2 -(2-Chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine Reference Example D Compound 19-17: N -Benzyl-N- [4- [4- (3
-Methylphenyl) -2- (4-methylthiophenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] amine Reference Example D Compound 19-18: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole- Five
-Yl] -2-pyridyl] -N- (2-phenylethyl) amine Reference Example D Compound 19-19: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl)- 1,3-thiazole-5
-Yl] -2-pyridyl] -N- (3-phenylpropyl) amine Reference Example D Compound 19-20: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl)- 1,3-thiazole-5
-Yl] -2-pyridyl] -N- (2-naphthylmethyl) amine

Reference Example D20 N- [4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Reference Example D21 Reference Example D Compound 21-1: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide Reference Example D Compound 21-2: N- [4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3 -Phenylpropionamide Reference Example D Compound 21-3: N- [4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2- Pyridyl] -2-thiophenecarboxamide Reference Example D Compound 21-4: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2 -Pyridyl] -2-naphthamide Reference Example D Compound 21-5: N-benzyl-N- [4- [4- (3-
Methylphenyl) -2- (4-methylsulfonylphenyl)-
1,3-Thiazol-5-yl] -2-pyridyl] amine Reference Example D Compound 21-6: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1 , 3-Thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl)
Amine Reference Example D Compound 21-7: N- [4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]- N- (2-naphthylmethyl) amine Reference Example D22 N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-benzyl Amine

Reference Example D23 Reference Example D Compound 23-1: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N -(4-Methoxybenzyl) amine Reference Example D Compound 23-2: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-Methoxybenzyl) amine Reference Example D Compound 23-3: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2- Pyridyl] -N- (2-methoxybenzyl) amine Reference Example D Compound 23-4: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl]- 2-Pyridyl] -N- (4-chlorobenzyl) amine Reference Example D Compound 23-5: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl ] -2-Pyridyl] -N- (3-chlorobenzyl) amine Reference Example D Compound 23-6: (R) -N- [4- [ 2-amino-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (1-phenylethyl) amine Reference Example D Compound 23-7: (S) -N- [4- [ 2-amino-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (1-phenylethyl) amine Reference Example D Compound 23-8: N- [4- [2-amino- 4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-benzyl-N-methylamine Reference Example D24 N- [4- [2-amino-4- (3 -Methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-benzylamine

Reference Example D25 Reference Example D Compound 25-1: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl]- 2-Pyridyl] -N- (2-phenylethyl) amine Reference Example D Compound 25-2: N- (4-Fluorobenzyl) -N
-[4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Amine Reference Example D Compound 25-3: N-benzyl-N-methyl-N- [4-
[4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine Reference Example D Compound 25-4: N-methyl-N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,
3-Thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine Reference Example D Compound 25-5: N- [4- [4- (3-methylphenyl) -2- (4 -Methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-thienylmethyl) amine Reference Example D26 4- (3-Methylphenyl) -2- (4-methylsulfonyl) Phenyl) -5- (2-phenylthio-4-pyridyl) -1,3-thiazole Reference Example D27 5- (2-benzylthio-4-pyridyl) -4-
(3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole Reference Example D28 4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -5- (2-phenyl Sulfonyl-4-pyridyl) -1,3-thiazole

The compounds produced in the above Reference Examples D9 to 28 are shown in Tables 47 to 52.

[Table 47]

[0244]

[Table 48]

[0245]

[Table 49]

[0246]

[Table 50]

[0247]

[Table 51]

[0248]

[Table 52]

Reference Example E1 (1) Compound of Reference Example D1 50 mg (2) Lactose 34 mg (3) Corn starch 10.6 mg (4) Corn starch (paste-like) 5 mg (5) Magnesium stearate 0.4 mg (6) Carboxymethyl cellulose calcium 20 mg Total 120 mg According to a conventional method, the above (1) to (6) were mixed and compressed with a tableting machine to obtain tablets. Reference Example E2 (1) Reference Example D Compound 16-1 10.0 mg (2) Lactose 60.0 mg (3) Corn Starch 35.0 mg (4) Gelatin 3.0 mg (5) Magnesium Stearate 2.0 mg Reference Example D Compound 16-1 A mixture of 10.0 mg, lactose 60.0 mg and corn starch 35.0 mg was used in a 10% aqueous gelatin solution 0.03 ml (3.0 mg as gelatin).
After granulating through a 1 mm mesh sieve, it is dried at 40 ° C. and sieved again. The granules thus obtained are mixed with 2.0 mg of magnesium stearate and compressed. The resulting core tablets are sugar-coated with a suspension of sucrose, titanium dioxide, talc and gum arabic. The coated tablets are polished with beeswax to obtain coated tablets. Reference Example E3 (1) Reference Example D Compound 16-1 10.0 mg (2) Lactose 70.0 mg (3) Corn starch 50.0 mg (4) Soluble starch 7.0 mg (5) Magnesium stearate 3.0 mg Reference Example D Compound 16-1 (10.0 mg) and magnesium stearate (3.0 mg) were added as an aqueous solution of soluble starch (0.07 ml).
After granulating (7.0 mg as soluble starch), it is dried and mixed with 70.0 mg lactose and 50.0 mg corn starch. The mixture is compressed to give tablets. Reference Example E4 (1) Reference Example D Compound 18 5.0 mg (2) Salt 20.0 mg (3) Distilled water Reference Example D Compound 18 5.0 mg and salt 20.0 mg were dissolved in distilled water to a total volume of 2 ml, Add water to bring the total volume to 2.0 ml. The solution is filtered and filled under aseptic conditions into 2 ml ampoules. After sterilizing the ampoule, it is sealed to obtain a solution for injection.

Reference Example F1 Genetic engineering is based on molecular cloning (Cold S
Method described in pring Harbor Laboratory, 1989)
Alternatively, the method described in the attached protocol of the reagent was followed. 1) Human adenosine A_ThreeReceptor cloning Adenosine A from human brain cDNA by PCR_ThreeReceptor remains
The gene was cloned. 1 ng brain cDNA (East
Yoko, QUICK-Clone cDNA) was used as a template, and Salvatore et al.
Report (Proc.Natl.Acad.Sci.U.S.A., 90: 10365-10369,199
3) Doing adenosine A_ThreeSee the receptor gene nucleotide sequence
Primer set created in consideration 5'-CGCCTCTAGACAAGATGC
CCAACAACAGCACTGC-3 '[SEQ ID NO: 7] and 5'-CGGGGTCGACA
CTACTCAGAATTCTTCTCAATGC-3 '[SEQ ID NO: 8]
Add 50 pmol each and add TaKaRa LA PCR Kit Ver.
PCR reaction using 2 (Takara Shuzo)
I went to Le Cycler 480 (Perkin Elmer)
(Reaction conditions: 95 ° C for 1 minute, 66 ° C for 1 minute, 75 ° C
For 2 minutes for 35 cycles). The PCR product obtained is
Perform gel electrophoresis and recover 1.0 kb DNA fragment
After that, use the Original TA Cloninng Kit (Funakoshi)
Adenosine A_ThreeThe receptor gene was cloned.
Next, the obtained plasmid was digested with the restriction enzyme XbaI (Takara sake).
Digestion with T4 DNA polymerase (Takara sake)
Blunting treatment to make the ends blunt, and then SalI (Takarashu)
A) and adenosine A_ThreeObtain a fragment of the receptor gene
It was 2) Human adenosine A_ThreeConstruction of plasmid for receptor expression PTB1411 described in JP-A-5-076385
The SRα promoter derived from BglII (Takara Shuzo)
Digest with and smooth it, digest with EcoRI (Takara Shuzo)
PCI vector (Promega) with DNA Ligation kit
(Takara Shuzo) to make pCI-SRα. Next
And digest this pCI-SRα with ClaI (Takara Shuzo)
Then, by T4 DNA polymerase (Takara Shuzo) treatment
The ends were blunted. On the other hand, pGFP-C1 (Toyo
Spinning) is digested with Bsu36I (Daiichi Pure Chemicals) and then T
4 DNA polymerase (Takara Shuzo) treatment
Sliding to obtain a 1.63 kb DNA fragment, DNA L
ligation kit (Takara Shuzo) to connect E. coli JM109
By transforming competent cells (Takara Shuzo),
The sumid pMSRαneo was obtained. Next, pMSRαne
After digesting o with EcoRI (Takara Shuzo), T4 DNA
After blunting the ends with polymerase (Takara Shuzo) treatment,
5.4 kb obtained by digesting with SalI (Takara Shuzo)
  DNA fragment and adenosine A obtained in 1) above _ThreeAcceptance
Mixing body gene fragments, DNA Ligation kit (Takara Shuzo)
, And compete with E. coli JM109 competent cells
Brewing) to transform plasmid pA_ThreeSRα
Obtained. 3) Human adenosine A_ThreeCH of receptor expression plasmid
O (dhfr⁻) Introduction and expression in cells 10% fetal bovine serum (Lifetech Oriental)
Tissue culture with Ham's F12 medium (Nippon Pharmaceutical) containing
-Grow in 750 mL flask (Becton Dickinson)
CHO (dhfr)⁻) Tryps with 0.5 g / L tryps
Shin-0.2g / L EDTA (Life Tech Orient
Cells with PBS (Lifetech Ori
Wash with enthal and centrifuge (1000 rpm, 5 minutes)
And suspended in PBS. Next, Gene Pulsar (Bio
Rad Inc.) and use the
Introduced into the cell. That is, 0.4 cm gap cuvette
8 x 10⁶Individual cells and 10 μg of human adenosine A
_ThreePlasmid pA for receptor expression_ThreeAdd SRα to 0.8
mL capacity, voltage 0.25kV, capacitance 960
Electroporated under μF. Then the cells
Transfer to Ham's F12 medium containing 10% fetal bovine serum, and
Incubate for hours, detach cells again, centrifuge, then
500 μg of Tishin (Lifetech Oriental) /
Ha containing 10% fetal bovine serum added to make up to mL.
Suspension in F12 medium^FourTo be cells / mL
96 well plate diluted (Becton Dickinson)
To obtain a geneticin-resistant strain. Then got
The prepared Geneticin-resistant strain was
Tondikinson), and then add
Nosin A_ThreeReceptor expressing cells were selected. That is, 50 pM
of¹²⁵Igan the I-AB-MECA (Amersham)
Buffer I (0.1% B)
SA, 0.25 mM PMSF, 1 μg / mL peps
HBS containing tatin and 20 μg / mL leupeptin
S (Wako Pure Chemical Industries)) for 1 hour, and
After washing with fur I, measure the radioactivity with a γ counter
Thus, the cells to which the ligand specifically binds, A _ThreeAR /
The CHO strain was selected. 4) Adenosine A_ThreePreparation of cell membrane fraction of receptor-expressing cells A obtained in 3) above_ThreeAR / CHO strain is 10% bovine
After culturing in Ham's F12 medium containing fetal serum for 2 days,
Peel off with PBS containing 0.02% EDTA and centrifuge.
Cells and collect in Assay Buffer II (50 mM Tri
Su-hydrochloric acid (pH 7.5), 1 mM EDTA, 10 mM
  Magnesium chloride, 0.25 mM PMSF, 1 μg
/ ML Pepstatin, 20μg / mL Leupepti
Polytron homogenizer (model PT)
-3000, KINEMATICA AG) 20,0
Cells are treated by treating at 00 rpm for 3 times for 20 seconds.
Was crushed. 10 minutes at 2,000 rpm after cell disruption
Centrifugation gave a supernatant containing the membrane fraction. Super this supernatant
Centrifuge (Model L8-70M, rotor 70Ti, bed
(Kuman) Centrifuge at 30,000 rpm for 1 hour to remove the membrane
A precipitate containing fractions was obtained. Next, the precipitate is 2 unit /
mL adenosine deaminase (Boehringer Mann High
Suspension in Assay Buffer II containing
Treatment for 30 minutes and then centrifuge again as above.
A precipitate containing the separated membrane fraction was obtained. 5) Adenosine A_ThreeReceptor binding experiment 1 obtained in 4) above in a 96-well microplate
Includes a membrane fraction of 00 μg / mL and a test compound at each concentration
In assay buffer II, the ligand [^ThreeH]
-Add NECA (Amersham) to 10 nM
And reacted at room temperature for 1 hour. Next, the cell harvester
Membrane drawing by filtering the reaction solution using (Packard)
Transfer minutes to Unifilter GF / C (Packard) and cool
50 mM Tris buffer (pH 7.5)
It was washed 3 times. After drying the filter,
Add 0 (Packard) to the filter and add a top counter
Measure the radioactivity with (Packard), [^ThreeH] -NEC
Required to reduce the amount of A bound to the membrane fraction to 50%
Concentration of test compound (IC_Fifty) To PRISM 2.01
(Graph Pad Software) That conclusion
As a result, the IC of the compound of Reference Example D1_FiftyThe value is 11.6 nM
there were. Compound (II) is an excellent adenosine A_ThreeTo the receptor
It can be seen that it has an affinity for.

Reference Example F2 The gene manipulation method described below is based on the literature (Maniatis et al., Molecular Cloning, Cold Spring Harbor Laborato).
ry, 1989) or the method described in the attached protocol of reagents. (1) Cloning of Human p38MAP Kinase Gene and Preparation of Recombinant Baculovirus For cloning of human p38MAP kinase gene, kidney cDNA (Toyobo, QUICK-Clone cDNA) was used as a template,
Report by Han et al. (Science 265 (5173), 808-811 (1994))
Primer set P38-U: 5'-ACCAC prepared with reference to the nucleotide sequence of p38MAP kinase gene
TCGAGATGGGACTACAAGGACGACGA
TGACAAGTCTCAGGAGAGGGCCCACG
TTCTACC-3 ′ [SEQ ID NO: 9] and PAG-L:
5'-ACCCGGTACCACAGGGTGCTCA
It was performed by the PCR method using GGACTCCATCTCT-3 ′ [SEQ ID NO: 10]. PCR reaction is Ampli
Ho using Wax PCR Gem 100 (Takara Shuzo)
t Start method. As a lower layer mixture, 10xL
A PCR Buffer 2 μL, 2.5 mM dN
TP solution 3 μL, 12.5 μM primer solution 2.5 each
μL and 10 μL of sterile distilled water were mixed. As the upper layer mixture, 1 human heart cDNA (1 ng / mL) was used as a template.
μL, 10 × LA PCR Buffer 3 μL,
2.5 mM dNTP solution 1 μL, TaKaRa LA
Taq DNA po1zyme (Takara Shuzo) 0.5
μL and 24.5 μL of sterile distilled water were mixed. One AmpliWax PCR Gem 100 (Takara Shuzo Co., Ltd.) was added to the prepared lower layer mixture, and the mixture was treated at 70 ° C. for 5 minutes and in ice for 5 minutes, and then the upper layer mixture was added to prepare a PCR reaction solution. The tube containing the reaction solution was set in a thermal cycler (Perkin Elmer) and then treated at 95 ° C for 2 minutes. Further, a cycle of 95 ° C. for 15 seconds and 68 ° C. for 2 minutes was repeated 35 times, and then, 72 ° C. for 8 minutes.
The obtained PCR product was electrophoresed on agarose gel (1%), and a 1.1 kb D containing the p38 MAP kinase gene was electrophoresed.
After recovering the NA fragment from the gel, pT7Blue-T
The plasmid pHP38 was prepared by inserting into vector (Takara Shuzo). Plasmid pFASTBAC
1 (CIBCOBRL) 4.8 kb XhoI-Kp
nI fragment and 1.1 kb X of the above plasmid pHP38
ligated with the hoI-Kpn fragment to obtain plasmid pFBHP
38 was produced. Plasmids pFBHP38 and BAC
-TO-BAC Baculovirus Expre
Recombinant baculovirus virus stock BAC- using the Sion System (GIBCOBRL).
HP38 was prepared. (2) Cloning of the human MKK3 gene and preparation of recombinant baculovirus
(Toyobo, QUICK-Clone cDNA) is used as a template and Derijard,
Primer set MKK-U: 5'-ACAAGAATTCAT prepared with reference to the nucleotide sequence of the MKK3 gene reported by B. et al. (Science 267 (5198), 682-685 (1995)).
AACATATGGCTCATCATCATCATCA
TCATTCCAAGCCACCCCGCACCCAA-
3 '[SEQ ID NO: 11] and MKK-L: 5'-TCC
CGTCTAGACTATGAGTCTTTCTCCCA
It was performed by the PCR method using GGAT-3 ′ [SEQ ID NO: 12]. PCR reaction is AmpliWax PCR G
It was carried out by the Hot Start method using em 100 (Takara Shuzo). As the lower layer mixture, 10xLA PCR Buf
fer 2 μl, 2.5 mM dNTP solution 3 μL, 1
2.5 μM each of 2.5 μL primer solution, sterile distilled water 1
0 μL was mixed. As the upper mixture, 1 μL of human kidney cDNA (1 ng / mL) was used as a template, 10 × LA
PCR Buffer 3 μL, 2.5 mM dNTP
Solution 1 μL, TaKaRa LA Taq DNA po1
ymerase (Takara Shuzo) 0.5 μL, sterile distilled water 2
4.5 μL was mixed. Ampli is added to the prepared lower layer mixture.
One Wax PCR Gem 100 (Takara Shuzo) was added, and the mixture was treated at 70 ° C. for 5 minutes and on ice for 5 minutes, and then the upper layer mixture was added to prepare a PCR reaction solution. The tube containing the reaction solution was set in a thermal cycler (Perkin Elmer) and then treated at 95 ° C for 2 minutes. Further, a cycle of 95 ° C. for 15 seconds and 68 ° C. for 2 minutes was repeated 35 times, and then, 72 ° C. for 8 minutes. The obtained PCR product was electrophoresed on agarose gel (1%), and a 1.0 kb DNA fragment containing the MKK3 gene was recovered from the gel.
It was inserted into T7Blue-Tvector (Takara Shuzo) to obtain plasmid pHMKK3. Primer set SER to mutate MKK3 into a constitutively active form (Ser at position 189 is Glu, Thr at position 193 is Glu)
-U: 5'-GGCTACTTGGTGGACGAGG
TGGCCAAGGAGATGGATGCCGGCTG
C-3 ′ [SEQ ID NO: 13] and SER-L: 5′-G
CAGCCGGGCATCCATCTCCTTGGCCA
CCTCGTCCACCAAGTAGCC-3 ′ [SEQ ID NO: 14], using QuikChange Sit
e-Directed Mutagenesis Ki
t (Stratagene) was used to introduce a mutation,
aMKK3 was obtained. Plasmid pFASTBAC1 (C
IBCOBRL) 4.8 kb EcoRI-XbaI
Fragment and 1.0 kb E of the above plasmid pcaMKK3
The coRI-XbaI fragment was ligated and the plasmid pFBc
aMKK3 was prepared. Plasmid pFBcaMKK3
And BAC-TO-BAC Baculovirus E
xpression System (GIBCOBR
L) was used to prepare a recombinant baculovirus virus stock BAC-caMKK3. (3) Preparation of activated p38 MAP kinase Sf-21 cells were treated with 100 ml of Sf-900II SFM medium (G) so as to have 1 × 10 ⁶ cells / mL.
(IBCOBRL) and then cultured at 27 ° C. for 24 hours. Recombinant baculovirus virus stock BA
C-HP38 and BAC-caMKK3 are each 0.2
After adding mL, the cells were further cultured for 48 hours. The cells were separated from the culture solution by centrifugation (3000 rpm, 10 min), and then washed twice with PBS. 1 cell
0 mL Lysis buffer (25 mM HEP
ES (pH 7.5), 1% TritonX, 130m
MNaCl, 1 mM EDTA, 1 mM DTT, 25
mM β-glycerophosphate, 20 m
M leupeptin, 1 mM APMSF, 1 mM
After suspending in Sodium orthovanadate), use a homogenizer (POLYTRON) for 200
The cells were disrupted by performing the treatment twice at 00 rpm for 2 minutes. From the supernatant obtained by centrifugation (40000 rpm, 45 minutes), Anti-FLAG M2 Affinity
The active p38MAP kinase was purified using Gel (Eastman Chemical Co.). (4) Measurement of p38 MAP kinase inhibitory activity 37. Containing 260 ng of active p38 MAP kinase and 1 µg of Myelin Basic Protein.
5 μL reaction solution (25 mM HEPES (pH 7.
5), 10 mM Magnesium Acetat
After 2.5 μL of the test compound dissolved in DMSO was added to e), the mixture was incubated at 30 ° C. for 5 minutes. ATP solution (2.5
The reaction was started by adding 10 μL of μM ATP, 0.1 μCi [g- ³² P] ATP). After reacting at 30 ° C. for 60 minutes, 50 μL of 20% TCA solution was added to stop the reaction. After leaving the reaction solution at 0 ° C. for 20 minutes, the acid-insoluble fraction was transferred to GF / C filter (Packard Japan) using a cell harvester (Packard Japan), and 250 mM was added.
Washed with H ₃ PO ₄ . After drying at 45 ° C. for 60 minutes, 40 μL of Microscint0 (Packard Japan) was added, and the radioactivity was measured by Top Count (Packard Japan). The concentration (IC ₅₀ value) of the test compound required to inhibit the incorporation of ³² P into the acid-insoluble fraction by 50% was determined by PRISM 2.01 (Graph Pad).
Software company) calculated.

The results are shown in Table 53.

[Table 53] From this, it is understood that the compound (II) has excellent p38MAP kinase inhibitory activity. Reference Example F3 Measurement of TNF-α production inhibitory activity 1% inactivated fetal bovine serum (Life Technology (Li
fe Technologies, Inc. ), Country name: USA) and 10 mM HEPES (pH 7.
5) containing PRMI1640 medium (Life Technologies, Inc.)
The THP-1 cells cultivated in (1) were seeded in a 96-well plate at 1 × 10 ⁵ cells / well, and 1 μL of the test compound dissolved in DMSO was added.
After culturing in a carbon dioxide gas incubator at 37 ° C. for 1 hour, LPS (Wako Pure Chemical Industries, Ltd.) was added to a final concentration of 5 μg / mL. After culturing at 37 ° C. for 4 hours in a carbon dioxide gas incubator, a supernatant was obtained by centrifugation. The TNFα concentration in the supernatant was measured by ELISA (R & D System).
S., Quantine Kit). The concentration of the test compound required to inhibit TNFα production by 50% (IC ₅₀ value) was calculated by PRISM 2.01 (Graph Pad Software).

The results are shown in Table 54.

[Table 54] From this, it is understood that the compound (II) has an excellent TNF-α production inhibitory activity. Reference Example G1 1-Bromo-3-ethylbenzene 3-ethylaniline (10.0 g, 82.5 mmol) in 50% sulfuric acid aqueous solution (43.6 g) at 0 ° C. sodium nitrite (6.83 g, 99.0 mmo)
The aqueous solution (16.5 mL) of l) was added dropwise over 30 minutes. The resulting reaction mixture was stirred at 0 ° C for 45 minutes. A solution of this diazonium salt is slowly heated to reflux with copper (I) bromide.
(12.4 g, 86.6 mmol) was added to a 48% hydrobromic acid solution (82.5 mL) little by little. After the addition, the reaction mixture was heated to reflux for 30 minutes. The reaction mixture was cooled to room temperature and extracted with ether. The extract was washed successively with 1N-sodium hydroxide aqueous solution and saturated brine, filtered, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate =
It was purified by 20: 1) to obtain 6.13 g (yield 40%) of the title compound. Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.23 (3H, t, J = 7.5Hz), 2.63 (2H,
q, J = 7.5Hz), 7.11-7.20 (2H, m), 7.28-7.38 (2H,
m). Reference Example G2 According to Reference Example G1, instead of 3-ethylaniline, 3- (1
The following Reference Example G compound 2 was synthesized using -methylethyl) aniline. Reference Example G Compound 2: 1-Bromo-3- (1-methylethyl) benzene oil. ¹ H-NMR (CDCl ₃ ) δ: 1.24 (6H, d, J = 7.0Hz), 2.77-2.99
(1H, m), 7.03-7.16 (2H, m), 7.27-7.34 (1H, m), 7.
37 (1H, s).

Reference Example G3 3-Ethylbenzoic acid 1-Bromo-3-ethylbenzene (5.1 g,
A tetrahydrofuran solution (45 mL) of 28 mmol) was added dropwise to a tetrahydrofuran mixture (5.0 mL) of magnesium pieces (0.74 g, 31 mmol), and the mixture was stirred for 30 minutes as it was. The reaction mixture was added to crushed dry ice, and the mixture was stirred as it was for 1 hour. 1N-hydrochloric acid was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried, filtered and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 5: 1) to give 3.87 g of the title compound (yield 93%).
Got Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.28 (3H, t, J = 7.5Hz), 2.73 (2H,
q, J = 7.5Hz), 7.34-7.50 (2H, m), 7.92-7.98 (2H,
m). Reference Example G4 According to Reference Example G3, 1-bromo-3- (1-methylethyl) benzene and 1-bromo-4-fluoro-3-methylbenzene were used instead of 1-bromo-3-ethylbenzene. The following Reference Example G compounds 4-1 and 4-2 were synthesized using each of them. Reference Example G Compound 4-1: 3- (1-methylethyl) benzoic acid oily substance. ¹ H-NMR (CDCl ₃ ) δ: 1.29 (6H, d, J = 7.0Hz), 2.98-3.06
(1H, m), 7.38-7.54 (2H, m), 7.90-8.02 (2H, m). Reference Example G Compound 4-2: 4-Fluoro-3-methylbenzoic acid Melting point 165-167 ° C. Reference Example G5 3-Ethylbenzoyl chloride 3-Ethylbenzoic acid (9.40 g, 62.6 mmol) was slowly added to thionyl chloride (45 mL) at 0 ° C, and N, N-dimethylformamide (3 drops) was added dropwise. The obtained reaction mixture was heated under reflux for 2 hours as it was. The reaction mixture was concentrated and used in the next reaction without purification.

Reference Example G6 According to Reference Example G5, 3- (1
-Methylethyl) benzoic acid, 4-fluoro-3-methylbenzoic acid, 4-cyclohexylbenzoic acid and 3,5-dimethylbenzoic acid were used respectively in the following Reference Example G compounds 6-1 to 6
-4 was synthesized. Reference Example G Compound 6-1: 3- (1-methylethyl) benzoyl chloride Used in the next reaction without purification. Reference Example G Compound 6-2: 4-Fluoro-3-methylbenzoyl chloride Used in the next reaction without purification. Reference Example G Compound 6-3: 4-Cyclohexylbenzoyl chloride Used in the next reaction without purification. Reference Example G Compound 6-4: 3,5-dimethylbenzoyl chloride boiling point 82-85 ° C (933 Pa). Reference Example G7 N- (4-chlorobenzoyl) propyleneimine A solution of propyleneimine (12 mL, 0.15 mol) in tetrahydrofuran (160 mL) was added to a 1N-sodium hydroxide aqueous solution. This mixture was added to 4-chlorobenzoyl chloride (25
g, 0.14 mol) was added dropwise. After completion of dropping, the mixture was further stirred for 30 minutes. The reaction mixture was extracted with ethyl acetate. The extract was dried and the solvent was evaporated to give the title compound (25 g, yield 89%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5Hz), 2.15 (1H,
d, J = 2.9Hz), 2.51-2.66 (2H, m), 7.39-7.47 (2H,
m), 7.93-8.01 (2H, m).

Reference Example G8 According to Reference Example G7, instead of 4-chlorobenzoyl chloride, 3-chlorobenzoyl chloride, 3-methylbenzoyl chloride, 3,5-dimethylbenzoyl chloride, 4-fluorobenzoyl chloride, benzoyl chloride, 3-bromobenzoyl chloride, 4- (methylthio) benzoyl chloride, 2-thiophene carbonyl chloride, 3-propylbenzoyl chloride, 3-trifluoromethylbenzoyl chloride, 3-ethylbenzoyl chloride, 3- (1-methylethyl) benzoyl chloride , 4-fluoro-3-methylbenzoyl chloride, 3-fluorobenzoyl chloride, 3-methoxybenzoyl chloride and 4-methoxybenzoyl chloride, respectively, and the following Reference Example G compound 8-1
~ 8-16 were synthesized. Reference Example G Compound 8-1: N- (3-chlorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.1Hz), 2.17 (1H,
d, J = 3.3Hz), 2.53-2.68 (2H, m), 7.40 (1H, dd, J =
7.7, 8.1Hz), 7.53 (1H, ddd, J = 1.5, 2.2, 8.1Hz),
7.90 (1H, dt, J = 7.7, 1.5Hz), 8.00 (1H, dd, J = 1.
5, 2.2 Hz). Reference Example G Compound 8-2: N- (3-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5Hz), 2.14 (1H,
d, J = 3.3Hz), 2.41 (3H, s), 2.51-2.66 (2H, m), 7.
32-7.39 (2H, m), 7.79-7.87 (2H, m). Reference Example G Compound 8-3: N- (3,5-dimethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5Hz), 2.13 (1H,
d, J = 3.7Hz), 2.37 (6H, s), 2.47-2.62 (2H, m), 7.
19 (1H, s), 7.64 (2H, s). Reference Example G Compound 8-4: N- (4-fluorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.2Hz), 2.14-2.15
(1H, m), 2.52-2.63 (2H, m), 7.08-7.19 (2H, m), 8.
00-8.10 (2H, m). Reference Example G Compound 8-5: N-benzoylpropyleneimine oil ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 6.0Hz), 2.15 (1H,
d, J = 3.2Hz), 2.52-2.67 (2H, m), 7.40-7.61 (3H,
m), 7.98-8.07 (2H, m). Reference Example G Compound 8-6: N- (3-bromobenzoyl) propyleneimine oil ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.2Hz), 2.16-2.18
(1H, m), 2.53-2.65 (2H, m), 7.34 (1H, t, J = 7.9H
z), 7.65-7.71 (1H, m), 7.95 (1H, d, J = 7.9Hz), 8.1
6 (1H, t, J = 1.8Hz). Reference Example G Compound 8-7: N- [4- (methylthio) benzoyl]
Propyleneimine oil ¹ H-NMR (CDCl ₃ ) δ: 1.49 (3H, d, J = 6.0Hz), 2.13 (1H,
d, J = 3.2Hz), 2.49-2.60 (5H, m), 7.24-7.30 (2H,
m), 7.90-7.96 (2H, m). Reference Example G Compound 8-8: N- (2-thiophenecarbonyl) propyleneimine oil ¹ H-NMR (CDCl ₃ ) δ: 1.43 (3H, d, J = 5.2Hz), 2.14 (1H,
d, J = 3.6Hz), 2.56-2.72 (2H, m), 7.08-7.16 (1H,
m), 7.53-7.60 (1H, m), 7.75-7.81 (1H, m). Reference Example G Compound 8-9: N- (3-propylbenzoyl) propyleneimine oil ¹ H-NMR (CDCl ₃ ) δ : 0.95 (3H, t, J = 7.3Hz), 1.40 (3H,
d, J = 4.8Hz), 1.59-1.78 2H, m), 2.14 (1H, d, J =
2.8Hz), 2.52-2.74 (4H, m), 7.34-7.43 (2H, m), 7.81-
7.89 (2H, m). Reference Example G Compound 8-10: N- (3-trifluoromethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (3H, d, J = 5.5Hz), 2.20 (1H,
d, J = 3.3Hz), 2.56-2.67 (2H, m), 7.61 (1H, t, J =
7.7Hz), 7.81 (1H, d, J = 7.7Hz), 8.21 (1H, d, J = 7.7)
Hz), 8.30 (1H, s). Reference Example G Compound 8-11: N- (3-ethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.27 (3H, t, J = 7.5Hz), 1.40 (3H,
d, J = 5.5Hz), 2.14 (1H, d, J = 2.9Hz), 2.52-2.61
(2H, m), 2.71 (2H, q, J = 7.5Hz), 7.32-7.41 (2H,
m), 7.81-7.89 (2H, m). Reference Example G Compound 8-12: N- [3- (1-methylethyl) benzoyl] propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.29 (6H, d, J = 7.0Hz), 1.40 (3H,
d, J = 5.9Hz), 2.14 (1H, d, J = 3.7Hz), 2.51-2.64
(2H, m), 2.87-3.10 (1H, m), 7.33-7.46 (2H, m), 7.8
4 (1H, dt, J = 7.0, 1.8Hz), 7.91 (1H, s). Reference Example G Compound 8-13: N- (4-fluoro-3-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.4Hz), 2.14 (1H,
d, J = 3.4Hz), 2.33 (3H, s), 2.51-2.61 (2H, m), 7.
06 (1H, t, J = 8.8Hz), 7.81-7.90 (2H, m). Reference Example G Compound 8-14: N- (3-fluorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.5Hz), 2.16 (1H,
d, J = 3.3Hz), 2.52-2.68 (2H, m), 7.25 (1H, ddd, J
= 1.1, 2.6, 8.4Hz), 7.43 (1H, ddd, J = 5.5, 7.7, 8.
1Hz), 7.69 (1H, ddd, J = 1.5, 2.6, 8.1Hz), 7.81 (1
H, ddd, J = 1.1, 1.5, 7.7 Hz). Reference Example G Compound 8-15: N- (3-methoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.9Hz), 2.14 (1H,
d, J = 2.9Hz), 2.52-2.65 (2H, m), 3.86 (3H, s), 7.
10 (1H, ddd, J = 1.1, 2.6, 8.4Hz), 7.37 (1H, dd, J =
8.4, 7.3Hz), 7.55 (1H, dd, J = 1.5, 2.6Hz), 7.63 (1
H, ddd, J = 1.1, 1.5, 7.3 Hz). Reference Example G Compound 8-16: N- (4-methoxyphenyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.9Hz), 2.11 (1H,
d, J = 3.3Hz), 2.50-2.63 (2H, m), 3.87 (3H, s), 6.
94 (2H, d, J = 9.2Hz), 8.00 (1H, d, J = 9.2Hz).

