JP2003061680A - Attenuated detection probe for sphingomyelin - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a protein which is usable as a detection probe for sphingomyelin, specifically recognizes sphingomyelin and has low cytotoxicity. SOLUTION: This protein is a protein in which N-terminal and/or C-terminal of earthworm toxin lysenin 1 or earthworm toxin lysenin 3 is deleted and which specifically recognizes sphingomyelin.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel protein that can be used as a sphingomyelin detection probe. More specifically, the present invention relates to a protein consisting of a partial amino acid sequence of lysenin 1 or lysenin 3, which is characterized by specifically recognizing sphingomyelin and having low cytotoxicity. The present invention provides a gene encoding the above protein, a vector having the gene,
The present invention relates to a transformant having the vector, a sphingomyelin detection reagent containing the protein, a sphingomyelin detection method using the protein, and a sphingomyelin detection kit.

[0002]

BACKGROUND OF THE INVENTION The major lipid components of cell membranes include glycerolipids, sphingolipids and cholesterol. Glycerolipids of animal cells have a structure in which two molecules of fatty acid and a phosphate group are bound to the glycerol skeleton. When dispersed in an aqueous solution, a hydrophobic fatty acid residue is on the inside and a phosphate group is on the outside. Form a structure. The formed bilayer structure has the property of liquid crystal, and a "fluid mosaic model" in which proteins float in such a liquid crystal was proposed by Singer and Nicolson of the United States in 1972.

In addition to the membrane cells that separate cells from the outside world, cells also have a complicated membrane structure inside, and each forms an organelle having a characteristic function. The components of the cell membrane are synthesized in the organelle called the endoplasmic reticulum, and finally transported to the cell membrane through the Golgi apparatus.

Glycerolipid, which is one of the components of cell membranes, contains fatty acids and phosphate groups, but the types of fatty acids are diverse, and the base moieties also have diversity such as choline, ethanolamine, serine and inositol. Further, sphingolipids include those in which various sugars such as glucose, galactose and lactose are bound. Including all of the above, there are tens of thousands of lipid molecules in nature. The lipid composition varies depending on the type of organism, the type of organ, the type of cell, and the type of organelle. Furthermore, the lipid composition of the inner and outer layers of the lipid bilayer of the biological membrane is different.

On the other hand, sphingolipids, unlike glycerolipids, have a base called sphingosine as a skeleton, and thus can serve as both hydrogen bond donors and acceptors. In addition, sphingolipids are generally bound to fatty acids having a long chain length. Due to these structural features, the sphingolipids have a property of easily associating with each other by a hydrogen bond in the hydrophilic part and by a hydrophobic interaction of the fatty acid chain in the hydrophobic part. Germany's Simons and colleagues proposed that sphingolipids on cell membranes associate to form a lipid domain, which is called a lipid raft (lipidraf).
t) (hereinafter, also simply referred to as “raft”).

Since the concept of the raft as described above was proposed, the raft plays an important role not only in information transmission but also in cell adhesion, viral and bacterial infection, and intracellular macromolecular transport. Has been suggested. Further, in recent years, it has been revealed that sphingomyelin is a necessary and sufficient factor for raft formation among sphingolipids.

The present inventors have previously reported that the earthworm (Eiseni).
We found that Lysenin, a toxin protein secreted by a foetida), specifically binds to sphingomyelin.

Lysenin is known and Lysenin 1,
It is known that there are three types, 2 and 3. Lysenin 1 is amino acid residue 297 and Lysenin 2 and 3 are amino acid residue 300. Of these, Lysenin 1 and 3 have high cytotoxicity, and thus there is a problem that they cannot be used for labeling sphingomyelin in living cells. Also, lysenin 2 does not recognize sphingomyelin.
Therefore, the lysenin reported so far could not be put to practical use as a sphingomyelin detection probe.

[0009]

That is, it is an object of the present invention to provide a protein which can be used as a probe for detecting sphingomyelin and which specifically recognizes sphingomyelin and has low cytotoxicity. . Furthermore, the present invention provides a gene encoding the above protein, a vector having the gene, a transformant having the vector, a sphingomyelin detection reagent containing the protein, a method for detecting sphingomyelin using the protein, and The provision of a sphingomyelin detection kit was made a problem to be solved.

[0010]

The inventors of the present invention have conducted extensive studies to solve the above-mentioned problems, and as a result, have found that lysenin 1
We succeeded in obtaining a protein having a low toxicity and specifically recognizing sphingomyelin from the proteins consisting of the partial amino acid sequence of, and completed the present invention.

That is, according to the present invention, there is provided a protein in which the N-terminal and / or the C-terminal of earthworm toxin Lysenin 1 or earthworm toxin Lysenin 3 is deleted and which specifically recognizes sphingomyelin. It The protein of the present invention is preferably a protein obtained by deleting 50 to 200 amino acid residues at the N-terminal and / or C-terminal of earthworm toxin lysenin 1 or earthworm toxin lysenin 3.

As a specific example of the protein of the present invention, a protein having any of the following amino acid sequences is provided. (1) Amino acid sequence shown in SEQ ID NO: 1; or (2) An amino acid sequence having 1 to a plurality of amino acid substitutions, deletions and / or additions in the amino acid sequence shown in SEQ ID NO: 1, which is sphingomyelin. Amino acid sequence that specifically recognizes and has low cytotoxicity:

According to another aspect of the present invention, there is provided a gene encoding the above-mentioned protein of the present invention. As a specific example of the gene of the present invention, a gene having any of the following nucleotide sequences is provided. (1) The base sequence of SEQ ID NO: 2; or (2) the base sequence of SEQ ID NO: 2, which has one to a plurality of base substitutions, deletions and / or additions, and is sphingomyelin. A nucleotide sequence that specifically recognizes and encodes a protein with low cytotoxicity:

According to yet another aspect of the present invention, there is provided a vector having the above-mentioned gene of the present invention. According to still another aspect of the present invention, there is provided a transformant having the above-described vector of the present invention. According to yet another aspect of the present invention, it comprises the protein of the present invention described above,
A sphingomyelin detection reagent is provided.