Reference Example G9 2-Fluoro-4-methylpyridine Journal of Medicinal Chemistry (J
individual of Medicinal Chemi
story), 33, pp. 1667-1675, 1990.
It was synthesized according to the method described in the year. Boiling point 82-86 ° C (10 kPa). Reference Example G10 2-Phenylmethyloxy-4-methylpyridine sodium hydride (60% paraffin dispersion, 5.0 g, 120
mmol) was washed twice with hexane (5 mL) and suspended in tetrahydrofuran (200 mL). A solution of benzyl alcohol (14 g, 120 mmol) in tetrahydrofuran (50 mL) was added dropwise to this suspension at 0 ° C, the temperature was raised to room temperature, and the mixture was stirred for 15 minutes. 2-Bromo-4-methylpyridine (20 mL, 110 mmol) was added to this solution.
In tetrahydrofuran (50 mL) was added, and the mixture was heated under reflux for 14 hours. Water (200 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried and the solvent was distilled off. The crude product was distilled under reduced pressure to give the title compound (13 g, yield 67%). Boiling point 116-118 ℃ (400 Pa). ¹ H-NMR (CDCl ₃ ) δ: 2.30 (3H, s), 5.37 (2H, s), 6.63
(1H, s), 6.72 (1H, d, J = 5.1Hz), 7.29-7.50 (5H, m),
8.03 (1H, d, J = 5.1Hz). Reference Example G11 2-tert-butoxycarbonylamino-4-methylpyridine synthesis (Synthesis), pages 877-882, 199.
6 Years or Journal of Organic Chemistry, 61, 4
It was synthesized according to the method described on pages 810 to 4811, 1996. Reference Example G12 2- (2-Fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone Under an argon atmosphere, diisopropylamine (44 mL, 0.31
An anhydrous tetrahydrofuran (300 mL) solution of (mol) was cooled to -78 ° C, and 1.6M n-butyllithium hexane solution (190 mL, 0.31 mol) was added dropwise with stirring. After the dropping, stir for 10 minutes, and then 2-fluoro-4-methylpyridine (34.5
A solution of g, 0.31 mol) in anhydrous tetrahydrofuran (30 mL) was added. The reaction mixture was stirred at -10 ° C for 30 minutes. The reaction solution was cooled to -78 ° C and N- (3-methylbenzoyl) propyleneimine (52 g, 0.30 mol) in anhydrous tetrahydrofuran (3
0 mL) solution was added dropwise. After completion of dropping, the mixture was stirred at room temperature for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was recrystallized from isopropyl ether to give the title compound (35 g, yield 52%). Melting point 66-67 ° C.

Reference Example G13 According to Reference Example G12, instead of N- (3-methylbenzoyl) propyleneimine, N- (3-methoxybenzoyl) propyleneimine, N- (4-fluorobenzoyl) propyleneimine and N- ( 3-Chlorobenzoyl) propyleneimine, respectively, using the following Reference Example G compounds 13-1 to 13-3
Was synthesized. Reference Example G Compound 13-1: 2- (2-fluoro-4-pyridyl)-
1- (3-Methoxyphenyl) ethanone oil ¹ H-NMR (CDCl ₃ ) δ: 3.86 (3H, s), 4.31 (2H, s), 6.86
(1H, s), 7.03-7.19 (2H, m), 7.31-7.59 (3H, m), 8.1
8 (1H, d, J = 5.6Hz). Reference Example G Compound 13-2: 1- (4-fluorophenyl) -2-
(2-Fluoro-4-pyridyl) ethanone melting point 100-101 ° C. Reference Example G Compound 13-3: 1- (3-chlorophenyl) -2- (2-
Fluoro-4-pyridyl) ethanone melting point 84-86 ° C. Reference Example G14 1- (3-Methylphenyl) -2- (2-methyl-4-pyridyl) ethanone Diisopropylamine (112 mL) in anhydrous tetrahydrofuran (760 mL) was cooled to -50 ° C, and stirred to give 1.6. M
A n-butyllithium hexane solution (500 mL) was added dropwise. Stir for 10 minutes after the addition is complete, then continue with 2,4-lutidine (87.9 m
A solution of L) in anhydrous tetrahydrofuran (76 mL) was added dropwise at -30 ° C. After stirring for 1 hour, N- (3-methylbenzoyl) propyleneimine (134 g) in anhydrous tetrahydrofuran (76 m
L) solution was added dropwise at -78 ° C. After the completion of dropping, the mixture was stirred at -78 ° C for 2 hours. The reaction mixture was warmed to room temperature, water (800 mL) was added, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off. The obtained residue is isopropyl ether-
Crystallization from hexane gave 156 g of the title compound (yield 91%). Melting point 56-57 ° C. Reference Example G15 According to Reference Example G14, using N- (3,5-dimethylbenzoyl) propyleneimine and N- (4-fluorobenzoyl) propyleneimine instead of N- (3-methylbenzoyl) propyleneimine, The following Reference Example G compounds 15-1 and 15-2 were synthesized. Reference Example G Compound 15-1: 1- (3,5-dimethylphenyl) -2
-(2-Methyl-4-pyridyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 2.38 (6H, s), 2.54 (3H, s), 4.21
(2H, s), 6.98-7.10 (1H, m), 7.01 (1H, m), 7.06 (1
H, s), 7.23 (1H, s), 7.60 (2H, s), 8.42-8.45 (1H,
m). Reference example G compound 15-2: 2- (2-methyl-4-pyridyl) -1-
(4-Fluorophenyl) ethanone melting point 79-81 ° C. Reference Example G16 According to Reference Examples G14 and 15, γ-collidine was used in place of 2,4-lutidine, and the following Reference Example G compound 16 was used.
-1 and 16-2 were synthesized. Reference Example G Compound 16-1: 2- (2,6-dimethyl-4-pyridyl) -1- (3-methylphenyl) ethanone Melting point 46-48 ° C. Reference Example G Compound 16-2: 1- (3,5-dimethylphenyl) -2
-(2,6-Dimethyl-4-pyridyl) ethanone Melting point 135-136
° C. Reference Example G17 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-
(4-Methoxyphenyl) ethanone 2-tert-butoxycarbonylamino-4-methylpyridine (2
A solution of 0 g, 97 mmol) in anhydrous tetrahydrofuran (300 mL) was cooled to −78 ° C., and 1.6M n-butyllithium hexane solution (140 mL, 0.23 mol) was added dropwise with stirring. After the dropwise addition was completed, the mixture was stirred at 0 ° C for 30 minutes and then cooled to -78 ° C. N- (4
-Methoxybenzoyl) propyleneimine (25 g, 0.13 mo
A solution of l) in anhydrous tetrahydrofuran (50 mL) was added dropwise.
After completion of dropping, the mixture was stirred at room temperature for 2 hours. Water (10
0 mL) and isopropyl ether (300 mL) were added, and the obtained crude crystals were collected by filtration. The crude crystals were recrystallized from tetrahydrofuran-hexane to give the title compound (23 g)
(Yield 69%) was obtained. Melting point 187-190 ° C.

Reference Example G18 According to Reference Example G17, instead of N- (4-methoxybenzoyl) propyleneimine, N- (3-methylbenzoyl) propyleneimine, N- (3,5-dimethylbenzoyl) propyleneimine, N -(3-chlorobenzoyl) propyleneimine, N-benzoylpropyleneimine, N- (4-fluorobenzoyl) propyleneimine, N- [3- (trifluoromethyl) benzoyl] propyleneimine, N- (3-bromobenzoyl) Propyleneimine, N- [4- (methylthio) benzoyl] propyleneimine, N- (2-thiophenecarbonyl) propyleneimine, N- (3-propylbenzoyl) propyleneimine, N- [3
-(1-Methylethyl) benzoyl] propyleneimine, N- (4
-Fluoro-3-methylbenzoyl) propyleneimine, N-
The following Reference Example G compounds 18-1 to 18-15 were synthesized using (3-fluorobenzoyl) propyleneimine, N- (4-chlorobenzoyl) propyleneimine and N- (3-ethylbenzoyl) propyleneimine, respectively. did. Reference Example G Compound 18-1: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone Melting point 144-146 ° C. Reference Example G Compound 18-2: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3,5-dimethylphenyl) ethanone Melting point 133-136 ° C. Reference Example G Compound 18-3: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-chlorophenyl) ethanone Melting point 152-153 ° C. Reference Example G Compound 18-4: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-phenylethanone Melting point 162-163 ° C. Reference Example G Compound 18-5: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-fluorophenyl) ethanone Melting point 139-141 ° C. Reference Example G Compound 18-6: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- [3- (trifluoromethyl) phenyl] ethanone Melting point 149-150 ° C. Reference Example G Compound 18-7: 1- (3-bromophenyl) -2- (2-
tert-Butoxycarbonylamino-4-pyridyl) ethanone melting point 132-133 ° C. Reference Example G Compound 18-8: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- [4- (methylthio) phenyl] ethanone Melting point 177-178 ° C. Reference Example G Compound 18-9: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (2-thienyl) ethanone Melting point 161-162 ° C. Reference Example G Compound 18-10: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-propylphenyl) ethanone Melting point 110-111 ° C. Reference Example G Compound 18-11: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- [3- (1-methylethyl) phenyl] ethanone Melting point 176-177 ° C. Reference Example G Compound 18-12: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-fluoro-3-methylphenyl) ethanone Melting point 143-144 ° C. Reference Example G Compound 18-13: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-fluorophenyl) ethanone Melting point 164-165 ° C. Reference Example G Compound 18-14: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-chlorophenyl) ethanone Melting point 155-156 ° C. Reference Example G Compound 18-15: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-ethylphenyl) ethanone Melting point 122-123 ° C.

Reference Example G19 1- (3,5-Dimethylphenyl) -2- (2-phenylmethyloxy)
-4-pyridyl) ethanone diisopropylamine (9.6 mL, 6
9 mmol) in anhydrous tetrahydrofuran (60 mL) at -50 ° C
The mixture was cooled to 0 ° C, and a 1.6 M n-butyllithium hexane solution (43 mL, 69 mmol) was added dropwise with stirring. After the dropping was completed, the mixture was stirred for 10 minutes, and then 2-phenylmethyloxy-4-methylpyridine (12 g, 62 mmol) in anhydrous tetrahydrofuran (12
(mL) solution was added dropwise at -30 ° C. After stirring for 1 hour, N-
(3,5-Dimethylbenzoyl) propyleneimine (12 g, 62
Anhydrous tetrahydrofuran (12 mL) solution of (mmol) was added dropwise at -30 ° C. After the dropping was completed, the temperature was gradually raised to room temperature and the mixture was stirred for 2 hours. Water (60 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 5: 1) to give the title compound (9.1 g)
(Yield 44%) was obtained. Oil. ¹ H-NMR (CDCl ₃ ) δ: 2.37 (6H, s), 4.20 (2H, s), 5.37
(2H, s), 6.72 (1H, s), 6.81 (1H, d, J = 5.1Hz), 7.22
(1H, s), 7.30-7.49 (5H, m), 7.59 (2H, s), 8.12 (1
H, d, J = 5.1 Hz). Reference Example G20 2-Bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-methoxyphenyl) ethanone hydrobromide 2- ( 2-tert-butoxycarbonylamino-4-pyridyl) -1-
Bromine (0.058 mL, 1.1 mmol) was added to a solution of (4-methoxyphenyl) ethanone (0.36 g, 1.1 mmol) in acetic acid (5 mL), and the mixture was stirred at room temperature for 1 hr. The reaction mixture was concentrated and the residue was washed with isopropyl ether to give the title compound 0.4
4 g (yield 82%) was obtained. Amorphous powder ¹ H-NMR (CDCl ₃ ) δ: 1.55 (6H, s), 3.92 (3H, s), 6.35
(1H, s), 6.99-7.03 (2H, m), 7.66 (1H, dd, J = 1.8,
6.6Hz), 8.02-8.07 (2H, m), 8.20 (1H, d, J = 6.6Hz),
8.70 (2H, d, J = 1.8Hz), 11.02 (1H, br s). Reference Example G21 According to Reference Example G20, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4- Instead of (methoxyphenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl)- 1- (3,5-dimethylphenyl) ethanone, 1- (3,5-dimethylphenyl) -2- (2-
Phenylmethyloxy-4-pyridyl) ethanone and 1- (3
The following Reference Example G compounds 21-1 to 21-4 were synthesized using -bromophenyl) -2- (2-tert-butoxycarbonylamino-4-pyridyl) ethanone, respectively. Reference Example G Compound 21-1: 2-Bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide For the next reaction without purification. Using. Reference Example G Compound 21-2: 2-Bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3,5-dimethylphenyl) ethanone hydrobromide Used in the reaction. Reference Example G Compound 21-3: 2-Bromo-1- (3,5-dimethylphenyl) -2- (2-phenylmethyloxy-4-pyridyl) ethanone hydrobromide Melting point 88-90 ° C. Reference Example G Compound 21-4: 2-Bromo-1- (3-bromophenyl) -2- (2-tert-butoxycarbonylamino-4-pyridyl)
The ethanone hydrobromide salt was used in the next reaction without purification. Reference Example G22 2-Bromo-1- (3-methylphenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide 1- (3-methylphenyl) -2- (2-methyl-4) -Pyridyl) ethanone (150 g) was dissolved in acetic acid (450 mL), bromine (34.3 mL) was added, and the mixture was stirred at 70 ° C for 3 hr. The reaction solution is cooled with ice water,
The precipitated crystals were collected by filtration. The crystals were washed with ethyl acetate to give the title compound (168 g, yield 66%). Melting point 144-146 ° C.

Reference Example G23 According to Reference Example G22, 2- (2-fluoro-4-pyridyl) -1- was used instead of 1- (3-methylphenyl) -2- (2-methyl-4-pyridyl) ethanone. (3-methylphenyl) ethanone, 2- (2-fluoro-4-pyridyl) -1- (3-methoxyphenyl) ethanone, 2-
(2-Fluoro-4-pyridyl) -1- (4-fluorophenyl) ethanone, 2- (2-fluoro-4-pyridyl) -1- (3-chlorophenyl) ethanone, 1- (3,5-dimethylphenyl ) -2- (2-Methyl-
4-pyridyl) ethanone, 2- (2-methyl-4-pyridyl) -1- (4-
Fluorophenyl) ethanone, 2- (2,6-dimethyl-4-pyridyl) -1- (3-methylphenyl) ethanone, 1- (3,5-dimethylphenyl) -2- (2,6-dimethyl-4 -Pyridyl) ethanone, 2
-(2-tert-Butoxycarbonylamino-4-pyridyl) -1- (3
-Methylphenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-chlorophenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl)
-1-Phenylethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-fluorophenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl)
-1- [3- (trifluoromethyl) phenyl] ethanone, 2- (2-
tert-butoxycarbonylamino-4-pyridyl) -1- (3-bromophenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- [4- (methylthio) phenyl] ethanone, 2 -(2-tert-butoxycarbonylamino-4-pyridyl) -1- (2-thienyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-propylphenyl)
Ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-[(1-methylethyl) phenyl] ethanone, 2- (2
-tert-butoxycarbonylamino-4-pyridyl) -1- (3-fluorophenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-chlorophenyl) ethanone, 2- ( 2-tert-butoxycarbonylamino-4-pyridyl)
-1- (3-Ethylphenyl) ethanone and 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-fluoro-3-
The following Reference Example G compounds 23-1 to 23-22 were respectively synthesized using methylphenyl) ethanone. Reference Example G Compound 23-1: 2-Bromo-2- (2-fluoro-4-)
Pyridyl) -1- (3-methylphenyl) ethanone hydrobromide salt was used in the next reaction without purification. Reference Example G Compound 23-2: 2-Bromo-2- (2-fluoro-4-)
Pyridyl) -1- (3-methoxyphenyl) ethanone hydrobromide salt was used in the next reaction without purification. Reference Example G Compound 23-3: 2-Bromo-2- (2-fluoro-4-)
Pyridyl) -1- (4-fluorophenyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 7.16 (1H, s), 7.37-7.54 (4H,
m), 8.11-8.24 (2H, m), 8.30 (1H, d, J = 5.0Hz). Reference Example G compound 23-4: 2-bromo-1- (3-chlorophenyl) -2- (2-fluoro) -4-Pyridyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 7.19 (1H, s), 7.38 (1H, s), 7.5
2-7.56 (1H, m), 7.64 (1H, t, J = 8.0Hz), 7.77-7.82
(1H, m), 8.05-8.09 (1H, m), 8.16 (1H, t, J = 1.8Hz),
8.32 (1H, d, J = 5.2Hz), 10.23 (1H, br s). Reference Example G Compound 23-5: 2-Bromo-1- (3,5-dimethylphenyl) -2- (2-methyl- 4-Pyridyl) ethanone hydrobromide was used for the next reaction as it was. Reference Example G Compound 23-6: 2-Bromo-1- (4-fluorophenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 3.02 (3H, s), 6.68 (1H, s),
7.23 (2H, t, J = 8.4Hz), 8.05 (1H, s), 8.10-8.22 (3
H, m), 8.65 (1H, br s). Reference Example G Compound 23-7: 2-Bromo-2- (2,6-dimethyl-4)
-Pyridyl) -1- (3-methylphenyl) ethanone hydrobromide salt It was used in the next reaction as it was without purification. Reference Example G Compound 23-8: 2-Bromo-1- (3,5-dimethylphenyl) -2- (2,6-dimethyl-4-pyridyl) ethanone hydrobromide Melting point 208-212 ° C. Reference Example G Compound 23-9: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (3-methylphenyl) ethanone hydrobromide melting point 182-185 ° C. Reference Example G Compound 23-10: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (3-chlorophenyl) ethanone hydrobromide melting point 199-200 ° C. Reference Example G Compound 23-11: 2- (2-amino-4-pyridyl)-
2-Bromo-1-phenylethanone hydrobromide melting point 155-156 ° C. Reference Example G Compound 23-12: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (4-fluorophenyl) ethanone hydrobromide melting point 171-172 ° C. Reference Example G Compound 23-13: 2- (2-amino-4-pyridyl)-
2-Bromo-1- [3- (trifluoromethyl) phenyl] ethanone hydrobromide melting point 174-175 ° C. Reference Example G Compound 23-14: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (3-bromophenyl) ethanone hydrobromide was used in the next reaction without purification. Reference Example G Compound 23-15: 2- (2-amino-4-pyridyl)-
2-Bromo-1- [4- (methylthio) phenyl] ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 6.96-7.09 (2H, m), 7.24 (1H,
s), 7.32-7.43 (1H, m), 7.98 (1H, d, J = 6.6Hz), 8.1
2-8.36 (2H, m). Reference Example G Compound 23-16: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (2-thienyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 2.57 (3H, s), 6.94-7.01 (1H,
m), 7.14 (1H, s), 7.21 (1H, s), 7.38-7.46 (2H, m),
7.83-8.06 (3H, m), 8.21 (2H, br). Reference Example G Compound 23-17: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (3-propylphenyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 0.90 (3H, t, J = 7.3 Hz), 1.53-
1.73 (2H, m), 2.65 (2H, t, J = 7.5Hz), 3.40 (2H, br
s), 6.97 (1H, dd, J = 1.8, 6.6Hz), 7.13 (1H, s), 7.1
9 (1H, s), 7.46-7.59 (2H, m), 7.89-7.99 (3H, m),
8.14 (1H, brd, J = 6.6Hz). Reference Example G Compound 23-18: 2- (2-amino-4-pyridyl)-
2-Bromo-1- [3- (1-methylethyl) phenyl] ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 1.24 (6H, d, J = 6.6Hz) , 3.00 (1
H, septet, J = 6.6Hz), 7.15 (1H, s), 7.17 (1H, s),
7.46-7.65 (2H, m), 7.88-7.98 (4H, m), 8.09 (1H, br
s). Reference Example G Compound 23-19: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (3-fluorophenyl) ethanone hydrobromide melting point 206-207 ° C. Reference Example G Compound 23-20: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (4-chlorophenyl) ethanone hydrobromide melting point 202-203 ° C. Reference Example G Compound 23-21: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (3-ethylphenyl) ethanone hydrobromide melting point 46-47 ° C. Reference Example G Compound 23-22: 2- (2-amino-4-pyridyl)-
2-Bromo-1- (4-fluoro-3-methylphenyl) ethanone hydrobromide melting point 225-226 ° C.

Reference Example G24 4- (Methylthio) thiobenzamide 4- (methylthio) benzonitrile (12 g, 80 mmol) was dissolved in a 4N-hydrogen chloride solution in ethyl acetate (130 mL). O, O-diethyl dithiophosphate (15 mL, 88 mmol) was added to this solution, and the mixture was stirred at room temperature for 22 hr. Water in the reaction mixture
(100 mL) was added, and the mixture was extracted with ethyl acetate. After filtering the insoluble matter, the filtrate was washed with saturated saline and dried, and then the solvent was distilled off. The residue was recrystallized from ethyl acetate to give the title compound (10 g, yield 67%). Melting point 176-178 [deg.] C. Reference Example G25 According to Reference Example G24, instead of 4- (methylthio) benzonitrile, 2-chlorobenzonitrile, 4-chlorobenzonitrile, 2-fluorobenzonitrile, 4-fluorobenzonitrile, 2,4-difluorobenzo Nitrile, butyronitrile, valeronitrile, 3-phenylpropionitrile,
The following Reference Example G compounds 25-1 to 25-10 were synthesized using 4-phenylbutyronitrile and 1-methylpiperidine-4-carbonitrile, respectively. Reference Example G Compound 25-1: 2-chlorothiobenzamide melting point 58-59 ° C. Reference Example G compound 25-2: 4-chlorothiobenzamide melting point 130-131 ° C. Reference Example G Compound 25-3: 2-Fluorothiobenzamide melting point 113-114 ° C. Reference Example G compound 25-4: 4-fluorothiobenzamide melting point 156-157 ° C. Reference Example G Compound 25-5: 2,4-difluorothiobenzamide melting point 127-128 ° C. Reference Example G Compound 25-6: Thiobutyramide oily substance ¹ H-NMR (CDCl ₃ ) δ: 0.99 (3H, t, J = 7.6 Hz), 1.72-1.9
3 (2H, m), 2.64 (2H, t, J = 7.6Hz), 7.02 (1H, br
s), 7.77 (1H, br s). Reference Example G Compound 25-7: thiovaleramide oil ¹ H-NMR (CDCl ₃ ) δ: 0.94 (3H, t, J = 7.3Hz), 1.31-1.49
(2H, m), 1.68-1.83 (2H, m), 2.67 (2H, t, J = 7.7H
z), 6.92 (1H, br s), 7.73 (1H, br s). Reference Example G Compound 25-8: 3-phenyl (thiopropionamide) Melting point 83-84 ° C. Reference Example G Compound 25-9: 4-phenyl (thiobutylamide) Melting point 60-61 ° C. Reference Example G Compound 25-10: 1-Methylpiperidine-4-carbothioamide Melting point 216-220 ° C. Reference Example G26 Ethyl (4-phenyl-1-piperazinyl) carbothioyl carbamate Ethyl isothiocyanatoformate (8.1 g, 62 mmol)
Solution of 1-phenylpiperazine (10 g,
62 mmol) was added and the mixture was heated to reflux for 1 hour. The reaction mixture was concentrated, and the crude crystals were recrystallized from ethyl acetate to give the title compound (13 g, yield 73%). Melting point 134-135 ° C. Reference Example G27 According to Reference Example G26, the following Reference Example G compound 27 was synthesized using 1-methylpiperazine instead of 1-phenylpiperazine. Reference Example G Compound 27: Ethyl (4-methyl-1-piperazinyl) carbothioyl carbamate Melting point 155-157 ° C.

Reference Example G28 4-Phenyl-1-piperazinecarbothioamidoethyl (4-phenyl-1-piperazinyl) carbothioyl carbamate (13 g, 44 mmol) was added to concentrated hydrochloric acid (44 mL),
The mixture was stirred at 80 ° C. for 2 hours. The reaction mixture was made basic with 8N-sodium hydroxide aqueous solution, and the crystals were collected by filtration. The crystals were washed with water and dried to give 6.1 g of the title compound (yield 63
%). Melting point 178-179 ° C. Reference Example G29 According to Reference Example G28, instead of ethyl (4-phenyl-1-piperazinyl) carbothioyl carbamate, ethyl
The following Reference Example G compound 29 was synthesized using (4-methyl-1-piperazinyl) carbothioyl carbamate. Reference Example G Compound 29: 4-methyl-1-piperazinecarbothioamide melting point 173-175 ° C. Reference Example G30 3,3,3-trifluorothiopropionamide 3,3,3-trifluoropropionamide (2.00 g, 15.7 mm
ol) in anhydrous tetrahydrofuran (100 mL) was added Lawesson's reagent (3.79 g, 9.37 mmol), and the mixture was heated under reflux for 2 hours. After cooling to room temperature, saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried and the solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 10: 1 to 4: 1) to give the title compound (1.85 g, yield 82%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 3.61 (2H, q, J = 10.4Hz), 6.70-8.0
0 (2H, m). Reference Example G31 According to Reference Example G30, ethyl 3-amino-3-oxopropanate and ethyl 2-amino-2-oxoacetate were used instead of 3,3,3-trifluoropropionamide. Then, the following Reference Example G compounds 31-1 and 31-2 were synthesized. Reference Example G Compound 31-1: Ethyl 3-amino-3-thioxopropanate oily substance. ¹ H-NMR (CDCl ₃ ) δ: 1.31 (3H, t, J = 7.1Hz), 3.85 (2H,
s), 4.22 (2H, q, J = 7.1Hz), 7.74 (1H, br s), 8.92
Reference Example G Compound 31-2: Ethyl 2-amino-2-thioxoacetate ¹ H-NMR (CDCl ₃ ) δ: 1.41 (3H, t, J = 7.2Hz), 4.38 ( 2H,
q, J = 7.2Hz), 7.68 (1H, br s), 8.24 (1H, br s). Reference Example G32 According to Example 33 described later, 4- (3,5-dimethylphenyl) -5
-(2-Methyl-4-pyridyl) -2- [4- (methylthio) phenyl]-
Instead of 1,3-thiazole, 4- (3-methylphenyl) -2-
The following Reference Example G compound 32 was synthesized using (4-methylthiophenyl) -5- (4-pyridyl) -1,3-thiazole. Reference Example G Compound 32: 4- [4- (3-methylphenyl) -2- (4-
Methylsulfonylphenyl) -1,3-thiazol-5-yl] pyridine-N-oxide melting point 196-197 ° C. Reference Example G33 1-tert-Butoxycarbonylpiperidine-4-carboxamide Piperidine-4-carboxamide (5.0 g, 39 mmol) in water (30
Di-tert-butyl dicarbonate (9.2 mL, 40 mmol) was slowly added dropwise to the (mL) solution, and the mixture was stirred as it was at room temperature for 24 hours. The reaction mixture was extracted with ethyl acetate, the extract was washed with saturated brine, dried and the solvent was evaporated. The residue was crystallized from ethyl acetate to obtain the title compound (6.9 g, yield 78%). Melting point 163-165 ° C. Reference Example G34 According to Reference Example G30, the following Reference Example G compound 34 was synthesized using 1-tert-butoxycarbonylpiperidine-4-carboxamide instead of 3,3,3-trifluoropropionamide. Reference Example G Compound 34: 1-tert-butoxycarbonylpiperidine-4-carbothioamide melting point 129-131 ° C. Reference Example G35 According to Reference Example G12, the following Reference Example G compound 35 was synthesized using N- (3-ethylbenzoyl) propyleneimine instead of N- (3-methylbenzoyl) propyleneimine. Reference Example G Compound 35: 1- (3-Ethylphenyl) -2- (2-fluoro-4-pyridyl) ethanone Melting point 59-60 ° C.

Reference Example G36 According to Reference Example G22, instead of 1- (3-methylphenyl) -2- (2-methyl-4-pyridyl) ethanone, 1- (3-ethylphenyl) -2- (2 -Fluoro-4-pyridyl) ethanone,
The following Reference Example G compound 36 was synthesized. Reference Example G Compound 36: 2-Bromo-1- (3-ethylphenyl)-
2- (2-Fluoro-4-pyridyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 1.22 (3H, t, J = 7.6Hz), 2.70 (2
H, q, J = 7.6Hz), 7.19 (1H, s), 7.39 (1H, s), 7.45-
7.58 (3H, m), 7.77 (1H, br s), 7.92-7.97 (2H, m),
8.30 (1H, d, J = 5.6Hz). Reference Example G37 Ethyl 2,2-difluoropropionate ethylpyruvate (3.0 g, 26 mmol) and diethylaminosulfur trifluoride (3.4 mL, 26 mmol) over 1 hour. The mixture was added dropwise, and the reaction mixture was stirred at 60 ° C for 4 hr. The reaction mixture was poured into ice water and extracted with ethyl acetate. The extract was washed with saturated brine, dried, and the solvent was evaporated to give the title compound (1.2 g, yield 78%). Oil ¹ H-NMR (CDCl ₃ ) δ: 1.36 (3H, t, J = 7.2Hz), 1.81 (3
H, t, J = 19.0Hz), 4.33 (2H, q, J = 7.2Hz). Reference Example G38 2,2-Difluoropropionic acid Ethyl 2,2-difluoropropionate in 2N sodium hydroxide aqueous solution (26 mL) (1.2 g, 8.8 mmol) ethanol (26 m
L) solution was added and the mixture was stirred at room temperature for 14 hours. The reaction mixture was acidified with 2N hydrochloric acid and then extracted with ether.
After drying the extract, the solvent was distilled off to give the title compound.
0.9 g (yield 92%) was obtained. Oil ¹ H-NMR (CDCl ₃ ) δ: 1.85 (3H, t, J = 19.0Hz), 6.21 (1
H, br s). Reference Example G39 2,2-Difluoropropionamide 2,2-Difluoropropionic acid (7.8 g, 71 mmol) in tetrahydrofuran (80 mL) was dissolved in oxalyl chloride (6.6 m).
L, 78 mmol) at room temperature, and then N, N-dimethylformamide (2 drops) was added to the solution. The reaction mixture at room temperature
Stir for 2 hours. The reaction solution was added dropwise to 25% ammonia water at 0 ° C over 15 minutes, and the mixture was further stirred for 1 hour. The reaction mixture was extracted with ethyl acetate. After drying the extract, the solvent was distilled off. The obtained crude mixture was crystallized from hexane to give the title compound (3.7 g, yield 49%). Melting point 70-71 ° C. Reference Example G40 According to Reference Example G24, the following Reference Example G compound 40 was synthesized using (methylthio) acetonitrile instead of 4- (methylthio) benzonitrile. Reference Example G Compound 40: (Methylthio) thioacetamide Melting point 66-67 ° C. Reference Example G41 According to Reference Example G30, instead of 3,3,3-trifluoropropionamide, 3- (methylthio) propionamide, 2,
The following Reference Example G using 2-difluoropropionamide
Compounds 41-1 and 41-2 were synthesized. Reference Example G Compound 41-1: 3- (methylthio) thiopropionamide oily substance ¹ H-NMR (CDCl ₃ ) δ: 2.17 (3H, s), 2.93 (4H, s), 7.52
(2H, br s). Reference Example G Compound 41-2: 2,2-difluorothiopropionamide oil ¹ H-NMR (CDCl ₃ ) δ: 1.98 (3H, t, J = 18.5 HZ), 7.56
(1H, br s), 7.72 (1H, br s). Reference Example G42 2-Amino-1-methyl-2-oxoethylbenzoate 2-hydroxypropionamide (10.8 g, 121 mmol) in pyridine (40 mL) Add benzoyl chloride (14.2 m
L, 122 mmol) was added and the mixture was warmed to room temperature. After stirring the reaction mixture at room temperature for 3 hours, the solvent was evaporated.
Aqueous sodium hydrogen carbonate solution was poured into the residue, and the mixture was extracted with ethyl acetate. The extract was washed twice with 1N hydrochloric acid and then with water. The extract was dried and then concentrated. The obtained crude crystals were recrystallized from ethyl acetate-hexane to give the title compound (17.9 g, yield 77%). Melting point 116-117 ° C. Reference Example G43 2-amino-1-methyl-2-thioxoethylbenzoate 2-amino-1-methyl-2-oxoethylbenzoate (10.0
Lawson's reagent (11.2 g, 27.7 mmol) was added to 1,2-dimethoxyethane (90 mL) (g, 52.0 mmol) at 0 ° C., and the mixture was warmed to room temperature. Stir the reaction mixture at room temperature for 24 hours,
The precipitate was filtered off. The filtrate was concentrated. The residue was dissolved in ethyl acetate, and this solution was washed with saturated saline. The extract was dried and then concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 2: 1) to obtain crude crystals. The crude crystals were recrystallized from ethyl acetate-hexane to obtain 8.60 g (yield 79%) of the title compound. Melting point 100-101 ° C.

Reference Example H1 [5- (2-amino-4-pyridyl) -4- (4-methoxyphenyl) -1,
3-Thiazol-2-yl] amine 2-bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-methoxyphenyl) ethanone hydrobromide (2
-(2-tert-Butoxycarbonylamino-4-pyridyl) -1- (4
It was synthesized from -methoxyphenyl) ethanone (4.5 g, 13 mmol) by the method described in Reference Example G20. ) Of acetonitrile (40
Thiourea (1.1 g, 14 mmol) and triethylamine (1.9 mL, 14 mmol) were added to the (mL) solution, and the mixture was stirred at 80 ° C for 2 hr. The reaction mixture was cooled to room temperature and then concentrated.
To the residue was added saturated aqueous sodium hydrogen carbonate solution (200 mL),
The obtained solid was collected by filtration and washed with water. 2N-hydrochloric acid (35 mL) was added to this solid, and the mixture was stirred at 100 ° C. for 45 min.
The reaction mixture was cooled to room temperature, and then 8N-sodium hydroxide aqueous solution (10 mL) and sodium hydrogen carbonate aqueous solution (100 m
L) was added. The obtained crude crystals were collected by filtration and washed with water. The crude crystals were recrystallized from ethanol to give the title compound (2.7 g, yield 69%). Melting point 251-254 ° C. Reference Example H2 [5- (2-tert-butoxycarbonylamino-4-pyridyl) -3-
(4-Methoxyphenyl) -1,3-thiazol-2-yl] amine 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-
Bromine (1.0 mL) was added to a solution of (4-methoxyphenyl) ethanone (6.1 g, 18 mmol) in acetic acid (100 mL), and the mixture was stirred at room temperature for 2 hr. The reaction mixture was concentrated. Dissolve the residue in acetonitrile (100 mL) and add thiourea (1.1 mL) to the solution.
g, 14 mmol) and triethylamine (3.0 mL, 22 mmol) were added, and the mixture was stirred at room temperature for 2 hr and then concentrated.
A saturated aqueous sodium hydrogencarbonate solution (50 mL) was added to the residue, and the obtained solid was collected by filtration, washed with water, and recrystallized from ethanol to give the title compound (1.7 g, yield 24%). Melting point 270 ° C or higher (decomposition) Reference Example H3 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2
-Ethyl-4- (3-methylphenyl) -1,3-thiazole 2-bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromic acid Salt (2-
(2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-
It was synthesized from methylphenyl) ethanone (5.0 g, 24 mmol) by the method described in Reference Example G21. ) And thiopropionamide (1.4 g, 16 mmol) in N, N-dimethylformamide (50 m
L) The solution was stirred at room temperature for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate = 4
: 1) to obtain crystals. The crystals were washed with hexane to give the title compound (2.43 g, yield 39%). Melting point 162-163 ° C. Reference Example H4 According to Reference Example H3, instead of thiopropionamide,
The following Reference Example H compounds 4-1 and 4-2 were synthesized using thioacetamide and 4- (methylthio) thiobenzamide, respectively. Reference Example H Compound 4-1: 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-methyl-4- (3-methylphenyl) -1,3-thiazole Used in the reaction. Reference Example H Compound 4-2: 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -4- (3-methylphenyl) -2- [4-
(Methylthio) phenyl] -1,3-thiazole Used in the next reaction without purification. Reference Example H5 According to Reference Example H4, instead of 2-bromo-2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo-2- The following Reference Example H compound 5 was synthesized using -2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-methoxyphenyl) ethanone hydrobromide. Reference Example H Compound 5: 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -4- (4-methoxyphenyl) -2-methyl-
The 1,3-thiazole was used in the next reaction without purification.

Reference Example H6 [5- (2-Fluoro-4-pyridyl) -4- (3-methylphenyl) -1,
3-Thiazol-2-yl] amine 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide and thiourea (3.03 g, 39.8 m
Triethylamine (5.2 mL, 37.3 mmol) was added to an acetonitrile (50 mL) mixture of (mol), and the mixture was stirred at 80 ° C. for 2 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. After washing the obtained solid with water,
Dried. The crude crystals were recrystallized from ethanol to give the title compound (3.67 g, yield 35%). Melting point 214-218 ° C. Reference Example H7 According to Reference Example H6, instead of 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo-2- ( 2-Fluoro-4-pyridyl) -1- (3-methoxyphenyl) ethanone hydrobromide, 2-bromo-1- (3-
Chlorophenyl) -2- (2-fluoro-4-pyridyl) ethanone hydrobromide, 2-bromo-1- (4-fluorophenyl) -2- (2
-Fluoro-4-pyridyl) ethanone hydrobromide, 2-bromo-1- (3-methylphenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide, 2-bromo-1 -(3,5-Dimethylphenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide, 2
-Bromo-1- (3,5-dimethylphenyl) -2- (2,6-dimethyl-4
-Pyridyl) ethanone hydrobromide and 2-bromo-1- (3,
5-Dimethylphenyl) -2- (2,6-dimethyl-4-pyridyl) ethanone hydrobromide, 2-bromo-1- (4-fluorophenyl) -2- (2-methyl-4-pyridyl) The following Reference Example H compounds 7-1 to 7-8 were prepared using ethanone hydrobromide.
Was synthesized. Reference Example H Compound 7-1: [5- (2-fluoro-4-pyridyl) -4]
-(3-Methoxyphenyl) -1,3-thiazol-2-yl] amine melting point 190-191 ° C. Reference Example H Compound 7-2: 4- (3-chlorophenyl) -5- (2-fluoro-4-pyridyl) -1,3-thiazol-2-yl] amine Melting point 227-228 ° C. Reference Example H Compound 7-3: [4- (4-fluorophenyl) -5- (2
-Fluoro-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 243-245 ° C. Reference Example H Compound 7-4: [4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 205-206 ° C. Reference Example H Compound 7-5: [4- (3,5-dimethylphenyl) -5-
(2-Methyl-4-pyridyl) -1,3-thiazol-2-yl] amine Melting point 219-220 ° C. Reference Example H Compound 7-6: [5- (2,6-dimethyl-4-pyridyl)
-4- (3-Methylphenyl) -1,3-thiazol-2-yl] amine melting point 214-216 ° C. Reference Example H Compound 7-7: [4- (3,5-dimethylphenyl) -5-
(2,6-Dimethyl-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 256-258 ° C. Reference Example H Compound 7-8: [4- (4-fluorophenyl) -5- (2
-Methyl-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 233-234 ° C. Reference Example H8 According to Reference Example H6, the following Reference Example H compound 8 was synthesized using N-methylthiourea instead of thiourea. Reference Example H Compound 8: N-methyl- [5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine Melting point 186-187 ° C. Reference Example H9 According to Reference Example H8, instead of 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo-2- ( The following Reference Example H compound 9 was synthesized using 2-methyl-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide. Reference Example H Compound 9: N-methyl [4- (3-methylphenyl) -5-
(2-Methyl-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 164-165 ° C. Reference Example H10 According to Reference Example H9, instead of N-methylthiourea, N, N-
The following Reference Example H compound 10 was prepared using dimethylthiourea.
Was synthesized. Reference Example H Compound 10: N, N-dimethyl [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
Amine melting point 77-79 ° C.

Reference Example H11 2-Ethyl-5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole 2-bromo-2- (2-fluoro-4-pyridyl) ) -1- (3-Methylphenyl) ethanone hydrobromide (11
g, 29 mmol) and thiopropionamide (2.7 g, 30 mmol)
N, N-dimethylformamide (30 mL) solution of was stirred at room temperature for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 4: 1) to obtain 3.3 g (yield 38%) of the title compound. Oil ¹ H-NMR (CDCl ₃ ) δ: 1.64 (3H, t, J = 7.6Hz), 2.34 (3H,
s), 3.10 (2H, q, J = 7.6Hz), 6.84-6.86 (1H, m), 7.
05-7.09 (1H, m), 7.13-7.25 (3H, m), 7.37 (1H, s),
8.10 (1H, d, J = 5.6Hz). Reference Example H12 According to Reference Example H11, 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide was prepared. The following Reference Example H compound 12 was synthesized using 2-bromo-1- (3-chlorophenyl) -2- (2-fluoro-4-pyridyl) ethanone hydrobromide instead of the salt. Reference Example H Compound 12: 2-Ethyl-4- (3-chlorophenyl)-
5- (2-Fluoro-4-pyridyl) -1,3-thiazole melting point 102-103 ° C. Reference Example H13 According to Reference Example H11, instead of 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo-1- ( 3-Methylphenyl) -2- (2-methyl-
The following Reference Example H compound 13 was synthesized using 4-pyridyl) ethanone hydrobromide. Reference Example H Compound 13: 2-Ethyl-4- (3-methylphenyl)-
5- (2-Methyl-4-pyridyl) -1,3-thiazole oil ¹ H-NMR (CDCl ₃ ) δ: 1.45 (3H, t, J = 7.6Hz), 2.33 (3H,
s), 2.51 (3H, s), 3.09 (2H, q, J = 7.6Hz), 6.99 (1
H, dd, J = 1.2, 5.2Hz), 7.13-7.30 (4H, m), 7.39 (1
H, s), 8.38 (1H, d, J = 5.2Hz).

Reference Example H14 According to Reference Example H13, instead of thiopropionamide, 2-chlorothiobenzamide, 4-chlorothiobenzamide, 2-fluorothiobenzamide, 4-fluorothiobenzamide, 2,4-difluorothiobenzamide. , Thiobenzamide, phenyl (thioacetamide), 3-phenyl
(Thiopropionamide), 4-phenyl (thiobutylamide), thiovaleramide, thiobutylamide, ethyl 2
-Amino-2-thioxoacetate, 4-methyl-1-piperazinecarbothioamide and 1-methylpiperidine-4-carbothioamide were used to synthesize the following Reference Example H compounds 14-1 to 14-14. . Reference Example H Compound 14-1: 2- (2-chlorophenyl) -4- (3-
Methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazole melting point 83-84 ° C. Reference Example H Compound 14-2: 2- (4-chlorophenyl) -4- (3-
Methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazole melting point 104-105 ° C. Reference Example H Compound 14-3: 2- (2-fluorophenyl) -4-
(3-Methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazole Melting point 73-74 ° C. Reference Example H Compound 14-4: 2- (4-fluorophenyl) -4-
(3-Methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazole Melting point 89-91 ° C. Reference Example H Compound 14-5: 2- (2,4-difluorophenyl)
-4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-
Thiazole melting point 90-91 ° C. Reference Example H Compound 14-6: 4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -2-phenyl-1,3-thiazole melting point 79-80 ° C. Reference Example H Compound 14-7: 4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -2- (phenylmethyl) -1,3-thiazole melting point 82-84 ° C. Reference Example H Compound 14-8: 4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -2- (2-phenylethyl) -1,3-thiazole melting point 64-65 ° C. Reference Example H Compound 14-9: 4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -2- (3-phenylpropyl) -1,3-thiazole oil ¹ H-NMR (CDCl ₃ ) δ: 2.12-2.27 (2H, m), 2.33 (3H, s),
2.50 (3H, s), 2.79 (2H, t, J = 7.7Hz), 3.08 (2H, t,
J = 7.9Hz), 6.98 (1H, dd, J = 1.4, 5.6Hz), 7.10-7.3
5 (9H, m), 7.38 (1H, s), 8.38 (1H, d, J = 5.6Hz). Reference Example H compound 14-10: 2-butyl-4- (3-methylphenyl) -5- ( 2-Methyl-4-pyridyl) -1,3-thiazole oil ¹ H-NMR (CDCl ₃ ) δ: 0.99 (3H, t, J = 7.1Hz), 1.43-1.56
(2H, m), 1.76-1.91 (2H, m), 2.33 (3H, s), 2.50 (3
H, s), 3.05 (2H, t, J = 7.9Hz), 6.99 (1H, d, J = 5.4H
z), 7.10-7.20 (4H, m), 7.38 (1H, s), 8.37 (1H, d, J
= 5.4 Hz). Reference Example H Compound 14-11: 4- (3-methylphenyl) -5-
(2-Methyl-4-pyridyl) -2-propyl-1,3-thiazole oil ¹ H-NMR (CDCl ₃ ) δ: 1.08 (3H, t, J = 7.4Hz), 1.79-2.00
(2H, m), 2.33 (3H, s), 2.50 (3H, s), 3.03 (2H, t,
J = 7.4Hz), 6.99 (1H, d, J = 5.3Hz), 7.10-7.20 (4H,
m), 7.39 (1H, s), 8.37 (1H, d, J = 5.3Hz). Reference Example H Compound 14-12: Ethyl [4- (3-methylphenyl) -5- (2-methyl-4- Pyridyl) -1,3-thiazole-2-
Il] carboxylate melting point 97-98 ° C. Reference Example H Compound 14-13: 4- (3-methylphenyl) -2-
(4-Methylpiperazin-1-yl) -5- (2-methyl-4-pyridyl) -1,3-thiazole melting point 115-116 ° C. Reference Example H Compound 14-14: 4- (3-methylphenyl) -2-
(1-Methylpiperidin-4-yl) -5- (2-methyl-4-pyridyl) -1,3-thiazole melting point 127-130 ° C. Reference Example H15 According to Reference Example H11, the following Reference Example H compound 15 was synthesized using 4- (methylthio) thiobenzamide instead of thiopropionamide. Reference Example H Compound 15: 5- (2-Fluoro-4-pyridyl) -4- (3
-Methylphenyl) -2- [4- (methylthio) phenyl] -1,3-thiazole melting point 97-100 ° C. Reference Example H16 According to Reference Example H15, instead of 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo-1- ( 3-Methylphenyl) -2- (2-methyl-
4-pyridyl) ethanone hydrobromide, 2-bromo-1- (3,5-
Dimethylphenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide, 2-bromo-1- (3,5-dimethylphenyl) -2-
(2,6-Dimethyl-4-pyridyl) ethanone hydrobromide, 2-
Bromo-1- (3,5-dimethylphenyl) -2- (2,6-dimethyl-4-
Pyridyl) ethanone hydrobromide, 2-bromo-1- (4-fluorophenyl) -2- (2-methyl-4-pyridyl) ethanone hydrobromide and 2- (2-amino-4-pyridyl ) -2-Bromo-1-
The following Reference Example H compounds 16-1 to 16-6 were synthesized using (3-chlorophenyl) ethanone hydrobromide, respectively. Reference Example H Compound 16-1: 4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-
Thiazole melting point 119-122 ° C. Reference Example H Compound 16-2: 4- (3,5-dimethylphenyl) -5
-(2-Methyl-4-pyridyl) -2- [4- (methylthio) phenyl]-
1,3-thiazole melting point 123-125 ° C. Reference Example H Compound 16-3: 5- (2,6-dimethyl-4-pyridyl) -4- (3-methylphenyl) -2- [4- (methylthio) phenyl] -1,3-thiazole melting point 112- 114 ° C. Reference Example H Compound 16-4: 4- (3,5-dimethylphenyl) -5
-(2,6-Dimethyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-thiazole melting point 134-136 ° C. Reference Example H Compound 16-5: 4- (4-fluorophenyl) -5-
(2-Methyl-4-pyridyl) -2- [4- (methylthio) phenyl]-
1,3-thiazole melting point 99-100 ° C. Reference Example H Compound 16-6: 4- [4- (3-chlorophenyl) -2-
[4- (Methylthio) phenyl] -1,3-thiazol-5-yl] -2-
Pyridylamine melting point 183-184 ° C.

Reference Example H17 4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridylamine 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide (5.00 g, 12.3 mmol) and 2 A solution of -chlorothiobenzamide (1.06 g, 11.9 mmol) in N, N-dimethylformamide (40 mL) was stirred at room temperature for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. Silica gel column chromatography of the residue
The crystals were obtained by purification with (hexane-ethyl acetate = 4: 1 to 2: 1). The crystals were washed with isopropyl ether to give the title compound (3.15 g, yield 81%). Melting point 175-177 ° C. Reference Example H18 According to Reference Example H17, instead of 2-chlorothiobenzamide, 4-fluorothiobenzamide, thiovaleramide, 3,3,3-trifluorothiopropionamide, thiobutylamide, ethyl 3-amino-3 -Reference Examples H Compounds 18-1 to 18-1 each containing -thioxopropanate
8-5 was synthesized. Reference Example H Compound 18-1: 4- [2- (4-fluorophenyl)-
4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 160-162 ° C. Reference Example H compound 18-2: 4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine oil ¹ H-NMR (CDCl ₃ ) δ : 0.98 (3H, t, J = 7.3Hz), 1.39-1.59
(2H, m), 1.76-1.92 (2H, m), 2.34 (3H, s), 3.04 (2
H, t, J = 7.4Hz), 4.14 (2H, br s), 6.44 (1H, s), 6.5
6 (1H, dd, J = 1.5, 5.4Hz), 7.09-7.26 (3H, m), 7.41
(1H, s), 7.96 (1H, d, J = 5.4Hz). Reference Example H Compound 18-3: 4- [4- (3-methylphenyl) -2-
(2,2,2-Trifluoroethyl) -1,3-thiazol-5-yl]-
2-Pyridylamine melting point 131-132 ° C. Reference Example H Compound 18-4: 4- [4- (3-methylphenyl) -2-
Propyl-1,3-thiazol-5-yl] -2-pyridylamine melting point 113-115 ° C. Reference Example H Compound 18-5: Ethyl [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] acetate Melting point 128-129 ° C. Reference Example H19 According to Reference Example H17, the following Reference Example H compound 19 was synthesized using ethyl 2-amino-2-thioxoacetate instead of 2-chlorothiobenzamide. Reference Example H Compound 19: Ethyl [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] carboxylate Melting point 147-148 ° C.

Reference Example H20 According to Reference Example H19, instead of 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide, 2- (2 -Amino-4-pyridyl) -2-bromo-1- (3-chlorophenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2-bromo-1-phenylethanone hydrogen bromide Acid salt, 2-
(2-Amino-4-pyridyl) -2-bromo-1- (4-fluorophenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2
-Bromo-1- [3- (trifluoromethyl) phenyl] ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2-bromo-1-
[4- (Methylthio) phenyl] ethanone hydrobromide, 2- (2
-Amino-4-pyridyl) -2-bromo-1- (3-fluorophenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2
-Bromo-1- (4-chlorophenyl) ethanone hydrobromide,
2- (2-amino-4-pyridyl) -2-bromo-1- (3-ethylphenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2
-Bromo-1- (4-fluoro-3-methylphenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2-bromo-1- [3-
(1-Methylethyl) phenyl] ethanone hydrobromide, 2-
(2-Amino-4-pyridyl) -2-bromo-1- (3-propylphenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2
The following Reference Example H compounds 20-1 to 20-12 were synthesized using -bromo-1- (2-thienyl) ethanone hydrobromide, respectively. Reference Example H Compound 20-1: 4- [2-Ethyl-4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 132-133 ° C. Reference Example H Compound 20-2: 4- (2-ethyl-4-phenyl-1,3
-Thiazol-5-yl) -2-pyridylamine melting point 158-159 ° C. Reference Example H Compound 20-3: 4- [2-ethyl-4- (4-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 140-141 ° C. Reference Example H Compound 20-4: 4- [2-ethyl-4- [3- (trifluoromethyl) phenyl] -1,3-thiazol-5-yl] -2-pyridylamine Melting point 117-118 ° C. Reference Example H Compound 20-5: 4- [2-Ethyl-4- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridylamine Melting point 119-120 ° C. Reference Example H compound 20-6: 4- [2-ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 153-154 ° C. Reference Example H Compound 20-7: 4- [4- (4-chlorophenyl) -2-
Ethyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 136-137 ° C. Reference Example H Compound 20-8: 4- [2-Ethyl-4- (3-ethylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 128-129 ° C. Reference Example H Compound 20-9: 4- [2-ethyl-4- (4-fluoro-
3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 134-135 ° C. Reference Example H Compound 20-10: 4- [2-Ethyl-4- [3- (1-methylethyl) phenyl] -1,3-thiazol-5-yl] -2-pyridylamine Melting point 80-81 ° C. Reference Example H Compound 20-11: 4- [2-Ethyl-4- (3-propylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 72-74 ° C. Reference Example H Compound 20-12: 4- [2-Ethyl-4- (2-thienyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 159-160 ° C.

Reference Example H21 According to Reference Example H18, instead of 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide, 2- (2 The following Reference Example H compounds 21-1 and 21-2 were synthesized using -amino-4-pyridyl) -2-bromo-1- (3-chlorophenyl) ethanone hydrobromide. Reference Example H Compound 21-1: 4- [4- (3-chlorophenyl) -2-
Propyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 99-100 ° C. Reference Example H Compound 21-2: Ethyl [5- (2-amino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] acetate Melting point 154-155 ° C. Reference Example H22 4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazole-5-
Iyl] -2-pyridylamine 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2
-Ethyl-4- (3-methylphenyl) -1,3-thiazole (2- (2-t
ert-Butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone (35 g, 170 mmol) Reference Example H3
It was synthesized by the method described. 2N-hydrochloric acid (200 mL) was added to the mixture), and the mixture was stirred at 100 ° C. for 1 hr. The reaction mixture was cooled to room temperature and then made basic with 2N-sodium hydroxide aqueous solution (200 mL) and sodium hydrogencarbonate aqueous solution. The obtained mixture was extracted with ethyl acetate, and the extract was washed with water. The extract was dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1) to give crystals. The crystals were washed with isopropyl ether to give the title compound (17 g, yield 55%). Melting point 144-146 ° C. Reference Example H23 According to Reference Example H22, 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-ethyl-4- (3-methylphenyl)-
Instead of 1,3-thiazole, 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-methyl-4- (3-methylphenyl) -1,3-thiazole, 5- [2 -(tert-Butoxycarbonylamino) -4-pyridyl] -4- (3-methylphenyl) -2- [4-
(Methylthio) phenyl] -1,3-thiazole and 5- [2- (te
The following Reference Example H compounds 23-1 to 23-3 were synthesized using rt-butoxycarbonylamino) -4-pyridyl] -4- (4-methoxyphenyl) -2-methyl-1,3-thiazole, respectively. did. Reference Example H Compound 23-1: 4- [2-methyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 152-153 ° C. Reference Example H Compound 23-2: 4- [4- (3-methylphenyl) -2-
[4- (Methylthio) phenyl] -1,3-thiazol-5-yl] -2-
Pyridylamine melting point 181-183 ° C. Reference Example H Compound 23-3: 4- [4- (4-methoxyphenyl)-
2-Methyl-1,3-thiazol-5-yl] -2-pyridylamine melting point 140-141 ° C. Reference Example H24 [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] ethyl acetate [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] acetate (7.00 g, 19.8
To a suspension of (mmol) in ethanol (40 mL) was added 1N-sodium hydroxide aqueous solution (40 mL), and the mixture was stirred as it was at room temperature for 2 hours. The reaction mixture was neutralized with 2N hydrochloric acid (20 mL), and the generated solid was collected by filtration. The crude product is washed with water, dried,
6.10 g (yield 95%) of the title compound was obtained. Melting point 132-133
° C.

Reference Example H25 According to Reference Example H24, instead of ethyl [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] acetate, Ethyl [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] carboxylate, ethyl [5- (2-methyl-4-pyridyl)- Four
-(3-Methylphenyl) -1,3-thiazol-2-yl] carboxylate and ethyl [5- (2-amino-4-pyridyl) -4-
(3-Chlorophenyl) -1,3-thiazol-2-yl] acetate was used in the following Reference Example H, Compounds 25-1 and 25-2.
5-3 was synthesized. Reference Example H Compound 25-1: 5- (2-amino-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazole-2-carboxylic acid melting point 156-157 ° C. Reference Example H Compound 25-2: 5- (2-methyl-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazole-2-carboxylic acid melting point 135-136 ° C. Reference Example H Compound 25-3: [5- (2-methyl-4-pyridyl) -4]
-(3-Chlorophenyl) -1,3-thiazol-2-yl] acetic acid Used for the next reaction without isolation. Reference Example H26 4- (3-Methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-
Thiazole 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-
Thiazole-2-carboxylic acid (0.20 g, 0.64 mmol) at 150 ° C
Stir for 15 minutes. After cooling to room temperature, the crude product was purified by silica gel column chromatography (ethyl acetate) to obtain 0.17 g (yield 98%) of the title compound. Oil. ¹ H-NMR (CDCl ₃ ) δ: 2.34 (3H, s), 2.53 (3H, s), 7.04
(1H, d, J = 5.1Hz), 7.16-7.24 (4H, m), 7.43 (1H,
s), 8.42 (1H, d, J = 5.1Hz), 8.88 (1H, s). Reference Example H27 According to Reference Example H26, 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) ) -1,3-Thiazole-2-carboxylic acid instead of 5- (2-amino-4-pyridyl) -4- (3-methylphenyl)-
Using 1,3-thiazole-2-carboxylic acid and [5- (2-amino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] acetic acid, the following reference Example H Compounds 27-1 and 27-2 were synthesized. Reference Example H Compound 27-1: 4- [4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridylamine melting point 91-92 ° C. Reference Example H Compound 27-2: 4- [4- (3-chlorophenyl) -2-
Methyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 142-143 ° C. Reference Example H28 N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole
-5-yl] -2-pyridyl] cyclohexanecarboxamide 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5-
In cyclohexanecarbonyl chloride (0.40 mL, 3.0 mmol) and triethylamine (0.39 m
L, 2.8 mmol) were added in order and the mixture was stirred at room temperature for 1 hour. Aqueous sodium hydrogen carbonate solution was added to the reaction mixture,
It was extracted with ethyl acetate. The extract was washed with aqueous sodium hydrogen carbonate solution, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate = 20: 1
~ 4: 1) to obtain crystals. The crystals were washed with hexane to give the title compound 0.83 g (yield 75%). Melting point 98-100 ° C.

Reference Example H29 According to Reference Example H28, the following Reference Example H compound was prepared by using cyclopentanecarbonyl chloride, acetyl chloride, 1-methylcyclohexanecarbonyl chloride, propionyl chloride and pivaloyl chloride instead of cyclohexanecarbonyl chloride. 29-1 to 29-5 were synthesized. Reference Example H Compound 29-1: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] cyclopentanecarboxamide Melting point 123-125 ° C . Reference Example H Compound 29-2: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 119-120 ° C. Reference Example H Compound 29-3: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -1-methylcyclohexanecarboxamide oil ¹ H-NMR (CDCl ₃ ) δ: 1.28 (3H, s), 1.30-1.75 (11H, m),
1.98-2.12 (2H, m), 2.33 (3H, s), 3.08 (2H, q, J =
7.6Hz), 6.79-6.85 (1H, m), 7.10-7.25 (3H, m), 7.38
-7.42 (1H, m), 8.04-8.07 (2H, m), 8.40-8.43 (1H,
m). Reference Example H Compound 29-4: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 103- 104 ° C. Reference Example H Compound 29-5: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] pivalamide oil. ¹ H-NMR (CDCl ₃ ) δ: 1.34 (9H, s), 1.44 (3H, t, J = 7.6
Hz), 2.33 (3H, s), 3.08 (2H, q, J = 7.6Hz), 6.79-6.
84 (1H, m), 7.09-7.27 (3H, m), 7.36-7.39 (1H, m),
8.03-8.10 (2H, m), 8.38-8.42 (1H, m). Reference Example H30 According to Reference Example H29, 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5 -Yl] -2-pyridylamine instead of 4- [4- (3-chlorophenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3 -Chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2-propyl-1,3-thiazol-5-yl]- 2-pyridylamine, 4- [2-ethyl-4- (2-
Thienyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl ] The following Reference Example H compounds 30-1 to 30-1 using 2-pyridylamine
2 was synthesized. Reference Example H Compound 30-1: N- [4- [4- (3-chlorophenyl)
-2-Methyl-1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 112-115 ° C. Reference Example H Compound 30-2: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 149-150 ° C. Reference Example H Compound 30-3: N- [4- [4- (3-chlorophenyl)
-2-Propyl-1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 144-145 ° C. Reference Example H Compound 30-4: N- [4- [2-ethyl-4- (2-thienyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 154-155 ° C. Reference Example H Compound 30-5: N- [4- [4- (3-chlorophenyl)
-2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl]
-2-Pyridyl] acetamide melting point 207-208 ° C. Reference Example H Compound 30-6: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] -1-methylcyclohexanecarboxamide oil. ¹ H-NMR (CDCl ₃ ) δ: 1.28 (3H, s), 1.35-1.82 (11H, m),
1.95-2.13 (2H, m), 3.08 (2H, q, J = 7.8Hz), 6.80-
6.84 (1H, m), 7.19-7.37 (3H, m), 7.53-7.62 (1H,
m), 8.07-8.12 (1H, m), 8.25-8.35 (1H, m), 8.40-8.4
3 (1H, m). Reference Example H Compound 30-7: N- [4- [4- (3-chlorophenyl)
-2-Methyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 134-135 ° C. Reference Example H Compound 30-8: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 132-133 ° C. Reference Example H Compound 30-9: N- [4- [4- (3-chlorophenyl)
-2-Propyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 103-104 ° C. Reference Example H Compound 30-10: N- [4- [2-ethyl-4- (2-thienyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 187-188 ° C. Reference Example H Compound 30-11: N- [4- [4- (3-chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] propionamide Melting point 187-188 ° C. Reference Example H Compound 30-12: N- [4- [4- (3-chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] pivalamide melting point 119-120 ° C.

Reference Example H31 N- (cyclohexylmethyl) -4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine aluminum chloride (0.40 g, 3.0 mmol) in tetrahydrofuran (40 mL) at 0 ° C lithium aluminum hydride
(0.12 g, 3.0 mmol) was added. To this solution was added N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] cyclohexanecarboxamide (0.40 g, 0.99
tetrahydrofuran solution (10 mL) was added dropwise, and the mixture was heated under reflux for 1 hr. The reaction mixture was cooled to room temperature, ice water was added, and the mixture was extracted with ethyl acetate. The extract was washed with aqueous sodium hydrogen carbonate solution, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 20: 1-4: 1) to give crystals. The crystals were washed with hexane to give the title compound 0.27 g (yield 70%). Melting point 74-75 ° C. Reference Example H32 According to Reference Example H31, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] cyclohexanecarboxamide was replaced with N -[4- [2-Ethyl-4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
The following Reference Example H compound 32 was synthesized using cyclopentanecarboxamide. Reference Example H Compound 32: N- (cyclopentylmethyl) -4- [2-
Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl]
-2-Pyridylamine melting point 67-69 ° C. Reference Example H33 [4- (3-Methylphenyl) -5- (2-piperidino-4-pyridyl)-
1,3-thiazol-2-yl] amine [5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,
3-Thiazol-2-yl] amine (0.70 g, 2.5 mmol) and piperidine (2.0 mL, 20 mmol) were stirred at 150 ° C. for 3 hours.
The reaction mixture was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1) to give the title compound 0.62.
g (yield 72%) was obtained. Melting point 181-182 ° C. Reference Example H34 According to Reference Example H33, the following Reference Example H compounds 34-1 to 34-3 were synthesized using morpholine, cyclohexylamine and cyclopentylamine instead of piperidine. Reference Example H Compound 34-1: [4- (3-methylphenyl) -5- (2
-Morpholino-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 188-189 ° C. Reference Example H Compound 34-2: [5- (2-cyclohexylamino
-4-Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] amine melting point 168-169 ° C. Reference Example H Compound 34-3: [5- (2-cyclopentylamino
-4-Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] amine melting point 169-170 ° C. Reference Example H35 According to Reference Example H34, [5- (2-fluoro-4-pyridyl) -4-
Instead of (3-methylphenyl) -1,3-thiazol-2-yl] amine, 4- (3-chlorophenyl) -5- (2-fluoro-4-pyridyl) -1,3-thiazol-2- And a 5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole, the following Reference Example H compound 35-1 and 35-2 were synthesized. Reference Example H Compound 35-1: [4- (3-chlorophenyl) -5- (2
-Piperidino-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 206-208 ° C. Reference Example H Compound 35-2: 4- (3-methylphenyl) -2- (4-
Methylsulfonylphenyl) -5- (2-piperidino-4-pyridyl) -1,3-thiazole melting point 155-157 ° C.

Reference Example H36 According to Reference Example H34, [5- (2-fluoro-4-pyridyl) -4-
Instead of (3-methylphenyl) -1,3-thiazol-2-yl] amine, [5- (2-fluoro-4-pyridyl) -4- (4-fluorophenyl) -1,3-thiazol- 2-yl] amine, N-methyl [5
-(2-Fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] amine, 2-ethyl-5- (2-fluoro-4
-Pyridyl) -4- (3-methylphenyl) -1,3-thiazole, 5-
(2-Fluoro-4-pyridyl) -4- (3-methylphenyl) -2- (4-
Methylsulfonylphenyl) -1,3-thiazole and 4- (3
-Chlorophenyl) -2-ethyl-5- (2-fluoro-4-pyridyl) -1,3-thiazole was used to synthesize the following Reference Example H compounds 36-1 to 36-11. Reference Example H Compound 36-1: [5- (2-cyclohexylamino
-4-Pyridyl) -4- (4-fluorophenyl) -1,3-thiazole
-2-yl] amine melting point 194-195 ° C. Reference Example H Compound 36-2: N-methyl [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine Melting point 211-212 ° C . Reference Example H Compound 36-3: N-methyl [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine Melting point 170-172 ° C . Reference Example H Compound 36-4: N-cyclohexyl-4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridylamine melting point 110-112 ° C. Reference Example H Compound 36-5: N-cyclohexyl-4- [4- (3-
Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3
-Thiazol-5-yl] -2-pyridylamine melting point 197-199 ° C. Reference Example H Compound 36-6: N-cyclopentyl-4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridylamine melting point 117-118 ° C. Reference Example H Compound 36-7: N-cyclopentyl-4- [4- (3-
Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3
-Thiazol-5-yl] -2-pyridylamine melting point 154-156 ° C. Reference Example H Compound 36-8: 4- (3-methylphenyl) -2- (4
-Methylsulfonylphenyl) -5- (2-morpholino-4-pyridyl) -1,3-thiazole melting point 200-202 ° C. Reference Example H Compound 36-9: 2-Ethyl-4- (3-methylphenyl) -5- (2-morpholino-4-pyridyl) -1,3-thiazole Melting point 69-71 ° C. Reference Example H Compound 36-10: 4- [4- (3-chlorophenyl)-
2-Ethyl-1,3-thiazol-5-yl] -N-cyclohexyl-2
-Pyridylamine melting point 106-107 ° C. Reference Example H compound 36-11: 4- [4- (3-chlorophenyl)-
2-Ethyl-1,3-thiazol-5-yl] -N-cyclopentyl-2
-Pyridylamine melting point 110-111 ° C. Reference Example H37 According to Reference Example H36, instead of cyclohexylamine, pyrrolidine, N-methylcyclohexylamine, (cyclohexylmethyl) amine and 1-methylpiperazine were used, respectively.
7-5 was synthesized. Reference Example H Compound 37-1: 2-Ethyl-4- (3-methylphenyl) -5- [2- (1-pyrrolidinyl) -4-pyridyl] -1,3-thiazole Melting point 108-109 ° C. Reference Example H Compound 37-2: N-cyclohexyl-N-methyl-
4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 173-174 ° C. Reference Example H Compound 37-3: N-cyclohexylmethyl-4-
[4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 157-159 ° C. Reference Example H Compound 37-4: 4- (3-methylphenyl) -2- (4-
Methylsulfonylphenyl) -5- [2- (1-pyrrolidinyl) -4-
Pyridyl] -1,3-thiazole melting point 199-201 ° C. Reference Example H Compound 37-5: 4- (3-methylphenyl) -5- [2
-(4-Methyl-1-piperazinyl) -4-pyridyl] -2- (4-methylsulfonylphenyl) -1,3-thiazole mp 153-154 ° C.