According to still another aspect of the present invention, there is provided a method for detecting sphingomyelin using the above-mentioned protein of the present invention. According to still another aspect of the present invention, there is provided a sphingomyelin detection kit containing the above-mentioned protein, gene, vector, transformant or sphingomyelin detection reagent of the present invention.

[0016]

BEST MODE FOR CARRYING OUT THE INVENTION Embodiments of the present invention will be described in detail below. (A) Protein of the Present Invention The protein of the present invention is a protein in which the N-terminal and / or C-terminal of earthworm toxin Lysenin 1 or earthworm toxin Lysenin 3 is deleted, and which specifically recognizes sphingomyelin. is there. The site to be deleted in the amino acid sequence of lysenin 1 or lysenin 3 may be N-terminal or C-terminal, or both N-terminal and C-terminal may be deleted. Preferably, the N-terminus can be deleted. The number of amino acid residues to be deleted is not particularly limited as long as the resulting protein can specifically recognize sphingomyelin, but preferably at least 50 amino acid residues or more are deleted, more preferably 70 amino acids. Residues or more, more preferably 100 amino acid residues or more, can be deleted. The upper limit of the number of amino acids to be deleted is preferably 200 or less.

Specific examples of the protein of the present invention include proteins having any of the following amino acid sequences. (1) Amino acid sequence shown in SEQ ID NO: 1; or (2) An amino acid sequence having 1 to a plurality of amino acid substitutions, deletions and / or additions in the amino acid sequence shown in SEQ ID NO: 1, which is sphingomyelin. Amino acid sequence that specifically recognizes and has low cytotoxicity:

The range of "1 to plural" in the above-mentioned "amino acid sequence having substitution, deletion and / or addition of 1 to plural amino acids in the amino acid sequence" is not particularly limited, but is, for example, 1 to 50. One, preferably one
To 20 pieces, more preferably 1 to 10 pieces, further preferably 1 to 5 pieces, particularly preferably 1 to 3 pieces.

The specific recognition of sphingomyelin in the present specification means that it reacts with sphingomyelin in ELISA, but it has low reactivity with phosphatidylcholine.

In order for the protein of the present invention to specifically recognize sphingomyelin, it is considered preferable that tryptophan (Trp) among amino acid residues is retained. That is, in a preferred embodiment of the present invention, the tryptophan residues at the 70th position, 128th position and 174th position are retained in the amino acid sequence set forth in SEQ ID NO: 1 in the sequence listing.

The cytotoxicity referred to in the present specification can be confirmed by measuring the hemolytic activity of red blood cells,
For example, various concentrations of test protein were added to sheep red blood cells, reacted at 37 ° C for 30 minutes, centrifuged to precipitate blood cells, and the amount of hemoglobin released by cell disruption was measured at 405n.
The hemolytic activity can be measured by measuring the absorbance as m. The protein of the present invention is characterized by low cytotoxicity measured as described above.

The method for obtaining and producing the protein of the present invention is not particularly limited, and may be either a chemically synthesized protein or a recombinant protein produced by a gene recombination technique. Recombinant proteins are preferable because they can be produced in a large amount with relatively easy operation.

When obtaining a chemically synthesized protein,
For example, the protein of the present invention can be synthesized according to a chemical synthesis method such as Fmoc method (fluorenylmethyloxycarbonyl method) and tBoc method (t-butyloxycarbonyl method). In addition, various commercially available peptide synthesizers (for example, Kuwawa Trading (manufactured by Advanced Chem Tech, USA), Perkin-Elmer Java (manufactured by Perkin-Elmer, USA), Pharmacia Biotech (manufactured by Pharmacia Biotech, Sweden), Aloka
(Made by Protein Technology Instrument Co., USA), Kurabo Industries
(Manufactured by Synthecell-Vega in the United States), Japan Perceptive Limited (manufactured by PerSeptive in the United States, Shimadzu, etc.) can also be used to synthesize the protein of the present invention.

To produce the protein of the present invention as a recombinant protein, D having a nucleotide sequence encoding the protein (for example, the nucleotide sequence shown in SEQ ID NO: 2) is used.
The protein of the present invention can be produced by obtaining NA or a mutant or homologue thereof and introducing this into a suitable expression system. Construction of expression vectors and transformants and production of recombinant proteins using them will be described later in this specification.

The amino acid sequence of SEQ ID NO: 1 has an amino acid substitution, deletion and / or addition of 1 to a plurality of amino acids, which specifically recognizes sphingomyelin and has low cytotoxicity. A protein having an amino acid sequence can be appropriately produced by those skilled in the art based on the information on the nucleotide sequence set forth in SEQ ID NO: 2 showing an example of the DNA sequence encoding the amino acid sequence set forth in SEQ ID NO: 1.

(B) Gene of the present invention The present invention also relates to a gene encoding the above-mentioned protein of the present invention. Specific examples of the gene of the present invention include genes having any of the following nucleotide sequences. (1) The base sequence of SEQ ID NO: 2; or (2) the base sequence of SEQ ID NO: 2, which has one to a plurality of base substitutions, deletions and / or additions, and is sphingomyelin. A nucleotide sequence that specifically recognizes and encodes a protein with low cytotoxicity:

The range of "1 to a plurality" in the above-mentioned "base sequence having 1 to a plurality of base substitutions, deletions and / or additions in the base sequence of SEQ ID NO: 2" is not particularly limited. , For example 1 to 150, preferably 1 to 60, more preferably 1 to 30, even more preferably 1 to 10, particularly preferably 1 to 5.
Means about individual pieces.

The method for obtaining the gene of the present invention is not particularly limited. SEQ ID NO: 1 in the sequence listing herein (lysenin 1
Amino acid residues 118 to 297 of SEQ ID NO: 2)
(Base sequence encoding amino acid residues 118 to 297 of lysenin 1), SEQ ID NO: 3 (base sequence and amino acid sequence of lysenin 1), and SEQ ID NO: 4 (base sequence and amino acid sequence of lysenin 3) Appropriate primers can be prepared based on the information on the nucleotide sequence and the amino acid sequence and used to construct the gene of the present invention.

As described above in the present specification, "a nucleotide sequence having 1 to a plurality of nucleotide substitutions, deletions and / or additions in the nucleotide sequence of SEQ ID NO: 2, which specifically recognizes sphingomyelin. And a gene having a “base sequence encoding a protein with low cytotoxicity” (mutant gene)
Can also be made by any method known to those skilled in the art such as chemical synthesis, genetic engineering techniques or mutagenesis.

Such a mutant gene can be obtained, for example, by using a DNA having the nucleotide sequence of SEQ ID NO: 2 and introducing a mutation into these DNAs. That is, DNA having the nucleotide sequence of SEQ ID NO: 2
On the other hand, it can be carried out by using a method of bringing into contact with a drug serving as a mutagen, a method of irradiating with ultraviolet rays, a genetic engineering method and the like. Site-directed mutagenesis, which is one of the genetic engineering methods, is useful because it is a method that can introduce a specific mutation at a specific position, and Molecular Cloning: A lab
^{oratory Mannual, 2 nd Ed.,} Cold Spring Harbor Labor
atory, Cold Spring Harbor, NY., 1989 .; or Current
Protocols in Molecular Biology, Supplement 1-38,
It can be carried out according to the method described in John Wiley & Sons (1987-1997) and the like.

(C) Vector Having the Gene of the Present Invention The gene of the present invention can be incorporated into an appropriate vector and used as a recombinant vector. The type of vector may be an expression vector or a non-expression vector and can be selected according to the purpose. As a cloning vector, one that can autonomously replicate in Escherichia coli K12 strain is preferable, and any of phage vector, plasmid vector and the like can be used. Specifically, ZAP Express, pBluescript
II SK (+), Lambda ZAP II (manufactured by Stratagene), λgt
10, λgt11, λTriplEx (Clontech), λExCel
l (Pharmacia), pT7T318U (Pharmacia), p
cD2, pMW218 (Wako Pure Chemical Industries), pUC118 (Takara Shuzo), pQE
-30 (manufactured by QIAGEN) and the like can be mentioned.

As the expression vector, one that can autonomously replicate in the host cell or can be integrated into the chromosome of the host cell is preferably used. As the expression vector, one containing a promoter at a position where the gene of the present invention can be expressed is used.

When a bacterium is used as a host cell, the expression vector for expressing the gene of the present invention is capable of autonomous replication in the bacterium and is composed of a promoter, a ribosome binding sequence, the above DNA and a transcription termination sequence. It is preferable that the recombinant vector is a modified recombinant vector. A gene that controls the promoter may be included.

Examples of expression vectors for bacteria include
pBTrP2, pBTac1, pBTac2 (all commercially available from Behringer Mannheim), pKK233-2 (Pharmacia), pSE280 (I
nvitrogen), pGEMEX-1 (Promega), pQE-8 (QIAGE
N company), pQE-30 (QIAGEN company), pKYP10 (JP-A-58-11060)
0), pKYP200 [Agrc.Biol.Chem., 48, 669 (1984)], PLS
A1 (Agrc. Blo1. Chem., 53, 277 (1989)), pGEL1 (Pro
c. Natl. Acad. Sci. USA, 82, 4306 (1985)], pBlues
crlptII SK +, pBluescriptII SK (-) (manufactured by Stratagene),
pTrS30 (FERM BP-5407), pTrS32 (FERM BP-5408), pGEX (Ph
armacia), pET-3 (Novagen), pTerm2 (US468619)
1, US4939094, US5160735), pSupex, pUB110, pTP5, pC
194, pUC18 [Gene, 33, 103 (1985)], pUC19 [Gene, 3
3, 103 (1985)], pSTV28 (Takara Shuzo), pSTV29 (Takara Shuzo), pUC118 (Takara Shuzo), pQE-30 (QIAGEN) and the like. As a promoter for bacteria, for example,
trp promoter (P trp), lac promoter (P lac), P _L
Promoter, P _R promoter, promoter derived from the P _SE such as promoter, E. coli, phage and the like, SP01
Examples thereof include a promoter, SP02 promoter, penP promoter and the like.

As an expression vector for yeast, for example, YE
p13 (ATCC37115), YEp24 (ATCC37051), Ycp5O (ATCC3741
9), pHS19, pHS15 and the like. Examples of yeast promoters include PHO5 promoter, PG
K promoter, GAP promoter, ADH promoter, g
Examples thereof include al1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter and CUP1 promoter.

As an expression vector for animal cells, for example, pcDNAI, pcDM8 (commercially available from Funakoshi), pAGE107 [JP-A-3-22979; Cytotechnology, 3, 133, (1990)], pAS3
-3 (JP-A-2-227075), pCDM8 (Nature, 329, 840, (198
7)], pcDNAI / AmP (manufactured by Invitrogen), pREP4 (Invitrogen
Company), pAGE103 [J. Blochem., 101, 1307 (1987)], pAG
E210 etc. can be illustrated. Examples of promoters for animal cells include cytomegalovirus (human CM
V) IE (immediate early) gene promoter, SV40
Early promoter, retrovirus promoter,
Examples thereof include metallothionein promoter, heat shock promoter, SRα promoter and the like.

As an expression vector for plant cells, for example, pIG121-Hm [Plant Cell Report, 15 , 809-814 (199
5)], pBI121 [EMBO J. 6 , 3901-3907 (1987)] and the like. Examples of promoters for plant cells include cauliflower mosaic virus 35S promoter [Mol. Gen. Genet (1990) 220 , 389-392], rubrose bisphosphate carboxylase small subunit promoter, and the like.