Reference Example H38 N- [5- (2-acetylamino-4-pyridyl) -4- (4-methoxyphenyl) -1,3-thiazol-2-yl] acetamide 4- [2-amino-4 -(4-methoxyphenyl) -1,3-thiazole-
To a solution of 5-yl] -2-pyridylamine (0.40 g, 1.4 mmol) and 4-dimethylaminopyridine (0.055 g, 0.45 mmol) in N, N-dimethylacetamide (10 mL) was added acetyl chloride (0.3 mL,
(4.2 mmol) was added and the mixture was stirred at 70 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The crude crystals were recrystallized from ethanol to give the title compound 0.30 g (yield 58%). Melting point 262-264 ° C. Reference Example H39 N- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,
3-thiazol-2-yl] acetamide [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-
A solution of thiazol-2-yl] amine (0.50 g, 1.8 mmol) and 4-dimethylaminopyridine (0.061 g, 0.50 mmol) in N, N-dimethylacetamide (15 mL) was added to acetyl chloride (0.19 mL,
2.7 mmol) was added, and the mixture was stirred at 80 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to give the title compound 0.39 g (yield 67%). Melting point 230-231 ° C. Reference Example H40 According to Reference Example H39, instead of [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [4- ( 3,5-Dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [5- (2,6-dimethyl-4-pyridyl) -4- ( 3-Methylphenyl) -1,3-thiazol-2-yl] amine and [4- (3,5-dimethylphenyl) -5-
Using (2,6-dimethyl-4-pyridyl) -1,3-thiazol-2-yl] amine, the following Reference Example H compounds 40-1 to 40-
3 was synthesized. Reference Example H compound 40-1: N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
Acetamide melting point 236-237 ° C. Reference Example H Compound 40-2: N- [5- (2,6-dimethyl-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl]
Acetamide melting point 185-187 ° C. Reference Example H Compound 40-3: N- [4- (3,5-Dimethylphenyl) -5- (2,6-dimethyl-4-pyridyl) -1,3-thiazole-2-
Il] acetamide melting point 266-267 ° C. Reference Example H41 According to Reference Example H39, the following Reference Example H compound 41 was synthesized using nicotinoyl chloride hydrochloride instead of acetyl chloride. Reference Example H Compound 41: N- [4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -1,3-thiazol-2-yl] nicotinamide melting point 175-178 ° C.

Reference Example H42 According to Reference Example H41, [4 (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine was used instead of [4 -(3,5-Dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [4- (3,5-dimethylphenyl) -5- (2 , 6-Dimethyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [5- (2-cyclohexylamino-4-
Pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine, [5- (2-cyclopentylamino-4-pyridyl)-
4- (3-methylphenyl) -1,3-thiazol-2-yl] amine, [5- (2-cyclohexylamino-4-pyridyl) -4- (4-fluorophenyl) -1,3-thiazole- 2-yl] amine, [5-
(2-Fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] amine, [4- (4-fluorophenyl)-
5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-
Methylphenyl) -1,3-thiazol-2-yl] -N-methylamine, N- [5- (2-cyclopentylamino-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazol-2-yl] -N-methylamine and N-methyl-N- [5- (2-methyl-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazol-2-yl] amine was used to prepare the following Reference Example H compounds 42-1 to 42-42.
-10 was synthesized. Reference Example H Compound 42-1: N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
Nicotinamide melting point 203-206 ° C. Reference Example H Compound 42-2: N- [4- (3,5-Dimethylphenyl) -5- (2,6-dimethyl-4-pyridyl) -1,3-thiazole-2-
Il] Nicotinamide melting point 267-268 ° C. Reference Example H Compound 42-3: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] nicotinamide melting point 201-203 ° C. Reference Example H Compound 42-4: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] nicotinamide melting point 215-216 ° C. Reference Example H Compound 42-5: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (4-fluorophenyl) -1,3-thiazol-2-yl] nicotinamide melting point 136-138 ° C . Reference Example H Compound 42-6: N- [5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] nicotinamide melting point 229-231 ° C. Reference Example H Compound 42-7: N- [4- (4-fluorophenyl)-
5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] nicotinamide melting point 261-262 ° C. Reference Example H Compound 42-8: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -N-methylnicotinamide melting point 147-148 ° C. Reference Example H Compound 42-9: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -N-methylnicotinamide melting point 148-149 ° C. Reference Example H Compound 42-10: N-methyl-N- [5- (2-methyl-
4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2-
Ill] nicotinamide oil. ¹ H-NMR (CDCl ₃ ) δ: 2.35 (3H, s), 2.53 (3H, s), 3.78
(3H, s), 7.05 (1H, d, J = 5.2Hz), 7.06-7.30 (4H, m),
7.41 (1H, s), 7.49 (1H, dd, J = 5.2, 7.0Hz), 7.95
(1H, d, J = 7.0Hz), 8.40 (1H, d, J = 5.2Hz), 8.80 (1
H, d, J = 5.2Hz), 8.88 (1H, s).

Reference Example H43 According to Reference Example H39, 6-chloro was used instead of acetyl chloride.
The following Reference Example H compound 43 was synthesized using -3-pyridylcarbonyl chloride hydrochloride. Reference Example H Compound 43: 6-chloro-N- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
Nicotinamide melting point 228-230 ° C. Reference Example H44 According to Reference Example H43, instead of [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [5- (2 -Cyclohexylamino-4-pyridyl) -4- (3-
Methylphenyl) -1,3-thiazol-2-yl] amine, [5-
(2-Cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine, [4- (3,5-dimethylphenyl) -5- (2-methyl -4-Pyridyl) -1,3-thiazol-2-yl] amine and N-methyl- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole The following Reference Example H using 2--2-yl] amine
Compounds 44-1 to 44-4 were synthesized. Reference Example H Compound 44-1: 6-chloro-N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] nicotinamide melting point 255-256 ° C. Reference Example H Compound 44-2: 6-chloro-N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] nicotinamide melting point 211-212 ° C. Reference Example H Compound 44-3: 6-chloro-N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazole
-2-yl] nicotinamide melting point 271-273 ° C. Reference Example H Compound 44-4: 6-chloro-N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] -N-methylnicotinamide melting point 171-172 ° C. Reference Example H45 According to Reference Example H39, 6-methyl instead of acetyl chloride
The following Reference Example H compound 45 was synthesized using -3-pyridylcarbonyl chloride hydrochloride. Reference Example H Compound 45: 6-methyl-N- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
Nicotinamide melting point 233-234 ° C. Reference Example H46 According to Reference Example H45, instead of [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [5- (2 -Cyclohexylamino-4-pyridyl) -4- (3-
Methylphenyl) -1,3-thiazol-2-yl] amine, [5-
(2-Cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine, [4- (3,5-dimethylphenyl) -5- (2-methyl -4-Pyridyl) -1,3-thiazol-2-yl] amine and N-methyl- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole The following Reference Example H using 2--2-yl] amine
Compounds 46-1 to 46-4 were synthesized. Reference Example H Compound 46-1: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methylnicotinamide melting point 242-243 ° C. Reference Example H Compound 46-2: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methylnicotinamide melting point 213-214 ° C. Reference Example H Compound 46-3: N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
-6-Methylnicotinamide melting point 252-253 ° C. Reference Example H Compound 46-4: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -N, 6-dimethylnicotinamide melting point 176-177 ° C.

Reference Example H47 According to Reference Example H39, using 6-methoxy-3-pyridylcarbonyl chloride hydrochloride instead of acetyl chloride,
The following Reference Example H compound 47 was synthesized. Reference Example H Compound 47: 6-methoxy-N- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] nicotinamide melting point 224-226 ° C. Reference Example H48 According to Reference Example H47, instead of [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [5- (2 -Cyclohexylamino-4-pyridyl) -4- (3-
Methylphenyl) -1,3-thiazol-2-yl] amine, [5-
(2-Cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine and [4- (3,5-
The following Reference Example H using dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine
Compounds 48-1 to 48-3 were synthesized. Reference Example H Compound 48-1: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methoxynicotinamide melting point 191-192 ° C. Reference Example H Compound 48-2: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methoxynicotinamide melting point 219-221 ° C. Reference Example H compound 48-3: N- [4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
-6-Methoxynicotinamide melting point 242-244 ° C. Reference Example H49 According to Reference Example H39, using 2-methoxy-3-pyridylcarbonyl chloride hydrochloride instead of acetyl chloride,
The following Reference Example H compound 49 was synthesized. Reference Example H Compound 49: 2-Methoxy-N- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] nicotinamide Melting point 169-170 ° C. Reference Example H50 According to Reference Example H39, instead of [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl] amine, [5- (2 -tert-Butoxycarbonylamino-4-pyridyl) -3- (4-methoxyphenyl) -1,3-thiazol-2-yl]
The following Reference Example H compound 50 was synthesized using an amine. Reference Example H Compound 50: N- [5- (2-amino-4-pyridyl) -4-
(4-Methoxyphenyl) -1,3-thiazol-2-yl] acetamide Melting point 247-250 ° C. Reference Example H51 According to Reference Example H50, benzoyl chloride was used instead of acetyl chloride, and Reference Example H compound 51 below was used. Was synthesized. Reference Example H Compound 51: N- [5- (2-amino-4-pyridyl) -4-
(4-Methoxyphenyl) -1,3-thiazol-2-yl] benzamide Melting point 219-222 ° C

Reference Example H52 N- [4- (2,6-Dimethyl-4-pyridyl) -5- (3-methylphenyl) -1,3-thiazol-2-yl] -N′-phenylurea [4 -(2,6-Dimethyl-4-pyridyl) -5- (3-methylphenyl)-
1,3-thiazol-2-yl] amine (0.50 g, 1.7 mmol) in N,
Phenyl isocyanate (0.28 mL, 2.6 mmol) was added to the N-dimethylacetamide (20 mL) solution, and the mixture was stirred at 80 ° C. for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1).
The obtained crude crystals were recrystallized from ethyl acetate-hexane to give the title compound 0.34 g (yield 48%). Melting point 173-174 ° C. Reference Example H53 According to Reference Example H52, [4- (2,6-dimethyl-4-pyridyl) -5
Instead of-(3-methylphenyl) -1,3-thiazol-2-yl] amine, [4- (3,5-dimethylphenyl) -5- (2,6-dimethyl-4-pyridyl) -1 , 3-thiazol-2-yl] amine, [5- (2
-Cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine, [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methyl Phenyl) -1,
3-thiazol-2-yl] amine and [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazol-2-yl]
Using amine, the following Reference Example H compounds 53-1 to 53
-4 was synthesized. Reference Example H Compound 53-1: N- [4- (3,5-dimethylphenyl) -5- (2,6-dimethyl-4-pyridyl) -1,3-thiazole-2-
Il] -N'-phenylurea Melting point 219-222 ° C. Reference Example H Compound 53-2: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -N'-phenylurea melting point 198-199 ° C. Reference Example H Compound 53-3: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -N'-phenylurea mp 188-190 ° C. Reference Example H compound 53-4: N- [4- (3-methylphenyl) -5-
(2-Methyl-4-pyridyl) -1,3-thiazol-2-yl] -N'-phenylurea Melting point 168-169 ° C. Reference Example H54 4- (3-Methylphenyl) -5- (2-methyl-4-pyridyl) -2- (4-
Methylsulfinylphenyl) -1,3-thiazole 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -2- [4-
(Methylthio) phenyl] -1,3-thiazole (0.55 g, 1.4 m
mol) in acetic acid (15 mL) solution (0.43 g, 1.6 m
Water (8 mL) solution of (mol) was added, and the mixture was stirred at room temperature for 14 hr.
Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. Column chromatography of the residue (filler Chro
The product was purified with matorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd.), hexane-ethyl acetate = 1: 4) and recrystallized from ethyl acetate-hexane to obtain 0.15 g (yield 26%) of the title compound. Melting point 128-130 ° C. Reference Example H55 5- (2,6-Dimethyl-4-pyridyl) -4- (3-methylphenyl) -2
-(4-Methylsulfinylphenyl) -1,3-thiazole 5- (2,6-dimethyl-4-pyridyl) -4- (3-methylphenyl) -2
-[4- (methylthio) phenyl] -1,3-thiazole (0.41 g,
1.0 mmol of N, N-dimethylformamide (15 mL) in m-
Chloroperbenzoic acid (0.25 g, 1.0 mmol) was added, and 1 was added at room temperature.
Stir for hours. 8N aqueous sodium hydroxide solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and dried, and the solvent was evaporated. The residue was subjected to column chromatography (filler Chromatorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd.), hexane: ethyl acetate =
1: 2) and the title compound 0.41 g (yield 97%)
Got Melting point 133-134 ° C.

Reference Example H56 According to Reference Example H55, 5- (2,6-dimethyl-4-pyridyl) -4-
(3-Methylphenyl) -2- [4- (methylthio) phenyl] -1,3-
Instead of thiazole, 4- (3,5-dimethylphenyl) -5-
(2-Methyl-4-pyridyl) -2- [4- (methylthio) phenyl]-
1,3-thiazole and 4- (3,5-dimethylphenyl) -5- (2,
6-dimethyl-4-pyridyl) -2- [4- (methylthio) phenyl]-
The following Reference Example H compounds 56-1 and 56-2 were synthesized using 1,3-thiazole, respectively. Reference Example H Compound 56-1: 4- (3,5-dimethylphenyl) -5
-(2-Methyl-4-pyridyl) -2- (4-methylsulfinylphenyl) -1,3-thiazole melting point 151-153 ° C. Reference Example H Compound 56-2: 4- (3,5-dimethylphenyl) -5
-(2,6-Dimethyl-4-pyridyl) -2- (4-methylsulfinylphenyl) -1,3-thiazole melting point 151-154 ° C. Reference Example H57 4- (3-Methylphenyl) -5- (2-methyl-4-pyridyl) -2- (4-
Methylsulfonylphenyl) -1,3-thiazole 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -2- [4-
(Methylthio) phenyl] -1,3-thiazole (0.61 g, 1.6 m
m-Chloroperbenzoic acid (0.87 g, 3.6 mmol) was added to a N, N-dimethylformamide (15 mL) solution of (mol) and the mixture was stirred at room temperature for 30 minutes. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1),
Recrystallization from ethanol gave the title compound 0.39 g (yield 59
%). Melting point 134-138 [deg.] C. Reference Example H58 According to Reference Example H57, instead of 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-thiazole, 4- (3,5-Dimethylphenyl) -5- (2-methyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-thiazole, 5- (2,6-dimethyl-4 -Pyridyl) -4- (3-methylphenyl) -2- [4- (methylthio) phenyl] -1,3-thiazole, 4- (3,5-dimethylphenyl) -5- (2,6-dimethyl- 4-Pyridyl) -2- [4- (methylthio) phenyl] -1,3-thiazole, 5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl)
-2- [4- (methylthio) phenyl] -1,3-thiazole, 4- (4-
Fluorophenyl) -5- (2-methyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-thiazole, N- [4- [4- (3-chlorophenyl) -2- [ 4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] acetamide, N- [4- [4- (3-
Chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] propionamide and
Using N- [4- [4- (3-chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] pivaloylamide, the following reference examples were used. H compound 58
-1-58-8 were synthesize | combined. Reference Example H Compound 58-1: 4- (3,5-dimethylphenyl) -5
-(2-Methyl-4-pyridyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole melting point 196-197 ° C. Reference Example H Compound 58-2: 5- (2,6-dimethyl-4-pyridyl) -4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole melting point 182-184 ° C. Reference Example H compound 58-3: 4- (3,5-dimethylphenyl) -5
-(2,6-Dimethyl-4-pyridyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole melting point 217-220 ° C. Reference Example H Compound 58-4: 5- (2-fluoro-4-pyridyl)-
4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole melting point 195-199 ° C. Reference Example H Compound 58-5: 4- (4-fluorophenyl) -5-
(2-Methyl-4-pyridyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole melting point 190-192 ° C. Reference Example H Compound 58-6: N- [4- [4- (3-chlorophenyl)
-2- (4-methylsulfonylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] acetamide melting point 216-217 ° C. Reference Example H Compound 58-7: N- [4- [4- (3-chlorophenyl)
-2- (4-methylsulfonylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] propionamide melting point 224-225 ° C. Reference Example H Compound 58-8: N- [4- [4- (3-chlorophenyl)
-2- (4-methylsulfonylphenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] pivalamide melting point 122-123 ° C.

Reference Example H59 4- [4- (3,5-Dimethylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-methylpyridine
N-oxide 4- (3,5-dimethylphenyl) -5- (2-methyl-4-pyridyl) -2
-[4- (Methylthio) phenyl] -1,3-thiazole (0.60 g,
1.5 mmol of N, N-dimethylformamide (20 mL) in m-
Add chloroperbenzoic acid (0.80 g, 3.2 mmol) and stir at room temperature for 30
Stir for a minute. The reaction mixture was added with m-chloroperbenzoic acid (0.1
1 g, 0.45 mmol) was added, and the mixture was further stirred at room temperature for 20 minutes. Add m-chloroperbenzoic acid (0.38 g, 1.5 mmo) to the reaction mixture.
l) was added and the mixture was further stirred at room temperature for 20 minutes. Aqueous sodium hydrogen carbonate solution was poured, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate = 1:
Purified in 4), recrystallized from ethanol to give the title compound 0.3
0 g (44% yield) was obtained. Melting point 255-256 ° C. Reference Example H60 N- [4- [4- (3-chlorophenyl) -2- (1-methylpiperidine-4
-Yl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide dihydrochloride N- [4- [4- (3-chlorophenyl) -2- (4-piperidyl) -1,3- Thiazol-5-yl] -2-pyridyl] propionamide (0.31
g, 0.72 mmol) in N, N-dimethylformamide (8 mL) solution, potassium carbonate (0.11 g, 0.82 mmol) and methyl iodide (0.04
5 mL, 0.72 mmol) were added in that order, and the mixture was stirred at room temperature for 20 hr. A sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. Wash the extract with saturated saline solution, dry,
Concentrated. Column chromatography of the residue (filler Ch
romatorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd.),
The product was purified with hexane-ethyl acetate = 1: 1) and converted to a hydrochloride with 10% hydrogen chloride in methanol. The crude crystals were washed with ethyl acetate to give the title compound 0.12 g (yield 32%). Melting point 248-253 ° C. Reference Example H61 According to Reference Example H53, the following Reference Example H was prepared using 2-chloroethyl isocyanate instead of phenyl isocyanate.
Compound 61 was synthesized. Reference Example H Compound 61: N- (2-chloroethyl) -N '-[5- (2-
Methyl-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] urea melting point 149-151 ° C. Reference Example H62 According to Reference Example H39, using 2-chloroethyl chloroformate instead of acetyl chloride, the following Reference Example H Compound 6
2 was synthesized. Reference Example H Compound 62: 2-chloroethyl [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazole-2-
Il] carbamate melting point 156-158 ° C. Reference Example H63 N-methoxy-N '-[4- (3-methylphenyl) -5- (2-methyl-4
-Pyridyl) -1,3-thiazol-2-yl] urea [4- (2-methyl-4-pyridyl) -5- (3-methylphenyl) -1,3-
1,1-Carbonyldiimidazole (0.43 g, 2.7 mmol) was added to a solution of thiazol-2-yl] amine (0.50 g, 1.8 mmol) in N, N-dimethylacetamide (20 mL), and the mixture was stirred at room temperature for 3 hours. It was O-Methylhydroxylamine hydrochloride (0.22 g, 2.7 mmol) was added to the reaction mixture, and the mixture was directly stirred at room temperature for 24 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the produced solid was collected by filtration. The solid was washed with water and dried. Column chromatography of the crude product
(Filling agent Chromatorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd., ethyl acetate). The obtained crystals were recrystallized from ethyl acetate to give the title compound 0.16 g (yield 25%).
Got Melting point 194-195 ° C.

Reference Example H64 According to Reference Example H63, the following Reference Example H compound 64 was synthesized by using O-phenylhydroxylamine hydrochloride instead of O-methylhydroxylamine hydrochloride. Reference Example H Compound 64: N- [4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -1,3-thiazol-2-yl] -N'-phenyloxyurea Melting point 154-155 ° C. Reference example H65 3- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,
3-Thiazol-2-yl] oxazolidin-2-one 2-chloroethyl [4- (3-methylphenyl) -5- (2-methyl-4
-Pyridyl) -1,3-thiazol-2-yl] carbamate (0.30
g, 0.80 mmol) in N, N-dimethylformamide (3 mL) was added potassium tert-butoxide (0.12 g, 1.1 mmol), and the mixture was stirred at room temperature for 1 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. Silica gel column chromatography of the residue (hexane-ethyl acetate = 4: 1)
And purified to obtain crystals. The crystals were recrystallized from hexane-ethyl acetate to give the title compound 0.20 g (yield 72%). Melting point 80-82 ° C. Reference Example H66 According to Reference Example H65, 2-chloroethyl [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,3-thiazole-2-
Il] N- (2-chloroethyl) -N'-in place of carbamate
[5- (2-methyl-4-pyridyl) -4- (3-methylphenyl) -1,3-
The following Reference Example H compound 66 was synthesized using thiazol-2-yl] urea. Reference Example H Compound 66: 1- [4- (3-methylphenyl) -5- (2-
Methyl-4-pyridyl) -1,3-thiazol-2-yl] imidazolidin-2-one melting point 200-201 ° C. Reference Example H67 1- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,
3-thiazol-2-yl] -3-phenylimidazolidin-2-one 1- [4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -1,
3-Thiazol-2-yl] -3-imidazolidin-2-one (0.42
g, 1.2 mmol), copper powder (0.23 g, 3.6 mmol), copper chloride (0.0
1 g, 0.12 mmol) and potassium acetate (0.23 g, 2.4 mmol)
Bromobenzene (0.56 g, 3.6 mmol) was added to the N, N-dimethylacetamide (10 mL) suspension, and the mixture was stirred at 150 ° C. for 4 hr. After filtration, water was added and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate =
Purification by 4: 1) gave crude crystals. The crude crystals were recrystallized from ethyl acetate to obtain the title compound 0.18 g (yield 35%). Melting point 180-182 ° C. Reference Example H68 According to Reference Example H59, 4- (3,5-dimethylphenyl) -5- (2-
Methyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-
Instead of thiazole, 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-thiazole and 2-ethyl-4- ( 3-methylphenyl) -5- (2-
The following Reference Example H compounds 68-1 and 68-2 were synthesized using methyl-4-pyridyl) -1,3-thiazole. Reference Example H Compound 68-1: 4- [4- (3-methylphenyl) -2-
(4-Methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-methylpyridine N-oxide melting point 197-198 ° C. Reference Example H Compound 68-2: [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-methylpyridine N-oxide oil. ¹ H-NMR (CDCl ₃ ) δ: 1.41 (3H, t, J = 7.6Hz), 2.34 (3H,
s), 2.46 (3H, s), 3.09 (2H, q, J = 7.6Hz), 7.01 (1
H, dd, J = 2.2, 7.0Hz), 7.12-7.24 (4H, m), 8.10 (1
H, d, J = 2.0Hz).

Reference Example H69 5- (2-chloro-4-pyridyl) -2-ethyl-4- (3-methylphenyl) -1,3-thiazole 4- [2-ethyl-4- (3-methylphenyl) ) -1,3-Thiazole-5-
A solution of [yl] pyridine N-oxide (1.00 g, 3.37 mmol) in phosphorus oxychloride (6.5 mL) was stirred at 100 ° C. for 2 hours. The reaction mixture was allowed to cool, added to saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 2: 1) to obtain 0.90 g of the title compound (yield 81%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (3H, t, J = 7.8Hz), 2.35 (3H,
s), 3.10 (2H, q, J = 7.8Hz), 7.09 (1H, dd, J = 1.4,
5.2Hz), 7.12-7.30 (4H, m), 7.37 (1H, s), 8.22-8.2
7 (1H, m). Reference Example H70 4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazole-5-
Il] -2-methylpyridine N-oxide (1.0 g, 3.2 mmol)
Phosphorus oxychloride (8 mL) solution of was stirred at 100 ° C. for 1 hour. The reaction mixture was allowed to cool, added to saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate = 10: 1 to 2:
Purified in 1), 5- (2-chloro-6-methyl-4-pyridyl) -2-ethyl-4- (3-methylphenyl) -1,3-thiazole 0.60 g (yield 57%) and 5 -(2-chloromethyl-4-pyridyl) -2-ethyl-4
-(3-Methylphenyl) -1,3-thiazole 0.20 g (yield 19
%). Reference Example H Compound 70-1: 5- (2-chloro-6-methyl-4-pyridyl) -2-ethyl-4- (3-methylphenyl) -1,3-thiazole oil. ¹ H-NMR (CDCl ₃ ) δ: 1.45 (3H, t, J = 7.8Hz), 2.35 (3H,
s), 2.45 (3H, s), 3.09 (2H, q, J = 7.8Hz), 6.98 (1
H, s), 7.06 (1H, s), 7.12--7.24 (3H, m), 7.38 (1H,
s). Reference Example H Compound 70-2: 5- (2-chloromethyl-4-pyridyl) -2-ethyl-4- (3-methylphenyl) -1,3-thiazole oil. ¹ H-NMR (CDCl ₃ ) δ: 1.46 (3H, t, J = 7.6Hz), 2.33 (3H,
s), 3.10 (2H, q, J = 7.6Hz), 4.59 (2H, s), 7.10-7.
23 (4H, m), 7.35-7.40 (2H, m), 8.42-8.47 (1H, m). Reference Example H71 5- (2-Cyanomethyl-4-pyridyl) -2-ethyl-4- (3-methyl Phenyl) -1,3-thiazole 5- (2-chloromethyl-4-pyridyl) -2-ethyl-4- (3-methylphenyl) -1,3-thiazole (0.40 g, 1.2 mmol), potassium cyanide (0.095 g, 1.5 mmol), 18-crown-6 (0.14
A suspension of g, 0.51 mmol) in acetonitrile (5 mL) was heated under reflux for 6 hours. After allowing to cool, an aqueous potassium carbonate solution was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 2: 1). The obtained crystals were washed with hexane-isopropyl ether to give the title compound (0.19 g, 48%). Melting point 68-69 ° C. Reference Example H72 4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylmethanol 4- [4- (3-methylphenyl ) -2- (4-Methylsulfonylphenyl) -1,3-thiazol-5-yl] pyridine-N-oxide (0.
(43 g, 1.0 mmol) in methylene chloride (10 mL) was added to trimethyloxonium tetrafluoroborate (0.17 g, 1.2 mmol).
Was added and stirred for 2 hours. The reaction mixture was concentrated under reduced pressure,
Methanol (15 mL) was added to the residue. A solution of ammonium persulfate (0.05 g, 0.22 mmol) in water (1 mL) was added to the mixture under reflux, and the mixture was heated under reflux for 30 min. Ammonium persulfate
A solution of (0.03 g, 0.11 mmol) in water (1 mL) was added to the reaction mixture, and the mixture was heated under reflux for 13 hr. The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. Aqueous sodium hydrogen carbonate solution was added to the residue, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried over magnesium sulfate, filtered, and concentrated under reduced pressure. Column chromatography of the residue (filler Ch
romatorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd.),
0.26 g (61% yield) of the title compound after purification with ethyl acetate).
Got Melting point 172-173 ° C.

Reference Example H73 2- (4-Methylsulfonylphenyl) -4- (3-methylphenyl) -5- [2- (1-pyrrolidinylmethyl) -4-pyridyl] -1,3-thiazoledione Hydrochloride 4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylmethanol
Thionyl chloride (0.08 mL, 1.0 mmol) was added to a tetrahydrofuran (20 mL) solution of (0.43 g, 1.0 mmol), and the mixture was stirred for 20 minutes. The reaction mixture was concentrated under reduced pressure, and the obtained residue was pyrrolidine (0.09 mL, 1.1 mmol) and potassium carbonate (0.36 g,
2.6 mmol) of N, N-dimethylformamide (10 mL) was added, and the mixture was stirred at room temperature for 27 hours. Aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried over magnesium sulfate, filtered, and concentrated under reduced pressure. Column chromatography of the residue
(Filler Chromatorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd.), hexane-ethyl acetate = 1: 2) was used for purification.
The obtained oil was dissolved in methanol (10 mL), 10% hydrogen chloride-methanol solution (5 mL) was added, and the mixture was stirred at room temperature for 1 hr. The reaction mixture was concentrated under reduced pressure, and the obtained solid was washed with ethanol to give the title compound (yield 17%). Amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 1.90-2.10 (4H, m), 2.33 (3H,
s), 3.31 (3H, s), 4.10-4.40 (4H, m), 4.53 (2H, s),
7.28 (3H, s), 7.43-7.47 (2H, m), 7.67 (1H, s), 8.
12 (2H, d, J = 8.0Hz), 8.30 (2H, d, J = 8.0Hz), 8.68
(1H, d, J = 5.2Hz). Reference Example H74 2-Ethyl-4- (3-methylphenyl) -5- [2- (1-pyrrolidinylmethyl) -4-pyridyl] -1,3- A solution of thiazole dihydrochloride 5- (2-chloromethyl-4-pyridyl) -2-ethyl-4- (3-methylphenyl) -1,3-thiazole (0.20 g, 0.61 mmol) in pyrrolidine (0.5 mL) was added. Stir at 80 ° C. for 1 hour. After allowing to cool, an aqueous potassium carbonate solution was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated.
The residue was purified by alumina column chromatography (hexane-ethyl acetate = 2: 1). The obtained oily substance was made into hydrochloride using 4N-hydrogen chloride in ethyl acetate and recrystallized from ethanol-isopropyl ether to give the title compound (0.
23 g, 85%) was obtained. Melting point 146-151 ° C. Reference Example H75 2-Bromo-1- (3-bromophenyl) -2- [2- (tert-butoxycarbonylamino) -4-pyridyl] ethanone hydrobromide
(22 g, 51 mmol) of N, N-dimethylformamide (100 mL)
Thiopropionamide (4.3 g, 49 mmol) was added to the solution, and the mixture was stirred at room temperature for 2 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 4: 1) and then recrystallized from hexane-ethyl acetate.
-(3-Bromophenyl) -5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-ethyl-1,3-thiazole 6.0 g
(Yield 27%) and 5- (2-amino-4-pyridyl) -4- (3-bromophenyl) -2-ethyl-1,3-thiazole 1.4 g (yield 8%) were obtained. Reference Example H Compound 75-1: 4- (3-bromophenyl) -5- [2-
(tert-Butoxycarbonylamino) -4-pyridyl] -2-ethyl-1,3-thiazole melting point 172-174 ° C. Reference Example H Compound 75-2: 4- [4- (3-bromophenyl) -2-
Ethyl-1,3-thiazol-5-yl] -2-pyridylamine melting point 132-134 ° C. Reference Example H76 4- [4- (3-Cyanophenyl) -2-ethyl-1,3-thiazole-5-
Il] -2-pyridylamine 4- (3-bromophenyl) -5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-ethyl-1,3-thiazole (0.5 g,
1.1 mmol) in N, N-dimethylformamide (10 mL) was added with copper cyanide (0.25 g, 1.6 mmol) under argon atmosphere.
Stir at 150 ° C. for 20 hours. Aqueous ammonia was poured into the reaction mixture, the precipitate was removed, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate = 4
: 1) to obtain crystals. The crystals were washed with hexane-ethyl acetate to give the title compound 0.19 g (yield 57%). Melting point 178-179 ° C.

Reference Example H77 3- [5- (2-amino-4-pyridyl) -2-ethyl-1,3-thiazole
-4-yl] benzoic acid 5- (2-amino-4-pyridyl) -4- (3-cyanophenyl) -2-ethyl-1,3-thiazole (0.50 g, 1.6 mmol) in acetic acid (5 mL)
50% Sulfuric acid (2.0 mL) was added to the solution, and the mixture was stirred at 110 ° C for 6 hr. The reaction mixture was made alkaline with aqueous sodium hydroxide solution and washed with ethyl acetate. The aqueous layer was neutralized with hydrochloric acid and the precipitated crystals were washed with water and ethyl ether to give the title compound 0.45 g (yield 84%). Melting point 273-274 ° C. Reference Example H78 3- [5- (2-amino-4-pyridyl) -2-ethyl-1,3-thiazole
Methyl-4-yl] benzoate 3- [5- (2-amino-4-pyridyl) -4- (3-cyanophenyl) -2-
Ethyl-1,3-thiazol-4-yl] benzoic acid (0.3 g, 1.0 m
mol) in methanol (10 mL) to which concentrated sulfuric acid (0.1 mL) was added 7
Stir at 0 ° C. for 5 hours. The reaction mixture was made basic with aqueous sodium hydroxide solution and then extracted with ethyl acetate. The extract was washed with water, dried and concentrated. Hexane residue
The crystals were washed with ethyl acetate to give the title compound 0.29 g (yield 85%). Melting point 173-174 ° C. Reference Example H79 4- (3-Bromophenyl) -5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-ethyl-1,3-thiazole (1.0 g,
2.2 mmol) in tetrahydrofuran (20 mL) under argon atmosphere at -78 ° C in 1.5 M n-butyllithium hexane solution.
(2.9 mL, 4.3 mmol) was added dropwise, and the mixture was stirred for 15 minutes. The reaction mixture was poured into dry ice and extracted with ethyl acetate-tetrahydrofuran. The extract was washed with aqueous sodium hydroxide solution, dried and concentrated. The residue was recrystallized from hexane-ethyl acetate to give 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-ethyl-4-phenyl-1,3-thiazole.
0.29 g (35% yield) was obtained. After acidifying the aqueous layer with hydrochloric acid,
It was extracted with ethyl acetate-tetrahydrofuran. The extract was washed with water, dried and concentrated, and the residue was washed with ethyl acetate [5
-[2- (tert-Butoxycarbonylamino) -4-pyridyl] -2-
Ethyl-1,3-thiazol-4-yl] benzoic acid 0.21 g (yield
23%). Reference Example H Compound 79-1: 5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-ethyl-4-phenyl-1,3-thiazole melting point 154-155 ° C. Reference Example H Compound 79-2: 3- [5- [2- (tert-butoxycarbonylamino) -4-pyridyl] -2-ethyl-1,3-thiazole-
4-yl] benzoic acid ¹ H-NMR (CDCl ₃ ) δ: 1.37 (3H, t, J = 7.5Hz), 1.45 (9
H, s), 3.08 (2H, q, J = 7.5Hz), 6.83 (1H, dd, J = 1.
4, 5.0Hz), 7.34-7.37 (2H, m), 7.42-7.49 (2H, m), 7.
86 (1H, s), 8.16 (1H, d, J = 5.0Hz), 9.91 (1H, s). Reference Example H80 4- [2- (1-tert-butoxycarbonylpiperidin-4-yl)-
4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine 2- (2-amino-4-pyridyl) -2-bromo-1- (3-chlorophenyl) ethanone hydrogen bromide Acid salt (2.74 g, 8.36 mmol) and 1-tert
-Butoxycarbonylpiperidine-4-carbothioamide
(2.00 g, 8.18 mmol) N, N-dimethylformamide (50 m
L) The solution was stirred at room temperature for 3 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The residue was purified by silica gel column chromatography (ethyl acetate), and further column chromatography (packing material Chromatorex NH
DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd., ethyl acetate)
Purified in. The obtained crude crystals were recrystallized from ethyl acetate-hexane to give the title compound (1.94 g, yield 50%). Melting point 143-145 ° C. Reference Example H81 N- [4- [2- (1-tert-butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] acetamide 4- [2- (1-tert-butoxycarbonylpiperidin-4-yl)-
4- (3-Chlorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine (1.60 g, 3.40 mmol) in tetrahydrofuran (20 mL) was added to acetyl chloride (0.25 mL, 3.52 mmol) and triethylamine ( 0.50 mL, 3.58 mmol) was sequentially added at 0 ° C., and the mixture was stirred at room temperature for 3 hr. Aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. Silica gel column chromatography (filler Chro
matorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd.), purified with hexane-ethyl acetate = 1: 1) to give the title compound 1.79.
g (yield 98%) was obtained. Amorphous powder ¹ H-NMR (CDCl ₃ ) δ: 1.49 (9H, s), 1.68-1.88 (2H, m),
2.13-2.21 (5H, m), 2.91 (2H, br t, J = 12.0 Hz), 3.
12-3.25 (1H, m). 4.20-4.27 (2H, m), 6.87 (1H, dd,
J = 1.8, 5.4Hz), 7.18-7.35 (3H, m), 7.56 (1H, t, J =
1.8 Hz), 8.15 (1H, d, J = 5.4 Hz), 8.27-8.33 (2H,
m).

Reference Example H82 According to Reference Example H81, 4- [2- (1-tert-butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl]- Instead of 2-pyridylamine, 4- (2-ethyl-4-phenyl-1,3-thiazol-5-yl) -2-pyridylamine, 4- [2-ethyl-4- (4-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4-
(3-trifluoromethylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4- (4-fluoro-3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl Amine, 4- [4- (4-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4- (3-ethylphenyl) -1 , 3-Thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4-
[3- (1-Methylethyl) phenyl] -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4- (3-propylphenyl) -1,3-thiazole- 5-yl] -2-pyridylamine, 4
-[2-Methyl-4- (3-methylphenyl) -1,3-thiazole-5-
Il] -2-pyridylamine, 4- [4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridylamine and 4- [4- (3
-Methylphenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridylamine was used to synthesize the following Reference Example H compounds 82-1 to 82-12. did. Reference Example H Compound 82-1: N- [4- (2-ethyl-4-phenyl-
1,3-thiazol-5-yl) -2-pyridyl] acetamide melting point 175-176 ° C. Reference Example H Compound 82-2: N- [4- [2-ethyl-4- (4-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 190-191 ° C. Reference Example H Compound 82-3: N- [4- [2-ethyl-4- (3-trifluoromethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 146-147 ° C . Reference Example H Compound 82-4: N- [4- [2-ethyl-4- (4-fluoro-3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 142- 143 ° C. Reference Example H Compound 82-5: N- [4- [2-ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 141-142 ° C. Reference Example H Compound 82-6: N- [4- [4- (4-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 190-191 ° C. Reference Example H Compound 82-7: N- [4- [2-ethyl-4- (3-ethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 112-113 ° C. Reference Example H Compound 82-8: N- [4- [2-ethyl-4- [3- (1-methylethyl) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 116 -117 ° C. Reference Example H Compound 82-9: N- [4- [2-Ethyl-4- (3-propylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 121-122 ° C. Reference Example H Compound 82-10: N- [4- [2-methyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 162-163 ° C. Reference Example H Compound 82-11: N- [4- [4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 149-150 ° C. Reference Example H Compound 82-12: N- [4- [4- (3-methylphenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 181-182 ° C. Reference Example H83 According to Reference Example H81, the following Reference Example H compound 83 was synthesized using propionyl chloride instead of acetyl chloride. Reference Example H Compound 83: N- [4- [2- (1-tert-butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridyl ] Propionamide amorphous powder ¹ H-NMR (CDCl ₃ ) δ: 1.25 (3H, t, J = 7.5 Hz), 1.49 (9
H, s), 1.66-1.89 (2H, m), 2.08-2.22 (2H, m), 2.44
(2H, q, J = 7.5 Hz), 2.82-3.00 (2H, m), 3.11-3.24
(1H, m). 4.18-4.30 (2H, m), 6.84 (1H, dd, J = 1.8,
5.0 Hz), 7.19-7.36 (3H, m), 7.56 (1H, t, J = 3.2 H
z), 8.13 (1H, d, J = 5.0 Hz), 8.18 (1H, brs), 8.33
(1H, s).

Reference Example H84 According to Reference Example H83, 4- [2- (1-tert-butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl]- Instead of 2-pyridylamine, 4- (2-ethyl-4-phenyl-1,3-thiazol-5-yl) -2-pyridylamine, 4- [4- (4-fluorophenyl) -2-ethyl -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4-
(3-trifluoromethylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4- (4-fluoro-3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl Amine, 4- [4- (4-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4- [3- (1-methylethyl ) Phenyl] -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-
Ethyl-4- (3-propylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine and 4- [4- (3-methylphenyl)-
2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl]-
The following Reference Example H compounds 84-1 to 84-9 were synthesized using 2-pyridylamine, respectively. Reference Example H compound 84-1: N- [4- (2-ethyl-4-phenyl-
1,3-thiazol-5-yl) -2-pyridyl] propionamide melting point 139-140 ° C. Reference Example H Compound 84-2: N- [4- [2-Ethyl-4- (4-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide Melting point 156-157 ° C. Reference Example H Compound 84-3: N- [4- [2-Ethyl-4- (3-trifluoromethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide Melting point 126-127 ° C. Reference Example H Compound 84-4: N- [4- [2-ethyl-4- (4-fluoro-3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 105 -107 ° C. Reference Example H Compound 84-5: N- [4- [2-ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 121-122 ° C. Reference Example H Compound 84-6: N- [4- [4- (4-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 152-153 ° C. Reference Example H Compound 84-7: N- [4- [2-ethyl-4- [3- (1-methylethyl) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 93-94 ° C. Reference Example H Compound 84-8: N- [4- [2-ethyl-4- (3-propylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 124-125 ° C. Reference Example H Compound 84-9: N- [4- [4- (3-methylphenyl)
-2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl]
-2-Pyridyl] propionamide melting point 171-172 ° C.

Reference Example H85 According to Reference Example H28, the following Reference Example H compound 85 was synthesized by using butyryl chloride instead of cyclohexanecarbonyl chloride. Reference Example H Compound 85: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] butyramide melting point 88-89 ° C. Reference Example H86 According to Reference Example H85, instead of 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- ( The following Reference Example H compound 86 was synthesized using 3-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine. Reference Example H Compound 86: N- [4- [4- (3-chlorophenyl) -2-
Ethyl-1,3-thiazol-5-yl] -2-pyridyl] butyramide melting point 119-120 ° C. Reference Example H87 According to Reference Example H85, the following Reference Example H compounds 87-1 and 87-2 were synthesized using valeryl chloride and hexanoyl chloride instead of butyryl chloride, respectively. Reference Example H Compound 87-1: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] valeramide melting point 81-82 ° C. Reference Example H Compound 87-2: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] hexanamide melting point 84-85 ° C. Reference Example H88 According to Reference Example H86, the following Reference Example H compounds 88-1 and 88-2 were synthesized using valeryl chloride and hexanoyl chloride instead of butyryl chloride, respectively. Reference Example H Compound 88-1: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] valeramide melting point 109-110 ° C. Reference Example H Compound 88-2: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] hexanamide melting point 114-115 ° C. Reference Example H89 According to Reference Example H28, the following Reference Example H compound 89 was synthesized by using cyclopentylacetyl chloride instead of cyclohexanecarbonyl chloride. Reference Example H Compound 89: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] cyclopentylacetamide Melting point 85-86 ° C.

Reference Example H90 According to Reference Example H89, 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine was replaced by 4- [ 4- (3-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine and 4- [4- (4-chlorophenyl) -2-ethyl-1,3-thiazole-5 -Yl] -2-pyridylamine is used respectively in the following Reference Example H compound 90-
1 and 90-2 were synthesized. Reference Example H Compound 90-1: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] cyclopentylacetamide melting point 121-122 ° C. Reference Example H Compound 90-2: N- [4- [4- (4-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] cyclopentylacetamide melting point 149-150 ° C. Reference Example H91 N- [4- [4- (3-chlorophenyl) -2- (4-piperidyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide dihydrochloride N- [4- [ 2- (1-tert-Butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-
To a solution of pyridyl] acetamide (1.44 g, 2.81 mmol) in methanol (10 mL) was added 2N hydrochloric acid (4 mL), and the mixture was stirred at 80 ° C for 1 hr. The solvent was distilled off, and the residue was recrystallized from methanol to obtain 0.87 g (yield 64%) of the title compound. Melting point 193-195 ° C. Reference Example H92 According to Reference Example H91, N- [4- [2- (1-tert-butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl]- Instead of 2-pyridyl] acetamide, N- [4- [2- (1-tert-butoxycarbonylpiperidine-4
-Yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl]
2-pyridyl] propionamide
Compound 92 was synthesized. Reference Example H Compound 92: N- [4- [4- (3-chlorophenyl) -2-
(4-Piperidyl) -1,3-thiazol-5-yl] -2-pyridyl]
Propionamide dihydrochloride melting point 202-203 ° C. Reference Example H93 N- [4- [2- (1-acetylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide N- [4 -[4- (3-Chlorophenyl) -2- (4-piperidyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide dihydrochloride
Acetyl chloride (0.13 mL, 1.8 mmol) and triethylamine (0.50 mL, 3.6 mmol) were sequentially added to a tetrahydrofuran (20 mL) suspension of (0.41 g, 0.84 mmol), and the mixture was stirred at room temperature for 30 min. A saturated aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The residue was recrystallized from ethyl acetate-hexane to give the title compound 0.24 g (yield 62%). Melting point 160-161 ° C. Reference Example H94 According to Reference Example H93, N- [4- [4- (3-chlorophenyl) -2-
(4-Piperidyl) -1,3-thiazol-5-yl] -2-pyridyl]
Instead of acetamide dihydrochloride, N- [4- [4- (3-chlorophenyl) -2- (4-piperidyl) -1,3-thiazol-5-yl]-
The following Reference Example H compound 94 was synthesized using 2-pyridyl] propionamide dihydrochloride. Reference Example H Compound 94: N- [4- [2- (1-acetylpiperidine-
4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 174-175 ° C.

Reference Example H95 According to Reference Example H11, instead of 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo- The following Reference Example H compound 95 was synthesized using 1- (3-ethylphenyl) -2- (2-fluoro-4-pyridyl) ethanone hydrobromide. Reference Example H Compound 95: 2-ethyl-4- (3-ethylphenyl)-
5- (2-Fluoro-4-pyridyl) -1,3-thiazole oil ¹ H-NMR (CDCl ₃ ) δ: 1.18 (3H, t, J = 7.6 Hz), 1.46 (3
H, t, J = 7.6 Hz), 2.62 (2H, q, J = 7.6 Hz), 3.10 (2
H, q, J = 7.6 Hz), 6.86 (1H, t, J = 1.4 Hz), 7.07 (1
H, dt, J = 5.2, 1.4 Hz), 7.16-7.30 (3H, m), 7.33 (1
H, s), 8.10 (1H, d, J = 5.2 Hz). Reference Example H96 N-Cyclopentyl-4- [2-ethyl-4- (3-ethylphenyl)-
1,3-Thiazol-5-yl] -2-pyridylamine 2-ethyl-4- (3-ethylphenyl) -5- (2-fluoro-4-pyridyl) -1,3-thiazole (0.51 g, 1.6 mmol) and cyclopentylamine (1.6 mL, 16 mmol) were stirred at 140 ° C. for 12 hours. A sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract is a sodium hydrogen carbonate solution,
The extract was washed successively with saturated brine, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate =
It was purified by 4: 1) and recrystallized from isopropyl ether to obtain 0.40 g of the title compound (yield 66%). Melting point 77-79 ° C. Reference Example H97 According to Reference Example H96, the following Reference Example H compound 97 was synthesized using cyclohexylamine instead of cyclopentylamine. Reference Example H Compound 97: N-cyclohexyl-4- [2-ethyl-4]
-(3-Ethylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 115-116 ° C. Reference Example H98 According to Reference Example H57, instead of 4- (3-methylphenyl) -5- (2-methyl-4-pyridyl) -2- [4- (methylthio) phenyl] -1,3-thiazole, N- [4- [4- (3-methylphenyl) -2- [4-
(Methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] acetamide and N- [4- [4- (3-methylphenyl) -2- [4- (methylthio) phenyl] -1 , 3-thiazol-5-yl] -2-pyridyl] propionamide,
The following Reference Example H compounds 98-1 and 98-2 were synthesized. Reference Example H Compound 98-1: N- [4- [4- (3-methylphenyl)
-2- (4-methylsulfonylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] acetamide melting point 222-223 ° C. Reference Example H Compound 98-2: N- [4- [4- (3-methylphenyl)
-2- (4-methylsulfonylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] propionamide melting point 238-239 ° C. Reference Example H99 According to Reference Example H17, 3- (methylthio) thiopropionamide and 2-amino were used instead of 2-chlorothiobenzamide.
The following Reference Example H compounds 99-1 and 99-2 were synthesized using -1-methyl-2-thioxoethylbenzoate. Reference Example H Compound 99-1: 4- [4- (3-methylphenyl) -2-
[2- (Methylthio) ethyl] -1,3-thiazol-5-yl] -2-pyridylamine Melting point 98-99 ° C. Reference Example H Compound 99-2: 1- [5- (2-amino-4-pyridyl)
-4- (3-Methylphenyl) -1,3-thiazol-2-yl] ethylbenzoate Melting point 89-91 ° C.

Reference Example H100 According to Reference Example H99, instead of 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide, 2- (2 The following Reference Example H compounds 100-1 and 100-2 were synthesized using -amino-4-pyridyl) -2-bromo-1- (3-chlorophenyl) ethanone hydrobromide. Reference Example H Compound 100-1: 4- [4- (3-chlorophenyl)-
2- [2- (methylthio) ethyl] -1,3-thiazol-5-yl] -2-
Pyridylamine melting point 96-97 ° C. Reference Example H Compound 100-2: 1- [5- (2-amino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] ethylbenzoate amorphous powder ¹ H -NMR (CDCl ₃ ) a: 1.89 (3H, d, J = 6.4Hz), 4.50 (2H,
br s), 6.38-6.47 (2H, m), 6.56 (1H, dd, J = 1.4, 5.
6 Hz), 7.23-7.38 (3H, m), 7.45-7.53 (2H, m), 7.58-
7.66 (2H, m), 8.01 (1H, d, J = 5.6Hz), 8.11-8.16 (2
H, m). Reference Example H101 According to Reference Example H100, instead of 3- (methylthio) thiopropionamide, 3- (methylthio) thioacetamide,
The following Reference Example H compounds 101-1 and 101-2 were synthesized using 2,2-difluorothiopropionamide. Reference Example H Compound 101-1: 4- [4- (3-chlorophenyl)-
2- (methylthio) methyl-1,3-thiazol-5-yl] -2-pyridylamine melting point 111-112 ° C. Reference Example H Compound 101-2: 4- [4- (3-chlorophenyl)-
2- (1,1-Difluoroethyl) -1,3-thiazol-5-yl] -2-
Pyridylamine melting point 131-132 ° C. Reference Example H102 According to Reference Example H83, 4- [2- (1-tert-butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridyl was prepared. Instead of amine, 4- [4- (3
-Methylphenyl) -2- [2- (methylthio) ethyl] -1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2- [2- (methylthio ) Ethyl] -1,3-thiazole-5-
Il] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2-
(Methylthio) methyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2- (1,1-difluoroethyl) -1,3-thiazol-5 -Yl] -2-pyridylamine, 1- [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] ethylbenzoate, 1- [ Five
-(2-amino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] ethylbenzoate was used to prepare the following Reference Example H compounds 102-1 to 102-6. Synthesized. Reference Example H Compound 102-1: N- [4- [4- (3-methylphenyl) -2- [2- (methylthio) ethyl] -1,3-thiazol-5-yl] -2-pyridyl] propion Amide melting point 85-86 ° C. Reference Example H Compound 102-2: N- [4- [4- (3-chlorophenyl) -2- [2- (methylthio) ethyl] -1,3-thiazol-5-yl] -2-pyridyl] propionamide Melting point 91-92 ° C. Reference Example H Compound 102-3: N- [4- [4- (3-chlorophenyl) -2- (methylthio) methyl-1,3-thiazol-5-yl] -2-
Pyridyl] propionamide melting point 118-119 ° C. Reference Example H Compound 102-4: N- [4- [4- (3-chlorophenyl) -2- (1,1-difluoroethyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide Melting point 141-142 ° C. Reference Example H Compound 102-5: 1- [4- (3-methylphenyl)-
5- (2-propionylamino-4-pyridyl) -1,3-thiazole
-2-yl] ethylbenzoate melting point 102-103 ° C. Reference Example H Compound 102-6: 1- [4- (3-chlorophenyl)-
5- (2-propionylamino-4-pyridyl) -1,3-thiazole
-2-yl] ethylbenzoate melting point 124-127 ° C. Reference Example H103 According to Reference Example H81, 4- [2- (1-tert-butoxycarbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridyl Instead of amine, 1- [5- (2
-Amino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] ethylbenzoate, ethyl [5- (2-amino-4-pyridyl) -4- (3-chlorophenyl) ) -1,3-Thiazol-2-yl] acetate using Reference Example H Compound 1 below
03-1 and 103-2 were synthesized. Reference Example H Compound 103-1: 1- [5- (2-acetylamino-4
-Pyridyl) -4- (3-chlorophenyl) -1,3-thiazole-2-
Il] ethylbenzoate melting point 152-154 ° C. Reference Example H Compound 103-2: ethyl [5- (2-acetylamino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] acetate melting point 99-100 ° C.

Reference Example H104 N- [4- [2- (1-hydroxyethyl) -4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] propionamide 1- [4- (3-methylphenyl) -5- (2-propionylamino-4-
Pyridyl) -1,3-thiazol-2-yl] ethylbenzoate
To a solution of (1.63 g, 3.46 mmol) in methanol (5 mL) and tetrahydrofuran (20 mL) was added 1N aqueous sodium hydroxide solution at 0 ° C, and the temperature was raised to room temperature. The reaction mixture was stirred at room temperature for 30 minutes, and the solvent was evaporated. Aqueous sodium hydrogen carbonate solution was added to the residue, and the mixture was extracted with ethyl acetate. The extract was washed with aqueous sodium hydrogen carbonate solution and saturated brine. After drying the extract, the solvent was distilled off. The obtained crude crystals are ethyl acetate
-Recrystallized from hexane to give 1.12 g of the title compound (yield 89
%). Melting point 115-116 ° C. Reference Example H105 According to Reference Example H104, 1- [4- (3-methylphenyl) -5- (2
-Propionylamino-4-pyridyl) -1,3-thiazole-2-
1- [4- (3-chlorophenyl) -5- (2-propionylamino-4-pyridyl) -1,3-instead of [yl] ethylbenzoate
The following Reference Example H compound 105 was synthesized using thiazol-2-yl] ethylbenzoate. Reference Example H Compound 105: N- [4- [4- (3-chlorophenyl) -2
-(1-Hydroxyethyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide Melting point 131-132 ° C Reference example H106 N- [4- [2-acetyl-4- (3-methylphenyl) ) -1,3-Thiazol-5-yl] -2-pyridyl] propionamide dimethyl sulfoxide (0.30 mL, 4.2 mmol) in dichloromethane (1.0 mL) was added to oxalyl chloride (0.11 mL, 1.
26 mmol) in dichloromethane (2.0 mL) was added at -78 ° C, and the obtained reaction solution was stirred for 15 minutes. N- [4- [2- (1
-Hydroxyethyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide (0.38 g,
A solution of 1.0 mmol) in dichloromethane (1.5 mL) was added to the reaction mixture, and the mixture was stirred as it was for 45 minutes. -50 reaction mixture
The temperature was raised to ° C, and triethylamine (0.72 mL, 5.17 mmol) was added dropwise to the mixture. The obtained reaction mixture was stirred for 30 minutes and poured into an aqueous sodium hydrogen carbonate solution. The mixture was extracted with ethyl acetate and washed with aqueous sodium hydrogen carbonate solution and saturated brine. The resulting solution was dried and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 2: 1) to give crystals. The crystals were recrystallized from isopropyl ether to give the title compound 0.22 g (yield 58%). Melting point 121-123 ° C

Reference Example H107 In accordance with Reference Example H106, N- [4- [2- (1-hydroxyethyl)
Instead of -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide, N- [4- [4- (3-chlorophenyl) -2- (1- Hydroxyethyl) -1,3-thiazole-
The following Reference Example H compound 107 was synthesized using 5-yl] -2-pyridyl] propionamide. Reference Example H Compound 107: N- [4- [2-acetyl-4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide Melting point 115-117 ° C Reference Example H108 N -Ethyl-N '-[4- [2-ethyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] urea 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5-
Iyl] -2-pyridylamine (0.50 g, 1.7 mmol) in N, N-dimethylacetamide (10 mL) was added with ethyl isocyanate (0.20 mL, 2.5 mmol) and the reaction mixture was stirred at 80 ° C for 2
Stir for 0 hours. The reaction mixture was poured into an aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with aqueous sodium hydrogen carbonate solution and saturated brine. The solution was dried and concentrated. The obtained crude crystals were recrystallized from ethyl acetate-hexane to give the title compound 0.29 g (yield 47%). Melting point 160-162 ° C Reference Example H109 According to Reference Example H108, instead of 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4 The following Reference Example H compound 109 was synthesized using-[4- (3-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine. Reference Example H Compound 109: N- [4- [4- (3-chlorophenyl) -2
-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] -N'-ethylurea melting point 177-180 ° C Reference Example H110 According to Reference Example H81, [4- [2- (1-tert-butoxy Instead of carbonylpiperidin-4-yl) -4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 1- [5- (2
The following Reference Example H compound 110 was synthesized using -amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] ethylbenzoate. Reference Example H Compound 110: 1- [5- (2-acetylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] ethylbenzoate Melting point 110-113 ° C

Reference Example H111 According to Reference Example H104, 1- [4- (3-methylphenyl) -5- (2
-Propionylamino-4-pyridyl) -1,3-thiazole-2-
1- [5- (2-acetylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] ethylbenzoate and 1- Using [5- (2-acetylamino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] ethylbenzoate, the following Reference Example H compounds 111-1 and 111 -2 was synthesized. Reference Example H Compound 111-1: N- [4- [2- (1-hydroxyethyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl]-
2-Pyridyl] acetamide Melting point 99-102 ° C Reference example H compound 111-2: N- [4- [4- (3-chlorophenyl) -2- (1-hydroxyethyl) -1,3-thiazol-5-yl ]-
2-Pyridyl] acetamide Melting point 142-145 ° C Reference Example H112 According to Reference Example H106, N- [4- [2- (1-hydroxyethyl))
Instead of -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide, N- [4- [4- (3-chlorophenyl) -2- (1- Hydroxyethyl) -1,3-thiazole-
The following Reference Example H compound 112 was synthesized using 5-yl] -2-pyridyl] acetamide. Reference Example H Compound 112: N- [4- [2-acetyl-4- (3-chlorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide Melting point 180-183 ° C Reference Example H113 Reference Example According to H101, 2- (2-amino-4-pyridyl) -2-bromo-1- (3-chlorophenyl) ethanone is replaced by 2- (2-amino-4-pyridyl) -2 instead of hydrobromide. The following Reference Example H compounds 113-1 and 113-2 were synthesized using -bromo-1- (3-methylphenyl) ethanone hydrobromide. Reference Example H Compound 113-1: 4- [4- (3-methylphenyl)-
2- (Methylthio) methyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 113-114 ° C Reference example H compound 113-2: 4- [2- (1,1-difluoroethyl) -4 -(3-Methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridylamine Melting point 140-141 ° C Tables 55-75 show the compounds prepared in Reference Examples H1-113.
Shown in.

[0296]

[Table 55]

[0297]

[Table 56]

[0298]

[Table 57]

[0299]

[Table 58]

[0300]

[Table 59]

[0301]

[Table 60]

[0302]

[Table 61]

[0303]

[Table 62]

[0304]

[Table 63]

[0305]

[Table 64]

[0306]

[Table 65]

[0307]

[Table 66]

[0308]

[Table 67]

[0309]

[Table 68]

[0310]

[Table 69]

[0311]

[Table 70]

[0312]

[Table 71]

[0313]

[Table 72]

[0314]

[Table 73]

[0315]

[Table 74]

[0316]

[Table 75]

Reference Example I1 (1) Reference Example H Compound 29-2 10.0 mg (2) Lactose 60.0 mg (3) Corn starch 35.0 mg (4) Gelatin 3.0 mg (5) Magnesium stearate 2.0 mg Reference Example H Compound 29-2 A mixture of 10.0 mg of lactose 60.0 mg and cornstarch 35.0 mg was used in 0.03 ml of 10% aqueous gelatin solution (3.0 mg as gelatin).
After granulating through a sieve of mm mesh, it is dried at 40 ° C. and sieved again. The granules thus obtained are mixed with 2.0 mg of magnesium stearate and compressed. The resulting core tablets are sugar-coated with a suspension of sucrose, titanium dioxide, talc and gum arabic. The coated tablets are polished with beeswax to obtain coated tablets. Reference Example I2 (1) Reference Example H Compound 29-2 10.0 mg (2) Lactose 70.0 mg (3) Corn Starch 50.0 mg (4) Soluble Starch 7.0 mg (5) Magnesium Stearate 3.0 mg Reference Example H Compound 29-2 (10.0 mg) and magnesium stearate (3.0 mg) were added to an aqueous solution of soluble starch (0.07 ml).
After granulating (7.0 mg as soluble starch) it is dried and mixed with 70.0 mg lactose and 50.0 mg corn starch. The mixture is compressed to give tablets. Reference Example I3 (1) Reference Example H Compound 29-2 5.0 mg (2) Salt 20.0 mg (3) Distilled water Reference Example H compound 29-2 5.0 mg and salt 20.0 mg are distilled water. And add water to bring the total volume to 2.0 ml. The solution is filtered and filled under aseptic conditions into 2 ml ampoules.
After sterilizing the ampoule, it is sealed to obtain a solution for injection. Reference Example J1 (1) Rofecoxib 5.0 mg (2) Salt 20.0 mg (3) Distilled water Total amount 2 ml Rofecoxib 5.0 mg and salt 20.0 mg were dissolved in distilled water, and water was added to a total amount 2.0 ml. And The solution is filtered and filled under aseptic conditions into 2 ml ampoules. After sterilizing the ampoule, it is sealed to obtain a solution for injection. Reference Example J2 (1) Rofecoxib 50 mg (2) Lactose 34 mg (3) Corn starch 10.6 mg (4) Corn starch (paste-like) 5 mg (5) Magnesium stearate 0.4 mg (6) Carboxymethylcellulose calcium 20 mg Total 120 mg Regular According to the method, the above (1) to (6) were mixed and compressed with a tableting machine to obtain tablets.

Reference Example I4 A formulation of any of Reference Examples I1 to 3 and a formulation of any of Reference Examples J1 to J2 are combined. Reference Example K1 The gene manipulation method described below is based on the literature (Maniatis et al., Molecular Cloning, Cold Spring Harbor Laborato).
ry, 1989) or the method described in the attached protocol of reagents. (1) Cloning of human p38 MAP kinase gene and preparation of recombinant baculovirus Cloning of human p38 MAP kinase gene
Reported by Han et al. (Science 265 (5173), 808-811 (199) using kidney cDNA (Toyobo, QUICK-Clone cDNA) as a template.
4)) Primer set P38-U: 5'-AC prepared with reference to the nucleotide sequence of p38 MAP kinase gene
CACTCGAGATGGGACTACAAGGACGA
CGATGACAAGTCTCAGGAGAGGGCCC
ACGTTCTAC-3 '[SEQ ID NO: 15] and PA
G-L: 5'-ACCCGGTACCACCACGTGG
It was performed by the PCR method using CTCAGGACTCCATCTCT-3 ′ [SEQ ID NO: 16]. PCR reaction is A
It was performed by the Hot Start method using mpliWax PCR Gem 100 (Takara Shuzo). As a lower layer mixture,
10xLA PCR Buffer 2 μL, 2.5 m
3 μL of M dNTP solution, 2.5 μL each of 12.5 μM primer solution, and 10 μL of sterile distilled water were mixed. As the upper layer mixture, human heart cDNA (1 ng / m 2) was used as a template.
L) 1 μL, 10 × LA PCR Buffer 3
μL, 2.5 mM dNTP solution 1 μL, TaKaRa
LA Taq DNA po1ymerase (Takara Shuzo)
0.5 μL and 24.5 μL of sterile distilled water were mixed. AmpliWax PCR Gem 10 was added to the prepared lower layer mixture.
0 (Takara Shuzo) was added, and the mixture was treated at 70 ° C. for 5 minutes and on ice for 5 minutes, and the upper layer mixture was added to prepare a PCR reaction solution. The tube containing the reaction solution was set in a thermal cycler (Perkin Elmer) and then treated at 95 ° C for 2 minutes. Further, a cycle of 95 ° C. for 15 seconds and 68 ° C. for 2 minutes was repeated 35 times and then treated at 72 ° C. for 8 minutes. The obtained PCR product is agarose gel (1%)
Electrophoresed and containing the p38 MAP kinase gene
After recovering the 1 kb DNA fragment from the gel, pT7Bl
The plasmid pHP38 was prepared by inserting it into ue-T vector (Takara Shuzo). Plasmid pFA
STBAC1 (CIBCOBRL) 4.8kb Xh
oI-KpnI fragment and 1. of plasmid pHP38 above.
The 1 kb XhoI-Kpn fragment was ligated to prepare a plasmid pFBHP38. Plasmid pFBHP38
And BAC-TO-BAC Baculovirus
Expression System (GIBCOBR
L) was used to prepare the recombinant baculovirus virus stock BAC-HP38. (2) Cloning of the human MKK3 gene and preparation of recombinant baculovirus
(Toyobo, QUICK-Clone cDNA) is used as a template and Derijard,
Primer set MKK-U: 5'-ACAAGAATTCAT prepared with reference to the nucleotide sequence of the MKK3 gene reported by B. et al. (Science 267 (5198), 682-685 (1995)).
AACATATGGCTCATCATCATCATCA
TCATTCCAAGCCACCCCGCACCCAA-
3 '[SEQ ID NO: 17] and MKK-L: 5'-TCC
CGTCTAGACTATGAGTCTTTCTCCCA
It was performed by the PCR method using GGAT-3 ′ [SEQ ID NO: 18]. PCR reaction is AmpliWax PCR G
It was carried out by the Hot Start method using em 100 (Takara Shuzo). As the lower layer mixture, 10xLA PCR Buf
fer 2 μL, 2.5 mM dNTP solution 3 μL, 1
2.5 μM each of 2.5 μL primer solution, sterile distilled water 1
0 μL was mixed. As the upper mixture, 1 μL of human kidney cDNA (1 ng / mL) was used as a template, 10 × LA
PCR Buffer 3 μL, 2.5 mM dNTP
Solution 1 μL, TaKaRa LA Taq DNA po1
ymerase (Takara Shuzo) 0.5 μL, sterile distilled water 2
4.5 μL was mixed. Ampli is added to the prepared lower layer mixture.
One Wax PCR Gem 100 (Takara Shuzo) was added, and the mixture was treated at 70 ° C. for 5 minutes and on ice for 5 minutes, and then the upper layer mixture was added to prepare a PCR reaction solution. The tube containing the reaction solution was set in a thermal cycler (Perkin Elmer) and then treated at 95 ° C for 2 minutes. 1 at 95 ° C
A cycle of 68 ° C. for 2 minutes for 5 seconds was repeated 35 times, followed by treatment at 72 ° C. for 8 minutes. The obtained PCR product was subjected to agarose gel (1%) electrophoresis, and a 1.0 kb DNA fragment containing the MKK3 gene was recovered from the gel.
It was inserted into 7Blue-T vector (Takara Shuzo) to obtain a plasmid pHMKK3. Primer set SER to mutate MKK3 into a constitutively active form (Ser at position 189 is Glu, Thr at position 193 is Glu)
-U: 5'-GGCTACTTGGTGGACGAGG
TGGCCAAGGAGATGGATGCCGGCTG
C-3 ′ [SEQ ID NO: 19] and SER-L: 5′-G
CAGCCGGGCATCCATCTCCTTGGCCA
CCTCGTCCACCAAGTAGCC-3 ′ [SEQ ID NO: 20] was used to perform QuikChange Sit.
e-Directed Mutagenesis Ki
t (Stratagene) was used to introduce a mutation,
aMKK3 was obtained. Plasmid pFASTBAC1 (C
IBCOBRL) 4.8 kb EcoRI-XbaI
Fragment and 1.0 kb E of the above plasmid pcaMKK3
The coRI-XbaI fragment was ligated and the plasmid pFBc
aMKK3 was prepared. Plasmid pFBcaMKK3
And BAC-TO-BAC Baculovirus E
xpression System (GIBCOBR
L) was used to prepare a recombinant baculovirus virus stock BAC-caMKK3. (3) Preparation of active p38 MAP kinase Sf-21 cells were treated with 100 mL Sf-900II SFM medium (G) so as to have 1 × 10 ⁶ cells / mL.
(IBCOBRL) and then cultured at 27 ° C. for 24 hours. Recombinant baculovirus virus stock BA
C-HP38 and BAC-caMKK3 are each 0.2
After adding mL, the cells were further cultured for 48 hours. The cells were separated from the culture solution by centrifugation (3000 rpm, 10 min), and then washed twice with PBS. 10 cells
mL Lysis buffer (25 mM HEPE
S (pH 7.5), 1% TritonX, 130 mM
NaCl, 1 mM EDTA, 1 mM DTT, 25 m
M β-glycerophosphate, 20 mM
leupeptin, 1 mM APMSF, 1 mM
After suspending in Sodium orthovanadate), 2000 with a homogenizer (POLYTRON)
The cells were disrupted by performing the treatment twice at 0 rpm for 2 minutes. From the supernatant obtained by centrifugation (40000 rpm, 45 minutes), Anti-FLAG M2 Affinity
The active p38 MAP kinase was purified using Gel (Eastman Chemical Co.). (4) Measurement of enzyme inhibitory activity 260 ng of active p38 MAP kinase and 1 μg
Including Myelin Basic Protein 3
7.5 μL reaction solution (25 mM HEPES (pH 7.
5), 10 mM Magnesium Acetat
After 2.5 μL of the test compound dissolved in DMSO was added to e), the mixture was incubated at 30 ° C. for 5 minutes. ATP solution (2.5
The reaction was started by adding 10 μL of μM ATP, 0.1 μCi [g- ³² P] ATP). After reacting at 30 ° C. for 60 minutes, 50 μL of 20% TCA solution was added to stop the reaction. After leaving the reaction solution at 0 ° C. for 20 minutes, the acid-insoluble fraction was transferred to GF / C filter (Packard Japan) using a cell harvester (Packard Japan), and 250 mM was added.
Washed with H ₃ PO ₄ . After drying at 45 ° C for 60 minutes, Microscint 0 (Packard Japan)
Was added to 40 μL and the radioactivity was measured by Top Count (Packard Japan). The concentration (IC ₅₀ value) of the test compound required to inhibit the incorporation of ³² P into the acid-insoluble fraction by 50% was determined by PRISM 2.01 (Graph Pad).
Software company) calculated. The results are shown in Table 76.