(D) Transformant Having Gene of Present Invention Transformant having gene encoding the protein of the present invention is prepared by introducing the above recombinant vector (preferably expression vector) into a host. You can Specific examples of bacterial host cells include Escherichia
Genus, Corynebacterium, Brevibacterium, Bacillus
Genus, Microbacterium, Serratia, Pseudomonas, A
genus grobacterium, genus Alicyclobacillus, genus Anabaena, An
acystis, Arthrobacter, Azobacter, Chromatium
Genus, Erwinia, Methylobacterium, Phormidium, R
hodobacter, Rhodopseudomonas, Rhodospiri11um
Genus, Scenedesmun, Streptomyces, Synnecoccus,
Microorganisms belonging to the genus Zymomonas and the like can be mentioned.
Examples of methods for introducing a recombinant vector into a bacterial host include a method using calcium ions and a protoplast method.

Specific examples of yeast hosts include Saccharomyces cerevisae, Schizosaccharomyces pombe, Kluyveromyces lactis,
Trichosporon pu11ulan
s), Schwanniomyces a1
1 uvius) and the like. Examples of the method for introducing the recombinant vector into the yeast host include the electroporation method, the spheroblast method, the lithium acetate method, and the like.

Animal cell hosts include Namalwa cells, CO
Examples include S1 cells, COS7 cells, CHO cells and the like.
As a method for introducing the recombinant vector into animal cells, for example, electroporation method, calcium phosphate method, lipofection method and the like can be used.

When an insect cell is used as a host, the recombinant gene transfer vector and baculovirus are co-introduced into the insect cell to obtain the recombinant virus in the insect cell culture supernatant, and then the recombinant virus is further added to the insect. Cells can be infected and proteins expressed (eg, Ba
culovirus Expression Vectors, A Laboratory Manua
1; and Current Protocols in Molecular Biology, Bio / Technology, 6, 47 (1988), etc.).

Examples of the baculovirus include, for example, Outgrapha
California nuclear polyhedrosis vir (Autographa californica nuclear polyhedrosis vir
us) or the like can be used. As an insect cell, Spodo
ptera frugiperda ovarian cells Sf9 and Sf21
[Baculovirus Expression Vectors, A Laboratory Manual, W. H. Freeman and Company (WH Freeman a
nd Company), New York, (1992)], Tri
For example, HiFive (manufactured by Invitrogen), which is an ovary cell of choplusia ni, can be used. As a method for co-introducing the recombinant gene transfer vector and the above-mentioned baculovirus into insect cells for preparing a recombinant virus,
For example, the calcium phosphate method, the lipofection method, etc. can be mentioned.

(E) Recombination using the transformant of the present invention
In the present invention, the transformant having the gene of the present invention produced as described above is cultured, the protein of the present invention is produced and accumulated in the culture, and the protein of the present invention is produced from the culture. The recombinant protein can be isolated by collecting.

When the transformant of the present invention is a prokaryote such as Escherichia coli or a eukaryote such as yeast, the medium for culturing these microorganisms includes a carbon source, nitrogen source,
Either a natural medium or a synthetic medium may be used as long as it is a medium containing inorganic salts and the like and capable of efficiently culturing the transformant.
Culturing is preferably carried out under aerobic conditions, the culturing temperature is usually 15 to 40 ° C., and the culturing time is usually 16 hours to 7 days. The pH of the culture solution can be adjusted using an inorganic or organic acid, an alkaline solution, urea, calcium carbonate, ammonia, or the like. In addition, if necessary during culturing,
Antibiotics such as ampicillin and tetracycline may be added to the medium.

As a medium for culturing a transformant obtained by using animal cells as host cells, RP which is generally used
M11640 medium, Eagle's MEM medium, DMEM medium or a medium obtained by adding fetal bovine serum or the like to these mediums is used. Culture is usually pH6~8,30~40 ℃, 1 under conditions such as 5% C0 ₂ presence
Do ~ 7 days. If necessary, antibiotics such as kanamycin and penicillin may be added to the medium during the culture.

As a medium for culturing the transformant obtained by using plant cells as host cells, MS medium, R2P medium and the like, which are generally used depending on the plant species, are used. Culturing is usually carried out for 1 to 21 days under conditions such as pH 6 to 8 and 15 to 35 ° C. If necessary, antibiotics such as kanamycin and hygromycin may be added to the medium during the culture.

To isolate and purify the protein of the present invention from the culture of the transformant, conventional protein isolation and purification methods may be used. For example, the protein of the present invention is
When the cells are expressed in a lysed state, after culturing, the cells are collected by centrifugation and suspended in an aqueous buffer solution, and then disrupted by an ultrasonic disruptor, a French press, a Mantongaurin homogenizer, a Dynomill, etc. , To obtain a cell-free extract. From the supernatant obtained by centrifuging the cell-free extract, a usual protein isolation and purification method, that is,
Solvent extraction method, salting-out method with ammonium sulfate, desalting method, precipitation method with organic solvent, anion exchange chromatography method using a resin such as diethylaminoethyl (DEAE) sepharose, S-Sepharose FF (Pharmacia), etc. Cation exchange chromatography using resin, butyl sepharose, phenyl sepharose and other resins using hydrophobic chromatography, molecular sieve gel filtration method,
A purified sample can be obtained by using techniques such as an affinity chromatography method, a chromatofocusing method, and an electrophoretic method such as isoelectric focusing, alone or in combination.

(F) Sphingomyelin Detection Reagent The present invention also relates to a sphingomyelin detection reagent containing the above-described protein of the present invention. Since the protein of the present invention can specifically recognize sphingomyelin, it is useful as a sphingomyelin detection reagent. When the protein of the present invention is used as a reagent for detecting sphingomyelin, the protein of the present invention may be used alone as it is, or may be used as a labeled protein labeled with a substance for detection. The type of labeling substance for detection is not particularly limited, but for example,
Affinity substances (eg maltose binding protein (Malt
ose-binding protein), biotin, avidin, streptavidin, etc.), enzyme (for example, horseradish peroxidase or alkaline phosphatase) fluorescent substance (Cy5, Cy3 (above Amersham), fluorescein, tetramethylrhodamine, Texas red, acridine orange, etc. ), Chemiluminescent substances (for example, luminol, acridinium-I, etc.), radioactive substances and the like.