[0319]

[Table 76] Reference Example Measurement of K2 TNFα production inhibitory activity 1% inactivated fetal bovine serum (Life Technology (Li
fe Technologies, Inc. ), Country name: USA) and 10 mM HEPES (pH 7.
5) containing PRMI1640 medium (Life Technologies, Inc.)
The THP-1 cells cultivated in (1) were seeded in a 96-well plate at 1 × 10 ⁵ cells / well, and 1 μL of the test compound dissolved in DMSO was added.
After culturing in a carbon dioxide gas incubator at 37 ° C. for 1 hour, LPS (Wako Pure Chemical Industries, Ltd.) was added to a final concentration of 5 μg / mL. After culturing at 37 ° C. for 4 hours in a carbon dioxide gas incubator, a supernatant was obtained by centrifugation. The TNF-α concentration in the supernatant was measured by ELISA (R & D System).
It was measured by a Quantine Kit, manufactured by ms. The concentration (IC ₅₀ value) of the test compound required to inhibit TNF-α production by 50% was calculated by PRISM 2.01 (Graph Pad Software). The results are shown in Table 7.
7 shows.

[0320]

[Table 77] From the above results, the compound of the present invention has excellent p38 MA.
It can be seen that it has a P kinase inhibitory action and a TNF-α production inhibitory action.

Reference Example L1 1-Bromo-3-ethylbenzene 3-ethylaniline (10.0 g, 82.5 mmol) in 50% sulfuric acid aqueous solution (43.6 g) at 0 ° C. sodium nitrite (6.83 g, 99.0 mmo)
The aqueous solution (16.5 mL) of l) was added dropwise over 30 minutes. The resulting reaction mixture was stirred at 0 ° C for 45 minutes. A solution of this diazonium salt is slowly heated to reflux with copper (I) bromide.
(12.4 g, 86.6 mmol) was added to a 48% hydrobromic acid solution (82.5 mL) little by little. After the addition, the reaction mixture was heated to reflux for 30 minutes. The reaction mixture was cooled to room temperature and extracted with ethyl ether. The extract was washed successively with 1N-sodium hydroxide aqueous solution and saturated brine, filtered, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 20: 1) to give the title compound (6.13 g, yield 40%).
%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.23 (3H, t, J = 7.5Hz), 2.63 (2H,
q, J = 7.5Hz), 7.11-7.20 (2H, m), 7.28-7.38 (2H,
m). Reference Example L2 According to Reference Example L1, instead of 3-ethylaniline, 3- (1
-Methylethyl) aniline was used to prepare the following reference compound L
2 was synthesized. Reference Example L Compound 2: 1-Bromo-3- (1-methylethyl) benzene oil. ¹ H-NMR (CDCl ₃ ) δ: 1.24 (6H, d, J = 7.0Hz), 2.77-2.99
(1H, m), 7.03-7.16 (2H, m), 7.27-7.34 (1H, m), 7.
37 (1H, s). Reference Example L3 3-Ethylbenzoic acid 1-Bromo-3-ethylbenzene (5.1 g,
A tetrahydrofuran solution (45 mL) of 28 mmol) was added dropwise to a tetrahydrofuran mixture (5.0 mL) of magnesium pieces (0.74 g, 31 mmol), and the mixture was stirred for 30 minutes as it was. The reaction mixture was added to crushed dry ice, and the mixture was stirred as it was for 1 hour. 1N-hydrochloric acid was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried, filtered and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 5: 1) to give 3.87 g of the title compound (yield 93%).
Got Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.28 (3H, t, J = 7.5Hz), 2.73 (2H,
q, J = 7.5Hz), 7.34-7.50 (2H, m), 7.92-7.98 (2H,
m). Reference Example L4 According to Reference Example L3, instead of 1-bromo-3-ethylbenzene, 1-bromo-3- (1-methylethyl) benzene and 1-bromo-3- (1-methylethyl) benzene were used.
The following Reference Example L compounds 4-1 and 4-2 were synthesized using bromo-4-fluoro-3-methylbenzene, respectively.
Reference Example L Compound 4-1: 3- (1-methylethyl) benzoic acid oily substance. ¹ H-NMR (CDCl ₃ ) δ: 1.29 (6H, d, J = 7.0Hz), 2.98-3.06
(1H, m), 7.38-7.54 (2H, m), 7.90-8.02 (2H, m). Reference Example L Compound 4-2: 4-Fluoro-3-methylbenzoic acid Melting point 165-167 ° C. Reference Example L5 3-Ethylbenzoyl chloride 3-Ethylbenzoic acid (9.40 g, 62.6 mmol) was slowly added to thionyl chloride (45 mL) at 0 ° C, and N, N-dimethylformamide (3 drops) was added dropwise. The obtained reaction mixture was heated under reflux for 2 hours as it was. The reaction mixture was concentrated and used in the next reaction without purification.

Reference Example L6 According to Reference Example L5, 3- (1
-Methylethyl) benzoic acid and 4-fluoro-3-methylbenzoic acid were used to synthesize the following Reference Example compounds L6-1 and L6-2. Reference Example L Compound 6-1: 3- (1-methylethyl) benzoyl chloride Used in the next reaction without purification. Reference Example L Compound 6-2: 4-Fluoro-3-methylbenzoyl chloride Used in the next reaction without purification. Reference Example L7 N- (4-chlorobenzoyl) propyleneimine A solution of propyleneimine (12 mL, 0.15 mol) in tetrahydrofuran (160 mL) was added to a 1N-sodium hydroxide aqueous solution. This mixture was added to 4-chlorobenzoyl chloride (25
g, 0.14 mol) was added dropwise. After completion of dropping, the mixture was further stirred for 30 minutes. The reaction mixture was extracted with ethyl acetate. The extract was dried and the solvent was evaporated to give the title compound (25 g, yield 89%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5Hz), 2.15 (1H,
d, J = 2.9Hz), 2.51-2.66 (2H, m), 7.39-7.47 (2H,
m), 7.93-8.01 (2H, m). Reference Example L8 According to Reference Example L7, instead of 4-chlorobenzoyl chloride, 3-chlorobenzoyl chloride, 3-methylbenzoyl chloride, 3-ethylbenzoyl chloride, 3-ethylbenzoyl chloride (1-Methylethyl) benzoyl chloride, 4-fluoro-3-methylbenzoyl chloride and 3-fluorobenzoyl chloride were used respectively to prepare the following Reference Example compounds L8-1 to L8.
-6 was synthesized. Reference Example L Compound 8-1: N- (3-chlorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.1Hz), 2.17 (1H,
d, J = 3.3Hz), 2.53-2.68 (2H, m), 7.40 (1H, dd, J =
7.7, 8.1Hz), 7.53 (1H, ddd, J = 1.5, 2.2, 8.1Hz),
7.90 (1H, dt, J = 7.7, 1.5Hz), 8.00 (1H, dd, J = 1.
5, 2.2 Hz). Reference Example L Compound 8-2: N- (3-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5Hz), 2.14 (1H,
d, J = 3.3Hz), 2.41 (3H, s), 2.51-2.66 (2H, m), 7.
32-7.39 (2H, m), 7.79-7.87 (2H, m). Reference Example L Compound 8-3: N- (3-ethylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.27 (3H, t, J = 7.5Hz), 1.40 (3H,
d, J = 5.5Hz), 2.14 (1H, d, J = 2.9Hz), 2.52-2.61
(2H, m), 2.71 (2H, q, J = 7.5Hz), 7.32-7.41 (2H,
m), 7.81-7.89 (2H, m). Reference Example L compound 8-4: N- [3- (1-methylethyl) benzoyl] propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.29 (6H, d, J = 7.0Hz), 1.40 (3H,
d, J = 5.9Hz), 2.14 (1H, d, J = 3.7Hz), 2.51-2.64
(2H, m), 2.87-3.10 (1H, m), 7.33-7.46 (2H, m), 7.8
4 (1H, dt, J = 7.0, 1.8Hz), 7.91 (1H, s). Reference Example L compound 8-5: N- (4-fluoro-3-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.4Hz), 2.14 (1H,
d, J = 3.4Hz), 2.33 (s, 3H), 2.51-2.61 (2H, m), 7.
06 (1H, t, J = 8.8Hz), 7.81-7.90 (2H, m). Reference Example L compound 8-6: N- (3-fluorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.5Hz), 2.16 (1H,
d, J = 3.3Hz), 2.52-2.68 (2H, m), 7.25 (1H, ddd, J
= 1.1, 2.6, 8.4Hz), 7.43 (1H, ddd, J = 5.5, 7.7, 8.
1Hz), 7.69 (1H, ddd, J = 1.5, 2.6, 8.1Hz), 7.81 (1
H, ddd, J = 1.1, 1.5, 7.7Hz). Reference Example L9 2-Fluoro-4-methylpyridine Journal of Medicinal Chemistry (J
individual of Medicinal Chemis
try), 33, pp. 1667-1675, 1990. Boiling point 82-86 ° C (10 kPa).

Reference Example L10 2-tert-Butoxycarbonylamino-4-methylpyridine Synthesis (Synthesis), pages 877-882, 199
6 Years or Journal of Organic Chemistry, 61, 4
It was synthesized according to the method described on pages 810 to 4811, 1996. Reference Example L11 2- (2-Fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone Under argon atmosphere, diisopropylamine (44 mL, 0.31
An anhydrous tetrahydrofuran (300 mL) solution of (mol) was cooled to -78 ° C, and 1.6M n-butyllithium hexane solution (190 mL, 0.31 mol) was added dropwise with stirring. After the dropping, stir for 10 minutes, and then 2-fluoro-4-methylpyridine (34.5
A solution of g, 0.31 mol) in anhydrous tetrahydrofuran (30 mL) was added. The reaction mixture was stirred at -10 ° C for 30 minutes. The reaction solution was cooled to -78 ° C and N- (3-methylbenzoyl) propyleneimine (52 g, 0.30 mol) in anhydrous tetrahydrofuran (3
0 mL) solution was added dropwise. After completion of dropping, the mixture was stirred at room temperature for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was recrystallized from isopropyl ether to give the title compound (35 g, yield 52%). Melting point 66-67 ° C. Reference Example L12 According to Reference Example L11, the following Reference Example compound 12 was synthesized using N- (3-chlorobenzoyl) propyleneimine instead of N- (3-methylbenzoyl) propyleneimine. Reference Example L Compound 12: 1- (3-chlorophenyl) -2- (2-fluoro-4-pyridyl) ethanone Melting point 84-86 ° C. Reference Example L13 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-
(3-Methylphenyl) ethanone 2-tert-butoxycarbonylamino-4-methylpyridine (1
A solution of 46 g, 0.700 mol) in anhydrous tetrahydrofuran (1.30 L) was cooled to −78 ° C., and 1.6M n-butyllithium hexane solution (875 mL, 1.40 mol) was added dropwise with stirring. After the dropwise addition was completed, the mixture was stirred at 0 ° C for 30 minutes and then cooled to -78 ° C. N-
(3-Methylbenzoyl) propyleneimine (123 g, 0.700
A solution of (mol) in anhydrous tetrahydrofuran (130 mL) was added dropwise. After the completion of dropping, the mixture was stirred at -78 ° C for 1 hr, heated to room temperature, and stirred for 1 hr. Saturated saline solution (1.30
L) was added and the organic layer was separated. The aqueous layer was extracted with ethyl acetate, and the combined organic layers were dried and concentrated. The crude crystals were recrystallized from ethyl acetate to give the title compound (185 g)
(Yield 81%) was obtained. Melting point 144-146 ° C. Reference Example L14 According to Reference Example L13, instead of N- (3-methylbenzoyl) propyleneimine, N- (3-chlorobenzoyl) propyleneimine, N- [3- (1-methylethyl) benzoyl] propyleneimine, N -(4-Fluoro-3-methylbenzoyl) propyleneimine, N- (3-fluorobenzoyl) propyleneimine, N- (4-chlorobenzoyl) propyleneimine and N-
The following Reference Example compounds 14-1 to 14-6 were synthesized using (3-ethylbenzoyl) propyleneimine, respectively. Reference Example compound 14-1: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-chlorophenyl) ethanone melting point 152-153 ° C. Reference Example compound 14-2: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- [3- (1-methylethyl) phenyl]
Ethanone melting point 176-177 ° C. Reference Example compound 14-3: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-fluoro-3-methylphenyl)
Ethanone melting point 143-144 ℃. Reference Example compound 14-4: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-fluorophenyl) ethanone melting point 164-165 ° C. Reference Example compound 14-5: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-chlorophenyl) ethanone melting point 155-156 ° C. Reference Example compound 14-6: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-ethylphenyl) ethanone melting point 122-123 ° C.

Reference Example L15 2- (2-Amino-4-pyridyl) -1- (3-methylphenyl) ethanone 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-
(3-Methylphenyl) ethanone (50.0 g, 0.153 mol) in 2N-
Hydrochloric acid (260 mL) was added, and the mixture was stirred at 100 ° C. for 2 hr. The reaction mixture was neutralized with aqueous sodium hydroxide solution and extracted with ethyl acetate. The extract was dried and concentrated. The crude crystals were washed with isopropyl ether to give the title compound (29.1 g, yield 84%). Melting point 119-120 ° C. Reference Example L16 According to Reference Example L15, 2- (2-tert-butoxycarbonylamino-4- was used instead of 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone. The following Reference Example compound 16 was synthesized using pyridyl) -1- (3-chlorophenyl) ethanone. Reference Example L Compound 16: 2- (2-amino-4-pyridyl) -1- (3-
Chlorophenyl) ethanone melting point 173-175 ° C. Reference Example L17 N- [4- [2- (3-Methylphenyl) -2-oxoethyl] -2-pyridyl] benzamide 2- (2-amino-4-pyridyl) -1- (3-methylphenyl) ethanone ( 24.0 g, 0.106 mol) in acetonitrile (500 mL) was added to benzoyl chloride (27.0 mL, 0.23
3 mol) was added at 0 ° C. Triethylamine (35.6 mL, 0.256 mol) was added dropwise to the obtained mixture, and the mixture was stirred at room temperature for 4 hr. Water was added to the reaction mixture, and the precipitated solid was collected by filtration. The aqueous layer was extracted with ethyl acetate and washed with an aqueous sodium hydrogen carbonate solution. The extract was dried and concentrated. The obtained residue and solid were combined with tetrahydrofuran (450 mL) and methanol (110
(mL) solution and 1N-sodium hydroxide aqueous solution (256
mL) was added. The reaction mixture was stirred for 2 hours and concentrated.
The residue was extracted with ethyl acetate, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 2: 1), and the obtained oil was crystallized from ethyl ether to give the title compound (19.5 g, yield 56%). Melting point 67-69 ° C. Reference Example L18 According to Reference Example L17, 2- (2-amino-4-pyridyl) -1- (3-
The following Reference Example L compound 18 was synthesized by using 2- (2-amino-4-pyridyl) -1- (3-chlorophenyl) ethanone instead of methylphenyl) ethanone. Reference Example L Compound 18: N- [4- [2- (3-chlorophenyl) -2-
Oxoethyl] -2-pyridyl] benzamide melting point 121-123 ° C. Reference Example L19 2- (2-Amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1 -
(3-Methylphenyl) ethanone (185 g, 0.566 mol) acetic acid
Bromine (29.2 mL, 0.566 mol) was added to the (400 mL) solution, and the mixture was stirred at 80 ° C. for 2 hr. The reaction mixture was concentrated, and the residue was crystallized from acetonitrile-ethyl acetate to give the title compound (171 g, yield 78%). Melting point 182-185 ° C.

Reference Example L20 According to Reference Example L19, 2- (2-fluoro-4-pyridyl was used instead of 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone. ) -1- (3-Methylphenyl) ethanone, 1- (3-chlorophenyl) -2- (2-fluoro-4-
Pyridyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-chlorophenyl) ethanone, 2-
(2-tert-butoxycarbonylamino-4-pyridyl) -1- [3-
(1-Methylethyl) phenyl] ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-fluorophenyl) ethanone, 2- (2-tert-butoxycarbonylamino-
4-pyridyl) -1- (4-chlorophenyl) ethanone, 2- (2-ter
t-Butoxycarbonylamino-4-pyridyl) -1- (3-ethylphenyl) ethanone and 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-fluoro-3-methylphenyl) ethanone The following Reference Example L compounds 20-1 to 20-8 were respectively synthesized using Reference Example L Compound 20-1: 2-Bromo-2- (2-fluoro-4-)
Pyridyl) -1- (3-methylphenyl) ethanone hydrobromide salt was used in the next reaction without purification. Reference Example L Compound 20-2: 2-Bromo-1- (3-chlorophenyl) -2- (2-fluoro-4-pyridyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 7.19 (1H, s), 7.38 (1H, s), 7.5
2-7.56 (1H, m), 7.64 (1H, t, J = 8.0Hz), 7.77-7.82
(1H, m), 8.05-8.09 (1H, m), 8.16 (1H, t, J = 1.8Hz),
8.32 (1H, d, J = 5.2Hz), 10.23 (1H, br s). Reference Example L Compound 20-3: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (3-chlorophenyl) ethanone hydrobromide melting point 199-200 ° C. Reference Example L Compound 20-4: 2- (2-amino-4-pyridyl) -2-
Bromo-1- [3- (1-methylethyl) phenyl] ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 1.24 (6H, d, J = 6.6Hz), 3.00 (1
H, septet, J = 6.6Hz), 7.15 (1H, s), 7.17 (1H, s),
7.46-7.65 (2H, m), 7.88-7.98 (4H, m), 8.09 (1H, br
s). Reference Example L Compound 20-5: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (3-fluorophenyl) ethanone hydrobromide melting point 206-207 ° C. Reference Example L Compound 20-6: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (4-chlorophenyl) ethanone hydrobromide melting point 202-203 ° C. Reference Example L Compound 20-7: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (3-ethylphenyl) ethanone hydrobromide melting point 46-47 ° C. Reference Example L Compound 20-8: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (4-fluoro-3-methylphenyl) ethanone hydrobromide melting point 225-226 ° C. Reference Example L21 N- [4- [1-Bromo-2- (3-methylphenyl) -2-oxoethyl] -2-pyridyl] benzamide hydrobromide N- [4- [2- (3-methylphenyl) ) -2-Oxoethyl] -2-pyridyl] benzamide (19.0 g, 57.5 mmol) in acetic acid (60 mL)
Bromine (3.0 mL, 57.5 mmol) was added dropwise to the solution at room temperature over 1 hour, and the reaction mixture was stirred as it was for 2 hours. The precipitated crude crystals were filtered, washed with ethyl acetate, and the title compound 25.
4 g (yield 90%) was obtained. Melting point 203-206 ° C. Reference Example L22 According to Reference Example L21, N- [4- [2- (3-methylphenyl) -2-
N- instead of oxoethyl] -2-pyridyl] benzamide
Using [4- [2- (3-chlorophenyl) -2-oxoethyl] -2-pyridyl] benzamide, the following Reference Example L compound 22
Was synthesized. Reference Example L Compound 22: N- [4- [1-Bromo-2- (3-chlorophenyl) -2-oxoethyl] -2-pyridyl] benzamide hydrobromide Melting point 212-213 ° C.

Reference Example L23 Thiobutylamidobutyronitrile (10.0 g, 145 mol) was dissolved in a 4N-hydrogen chloride solution in ethyl acetate (100 mL). Dithiophosphoric acid-O, O-diethyl (26.7 mL, 0.160 mol) was added to the solution, and the mixture was stirred at room temperature for 22 hr. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The filtrate was washed with saturated saline and an aqueous solution of sodium hydrogen carbonate, dried and the solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1) to give the title compound 6.68.
g (yield 45%) was obtained. Oil ¹ H-NMR (CDCl ₃ ) δ: 0.99 (3H, t, J = 7.6 Hz), 1.72-1.9
3 (2H, m), 2.64 (2H, t, J = 7.6Hz), 7.02 (1H, br
s), 7.77 (1H, br s). Reference Example L24 According to Reference Example L23, the following Reference Example L compound 24 was synthesized using 1-methylpiperidine-4-carbonitrile instead of butyronitrile. Reference Example L Compound 24: 1-Methylpiperidine-4-carbothioamide Melting point 216-220 ° C. Reference Example L25 [5- (2-Fluoro-4-pyridyl) -4- (3-methylphenyl) -1,
3-Thiazol-2-yl] amine 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide [2- (2-tert-butoxycarbonylamino 2- (2-Fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone (8.46 g, 36.9 mmol) was used in place of -4-pyridyl) -1- (3-methylphenyl) ethanone It was synthesized according to Reference Example L19. ] And thiourea (3.03 g, 3
Triethylamine (5.2 mL, 37.3 mmol) was added to an acetonitrile (50 mL) mixture of 9.8 mmol), and the mixture was stirred at 80 ° C. for 2 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture,
The precipitated solid was collected by filtration. The obtained solid was washed with water and then dried. The crude crystals were recrystallized from ethanol to give the title compound (3.67 g, yield 35%). Melting point 214-218 ° C. Reference Example L26 2-Ethyl-5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole 2-bromo-2- (2-fluoro-4-pyridyl) -1 A solution of-(3-methylphenyl) ethanone hydrobromide (11 g, 29 mmol) and thiopropionamide (2.7 g, 30 mmol) in N, N-dimethylformamide (30 mL) was stirred at room temperature for 14 hours. . Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off.
The residue was subjected to silica gel column chromatography (hexane-
Ethyl acetate = 4: 1) and the title compound 3.3 g (yield
38%). Oil ¹ H-NMR (CDCl ₃ ) δ: 1.64 (3H, t, J = 7.6Hz), 2.34 (3H,
s), 3.10 (2H, q, J = 7.6Hz), 6.84-6.86 (1H, m), 7.
05-7.09 (1H, m), 7.13-7.25 (3H, m), 7.37 (1H, s),
8.10 (1H, d, J = 5.6Hz).

Reference Example L27 According to Reference Example L26, instead of 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo- The following Reference Example L compound 27 was synthesized using 2- (2-fluoro-4-pyridyl) -1- (3-chlorophenyl) ethanone hydrobromide. Reference Example L Compound 27: 2-Ethyl-5- (2-fluoro-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazole Melting point 102-103 ° C. Reference Example L28 4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazole-5-
2-yl-2-pyridylamine 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide (125 g, 0.323 mol) and thiopropionamide (28 g , 0.314 mol) of N, N-dimethylformamide (1200 mL) was stirred at room temperature for 14 hours. The solvent was evaporated under reduced pressure, an aqueous sodium hydrogen carbonate solution was poured into the residue, and the mixture was extracted with ethyl acetate. The extract was washed with saturated aqueous sodium hydrogen carbonate solution, dried and concentrated. The crude crystals were washed with hexane-ethyl acetate = 1: 1 to give the title compound 7
6.0 g (yield 82%) was obtained. Melting point 144-146 ° C. Reference Example L29 According to Reference Example L28, thiobutylamide was used instead of thiopropionamide, and Reference Example L Compound 2 below.
9 was synthesized. Reference Example L Compound 29: 4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 113-115 ° C. Reference Example L30 According to Reference Example L28, instead of 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide, 2- (2-amino- 4-pyridyl) -2-bromo-1- (3-fluorophenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2-bromo-1- (4-chlorophenyl) ethanone bromide Hydrochloride, 2- (2-amino-4-pyridyl) -2-bromo-1- (3-ethylphenyl) ethanone hydrobromide, 2- (2-amino-4-
Pyridyl) -2-bromo-1- (4-fluoro-3-methylphenyl)
Ethanone hydrobromide and 2- (2-amino-4-pyridyl)-
2-Bromo-1- [3- (1-methylethyl) phenyl] ethanone Hydrobromide salt was used in the following Reference Example L compound 30
-1 to 30-5 were synthesized. Reference Example L Compound 30-1: 4- [2-Ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point 153-154 ° C. Reference Example L Compound 30-2: 4- [4- (4-chlorophenyl) -2-
Ethyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 136-137 ° C. Reference Example L compound 30-3: 4- [2-ethyl-4- (3-ethylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 128-129 ° C. Reference Example L Compound 30-4: 4- [2-ethyl-4- (4-fluoro-
3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 134-135 ° C. Reference Example L compound 30-5: 4- [2-ethyl-4- [3- (1-methylethyl) phenyl] -1,3-thiazol-5-yl] -2-pyridylamine melting point 80-81 ° C.

Reference Example L31 [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine [5- (2-fluoro-4-) Pyridyl) -4- (3-methylphenyl) -1,
A mixture of 3-thiazol-2-yl] amine (0.29 g, 1.0 mmol) and benzylamine (1.2 mL, 11 mmol) was stirred at 150 ° C. for 3 hours. The reaction mixture was cooled to room temperature, saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate =
1: 1) to give the title compound 0.16 g (yield 41%). Melting point 178-179 ° C. Reference Example L32 According to Reference Example L31, cyclohexylamine and cyclopentylamine were used instead of benzylamine, respectively, and the following Reference Example L compounds 32-1 and 32-
2 was synthesized. Reference Example L Compound 32-1: [5- (2-cyclohexylamino
-4-Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] amine melting point 168-169 ° C. Reference Example L compound 32-2: [5- (2-cyclopentylamino
-4-Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] amine melting point 169-170 ° C. Reference Example L33 N-Cyclopentyl-4- [2-ethyl-4- (3-methylphenyl)-
1,3-Thiazol-5-yl] -2-pyridylamine 2-ethyl-5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole (0.48 g, 1.6 A mixture of (mmol) and cyclopentylamine (1.6 mL, 16 mmol) was heated under reflux for 14 hours. The reaction mixture was cooled to room temperature, saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with ethyl acetate.
The extract was washed with water, dried and concentrated. The obtained crude crystals were recrystallized from ethyl acetate to give the title compound (0.19 g, yield 33
%). Melting point 117-118 ° C. Reference Example L34 4- [4- (3-chlorophenyl) -2-ethyl-1,3-thiazole-5-
-N-[(1S) -1-Phenylethyl] -2-pyridylamine hydrochloride 4- (3-chlorophenyl) -2-ethyl-5- (2-fluoro-4-pyridyl) -1,3- A mixture of thiazole (0.35 g, 1.1 mmol) and (S) -1-phenylethylamine (1.4 mL, 11 mmol) at 150 ° C.
Stir for 16 hours. After cooling the reaction mixture to room temperature,
A saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and concentrated. The obtained oil was treated with 10% hydrochloric acid-methanol to give the title compound.
27 g (yield 56%) was obtained. Melting point 165-166 ° C. Reference Example L35 N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole
-5-yl] -2-pyridyl] phenylacetamide 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5-
Il] -2-pyridylamine (0.80 g, 2.7 mmol) in tetrahydrofuran (8 mL), phenylacetyl chloride
(0.47 mL, 3.0 mmol) was added, and triethylamine (0.41 mL, 3.0 mmol) was added to the obtained mixture. The reaction mixture was stirred at room temperature for 2 hours. A saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate = 20: 1 to 4
: 1) and crystallized from isopropyl ether to give the title compound (0.75 g, yield 67%). Melting point 107-108 ° C.

Reference Example L36 According to Reference Example L35, the following Reference Example L was prepared by using propionyl chloride instead of phenylacetyl chloride.
Compound 36 was synthesized. Reference Example L Compound 36: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 103-104 ° C. Reference Example L37 According to Reference Example L35, 4- [4- (instead of 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine] 3-Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (4-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl ] -2-Pyridylamine, 4- [2-ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-ethyl-4-
(3-Ethylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine and 4- [2-ethyl-4- [3- (1-methylethyl) phenyl] -1,3-thiazole- 5-yl] -2-pyridylamine was used to prepare the following Reference Example L compounds 37-1 to 37:
-5 was synthesized. Reference Example L compound 37-1: N- [4- [2-propyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 109-111 ° C. Reference Example L Compound 37-2: N- [4- [4- (4-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 150-151 ° C. Reference Example L Compound 37-3: N- [4- [2-ethyl-4- (3-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide Melting point 113-114 ° C. Reference Example L compound 37-4: N- [4- [2-ethyl-4- (3-ethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 155-156 ° C. Reference Example L compound 37-5: N- [4- [2-ethyl-4- [3- (1-methylethyl) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 112-113 ° C. Reference example L38 N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole
-5-yl] -2-pyridyl] -2-thiophenecarboxamide 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5-
2-Thiophenecarbonyl chloride (0.36 mL, 3.4 mmol) was added to a solution of [yl] -2-pyridylamine (0.50 g, 1.7 mmol) in tetrahydrofuran (10 mL), and triethylamine (0.52 mL, 3.7 mmol) was added to the resulting mixture. ) Was added. The reaction mixture was stirred at room temperature for 10 minutes. A saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was concentrated hydrochloric acid (5 mL)
And was stirred at 40 ° C. for 14 hours. The reaction mixture was neutralized with aqueous sodium hydroxide solution and extracted with ethyl acetate.
The extract was dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 4: 1) and crystallized from isopropyl ether-hexane to give the title compound (0.56 g, yield 82%). Melting point 102-103 ° C. Reference Example L39 According to Reference Example L38, instead of 2-thiophenecarbonyl chloride, 3-thiophenecarbonyl chloride, 4-methoxybenzoyl chloride, 4-methylbenzoyl chloride, 3-fluorobenzoyl chloride, 4-fluorobenzoyl chloride and 3, The following Reference Example L compounds 39-1 to 39 were prepared using 5-dichlorobenzoyl chloride, respectively.
-6 was synthesized. Reference Example L Compound 39-1: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-thiophenecarboxamide Melting point 99- 101 ° C. Reference Example L Compound 39-2: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -4-methoxybenzamide Melting point 124- 125 ° C. Reference Example L Compound 39-3: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -4-methylbenzamide Melting point 105- 106 ° C. Reference Example L compound 39-4: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-fluorobenzamide melting point 101- 102 ° C. Reference Example L Compound 39-5: N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -4-fluorobenzamide Melting point 110- 111 ° C. Reference Example L Compound 39-6: 3,5-dichloro-N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] benzamide melting point 77-78 ° C.

Reference Example L40 According to Reference Example L38, benzoyl chloride was used in place of 2-thiophenecarbonyl chloride, and 4- [2-ethyl-4- (3
-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine instead of 4- [4- (4-chlorophenyl) -2-ethyl
-1,3-thiazol-5-yl] -2-pyridylamine and 4- [2
-Ethyl-4- (4-fluoro-3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine was used to prepare the following Reference Example L compounds 40-1 and 40-2. Synthesized. Reference Example L Compound 40-1: N- [4- [4- (4-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide melting point 138-139 ° C. Reference Example L compound 40-2: N- [4- [2-ethyl-4- (4-fluoro-3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide melting point 108- 109 ° C. Reference Example L41 N- [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] nicotinamide [5- (2-benzylamino-4] -Pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine (0.52 g, 1.4 mmol)
And 4-dimethylaminopyridine (0.051 g, 0.42 mmol) N, N
-Nicotinoyl chloride hydrochloride (0.37 g, 2.1 mmol) was added to the dimethylacetamide (10 mL) solution, and the mixture was stirred at 80 ° C. for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The produced crystals were crystallized from isopropyl ether to give the title compound (0.28 g, yield 59%). Melting point 220-222 ° C. Reference Example L42 6-Chloro-N- [5- (2-cyclopentylamino-4-pyridyl)-
4- (3-Methylphenyl) -1,3-thiazol-2-yl] nicotinamide [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole- 2-yl] amine (0.50 g, 1.4
mmol) and 4-dimethylaminopyridine (0.052 g, 0.43 mmo
To a solution of l) in N, N-dimethylacetamide (10 mL) was added 6-chloronicotinoyl chloride hydrochloride (0.46 g, 2.1 mmol), and the mixture was stirred at 80 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was chromatographed on silica gel (hexane-ethyl acetate).
= 4: 1) and the resulting crystals were recrystallized from ethanol to give the title compound 0.30 g (yield 42%). Melting point 211-212 ° C. Reference Example L43 According to Reference Example L42, [5- (2-cyclopentylamino-4-
Pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine instead of [5- (2-cyclohexylamino-4-
The following Reference Example L compound 43 was synthesized using pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine. Reference Example L compound 43: 6-chloro-N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] nicotinamide melting point 255- 256 ° C. Reference Example L44 N- [4- [4- (3-methylphenyl) -2- (1-methylpiperidine-4
-Yl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide N- [4- [1-bromo-2- (3-methylphenyl) -2-oxoethyl] -2-pyridyl] benzamide odor Hydrochloride (0.60 g, 1.
2 mmol) and 1-methylpiperidine-4-carbothioamide (0.1
A solution of 9 g, 1.18 mmol) in N, N-dimethylformamide (20 mL) was stirred at room temperature for 14 hours. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated aqueous sodium hydrogen carbonate solution, dried and concentrated. Column chromatography of the residue (packing material Chro
matorex NH DM1020 (trade name, manufactured by Fuji Silysia Chemical Ltd.), hexane-ethyl acetate = 2: 1), and the resulting crystals were recrystallized from ethyl acetate to give 0.26 g of the title compound (yield 46
%). Melting point 151-152 ° C.