(G) Sphere using the protein of the present invention
Ngomyelin detection method The protein of the present invention is characterized by specifically recognizing sphingomyelin and having low cytotoxicity.
Therefore, sphingomyelin can be detected by using the protein of the present invention as a probe. The method for detecting sphingomyelin is not particularly limited,
An in vitro method such as ELISA or an in vivo method such as cell staining may be used.

In order to perform the ELISA, the ELISA plate is coated with a sphingomyelin-containing sample, blocked with bovine serum albumin or the like, and then the protein of the present invention is added to the plate and incubated. After washing the plate, sphingomyelin in the sample can be detected by sequentially adding and reacting an appropriate reagent for detecting the protein of the present invention. For example, when the protein of the present invention having an MBP (Maltose-binding protein) sequence is used as a detection probe, anti-MBP rabbit serum is incubated and washed after the reaction with the sample. Then, it was incubated with biotin-labeled anti-rabbit antibody, horseradish peroxidase (HRP) -labeled streptavidin, and developed with o-phenylendiamine.
Sphingomyelin in the sample can be detected by measuring the absorbance at 92 mm.

In order to carry out the cell staining method, for example, cells are fixed on a coverslip, and then the cell plasma membrane is perforated by treatment with digitonin to react with the protein of the present invention. After the reaction, sphingomyelin in cells can be detected by sequentially adding and reacting an appropriate reagent for detecting the protein of the present invention. For example, as a detection probe, MBP (Maltose-binding protei
n) When using the protein of the present invention having the sequence, diluted anti-MBP rabbit serum (NE
B), Sphingomyelin in cells can be detected by incubating with fluorescently labeled anti-rabbit antibody, encapsulating, and observing the cells with a confocal microscope.

(H) Sphingomyelin Detection Kit The protein, gene, vector, transformant, or sphingomyelin detection reagent of the present invention described above is provided in the form of a sphingomyelin detection kit. Is also possible. Such a sphingomyelin detection kit may contain other necessary reagents in addition to the above-mentioned protein, gene, vector, transformant, or sphingomyelin detection reagent, if desired. Examples of such other reagents include a buffer solution, a blocking solution, a washing solution necessary for the reaction, and other reagents necessary for detecting the label. Those skilled in the art can appropriately select such reagents to construct a kit. The present invention will be described more specifically with reference to the following examples, but the present invention is not limited to the examples.

[0053]

EXAMPLES Example 1: cDNA of earthworm toxin lysenin
Cloning of the earthworm toxin lysenin has been reported previously (Sekizawa, Y., Kubo, T., Kobayashi,
H., Nakajima, T., and Natori, S. (1997). Molecular
cloning of cDNA for lysenin, a novel protein in t
he earthworm Eisenia foetida that causes contracti
on of rat vascular smooth muscle. Gene 191, 97-10
2). The nucleotide sequence of lysenin 1 is also registered in the database (GenBank85846). The nucleotide sequence and amino acid sequence of Lysenin 1 are shown in SEQ ID NO: 3 in the sequence listing.

Example 2: Method for preparing MBP-lysenin118-297. When amplified by PCR, 5'end is BamHI and 3'end is HindIII
The following primer capable of amplifying a fragment corresponding to amino acids 118-297 of lysenin 1 (including 351 to 894 bases in the base sequence) was prepared. lysenin118 forward; ttcggatccctgaatgxtgacgttggtgga
(SEQ ID NO: 5) lysenin1 reverse; aagcttccgctttagttgcacctcatc (SEQ ID NO: 6)

Lysenin 1 cDN collected in Example 1
Using A as a template and PCR using the above primers,
PCR-TOPOII after amplifying amino acids 118-297 of lysenin1
After cloning into the vector (Invitrogen), the entire nucleotide sequence was confirmed. The above plasmid was treated with BamHI and HindIII, the fragment containing lysenin was recovered, and pMAL-C2X (New England, also treated with BamHI and HindIII was recovered.
Biolab) and MBP (Maltose-
binding protein) plasmid, pMBP-Lysnin
Got 118-297.

Example 3: Expression of protein The plasmid prepared in Example 2 was transformed into Escherichia coli JM109, protein expression was induced by IPTG by a standard method, and the bacterium was recovered and solubilized by sonication. After affinity purification with amylose resin (NEB), expression was confirmed by silver staining and western blotting with anti-MBP antibody.

Example 4: ELISA (enzyme-linked immunoso
Confirmation of specific reaction between the protein of the present invention and sphingomyelin by rbent assay (fixed enzyme immunoassay) ELISA (enzyme-linked immunosorbent assay) was performed as follows. 96-well ELISA plate
(Immulon 1, Dynatech Laboratories) is coated with 10 μM sphingomyelin (phosphatidylcholine as a control). 3% bovine serum albumin (bovine
MBP-lys after blocking with serum albumin (BSA)
dilute enin1, MBP, and MBP-lysenin118-297 to an appropriate amount,
Incubate the plate for 2 hours at room temperature. After washing 3 times, the anti-MBP rabbit serum (NEB) diluted 1: 1000 is incubated for 2 hours and washed. Furthermore, it was incubated with biotin-labeled anti-rabbit antibody and horseradish peroxidase (HRP) -labeled streptavidin to give o-phenylen.
Colored with diamine, 492 nm (630 n as control)
The absorbance of m) was measured. The obtained results are shown in FIG.
From the results of FIG. 1, MBP-lysenin118-297 was found to be MBP-lysenin1
It was shown to bind specifically to sphingomyelin (SM) as well as.

Example 5: Sheep erythrocytes at 3 × 10 ⁷ cells / mL with various concentrations of MBP-lysenin 1 and MBP-lysenin 118-297
And incubate for 30 minutes at 37 ° C, centrifuge to precipitate blood cells, and measure the amount of hemoglobin released by cell disruption.
It was measured as the absorbance at 405 nm. The value at the time when all the cells were destroyed was taken as 100%, and the value at each point was calculated. The obtained results are shown in FIG. From the results in Figure 2, MBP-
It was shown that lysenin1 shows hemolytic activity above a certain concentration, whereas MBP-lysenin118-297 (indicated as del 118-297 in FIG. 2) does not show hemolytic activity even at high concentration.