Reference Example L45 According to Reference Example L44, N- [4- [1-bromo-2- (3-methylphenyl) -2-oxoethyl] -2-pyridyl] benzamide instead of N-hydrobromide was used. The following Reference Example L compound 45 was synthesized using-[4- [1-Bromo-2- (3-chlorophenyl) -2-oxoethyl] -2-pyridyl] benzamide hydrobromide. Reference Example L Compound 45: N- [4- [4- (3-chlorophenyl) -2-
(1-Methylpiperidin-4-yl) -1,3-thiazol-5-yl]
-2-Pyridyl] benzamide melting point 125-127 ° C. The compounds produced in Reference Examples L32 to 45 are shown in Tables 78 and 79.

[0332]

[Table 78]

[0333]

[Table 79]

Reference Example L46 According to Reference Example L7, instead of 4-chlorobenzoyl chloride, benzoyl chloride, 3-methoxybenzoyl chloride, 4-methylbenzoyl chloride, 3-bromobenzoyl chloride, 2-thiophenecarbonyl chloride and 4-
The following Reference Example L compounds 46-1 to 46-6 were synthesized using fluorobenzoyl chloride, respectively. Reference Example L Compound 46-1: N-benzoylpropyleneimine oily substance. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 6.0 Hz), 2.15 (1
H, d, J = 3.2 Hz), 2.52-2.67 (2H, m), 7.40-7.61 (3H,
m), 7.98-8.07 (2H, m). Reference Example L compound 46-2: N- (3-methoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.9 Hz), 2.14 (1
H, d, J = 2.9 Hz), 2.52-2.65 (2H, m), 3.86 (3H, s),
7.10 (1H, ddd, J = 1.1, 2.6, 8.4 Hz), 7.37 (1H, dd,
J = 8.4, 7.3 Hz), 7.55 (1H, dd, J = 1.5, 2.6 Hz), 7.63
(1H, ddd, J = 1.1, 1.5, 7.3 Hz). Reference Example L compound 46-3: N- (4-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.12 (1
H, d, J = 2.9 Hz), 2.42 (3H, s), 2.50-2.62 (2H, m),
7.25 (2H, d, J = 8.1 Hz), 7.92 (2H, d, J = 8.1 Hz). Reference Example L compound 46-4: N- (3-bromobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.2Hz), 2.16-2.18
(1H, m), 2.53-2.65 (2H, m), 7.34 (1H, t, J = 7.9H
z), 7.65-7.71 (1H, m), 7.95 (1H, d, J = 7.9Hz), 8.1
6 (1H, t, J = 1.8Hz). Reference Example L compound 46-5: N- (2-thiophenecarbonyl)
Propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (3H, d, J = 5.2Hz), 2.14 (1H,
d, J = 3.6Hz), 2.56-2.72 (2H, m), 7.08-7.16 (1H,
m), 7.53-7.60 (1H, m), 7.75-7.81 (1H, m). Reference Example L compound 46-6: N- (4-fluorobenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.2Hz), 2.14-2.15
(1H, m), 2.52-2.63 (2H, m), 7.08-7.19 (2H, m), 8.
00-8.10 (2H, m). Reference Example L47 According to Reference Example L11, using N- (4-fluorobenzoyl) propyleneimine instead of N- (3-methylbenzoyl) propyleneimine, the following Reference Example L Compound 47 was synthesized. Reference Example L compound 47: 1- (4-fluorophenyl) -2- (2-fluoro-4-pyridyl) ethanone melting point 100-101 ° C.

Reference Example L48 According to Reference Example L13, instead of N- (3-methylbenzoyl) propyleneimine, N-benzoylpropyleneimine and N-
(4-Fluorobenzoyl) propyleneimine, N- (3-bromobenzoyl) propyleneimine, N- (2-thiophenecarbonyl) propyleneimine, N- (3-methoxybenzoyl)
The following Reference Example L compound 4 was prepared using propyleneimine and N- (4-methylbenzoyl) propyleneimine, respectively.
8-1 to 48-6 were synthesized. Reference Example L compound 48-1: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1-phenylethanone melting point 162-163 ° C. Reference Example L Compound 48-2: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-fluorophenyl) ethanone Melting point 139-141 ° C. Reference Example L Compound 48-3: 1- (3-bromophenyl) -2- (2-
tert-Butoxycarbonylamino-4-pyridyl) ethanone melting point 132-133 ° C. Reference Example L compound 48-4: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (2-thienyl) ethanone melting point 161-162 ° C. Reference Example L Compound 48-5: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methoxyphenyl) ethanone Melting point 99-100 ° C. Reference Example L Compound 48-6: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-methylphenyl) ethanone Melting point 137-138 ° C. Reference Example L49 According to Reference Example L19, 1- (4-fluorophenyl) -2- (2 instead of 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone was used. -Fluoro-4-pyridyl) ethanone, 1- (3-bromophenyl) -2- (2-tert-butoxycarbonylamino-4-pyridyl) ethanone, 2- (2-ter
t-butoxycarbonylamino-4-pyridyl) -1- (4-fluorophenyl) ethanone, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (4-methylphenyl) ethanone, 2
-(2-tert-butoxycarbonylamino-4-pyridyl) -1-phenylethanone, 2- (2-tert-butoxycarbonylamino
-4-pyridyl) -1- (2-thienyl) ethanone and 2- (2-tert
The following Reference Example L compounds 49-1 to 49-7 were synthesized using -butoxycarbonylamino-4-pyridyl) -1- (3-methoxyphenyl) ethanone, respectively. Reference Example L Compound 49-1: 2-Bromo-1- (4-fluorophenyl) -2- (2-fluoro-4-pyridyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 7.16 (1H, s), 7.37-7.54 (4H,
m), 8.11-8.24 (2H, m), 8.30 (1H, d, J = 5.0Hz). Reference Example L compound 49-2: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (3-bromophenyl) ethanone hydrobromide It was used in the next reaction as it was without purification. Reference Example L Compound 49-3: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (4-fluorophenyl) ethanone hydrobromide melting point 171-172 ° C. Reference Example L Compound 49-4: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (4-methylphenyl) ethanone hydrobromide melting point 200-201 ° C. Reference Example L Compound 49-5: 2- (2-amino-4-pyridyl) -2-
Bromo-1-phenylethanone hydrobromide Melting point 155-156 ° C. Reference Example L compound 49-6: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (2-thienyl) ethanone hydrobromide amorphous powder ¹ H-NMR (DMSO-d ₆ ) δ: 6.96-7.09 (2H, m), 7.24 (1H,
s), 7.32-7.43 (1H, m), 7.98 (1H, d, J = 6.6 Hz), 8.1
2-8.36 (2H, m). Reference Example L compound 49-7: 2- (2-amino-4-pyridyl) -2-
Bromo-1- (3-methoxyphenyl) ethanone hydrobromide melting point 205-206 ° C.

Reference Example L50 According to Reference Example L23, 4-butyronitrile was used instead of 4-
The following Reference Example L compounds 50-1 to 50-3 were synthesized using (methylthio) benzonitrile, valeronitrile, and ethyl cyanoacetate, respectively. Reference Example L compound 50-1: 4- (methylthio) thiobenzamide melting point 176-178 ° C. Reference Example L compound 50-2: thiovaleramide oily substance ¹ H-NMR (CDCl ₃ ) δ: 0.94 (3H, t, J = 7.3Hz), 1.31-1.49
(2H, m), 1.68-1.83 (2H, m), 2.67 (2H, t, J = 7.7H
z), 6.92 (1H, br s), 7.73 (1H, br s). Reference Example L Compound 50-3: Ethyl 3-amino-3-thioxopropanate oil. ¹ H-NMR (CDCl ₃ ) δ: 1.31 (3H, t, J = 7.1Hz), 3.85 (2H,
s), 4.22 (2H, q, J = 7.1Hz), 7.74 (1H, br s), 8.92
(1H, br s). Reference Example L51 Ethyl 2-amino-2-thioxoacetate oxamate (3.21 g, 27.4 mmol) in anhydrous tetrahydrofuran (100 mL) was added to Lawesson's reagent (Lawesson's reagent).
reagent) (6.10 g, 15.1 mmol) was added and the mixture was heated under reflux for 2 hours. After cooling to room temperature, saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried and the solvent was distilled off. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate = 4: 1 to 2:
The product was purified in 1) and crystallized from isopropyl ether to give the title compound (2.92 g, yield 80%). Melting point 60-62 ° C. Reference Example L52 According to Reference Example L25, instead of 2-bromo-2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone hydrobromide, 2-bromo-1- ( 4-Fluorophenyl) -2- (2-fluoro-4-pyridyl) ethanone hydrobromide was used to synthesize the following Reference Example L compound 52. Reference Example L compound 52: [4- (4-fluorophenyl) -5- (2-
Fluoro-4-pyridyl) -1,3-thiazol-2-yl] amine melting point 243-245 ° C. Reference Example L53 According to Reference Example L25, the following Reference Example L compound 53 was synthesized using N-methylthiourea instead of thiourea. Reference Example L Compound 53: N-methyl- [5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine Melting point 186-187 ° C.

Reference Example L54 According to Reference Example L28, thiovaleramide, ethyl 2-amino-2-thioxoacetate and ethyl 3-amino-3-thioxopropanate were used instead of thiopropionamide, respectively. The following Reference Example L compound 54-
1 to 54-3 were synthesized. Reference Example L Compound 54-1: 4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine oil ¹ H-NMR (CDCl ₃ ) δ : 0.98 (3H, t, J = 7.3Hz), 1.39-1.59
(2H, m), 1.76-1.92 (2H, m), 2.34 (3H, s), 3.04 (2
H, t, J = 7.4Hz), 4.14 (2H, br s), 6.44 (1H, s), 6.5
6 (1H, dd, J = 1.5, 5.4Hz), 7.09-7.26 (3H, m), 7.41
(1H, s), 7.96 (1H, d, J = 5.4Hz). Reference Example L Compound 54-2: Ethyl [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1 , 3-Thiazol-2-yl] carboxylate Melting point 147-148 ° C. Reference Example L Compound 54-3: Ethyl [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] acetate Melting point 128-129 ° C. Reference Example L55 According to Reference Example L28, instead of 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide, 2- (2-amino- 4-Pyridyl) -2-bromo-1- (3-chlorophenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2-bromo-1- (3-bromophenyl) ethanone bromide Hydrochloride, 2- (2-amino-4-pyridyl) -2-bromo-1- (4-fluorophenyl) ethanone hydrobromide, 2- (2-amino-4-
Pyridyl) -2-bromo-1- (4-methylphenyl) ethanone hydrobromide, 2- (2-amino-4-pyridyl) -2-bromo-1-phenylethanone hydrobromide, 2 -(2-Amino-4-pyridyl) -2-bromo-1- (2-thienyl) ethanone hydrobromide and 2- (2-amino-4-pyridyl) -2-bromo-1- (3- The following Reference Example L compounds 55-1 to 55-7 were synthesized using methoxyphenyl) ethanone hydrobromide. Reference Example L Compound 55-1: 4- [4- (3-chlorophenyl) -2
-Ethyl-1,3-thiazol-5-yl] -2-pyridylamine melting point 132-133 ° C. Reference Example L compound 55-2: 4- [4- (3-bromophenyl) -2-
Ethyl-1,3-thiazol-5-yl] -2-pyridylamine melting point 132-134 ° C. Reference Example L compound 55-3: 4- [2-ethyl-4- (4-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 140-141 ° C. Reference Example L compound 55-4: 4- [2-ethyl-4- (4-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 126-127 ° C. Reference Example L compound 55-5: 4- (2-ethyl-4-phenyl-1,3
-Thiazol-5-yl) -2-pyridylamine melting point 158-159 ° C. Reference Example L Compound 55-6: 4- [2-ethyl-4- (2-thienyl)
-1,3-thiazol-5-yl] -2-pyridylamine melting point 159-160 ° C. Reference Example L compound 55-7: 4- [2-ethyl-4- (3-methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridylamine melting point 130-131 ° C. Reference Example L56 According to Reference Example L29, instead of 2- (2-amino-4-pyridyl) -2-bromo-1- (3-methylphenyl) ethanone hydrobromide, 2- (2-amino- The following Reference Example L compound 56 was synthesized using 4-pyridyl) -2-bromo-1- (3-chlorophenyl) ethanone hydrobromide. Reference Example L Compound 56: 4- [4- (3-chlorophenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 99-100 ° C.

Reference Example L57 According to Reference Example L56, instead of thiobutyramide, 4-
(Methylthio) thiobenzamide and ethyl 3-amino
The following Reference Example L compounds 57-1 and 57-2 were synthesized using -3-thioxopropanate, respectively. Reference Example L Compound 57-1: 4- [4- (3-chlorophenyl) -2- [4-
(Methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridylamine Melting point 183-184 ° C. Reference Example L compound 57-2: ethyl [5- (2-amino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] acetate melting point 154-155 ° C. Reference Example L58 [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] ethyl acetate [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] acetate (7.00 g, 19.8
To a suspension of (mmol) in ethanol (40 mL) was added 1N-sodium hydroxide aqueous solution (40 mL), and the mixture was stirred as it was at room temperature for 2 hours. The reaction mixture was neutralized with 2N hydrochloric acid (20 mL), and the generated solid was collected by filtration. The crude product is washed with water, dried,
6.10 g (yield 95%) of the title compound was obtained. Melting point 132-133 ° C. Reference Example L59 According to Reference Example L58, instead of ethyl [5- (2-amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] acetate, ethyl [5 -(2-Amino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] carboxylate and ethyl [5- (2-amino-4-pyridyl) -4- ( 3-Chlorophenyl) -1,3-thiazol-2-yl] acetate was used in the following Reference Example L compound 59-
1 and 59-2 were synthesized. Reference Example L Compound 59-1: 5- (2-amino-4-pyridyl) -4
-(3-Methylphenyl) -1,3-thiazole-2-carboxylic acid melting point 135-136 ° C. Reference Example L compound 59-2: [5- (2-amino-4-pyridyl) -4
-(3-Chlorophenyl) -1,3-thiazol-2-yl] acetic acid Used for the next reaction without isolation. Reference Example L60 4- [2-Methyl-4- (3-methylphenyl) -1,3-thiazole-5-
Iyl] -2-pyridylamine [5- (2-amino-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazol-2-yl] acetic acid (5.0
g, 15 mmol) was stirred at 150 ° C. for 15 minutes. After cooling to room temperature, the crude product is subjected to silica gel column chromatography.
It was purified with (ethyl acetate) and recrystallized from ethyl acetate to obtain 4.0 g of the title compound (yield 93%). Melting point 152-153 ° C.

Reference Example L61 According to Reference Example L60, [5- (2-amino-4-pyridyl) -4- (3-
Methylphenyl) -1,3-thiazol-2-yl] acetic acid instead of 5- (2-amino-4-pyridyl) -4- (3-methylphenyl)-
Using 1,3-thiazole-2-carboxylic acid and [5- (2-amino-4-pyridyl) -4- (3-chlorophenyl) -1,3-thiazol-2-yl] acetic acid, the following reference Example L Compounds 61-1 and 61-2 were synthesized. Reference Example L compound 61-1: 4- [4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridylamine melting point 91-92 ° C. Reference Example L Compound 61-2: 4- [4- (3-chlorophenyl) -2-
Methyl-1,3-thiazol-5-yl] -2-pyridylamine Melting point 142-143 ° C. Reference Example L62 According to Reference Example L33, instead of 2-ethyl-5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole, N-methyl- [5- With (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine,
The following Reference Example L compound 62 was synthesized. Reference Example L Compound 62: N-methyl- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine Melting point 170-172 ° C. Reference Example L63 According to Reference Example L62, the following Reference Example L compound 63 was synthesized by using cyclohexylamine instead of cyclopentylamine. Reference Example L Compound 63: N-methyl- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine Melting point 211-212 ° C. Reference Example L64 According to Reference Example L63, N-methyl- [5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl]
Instead of amine, [4- (4-fluorophenyl) -5- (2-fluoro-4-pyridyl) -1,3-thiazol-2-yl] amine, 2
-Ethyl-5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole and 4- (3-chlorophenyl) -2-
Using ethyl-5- (2-fluoro-4-pyridyl) -1,3-thiazole respectively, the following Reference Example L compounds 64-1 to 64
-3 was synthesized. Reference Example L Compound 64-1: [5- (2-cyclohexylamino
-4-Pyridyl) -4- (4-fluorophenyl) -1,3-thiazole
-2-yl] amine melting point 194-195 ° C. Reference Example L Compound 64-2: N-cyclohexyl-4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridylamine melting point 110-112 ° C. Reference Example L compound 64-3: N-cyclohexyl-4- [4- (3-
Chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-
Pyridylamine melting point 106-107 ° C.

Reference Example L65 According to Reference Example L41, instead of [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine, N-cyclopentyl-4- [2-ethyl-4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, N-cyclohexyl-4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, N
-Methyl- [5- (2-cyclopentylamino-4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazol-2-yl] amine and N-methyl- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3- The following Reference Example L compound 65-1 was prepared using thiazol-2-yl] amine.
~ 65-4 were synthesized. Reference Example L Compound 65-1: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] nicotinamide melting point 201-203 ° C. Reference Example L Compound 65-2: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] nicotinamide melting point 215-216 ° C. Reference Example L Compound 65-3: N-methyl-N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] nicotinamide melting point 135-136 ° C. Reference Example L Compound 65-4: N-methyl-N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] nicotinamide melting point 148-149 ° C. Reference Example L66 According to Reference Example L42, 6-methylnicotinoyl chloride hydrochloride and 6-methoxynicotinoyl chloride hydrochloride were used instead of 6-chloronicotinoyl chloride hydrochloride, respectively. -1 and 66-
2 was synthesized. Reference Example L Compound 66-1: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methylnicotinamide melting point 213-214 ° C. Reference Example L Compound 66-2: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methoxynicotinamide melting point 219-221 ° C.

Reference Example L67 According to Reference Example L66, [5- (2-cyclopentylamino-4-
Pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine instead of [5- (2-cyclohexylamino-4-
Pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine and N-methyl- [5- (2-cyclopentylamino
-4-Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
Each of the following Reference Example L compounds 67-1 to 67-3 were synthesized using -yl] amine. Reference Example L Compound 67-1: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methylnicotinamide melting point 242-243 ° C. Reference Example L Compound 67-2: N- [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -N, 6-dimethylnicotinamide melting point 176-177 ° C. Reference Example L Compound 67-3: N- [5- (2-cyclohexylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -6-methoxynicotinamide melting point 191-192 ° C. Reference Example L68 According to Reference Example L35, instead of 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- ( 3-Bromophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl ] -2-Pyridylamine, 4- [4- (3-chlorophenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-butyl-4- (3- Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-methyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl Amine, 4- [4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4-
[2-ethyl-4- (4-fluorophenyl) -1,3-thiazole-5-
Iyl] -2-pyridylamine, 4- [2-ethyl-4- (4-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4
-(2-Ethyl-4-phenyl-1,3-thiazol-5-yl) -2-pyridylamine and 4- [2-ethyl-4- (3-methoxyphenyl) -1,3-thiazole-5- And the following Reference Example L compounds 68-1 to 68-1.
0 was synthesized. Reference Example L compound 68-1: N- [4- [4- (3-bromophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 97-99 ° C. Reference Example L Compound 68-2: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 111-112 ° C. Reference Example L Compound 68-3: N- [4- [4- (3-chlorophenyl)
-2-Methyl-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 99-101 ° C. Reference Example L compound 68-4: N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 92-93 ° C. Reference Example L compound 68-5: N- [4- [2-methyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 114-115 ° C. Reference Example L Compound 68-6: N- [4- [4- (3-methylphenyl)
-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 135-136 ° C. Reference Example L Compound 68-7: N- [4- [2-ethyl-4- (4-fluorophenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide Melting point 178-179 ° C. Reference Example L compound 68-8: N- [4- [2-ethyl-4- (4-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 128-129 ° C. Reference Example L compound 68-9: N- [4- (2-ethyl-4-phenyl-
1,3-thiazol-5-yl) -2-pyridyl] phenylacetamide melting point 162-163 ° C. Reference Example L compound 68-10: N- [4- [2-ethyl-4- (3-methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide melting point 128-129 ° C.

Reference Example L69 According to Reference Example L36, 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine was replaced by 4- [ 4- (3-chlorophenyl) -2-ethyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2-methyl-1,3-thiazole-5 -Yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazole-
The following Reference Example L was prepared using 5-yl] -2-pyridylamine and 4- [2-ethyl-4- (2-thienyl) -1,3-thiazol-5-yl] -2-pyridylamine, respectively. Compound 69-1 to 69
-5 was synthesized. Reference Example L Compound 69-1: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 132-133 ° C. Reference Example L Compound 69-2: N- [4- [4- (3-chlorophenyl)
-2-Methyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 134-135 ° C. Reference Example L Compound 69-3: N- [4- [4- (3-chlorophenyl)
-2-Propyl-1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 103-104 ° C. Reference Example L compound 69-4: N- [4- [4- (3-chlorophenyl)
-2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl]
-2-Pyridyl] propionamide melting point 187-188 ° C. Reference Example L compound 69-5: N- [4- [2-ethyl-4- (2-thienyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 187-188 ° C. Reference Example L70 According to Reference Example L69, the following Reference Example L compounds 70-1 to 70-5 were synthesized using acetyl chloride, benzoyl chloride and pivaloyl chloride instead of propionyl chloride, respectively. Reference Example L Compound 70-1: N- [4- [4- (3-chlorophenyl)
-2-Ethyl-1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 149-150 ° C. Reference Example L Compound 70-2: N- [4- [4- (3-chlorophenyl)
-2-Propyl-1,3-thiazol-5-yl] -2-pyridyl] acetamide melting point 144-145 ° C. Reference Example L Compound 70-3: N- [4- [4- (3-chlorophenyl)
-2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl]
-2-Pyridyl] acetamide melting point 207-208 ° C. Reference Example L Compound 70-4: N- [4- [2-ethyl-4- (2-thienyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Melting point 116-117 ° C. Reference Example L Compound 70-5: N- [4- [4- (3-chlorophenyl)
-2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl]
-2-Pyridyl] pivaloamide Melting point 119-120 ° C.

Reference Example L71 N- [4- [4- (3-chlorophenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] acetamide N- [4 -[4- (3-Chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] acetamide
(0.30 g, 0.66 mmol) of N, N-dimethylformamide (10 m
70% m-chloroperbenzoic acid (0.34 g, 1.4 mmol) was added to the (L) solution, and the mixture was stirred at room temperature for 2 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water, dried and the solvent was distilled off. The residue was purified by silica gel column chromatography (ethyl acetate) and washed with ethyl acetate-isopropyl ether to give the title compound.
0.18 g (yield 55%) was obtained. Melting point 216-217 ° C. Reference Example L72 According to Reference Example L71, N- [4- [4- (3-chlorophenyl) -2-
[4- (Methylthio) phenyl] -1,3-thiazol-5-yl] -2-
Instead of pyridyl] acetamide, N- [4- [4- (3-chlorophenyl) -2- [4- (methylthio) phenyl] -1,3-thiazol-5-yl] -2-pyridyl] propionamide Then, the following Reference Example L compound 72 was synthesized. Reference Example L Compound 72: N- [4- [4- (3-chlorophenyl) -2-
(4-Methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] propionamide melting point 224-225 ° C. Reference Example L73 4- (3-Chlorophenyl) -2-ethyl-5- [2- (phenylmethylthio) -4-pyridyl] -1,3-thiazole Sodium hydride (0.24 g, 6.0 mmol) was added twice to hexane. After washing, it was suspended in N, N-dimethylformamide (10 mL). Phenylmethylthiol (0.58 mL,
4.9 mmol) was added at 0 ° C., and the mixture was stirred at the same temperature for 1 hr. 4- (3-chlorophenyl) -2-ethyl-5- (2-fluoro-4-pyridyl) -1,3-thiazole (0.78 g, 2.5 mmol) was added to the resulting solution.
N, N-dimethylformamide (6 mL) solution was added at the same temperature,
Further, the mixture was stirred at room temperature for 1 hour. 8N-Sodium hydroxide aqueous solution (5 mL) was added to the reaction mixture, and the mixture was extracted with isopropyl ether. The extract was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried and the solvent was evaporated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 9: 1) to give the title compound (0.56 g, yield 54
%). Oil ¹ H-NMR (CDCl ₃ ) δ: 1.44 (3H, t, J = 7.6Hz), 3.07 (2H,
q, J = 7.6 Hz), 4.39 (2H, s), 6.84-6.87 (1H, m),
7.10-7.11 (1H, m), 7.18-7.41 (8H, m), 7.58-7.60 (1
H, m), 8.34-8.37 (1H, m). Reference Example L74 N- [5- (2-Cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2- Ill] -N'-phenylurea [5- (2-cyclopentylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine (0.43 g, 1.2
phenyl isocyanate (0.19 mL, 1.8 mmol) was added to a solution of N) N-dimethylacetamide (10 mL) in 80 mmol.
Then stir for 1 hour. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1). The obtained crude crystals were recrystallized from ethyl acetate to give the title compound 0.23 g (yield 39%). Melting point 198-199 ° C. The compounds produced in Reference Examples L62 to 74 are shown in Tables 80 to 82.
Shown in.

[0344]

[Table 80]

[0345]

[Table 81]

[0346]

[Table 82]

Reference Example L75 Ethyl 2-acetyl-3- (dimethylamino) acrylate Ethyl acetoacetate (79 mL, 0.62 mol) was added to N, N-dimethylformamide dimethyl acetal (100 mL, 0.68 mol), and the mixture was mixed with 1 Heated to reflux for hours. Excess acetal was distilled off under reduced pressure, and the residue was distilled under reduced pressure to give the title compound 85
g (yield 74%) was obtained. Boiling point 125-130 ℃ (400Pa) ¹ H-NMR (CDCl ₃ ) δ: 1.33 (3H, t, J = 7.1 Hz), 2.33 (3
H, s), 3.04 (6H, br s), 4.23 (2H, q, J = 7.1 Hz), 7.
68 (1H, s). Reference Example L76 Ethyl 2,4-dimethyl-5-pyrimidinecarboxylate Acetamidine hydrochloride was added to a 10% sodium ethoxide solution in ethanol (410 mL, 0.53 mol) at room temperature. Then, ethyl 2-acetyl-3- (dimethylamino) acrylate (98 g, 0.53 mol) was added to the mixture, and the mixture was heated under reflux for 24 hours. Ethanol was distilled off under reduced pressure, water was added to the residue, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off. The residue was distilled under reduced pressure to give 73 g of the title compound (yield: 76
%). Boiling point 93-98 ° C (130Pa) ¹ H-NMR (CDCl ₃ ) δ: 1.42 (3H, t, J = 7.1 Hz), 2.75 (3
H, s), 2.80 (3H, s), 4.41 (2H, q, J = 7.1 Hz), 9.05
(1H, s). Reference Example L77 2,4-Dimethyl-5-pyrimidinecarboxylic acid potassium hydroxide (67 g, 1.0 mol) in 95% ethanol (30
0 mL) was added to a 95% ethanol solution (100 mL) of ethyl 2,4-dimethyl-5-pyrimidinecarboxylate (73 g, 0.40 mol), and the mixture was heated under reflux for 5 hours. Ethanol was distilled off under reduced pressure, the residue was dissolved in water and acidified with concentrated hydrochloric acid. The precipitated solid was collected by filtration, washed with water and dried to give 36 g of the title compound (yield 58
%). ¹ H-NMR (CDCl ₃ ) δ: 2.63 (3H, s), 2.69 (3H, s), 8.97
(1H, s).

Reference Example L78 2,4-Dimethylpyrimidine 2,4-Dimethyl-5-pyrimidinecarboxylic acid was heated at 160 ° C. for 4 hours. The reaction mixture was directly distilled under normal pressure to give the title compound (17 g, yield 49%). Boiling point 152-153 ℃. ¹ H-NMR (CDCl ₃ ) δ: 2.50 (3H, s), 2.70 (3H, s), 6.98
(1H, d, J = 5.1Hz), 8.49 (1H, d, J = 5.1Hz). Reference Example L79 tert-Butyl 4-methyl-2-pyrimidinylcarbamate di (tert-butyl) dicarbamate (12mL, 50 mmol ) 4-
Methyl-2-pyrimidinylamine (5.0 g, 46 mmol) in tert-
Add it dropwise to the butanol solution over 1 hour and let the solution stand at room temperature for 14
Stir for hours. The solvent was distilled off under reduced pressure, and the obtained residue was purified by silica gel column chromatography (hexane-ethyl acetate = 1: 1). Crystallization from isopropyl ether-hexane gave the title compound (6.7 g, yield 70%). Melting point 87-88 ° C. Reference Example L80 1- (3-Methylphenyl) -2- (4-pyrimidinyl) ethenol Diisopropylamine (16 mL, 0.12 mol) in anhydrous tetrahydrofuran (100 mL) was cooled to -50 ° C and stirred to 1.6M. n-Butyllithium hexane solution (73 mL, 0.11
7 mol) was added dropwise. Stir for 10 minutes after dropping, and then
A solution of 4-methylpyrimidine (10 g, 0.11 mol) in anhydrous tetrahydrofuran (10 mL) was added dropwise at -30 ° C. After stirring for 0.5 hour, the reaction mixture was cooled to −78 ° C., and a solution of N- (3-methylbenzoyl) propyleneimine (19 g, 0.11 mol) in anhydrous tetrahydrofuran (10 mL) was added dropwise. After the completion of dropping, the mixture was stirred at -78 ° C for 2 hours. The reaction mixture was warmed to room temperature, water (100 mL) was added, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried, and then the solvent was distilled off. The obtained residue was purified by silica gel column chromatography (hexane-ethyl acetate).
= 7: 3). Crystallization from isopropyl ether gave the title compound (11 g, yield 49%). Melting point 66-67 ° C. Reference Example L81 According to Reference Example L80, instead of 4-methylpyrimidine, 2,
4-dimethylpyrimidine and tert-butyl 4-methyl-2-
The following Reference Example L compounds 81-1 and 81-2 were synthesized using pyrimidinyl carbamates, respectively. Reference Example L Compound 81-1: 1- (3-methylphenyl) -2- (2-
Methyl-4-pyrimidinyl) ethenol melting point 88-89 ° C. Reference Example L Compound 81-2: tert-Butyl 4- [2-hydroxy-2- (3-methylphenyl) ethenyl] -2-pyrimidinylcarbamate Melting point 194-195 ° C.

Reference Example M1 (1) Reference Example L35 Compound 50 mg (2) Lactose 34 mg (3) Corn starch 10.6 mg (4) Corn starch (paste-like) 5 mg (5) Magnesium stearate 0.4 mg (6) Carboxy Methylcellulose calcium 20 mg Total 120 mg According to a conventional method, the above (1) to (6) were mixed and compressed with a tableting machine to obtain tablets. Reference Example M2 (1) Reference Example L35 Compound 10.0 mg (2) Lactose 60.0 mg (3) Corn Starch 35.0 mg (4) Gelatin 3.0 mg (5) Magnesium Stearate 2.0 mg Reference Example L35 Compound 10.0 mg Using a mixture of 60.0 mg of lactose and 35.0 mg of corn starch and 0.03 ml of 10% gelatin aqueous solution (3.0 mg as gelatin), 1 mm
After granulating through a mesh sieve, it is dried at 40 ° C. and sieved again. The granules thus obtained are mixed with 2.0 mg of magnesium stearate and compressed. The resulting core tablets are sugar-coated with a suspension of sucrose, titanium dioxide, talc and gum arabic. The coated tablets are polished with beeswax to obtain coated tablets. Reference Example M3 (1) Reference Example L35 Compound 10.0 mg (2) Lactose 70.0 mg (3) Corn Starch 50.0 mg (4) Soluble Starch 7.0 mg (5) Magnesium Stearate 3.0 mg Reference Example L35 Compound 10. 0 mg and 3.0 mg magnesium stearate are granulated with 0.07 ml of an aqueous solution of soluble starch (7.0 mg as soluble starch), dried and mixed with 70.0 mg lactose and 50.0 mg corn starch. The mixture is compressed to give tablets. Reference Example M4 (1) Reference Example L35 Compound 5.0 mg (2) Salt 20.0 mg (3) Distilled water Total amount 2.0 ml of Reference Example L35 compound 5.0 mg and salt 20.0 mg were dissolved in distilled water, Add water to bring the total volume to 2.0 ml. The solution is filtered and filled under aseptic conditions into 2 ml ampoules. After sterilizing the ampoule, it is sealed to obtain a solution for injection.