Example 6 Cell Staining Using Niemann-Pick type A Fibroblasts On a glass coverslip, fibroblasts obtained from a type A Niemann-Pick patient were cultured for several days. After fixing with paraform aldehyde, perforating the plasma membrane with digitonin treatment, MBP-lysenin118-297, MBP-lysenin1, and MB
Reacted with P. Incubate with diluted anti-MBP rabbit serum (NEB), fluorescently labeled anti-rabbit antibody, and mount,
It was observed with a confocal microscope. At the same time, incubation was performed with a monoclonal antibody (CALTAG) obtained from a mouse against a protein CD63 existing in the late endosome, and a fluorescently labeled anti-mouse antibody to visualize the late endosome. The obtained results are shown in FIG. From the results of FIG. 3, it was shown that sphingomyelin in fibroblasts can be detected in vivo by using the MBP-lysenin118-297 of the present invention.

Using the same method as above, Niemann-Pic
k type A fibroblasts were stained. The obtained results are shown in FIG. MBP-61-297, MBP-131-297, MBP-146-297, MBP-16
It shows that 1-297 is detectable in vivo. M
It is suggested that BP-61-246, MBP-61-207, and MBP-208-297 do not recognize sphingomyelin.

[0061]

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to provide a protein which can be used as a sphingomyelin detection probe, specifically recognizes sphingomyelin, and has low cytotoxicity.

[0062]

[Sequence list] SEQUENCE LISTING <110> RIKEN <120> A probe for detection of sphingomyelin <130> A11403MA <160> 6

[0063] <210> 1 <211> 180 <212> PRT <213> Eisenia foetida <400> 1 Leu Asn Ala Asp Val Gly Gly Ala Asp Ile Glu Tyr Met Tyr Leu Ile   1 5 10 15 Asp Glu Val Thr Pro Ile Gly Gly Thr Gln Ser Ile Pro Gln Val Ile              20 25 30 Thr Ser Arg Ala Lys Ile Ile Val Gly Arg Gln Ile Ile Leu Gly Lys          35 40 45 Thr Glu Ile Arg Ile Lys His Ala Glu Arg Lys Glu Tyr Met Thr Val      50 55 60 Val Ser Arg Lys Ser Trp Pro Ala Ala Thr Leu Gly His Ser Lys Leu  65 70 75 80 Phe Lys Phe Val Leu Tyr Glu Asp Trp Gly Gly Phe Arg Ile Lys Thr                  85 90 95 Leu Asn Thr Met Tyr Ser Gly Tyr Glu Tyr Ala Tyr Ser Ser Asp Gln             100 105 110 Gly Gly Ile Tyr Phe Asp Gln Gly Thr Asp Asn Pro Lys Gln Arg Trp         115 120 125 Ala Ile Asn Lys Ser Leu Pro Leu Arg His Gly Asp Val Val Thr Phe     130 135 140 Met Asn Lys Tyr Phe Thr Arg Ser Gly Leu Cys Tyr Asp Asp Gly Pro 145 150 155 160 Ala Thr Asn Val Tyr Cys Leu Asp Lys Arg Glu Asp Lys Trp Ile Leu                 165 170 175 Glu Val Val Gly             180

[0064] <210> 2 <211> 543 <212> DNA <213> Eisenia foetida <400> 2 ctg aat gct gac gtt ggt gga gcg gat att gaa tac atg tat ttg att 48 Leu Asn Ala Asp Val Gly Gly Ala Asp Ile Glu Tyr Met Tyr Leu Ile   1 5 10 15 gat gaa gtc aca ccc ata gga ggg act cag agt att cca cag gtc atc 96 Asp Glu Val Thr Pro Ile Gly Gly Thr Gln Ser Ile Pro Gln Val Ile              20 25 30 aca agt cgg gct aaa att ata gtt ggc cga cag ata atc ctt gga aaa 144 Thr Ser Arg Ala Lys Ile Ile Val Gly Arg Gln Ile Ile Leu Gly Lys          35 40 45 aca gaa att cga att aag cat gca gaa agg aag gag tac atg aca gtc 192 Thr Glu Ile Arg Ile Lys His Ala Glu Arg Lys Glu Tyr Met Thr Val      50 55 60 gtt tca aga aaa agt tgg cca gct gca act ctt gga cat agc aaa ctt 240 Val Ser Arg Lys Ser Trp Pro Ala Ala Thr Leu Gly His Ser Lys Leu  65 70 75 80 ttc aag ttt gtg ctc tat gaa gat tgg ggg gga ttt cga att aaa acg 288 Phe Lys Phe Val Leu Tyr Glu Asp Trp Gly Gly Phe Arg Ile Lys Thr                  85 90 95 ctg aac acc atg tat tcg ggc tat gag tat gcc tat tcc tct gat caa 336 Leu Asn Thr Met Tyr Ser Gly Tyr Glu Tyr Ala Tyr Ser Ser Asp Gln             100 105 110 gga gga atc tac ttt gat cag ggt act gat aat ccg aaa cag cgc tgg 384 Gly Gly Ile Tyr Phe Asp Gln Gly Thr Asp Asn Pro Lys Gln Arg Trp         115 120 125 gca atc aat aag tca ttg cct ctt cgt cat ggt gac gta gtc acc ttc 432 Ala Ile Asn Lys Ser Leu Pro Leu Arg His Gly Asp Val Val Thr Phe     130 135 140 atg aat aag tac ttc act cgc agt ggg ctg tgc tac gat gat gga ccg 480 Met Asn Lys Tyr Phe Thr Arg Ser Gly Leu Cys Tyr Asp Asp Gly Pro 145 150 155 160 gca aca aac gtg tac tgt ctg gac aaa cgt gaa gac aag tgg att ttg 528 Ala Thr Asn Val Tyr Cys Leu Asp Lys Arg Glu Asp Lys Trp Ile Leu                 165 170 175 gaa gtg gtt ggt taa 543 Glu Val Val Gly             180

[0065] <210> 3 <211> 894 <212> DNA <213> Eisenia foetida <400> 3 atg tcg gct aaa gca gca gag gga tat gaa cag ata gaa gta gat gtg 48 Met Ser Ala Lys Ala Ala Glu Gly Tyr Glu Gln Ile Glu Val Asp Val   1 5 10 15 gtg gca gta tgg Aaa gaa ggc tat gta tac gaa aat cgc gga agc acc 96 Val Ala Val Trp Lys Glu Gly Tyr Val Tyr Glu Asn Arg Gly Ser Thr              20 25 30 agt gtg gat cag aag atc aca ata aca aaa ggc atg aaa aat gtg aat 144 Ser Val Asp Gln Lys Ile Thr Ile Thr Lys Gly Met Lys Asn Val Asn          35 40 45 tca gaa aca agg aca gtg act gct acg cat agt att ggt tct act att 192 Ser Glu Thr Arg Thr Val Thr Ala Thr His Ser Ile Gly Ser Thr Ile      50 55 60 agc act gga gat gca ttc gaa att gga agc gtg gag gtt agc tac agc 240 Ser Thr Gly Asp Ala Phe Glu Ile Gly Ser Val Glu Val Ser Tyr Ser  65 70 75 80 cat tca cat gaa gaa tcc caa gtt agc atg acg gaa act gaa gtt tat 288 His Ser His Glu Glu Ser Gln Val Ser Met Thr Glu Thr Glu Val Tyr                  85 90 95 gaa tca aag gtg atc gaa cac act ata acg att cca cct act tca aaa 336 Glu Ser Lys Val Ile Glu His Thr Ile Thr Ile Pro Pro Thr Ser Lys             100 105 110 ttc aca aga tgg caa ctg aat gct gac gtt ggt gga gcg gat att gaa 384 Phe Thr Arg Trp Gln Leu Asn Ala Asp Val Gly Gly Ala Asp Ile Glu         115 120 125 tac atg tat ttg att gat gaa gtc aca ccc ata gga ggg act cag agt 432 Tyr Met Tyr Leu Ile Asp Glu Val Thr Pro Ile Gly Gly Thr Gln Ser     130 135 140 att cca cag gtc atc aca agt cgg gct aaa att ata gtt ggc cga cag 480 Ile Pro Gln Val Ile Thr Ser Arg Ala Lys Ile Ile Val Gly Arg Gln 145 150 155 160 ata atc ctt gga aaa aca gaa att cga att aag cat gca gaa agg aag 528 Ile Ile Leu Gly Lys Thr Glu Ile Arg Ile Lys His Ala Glu Arg Lys                 165 170 175 gag tac atg aca gtc gtt tca aga aaa agt tgg cca gct gca act ctt 576 Glu Tyr Met Thr Val Val Ser Arg Lys Ser Trp Pro Ala Ala Thr Leu             180 185 190 gga cat agc aaa ctt ttc aag ttt gtg ctc tat gaa gat tgg ggg gga 624 Gly His Ser Lys Leu Phe Lys Phe Val Leu Tyr Glu Asp Trp Gly Gly         195 200 205 ttt cga att aaa acg ctg aac acc atg tat tcg ggc tat gag tat gcc 672 Phe Arg Ile Lys Thr Leu Asn Thr Met Tyr Ser Gly Tyr Glu Tyr Ala     210 215 220 tat tcc tct gat caa gga gga atc tac ttt gat cag ggt act gat aat 720 Tyr Ser Ser Asp Gln Gly Gly Ile Tyr Phe Asp Gln Gly Thr Asp Asn 225 230 235 240 ccg aaa cag cgc tgg gca atc aat aag tca ttg cct ctt cgt cat ggt 768 Pro Lys Gln Arg Trp Ala Ile Asn Lys Ser Leu Pro Leu Arg His Gly                 245 250 255 gac gta gtc acc ttc atg aat aag tac ttc act cgc agt ggg ctg tgc 816 Asp Val Val Thr Phe Met Asn Lys Tyr Phe Thr Arg Ser Gly Leu Cys             260 265 270 tac gat gat gga ccg gca aca aac gtg tac tgt ctg gac aaa cgt gaa 864 Tyr Asp Asp Gly Pro Ala Thr Asn Val Tyr Cys Leu Asp Lys Arg Glu         275 280 285 gac aag tgg att ttg gaa gtg gtt ggt taa 894 Asp Lys Trp Ile Leu Glu Val Val Gly     290 295