Reference Formulation Example M1 Concomitant drug (1) Rofecoxib 5.0 mg (2) Salt 20.0 mg (3) Distilled water Rofecoxib 5.0 mg and salt 20.0 mg were dissolved in distilled water to a total amount of 2.0 ml. And add water to bring the total volume to 2.0 ml. The solution is filtered and filled under aseptic conditions into 2 ml ampoules. After sterilizing the ampoule, it is sealed to obtain a solution for injection. (Reference formulation example M2) Concomitant drug (1) Rofecoxib 50 mg (2) Lactose 34 mg (3) Corn starch 10.6 mg (4) Corn starch (paste-like) 5 mg (5) Magnesium stearate 0.4 mg (6) Carboxymethyl cellulose Calcium 20 mg Total 120 mg According to the conventional method, the above (1) to (6) were mixed and compressed with a tableting machine to give tablets. Reference Example M5 Any formulation prepared in Reference Examples M1 to 4 is combined with the formulation of Reference Formulation Example M1 or M2.

Reference Example M6 [4- (3-Methylphenyl) -5- (4-pyrimidinyl) -1,3-thiazol-2-yl] amine 1- (3-methylphenyl) -2- (4-pyrimidinyl) ) Ethenol
(3.0 g, 14 mmol) and sodium acetate (2.32 g, 28.26 mmo
The acetic acid solution (70 mL) of bromine (0.72 mL, 14 mmol) was added dropwise to the acetic acid solution (70 mL) of (1) at room temperature over 30 minutes. The reaction mixture was stirred as it was at room temperature for 2 hours. Acetic acid was distilled off under reduced pressure, and aqueous sodium hydrogencarbonate was added to the residue. The mixture was extracted with ethyl acetate, and the extract was dried and concentrated. The residue is N,
It was dissolved in N-dimethylformamide (15 mL), and thiourea (1.1 g, 16 mmol) was added to the solution. The reaction mixture was stirred at room temperature for 14 hours. Aqueous sodium hydrogen carbonate solution was added, and the precipitated solid was collected by filtration. The solid was washed with water and dried. Recrystallization from ethyl acetate gave the title compound (3.4 g, yield 89%). Melting point 241-242 ° C. Reference Example M7 According to Reference Example M6, 1- (3-methylphenyl) -2- was used instead of 1- (3-methylphenyl) -2- (4-pyrimidinyl) ethenol.
(2-Methyl-4-pyrimidinyl) ethenol and tert-butyl 4- [2-hydroxy-2- (3-methylphenyl) ethenyl]-
Using 2-pyrimidinyl carbamate, the following Reference Example M
Compounds 7-1 and 7-2 were synthesized. Reference Example M Compound 7-1: [4- (3-methylphenyl) -5- (2-
Methyl-4-pyrimidinyl) -1,3-thiazol-2-yl] amine Melting point 185-186 ° C. Reference Example M compound 7-2: tert-butyl 4- [2-amino-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyrimidinyl carbamate melting point 262-264 ° C. Reference Example M8 Methyl 4-[[[4- (3-Methylphenyl) -5- (4-pyrimidinyl) -1,3-thiazol-2-yl] amino] carbonyl] benzoate Methyl 4-chloroformylbenzoate ( 1.1g, 5.6 mmo
l) to [4- (3-methylphenyl) -5- (4-pyrimidinyl) -1,3-
Thiazol-2-yl] amine and 4-dimethylaminopyridine
(0.14 g, 1.1 mmol) in N, N-dimethylacetamide (10 mL) solution was added, and the mixture was stirred at 70 ° C. for 14 hr. Aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the precipitated solid was collected by filtration. The crude crystals were washed with water and dried. Recrystallization from pyridine gave the title compound (1.0 g, yield 65%). Melting point 339-341 ° C. Reference Example M9 4-[[[4- (3-Methylphenyl) -5- (4-pyrimidinyl) -1,3-
Methyl thiazol-2-yl] amino] carbonyl] benzoate 4-[[[4- (3-Methylphenyl) -5- (4-pyrimidinyl)
2N- in a suspension of -1,3-thiazol-2-yl] amino] carbonyl] benzoate (0.50g, 1.2 mmol) in ethanol (10mL)
Aqueous sodium hydroxide solution (1.2 mL) was added, and the mixture was stirred as it was at room temperature for 2 hours. The reaction mixture was acidified with 2N-hydrochloric acid,
The precipitated solid was collected by filtration. Wash the crude crystals with water and dry,
0.40 g (yield 82%) of the title compound was obtained. Melting point 380-381 ° C. Reference Example M10 N- [4- (3-methylphenyl) -5- (2-methyl-4-pyrimidinyl) -1,3-thiazol-2-yl] acetamide [4- (3-methylphenyl) -5- (2-methyl-4-pyrimidinyl)-
1,3-thiazol-2-yl] amine (0.50 g, 1.8 mmol) and 4-
Dimethylaminopyridine (0.065 g, 0.53 mmol) in N, N-dimethylacetamide (10 mL) was added with acetyl chloride.
(0.19 mL, 2.7 mmol) was added, and the mixture was stirred at 80 ° C for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. After washing the extract with saturated saline,
It was dried and concentrated. The generated crystals were recrystallized from ethyl acetate to obtain the title compound 0.35 g (yield 61%). Melting point 230-231 ° C.

Reference Example M11 N- [5- (2-Methyl-4-pyrimidinyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -N′-phenylurea [5- ( 2-Methyl-4-pyrimidinyl) -4- (3-methylphenyl)-
1,3-thiazol-2-yl] amine (0.50 g, 1.8 mmol) in N,
Phenyl isocyanate (0.29 mL, 2.7 mmol) was added to the N-dimethylacetamide (10 mL) solution, and the mixture was stirred at 80 ° C. for 2 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The produced crystals were recrystallized from ethyl acetate-hexane to give the title compound (0.55 g, yield 78%). Melting point 141-142 ° C. Reference Example M12 N- [4- (3-Methylphenyl) -5- [2- (phenylacetylamino) -4-pyrimidinyl] -1,3-thiazol-2-yl] phenylacetamide tert-butyl 4- [2 -Amino-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyrimidinylcarbamate (0.50
g, 1.3 mmol) in N, N-dimethylacetamide (5 mL) was added with phenylacetyl chloride (0.52 mL, 3.9 mmol), and the mixture was stirred at 80 ° C. for 14 hr. Aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried and concentrated. The obtained residue is subjected to silica gel column chromatography (hexane-
Purified with ethyl acetate = 7: 3). The obtained oily substance was crystallized from ethyl ether to give the title compound (0.09 g, yield 13
%). Melting point 110-113 ° C. Table 83 shows the compounds produced in Reference Examples M6 to M12.

[0353]

[Table 83]

Reference Example N1 Measurement of TNF-α production inhibitory activity R containing 1% inactivated fetal bovine serum and 10 mM HEPES (pH 7.5)
THP-1 cells cultured in PMI1640 medium (GIBCO BRL) were seeded in a 96-well plate at 1 × 10 ⁵ cells / well, and 1 ml of a test compound dissolved in DMSO was added. After culturing in a carbon dioxide incubator at 37 ℃ for 1 hour, LP
S (Wako Pure Chemical Industries, Ltd.) was added to give a final concentration of 5 mg / ml. After culturing at 37 ° C. for 4 hours in a carbon dioxide gas incubator, the supernatant was obtained by centrifugation. TNF-α in the supernatant
The concentration was measured by an ELISA kit (Diacron). The concentration (IC ₅₀ value) of the test compound required to inhibit TNF-α production by 50% was calculated with PRISM2.01 (Graph Pad Software). The results are shown in Table 84.

[Table 84] From the above results, it was found that the compound of the present invention has an excellent TNF-α production inhibitory action.

[0355]

Example 1 Test Using Rat Yeast-Induced Pain Model Animal Four-week-old male Sprague-Dawley rats (CLEA Japan, Inc.) were used. 20% east physiological saline solution in the footpad of the right hind leg.
1 ml was subcutaneously injected into the right hind footpad to induce inflammation. 1
After a lapse of time, 0.5% methylcellulose water or 0.5% methylcellulose water in which Compound D of Reference Example D-1 was suspended was orally administered (0.5 ml / 100 g body weight). Two hours after the administration of the sample, the pain threshold value was measured by the pseudo escape reaction using a pressure device. There were 6 animals per group. As a result, Reference Example D
Compound 16-1 shows a dose-dependent antinociceptive effect,
The minimum effective dose was 10 mg / kg.

[Example 2] Osteoclast formation inhibitory effect 1 was obtained by collecting bone marrow cells from tibia of 8-week-old male ddY mice.
Suspended in αMEM medium containing 0% FBS, and added 10 ⁶ cells / 0.
The cells were seeded on a 24-well plate so as to have a volume of 5 ml / well. After performing static culture overnight, the medium was ^adjusted to 10 ⁻⁸ M.
1α, 25- (OH) ₂ D ₃ and Reference Example D compound 16-1 were replaced with the above-mentioned mediums containing 0.01, 0.1, 1 and 10 μM of each, and the cells were further cultured for 6 days. After completion of the culture, the cells were fixed and stained with an enzyme activity for tartrate-resistant acid phosphatase (TRAP), which is an osteoclast differentiation indicator.
The number of TRAP-positive, multinucleated cells of three or more nuclei was determined as an osteoclast under a microscope. As a result, about 2 from bone marrow cells
Although 100 cells / well of osteoclasts were formed, the number thereof was decreased in a dose-dependent manner by the addition of the compound D of Reference Example D compound 16-1 (Table 85). The effect was significantly recognized from 0.1 μM, and osteoclast formation was hardly observed at 10 μM. Reference Example D Compound 16-1 for Osteoclast Formation
_{IC 5 0} value of was 0.3μM.

[Table 85] From this result, it was found that Reference Example D compound 16-1 had an excellent osteoclast formation inhibitory effect in the mouse bone marrow cell culture system.

Example 3 Measurement of CYP3A4 inhibitory activity 10 pmol / mL of CYP3A4, 100 in 50 mM phosphate buffer (pH 7.4)
μM testosterone, 1/10 volume of the reaction solution, NADPH producing system, and a test substance (10 μM) were added, and control microsomes were added to adjust the final protein concentration to 1.0 mg / mL. After adjusting the reaction solution, it was reacted at 37 ° C. for 30 minutes (total reaction solution volume 100 μL). The reaction solution was stopped by adding 100 μL of acetonitrile. After stirring, 100 μL of distilled water was added and further stirred. Centrifuge for 10 minutes (15000 rpm) and add 80 μm to the supernatant by HPLC.
L was injected and the concentration of 6-β-hydroxytestosterone produced by the reaction was measured. The NADPH production system is prepared by 1 volume of 50 mM NADP (β-nicotinamide adenine dinucleotide oxidation type), 1 volume of 0.5 M glucose-6-phosphate, 5 volumes of 0.1 M magnesium chloride, 1 volume of 150 unit / mL. Glucose-6-phosphate dehydrogenase was mixed with 2 volumes of distilled water. The results are shown in Table 86.

[Table 86] From this result, a compound having a substituent introduced at the α-position of the nitrogen atom of the pyridyl group of the compound containing a pyridyl group, and a polar group to the aromatic hydrocarbon group of the compound containing a pyridyl group and an aromatic hydrocarbon group. The compound introduced is P45
It was found that the 0 inhibitory effect was reduced.

[0356]

The p38MAP kinase inhibitor or (and) TNF-α production inhibitor is a preventive / therapeutic agent for pain,
It is useful as an osteoclast activation inhibitor and an osteoclast formation inhibitor.

[0357]

[Sequence list] <110> Takeda Chemical Industries, Ltd. <120> Pharmaceutical Composition <130> B02167 <150> JP 2001-175224 <151> 2001-06-11 <150> JP 2001-175273 <151> 2001-06-11 <160> 20 <210> 1 <211> 62 <212> DNA <213> Artificial Sequence <400> 1 accactcgag atggactaca aggacgacga tgacaagtct caggagaggc ccacgttcta 60 cc 62 <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <400> 2 acccggtacc accaggtgct caggactcca tctct 35 <210> 3 <211> 61 <212> DNA <213> Artificial Sequence <400> 3 acaagaattc ataacatatg gctcatcatc atcatcatca ttccaagcca cccgcaccca 60 a 61 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <400> 4 tcccgtctag actatgagtc ttctcccagg at 32 <210> 5 <211> 45 <212> DNA <213> Artificial Sequence <400> 5 ggctacttgg tggacgaggt ggccaaggag atggatgccg gctgc 45 <210> 6 <211> 45 <212> DNA <213> Artificial Sequence <400> 6 gcagccggca tccatctcct tggccacctc gtccaccaag tagcc 45 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <400> 7 cgcctctaga caagatgccc aacaacagca ctgc 34 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <400> 8 cggggtcgac actactcaga attcttctca atgc 34 <210> 9 <211> 62 <212> DNA <213> Artificial Sequence <400> 9 accactcgag atggactaca aggacgacga tgacaagtct caggagaggc ccacgttcta 60 cc 62 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <400> 10 acccggtacc accaggtgct caggactcca tctct 35 <210> 11 <211> 61 <212> DNA <213> Artificial Sequence <400> 11 acaagaattc ataacatatg gctcatcatc atcatcatca ttccaagcca cccgcaccca 60 a 61 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <400> 12 tcccgtctag actatgagtc ttctcccagg at 32 <210> 13 <211> 45 <212> DNA <213> Artificial Sequence <400> 13 ggctacttgg tggacgaggt ggccaaggag atggatgccg gctgc 45 <210> 14 <211> 45 <212> DNA <213> Artificial Sequence <400> 14 gcagccggca tccatctcct tggccacctc gtccaccaag tagcc 45 <210> 15 <211> 62 <212> DNA <213> Artificial Sequence <400> 15 accactcgag atggactaca aggacgacga tgacaagtct caggagaggc ccacgttcta 60 cc 62 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <400> 16 acccggtacc accaggtgct caggactcca tctct 35 <210> 17 <211> 61 <212> DNA <213> Artificial Sequence <400> 17 acaagaattc ataacatatg gctcatcatc atcatcatca ttccaagcca cccgcaccca 60 a 61 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <400> 18 tcccgtctag actatgagtc ttctcccagg at 32 <210> 19 <211> 45 <212> DNA <213> Artificial Sequence <400> 19 ggctacttgg tggacgaggt ggccaaggag atggatgccg gctgc 45 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <400> 20 gcagccggca tccatctcct tggccacctc gtccaccaag tagcc 45

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 3/14 A61P 3/14 19/02 19/02 19/08 19/08 19/10 19/10 29 / 00 29/00 (72) Inventor Yoshinori Nagase 4-5-2-5 Hata, Ikeda-shi, Osaka (72) Inventor Seiji Miwa 8-10-201 Sakaemachi, Ikeda-shi, Osaka F-term (reference) 4C084 AA17 ZA082 ZA962 ZA972 ZB152 ZC212 4C086 AA01 AA02 BC73 BC82 GA02 GA03 GA07 GA08 GA10 MA01 MA04 ZA08 ZA96 ZA97 ZB15 ZC21

Claims (26)

[Claims] 1. A pain preventive / therapeutic or (and) osteoclast activation inhibitory or (and) formation inhibitor comprising a p38 MAP kinase inhibitor or (and) TNF-α production inhibitor. 2. The preventive and / or therapeutic agent for pain according to claim 1, which comprises a p38MAP kinase inhibitor or / and a TNF-α production inhibitor. 3. The inhibitor of osteoclast activation or (and) formation according to claim 1, which comprises a p38MAP kinase inhibitor or (and) TNF-α production inhibitor. 4. A 1,3-thiazole compound or a salt thereof, wherein the p38MAP kinase inhibitor or (and) TNF-α production inhibitor is substituted with a pyridyl group which may have a substituent at the 5-position. The agent according to claim 1, which is a prodrug. 5. A p38MAP kinase inhibitor or / and a TNF-α production inhibitor is represented by the formula: [In the formula, R ¹ represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. , R ² represents a pyridyl group which may have a substituent, and R ³ represents an aromatic group which may have a substituent. ] The agent according to claim 1, which is a compound represented by the formula or a salt thereof or a prodrug thereof. 6. A p38 MAP kinase inhibitor or / and a TNF-α production inhibitor which is optionally N-oxidized is represented by the formula: [In the formula, R ^1a represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. To R ^2a
Is an aromatic group which may have a substituent, R ^3a represents a hydrogen atom, a pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X ^a is an oxygen atom or an optionally oxidized sulfur atom, Y ^a is a bond, an oxygen atom, an optionally oxidized sulfur atom or a formula
NR ^4a (in the formula, R ^4a represents a hydrogen atom, an optionally substituted hydrocarbon group or an acyl group), and Z ^a has a bond or a substituent. It represents a divalent chain hydrocarbon group which may be present. ] The agent according to claim 1, which is a compound represented by the formula or a salt thereof or a prodrug thereof. 7. A p38MAP kinase inhibitor or (and
And) the TNF-α production inhibitor has the formula [Chemical 3] [Wherein a is N or C; b is CH when a is N,
when a is C, then O; = means that the azole ring is an imidazole ring
Or a single bond or double depending on whether it is an oxazole ring
Bond; Z_bIs N or CH; W_bIs -NR_6b-Y
_b-(R_6bIs a hydrogen atom, C_1-4Alkyl group, C_3-
8Cycloalkyl group, C_3-8Cycloalkyl-C
_1-3Alkyl group, C_{6-1 8}Aryl group, C_3-18
Heteroaryl group, C_7-19Aralkyl group or C
_4-19A heteroaralkyl group,_b-Is C_1-4A
A alkylene group or a bond), -O- or -S-
To R_2bIs a phenyl group (halogen atom, trifluoromethyl
Le, cyano, amide, thioamide, carboxylate,
Thiocarboxylate, C_1-4Alkoxy, C_1-4
Alkyl, amino and mono- or di-C_1-4Archi
One or more units selected from the group consisting of luamino
Optionally substituted with a substituent), R_3bIs hydrogen atom, halogen atom, C_1-10Alkyl
Base, C_2-4Alkenyl group, C_3-10Cycloalkyl
Base, C_3-18Heterocycloalkyl group, C_{6 -18}A
Reel base, C_3-18Heteroaryl group or -CH =
N-NH-C (NH) NH_Two(C above_1-10Archi
Lu group, C_2-4Alkenyl group, C_{3-1 0}Cycloalk
Lu group, C_3-18Heterocycloalkyl group, C_6-18
Aryl group, C_3-18Heteroaryl group or -CH
= N-NH-C (NH) NH_TwoRespectively hydroxy
C optionally substituted with_1-4Alkyl, halogen source
Child, C substituted with halogen_1-4Alkyl, hydroxy
Shi, C_1-4Alkoxy, C_1-4Alkylthio, cal
Boxy, C_1-6Alkyl or C_1-6Alkoxy
Carbonyl, amino, mono- or optionally substituted with
Is di-C_1-4Alkylamino and 5 to 7 membered N-
A heterocyclic group (which may further contain a hetero atom)
Substituted with 1 to 4 substituents selected from the group consisting of
May be) R_5bIs C_6-18Aryl group, C_3-18Hetero ant
Group or C_{3-1 Two}Cycloalkyl group (each C
_1-4Alkyl, halogen, C substituted with halogen
_1-4Alkyl, hydroxy, C_1-4Alkoxy, C
_1-4Alkylthio, amino, mono- or di-C_1-4
Alkylamino and 5- to 7-membered N-heterocyclic groups
May also contain heteroatoms).
Optionally substituted by 1 to 4 substituents)
Indicates. ] The compound or its salt represented by
The agent according to claim 1, which is a rodrug. 8. A p38 MAP kinase inhibitor or / and a TNF-α production inhibitor, wherein the 5-position is substituted with a 4-pyridyl group having a substituent containing no aromatic group, 1,3.
-The agent according to claim 1, which is a thiazole compound or a salt thereof or a prodrug thereof. 9. The 1,3-thiazole compound has the formula: [In the formula, R ^1c represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. , R ^2c represents a 4-pyridyl group having a substituent containing no aromatic group, and R ^3c represents an aromatic group which may have a substituent. ] The agent of Claim 8 which is a compound or its salt represented by these. 10. A p38MAP kinase inhibitor or / and a TNF-α production inhibitor is substituted at the 5-position with a pyridyl group having a substituent containing no aromatic group at a position adjacent to the nitrogen atom of the pyridyl group. The agent according to claim 1, which is a 1,3-thiazole compound, a salt thereof, or a prodrug thereof. 11. The 1,3-thiazole compound has the formula: [In the formula, R ^1d represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group which may have a substituent or an acyl group. , R ^2d represents a pyridyl group having a substituent containing no aromatic group at a position adjacent to the nitrogen atom of the pyridyl group, and R ^3d represents an aromatic group which may have a substituent. ] The agent of Claim 10 which is a compound or its salt represented by these. 12. A p38MAP kinase inhibitor or (and) TNF-α production inhibitor has 4-pyridyl which has a substituent containing no aromatic group at the position 5 adjacent to the nitrogen atom of the 4-pyridyl group. The agent according to claim 1, which is a 1,3-thiazole compound substituted with a group, a salt thereof or a prodrug thereof. 13. A p38MAP kinase inhibitor or (and) a TNF-α production inhibitor is N- [5- (2-benzoylamino-4-pyridyl) -4- (3,5-dimethylphenyl) -1, 3
-Thiazol-2-yl] acetamide, N- [5- (2-benzylamino-4-pyridyl) -4- (3,5-dimethylphenyl)-
1,3-thiazol-2-yl] acetamide, N- [4- [4- (4
-Methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl)- 1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [4- (3-Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [2-Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [4- (3-Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [2-ethyl- 4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2-ethyl-4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl]- 2-pyridyl] -3- (4-methoxyphenyl) propionamide, N- [4- [2-ethyl
-4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] -4-phenylbutyramide, N- [4- [4- (3-
Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazole- 5-yl] -2-
Pyridyl] -3-phenylpropionamide, N- [4- [2-
Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2-butyl-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N- [4- [2- (4
-Fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4-
[2- (4-fluorophenyl) -4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N- [4- [4- (3-methylphenyl) -2-
(4-Methylthiophenyl) -1,3-thiazol-5-yl] -2
-Pyridyl] benzamide, N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -3-phenylpropionamide, N
-Benzyl-N- [4- [2-ethyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] amine, N- [4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -N- (2-phenylethyl) amine, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2 -Pyridyl] -N- (3-phenylpropyl) amine, N-benzyl-N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2- Pyridyl] amine, N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine, N -[4- [4- (3-Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine, N-benzyl-N-
[4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine, N- [4- [2-butyl-4
-(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine, N- [4- [2-
Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine,
N-benzyl-N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine, N- [4- [4- (3-methylphenyl) -2- (4
-Methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine, N- [4- [4-
(3-Methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine, N- [4- [4- (3-methylphenyl) -2
-(4-Methylsulfonylphenyl) -1,3-thiazole-5-
Il] -2-pyridyl] benzamide, N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,
3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl ] -2-Pyridyl] -3-phenylpropionamide, N-benzyl-N-
[4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Amine, N- [4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] -N- (3-phenylpropyl) amine, N- [4-
[4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-
(2-phenylethyl) amine, N- (4-fluorobenzyl) -N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole-5- Il] -2-pyridyl] amine, (S) -N- [4- (3-methylphenyl) -5-
(2- (1-Phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] nicotinamide, (R) -N- [4- (3-
Methylphenyl) -5- (2- (1-phenylethylamino)-
4-Pyridyl) -1,3-thiazol-2-yl] nicotinamide, (S) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl ) -1,3-Thiazole-2
-Yl] -2-methylnicotinamide, (R) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-
Pyridyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, (S) -N- [4- (3-methylphenyl) -5- (2-
(1-Phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, (R) -N- [4-
(3-Methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, (S) -N- [4 -(3-methylphenyl) -5
-(2- (1-Phenylethylamino) -4-pyridyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide,
(R) -N- [4- (3-Methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide , N- [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] nicotinamide, N- [5- (2-benzylamino- 4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide, N-
[5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, N- [5- (2-benzylamino) -4-pyridyl) -4-
(3-Methylphenyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, N- [5- (2-benzoylamino-4-
Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] nicotinamide, N- [5- (2-benzoylamino-
4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -2-methylnicotinamide, N- [5- (2-benzoylamino-4-pyridyl) -4- (3-methylphenyl) -1,3
-Thiazol-2-yl] -2-chloronicotinamide, N- [5
-(2-benzoylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide, (S) -N- (1-phenylethyl) -4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl]-
2-pyridylamine, (R) -N- (1-phenylethyl) -4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridylamine, (S) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2 -Pyridylamine, (R) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine, ( S)
-N- (1-phenylethyl) -4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1 -Phenylethyl) -4- [2-butyl-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (S) -N- (1-phenylethyl) -4- [4-
(3-Methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridylamine, (R) -N-
(1-Phenylethyl) -4- [4- (3-methylphenyl) -2-
(4-Methylthiophenyl) -1,3-thiazol-5-yl] -2
-Pyridylamine, (S) -N- (1-phenylethyl) -4-
[4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1-phenylethyl) -4 -[4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (S) -N- (1-phenylethyl)- 4- [2- (4-fluorophenyl) -4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1-phenylethyl) -4- [2- (4-
The agent according to claim 1, which is fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine or a salt thereof. 14. Postmenopausal or senile primary osteoporosis, inflammation, hematological malignancies, endocrine disorders or secondary osteoporosis resulting from drug administration, bone metastasis of tumor or destruction or deformation of bone / joint tissue associated with rheumatism. , Paget
The agent according to claim 3, which is a prophylactic / therapeutic agent for disease or hypercalcemia. 15. A method for preventing and / or treating pain, which comprises administering an effective amount of a p38MAP kinase inhibitor or / and a TNF-α production inhibitor to a mammal. 16. A method for inhibiting activation of osteoclasts and / or inhibiting formation thereof, which comprises administering an effective amount of a p38MAP kinase inhibitor or (and) TNF-α production inhibitor to a mammal. . 17. A postmenopausal or senile primary osteoporosis, inflammation, blood, which comprises administering to a mammal an effective amount of a p38 MAP kinase inhibitor and / or a TNF-α production inhibitor. Malignant system disease, endocrine abnormalities or secondary osteoporosis caused by drug administration, destruction or deformation of bone / joint tissue associated with tumor bone metastasis or rheumatism, Paget's disease or hypercalcemia. 18. A p for producing an agent for preventing or treating pain.
38MAP Kinase Inhibitor or (and) TNF-α
Use of production inhibitors. 19. Inhibition of osteoclast activation or / and
Use of a p38 MAP kinase inhibitor or / and a TNF-α production inhibitor to produce an anti-formation agent. 20. Post-menopausal or senile primary osteoporosis, inflammation, hematological malignancies, endocrine abnormalities or secondary osteoporosis caused by drug administration, bone metastasis of tumor or destruction or deformation of bone / joint tissue associated with rheumatism. , Paget
P38 MAP Kinase Inhibitor or (and) T for the Production of a Prophylactic / Therapeutic Agent for Disease or Hypercalcemia
Use of NF-α production inhibitors. 21. A method for reducing the P450 inhibitory action of a compound containing a pyridyl group or a salt thereof, wherein a substituent is introduced at the α-position of the nitrogen atom of the pyridyl group. 22. A method for reducing the P450 inhibitory action of a compound or a salt thereof, which comprises introducing a polar group into the aromatic hydrocarbon group of a compound or a salt thereof containing a pyridyl group and an aromatic hydrocarbon group. 23. The method according to claim 22, wherein a substituent is further introduced at the α-position of the nitrogen atom of the pyridyl group. 24. P450 is CYP2C9, CYP2D6
23. The method according to claim 21 or 22, which is CYP3A4. 25. The substituent is (i) a halogen atom, (ii) C.
_1-6Alkyl group, C_2-6Alkenyl group, C_2-6A
Lucinyl group, C _3-6Cycloalkyl group, C_6-14A
Reel base or C_7-16Aralkyl groups [these groups
Is oxo, halogen atom, C_1-3Alkylene Dioki
Si, nitro, cyano, optionally halogenated C
_1-6Alkyl, optionally halogenated C_2-6
Alkenyl, carboxy C_2-6Alkenyl, halogen
C which may be converted_2-6Alkynyl, halogenated
May be C_3-6Cycloalkyl, C_6-14A
Reel, optionally halogenated C_1-8Arcoki
Shi, C_1-6Alkoxy-carbonyl-C_1-6Arco
Xy, hydroxy, C_{6 -14}Aryloxy, C
_7-16Aralkyloxy, mercapto, halogenated
May be C_1-6Alkylthio, C_6-14Ants
Luthio, C_7-16Aralkylthio, amino, mono-
C_1-6Alkylamino, mono-C_6-14Arylua
Mino, Di-C_1-6Alkylamino, di-C_6-14A
Reel amino, formyl, carboxy, C_1-6Archi
Le-carbonyl, C_3-6Cycloalkyl-carboni
Le, C_1-6Alkoxy-carbonyl, C_6-14Ants
Ar-carbonyl, C_7-16Aralkyl-Carboni
Le, C_6-14Aryloxy-carbonyl, C
_7-16Aralkyloxy-carbonyl, 5- or 6-membered compound
Elementary ring carbonyl, carbamoyl, thiocarbamoyl, mo
No-C_1-6Alkyl-carbamoyl, di-C_1-6A
Ruquil-carbamoyl, C_6-14Aryl-carbamo
Yl, 5- or 6-membered heterocyclic carbamoyl, C_1-6Archi
Lesulfonyl, C_6-14Arylsulfonyl, C
_1-6Alkylsulfinyl, C_6-14Arylsul
Finyl, formylamino, C_1-6Alkyl-carbo
Nylamino, C_6-14Aryl-carbonylamino,
C_1-6Alkoxy-carbonylamino, C_1-6Al
Killsulfonylamino, C_6-14Arylsulfonyl
Amino, C_1-6Alkyl-carbonyloxy, C
_6-14Aryl-carbonyloxy, C_1-6Arco
Xy-carbonyloxy, mono-C_1-6Alkyl-Mo
Lubamoyloxy, di-C_1-6Alkyl-carbamoy
Roxy, C_6-14Aryl-carbamoyloxy,
Nicotinoyloxy, other than one nitrogen atom and carbon atom
1 or more selected from nitrogen atom, sulfur atom and oxygen atom
May contain 1 to 4 heteroatoms 5
To 7-membered saturated cyclic amino (this cyclic amino is C
_1-6Alkyl, C_6-14Aryl, C_1-6Archi
L-carbonyl, a 5- to 10-membered aromatic heterocyclic group and
May have a substituent selected from the group consisting of oxo
I), nitrogen atoms, sulfur atoms and oxygen atoms in addition to carbon atoms
Containing 1 to 4 1 or 2 heteroatoms selected from
5- to 10-membered aromatic heterocyclic group, sulfo, sulfamo
Ilu, sulfinamoyl and sulfenamoyl
1 to 5 substituents selected from the group (substituent group A)
Optionally have], (iii) selected from the substituent group A
Other than carbon atom, which may have 1 to 3 substituents
1 or 2 selected from nitrogen atom, sulfur atom and oxygen atom
5- to 14-membered containing 1 to 4 heteroatoms
A heterocyclic group, (Iv) Formula:-(C = O) -R^Five,-(C = O) -OR^Five,-
(C = O) -NR^FiveR⁶,-(C = S) -NHR^FiveOr-SO₂
-R⁷ (In the formula, R^FiveIs selected from the group consisting of hydrogen atom and substituent A
C which may have 1 to 3 substituents_1-6Archi
Lu group, C_2-6Alkenyl group, C_2-6An alkynyl group,
C_3-6Cycloalkyl group, C_6-14Aryl group
Kuha C_7-16Aralkyl group or substituent selected from group A
A carbon atom which may have 1 to 3 substituents
Other than nitrogen atom, sulfur atom and oxygen atom 1
Or 5 to 14 containing 1 to 4 heteroatoms
Membered heterocyclic group is R⁶Is a hydrogen atom or C_1-6Alkyl
The base is R⁷Does not have 1 substituent selected from Group A of substituents
C which may have 3_1-6Alkyl group, C_2-6
Alkenyl group, C_2-6Alkynyl group, C_3-6Cyclo
Alkyl group, C_6-14Aryl group or C_{7-1 6}
The aralkyl group or the substituent selected from the substituent group A is 1
To nitrogen atoms other than carbon atoms, which may have 3 to 3.
1 or 2 species selected from a child, a sulfur atom and an oxygen atom
5- to 14-membered heterocyclic group containing 1 to 4 terror atoms
Represents an acyl group, (v) an amino group (this amino group
No group is a substituent selected from Group A of Substituents 1 to 3
C which may have_1-6Alkyl group, C_2-6Al
Kenyl group, C_2-6Alkynyl group, C_3-6Cycloal
Kill group, C_6-14Aryl group or C_{7-1 6}Ara
1 to 1 substituents selected from the group
Nitrogen atom, sulfur other than carbon atom, which may have 3
1 or 2 heteroatoms selected from atoms and oxygen atoms
A 5 to 14 membered heterocyclic group containing 1 to 4 of
Selected from the group consisting of acyl groups represented by (iv) above
(May have 1 or 2 substituents), (vi) 1
In addition to nitrogen atom and carbon atom, nitrogen atom, sulfur atom and acid
1 or 2 heteroatoms selected from elementary atoms
5 to 7-membered non-aromatic cyclic amino which may contain 4
A group (this cyclic amino group is C_1-6Alkyl, C
_6-14Aryl, C_1-6Alkyl-carbonyl, 5
To a 10-membered aromatic heterocyclic group and oxo
Which may have 1 to 3 substituents selected from the group),
And (vii) no substituent selected from Group A of substituents
May have three, C_{1 -6}Alkoxy group, C
_6-14Aryloxy group or C_7-16Aralkyl
22. It is 1 to 3 selected from oxy groups.
Or the method described in 23. 26. The polar group comprises (1) a halogen atom and (2) a hydroxy group.
A substituent selected from the group (3) Substituent group A and the above (iv)
Having 1 or 2 substituents selected from the acyls represented by
Optional amino, (4) nitro, (5) carboxy
Substitution selected from group A, group (6) formyl, and group (7) substituent
C optionally having 1 to 3 groups_{1- 6}Arcoki
A substituent selected from the group (8) Substituent A is 1 to 3
C which may have_1-6Alkoxy-carbonyl,
(9) cyano and (10) shown in (1) to (9) above
C having 1 to 3 groups as substituents_1-6Alkyl
Or C _6-141 to 3 selected from aryl
23. The method of claim 22, wherein