[0066] <210> 4 <211> 903 <212> DNA <213> Eisenia foetida <400> 4 atg tcg tct aga gca gga atc gca gag gga tat gaa cag ata gaa gta 48 Met Ser Ser Arg Ala Gly Ile Ala Glu Gly Tyr Glu Gln Ile Glu Val   1 5 10 15 gat gtg gtg gca gta tgg aaa gaa ggc tac gtt tac gaa aat cgg gga 96 Asp Val Val Ala Val Trp Lys Glu Gly Tyr Val Tyr Glu Asn Arg Gly              20 25 30 agc acc agt gtg gag cag aag atc aaa ata aca aaa ggc atg aga aat 144 Ser Thr Ser Val Glu Gln Lys Ile Lys Ile Thr Lys Gly Met Arg Asn          35 40 45 ttg aat tca gaa aca aag aca ttg acg gct tcg cat agt att ggt tct 192 Leu Asn Ser Glu Thr Lys Thr Leu Thr Ala Ser His Ser Ile Gly Ser      50 55 60 act att agc act gga gat cta ttt gaa ata gca acc gtg gat gtt agc 240 Thr Ile Ser Thr Gly Asp Leu Phe Glu Ile Ala Thr Val Asp Val Ser  65 70 75 80 tac agc tac tca cat gaa gaa tcc caa gtt agt atg acg gaa act gaa 288 Tyr Ser Tyr Ser His Glu Glu Ser Gln Val Ser Met Thr Glu Thr Glu                  85 90 95 gtt tat gaa tca aag gaa atc gaa cac act ata acg att cca cct act 336 Val Tyr Glu Ser Lys Glu Ile Glu His Thr Ile Thr Ile Pro Pro Thr             100 105 110 tca aaa ttc aca aga tgg caa ctg aat gct gac gtt ggt gga gcg gat 384 Ser Lys Phe Thr Arg Trp Gln Leu Asn Ala Asp Val Gly Gly Ala Asp         115 120 125 att gaa tac atg tat ttg att gat gaa gtc aca ccc ata gga ggg act 432 Ile Glu Tyr Met Tyr Leu Ile Asp Glu Val Thr Pro Ile Gly Gly Thr     130 135 140 ctg agt att cca cag gtc atc aaa agt cgg gct aaa att cta gtt ggc 480 Leu Ser Ile Pro Gln Val Ile Lys Ser Arg Ala Lys Ile Leu Val Gly 145 150 155 160 cga gaa ata tac ctt gga gaa aca gaa att cga ata aag cat gcg gac 528 Arg Glu Ile Tyr Leu Gly Glu Thr Glu Ile Arg Ile Lys His Ala Asp                 165 170 175 agg aaa gag tat atg aca gtc gtt tca aga aaa agc tgg cca gct gca 576 Arg Lys Glu Tyr Met Thr Val Val Ser Arg Lys Ser Trp Pro Ala Ala             180 185 190 act ctt gga cat agc aaa ctt tac aag ttt gtg ctc tat gaa gat atg 624 Thr Leu Gly His Ser Lys Leu Tyr Lys Phe Val Leu Tyr Glu Asp Met         195 200 205 tat gga ttt cga att aaa acg ctg aac acc atg tat Tcg ggc tat gag 672 Tyr Gly Phe Arg Ile Lys Thr Leu Asn Thr Mer Tyr Ser Gly Tyr Glu     210 215 220 tat gcc tat tcc tct gat caa gga gga atc tac ttt gat cag ggt agt 720 Tyr Ala Tyr Ser Ser Asp Gln Gly Gly Ile Tyr Phe Asp Gln Gly Ser 225 230 235 240 gat aat ccg aaa cag cgc tgg gca atc aat aag tca ttg cct ctt cgt 768 Asp Asn Pro Lys Gln Arg Trp Ala Ile Asn Lys Ser Leu Pro Leu Arg                 245 250 255 cat ggt gac gta gtc acc ttc atg aat aag tac ttc act cgc agt ggt 816 His Gly Asp Val Val Thr Phe Mer Asn Lys Tyr Phe Thr Arg Ser Gly             260 265 270 ctg tgc tac tat gat gga ccg gca aca gac gtg tac tgt ttg gac aaa 864 Leu Cys Tyr Tyr Asp Gly Pro Ala Thr Asp Val Tyr Cys Leu Asp Lys         275 280 285 cgt gaa gac aag tgg att tta gaa gtg gtt aaa ccc taa 903 Arg Glu Asp Lys Trp Ile Leu Glu Val Val Lys Pro     290 295 300

[0067] <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 5 ttcggatccc tgaatgxtga cgttggtgga 30

[0068] <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 6 aagcttccgc tttagttgca cctcatc 27

[Brief description of drawings]

FIG. 1 shows the results of an experiment for confirming the reactivity between the protein of the present invention and sphingomyelin by ELISA.

FIG. 2 shows the results of a hemolysis experiment using the protein of the present invention.

FIG. 3 shows the result of cell staining using Niemann-Pick type A fibroblasts.

FIG. 4 shows the result of cell staining using Niemann-Pick type A fibroblasts.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12N 5/10 C12Q 1/68 Z C12Q 1/02 G01N 33/53 S 1/68 33/566 G01N 33 / 53 C12N 15/00 ZNAA 33/566 5/00 AF Term (reference) 4B024 AA11 BA38 CA04 CA06 CA07 CA20 DA06 EA04 GA11 HA03 4B063 QA01 QQ70 QR48 QR56 QR77 QR80 QS05 QS32 QS36 QX02 4B065 AA26X AA58AXAAXAAXAAXAA72A01XAA72A01XAA72A01X CA46 4H045 AA10 AA20 AA30 BA10 BA41 CA50 DA83 EA50 FA74 GA01 GA26

Claims (10)

[Claims] 1. A protein in which the N-terminal and / or C-terminal of earthworm toxin lysenin 1 or earthworm toxin lysenin 3 is deleted and which specifically recognizes sphingomyelin. 2. The protein according to claim 1, which is a protein in which 50 to 200 amino acid residues at the N-terminal and / or C-terminal of earthworm toxin Lysenin 1 or earthworm toxin Lysenin 3 are deleted. 3. A protein having any of the following amino acid sequences. (1) Amino acid sequence shown in SEQ ID NO: 1; or (2) An amino acid sequence having 1 to a plurality of amino acid substitutions, deletions and / or additions in the amino acid sequence shown in SEQ ID NO: 1, which is sphingomyelin. Amino acid sequence that specifically recognizes and has low cytotoxicity: 4. A gene encoding the protein according to any one of claims 1 to 3. 5. A gene having any of the following nucleotide sequences. (1) The base sequence of SEQ ID NO: 2; or (2) the base sequence of SEQ ID NO: 2, which has one to a plurality of base substitutions, deletions and / or additions, and is sphingomyelin. A nucleotide sequence that specifically recognizes and encodes a protein with low cytotoxicity: 6. A vector having the gene according to claim 4 or 5. 7. A transformant having the vector according to claim 6. 8. A reagent for detecting sphingomyelin, which comprises the protein according to any one of claims 1 to 3. 9. A method for detecting sphingomyelin using the protein according to any one of claims 1 to 3. 10. The protein according to any one of claims 1 to 3, the gene according to claim 4 or 5, the vector according to claim 6, the transformant according to claim 7, or claim 8. A sphingomyelin detection kit, which comprises the sphingomyelin detection reagent described in 1.