JP2003047487A - Fibroblast growth factor 15 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a human fibroblast growth factor 15 polypeptide, a DNA (RNA) encoding the polypeptide, and also to provide a method for producing the polypeptide by a recombinant technology. SOLUTION: A method for using the polypeptide to stimulate a revascularization, treat a wound and prevent neuron from damage is provided. Antagonists against the polypeptide, and the use of the polypeptide as a therapeutic medicine for preventing cell propagation disorder, hypervascular diseases and epithelial lens cell propagation, are also disclosed. A method for diagnosing to detect a mutation in a coding sequence of the polypeptide in a specimen obtained from a host and the change of concentration of the polypeptide is also provided.

Description

Description: The present invention relates to a newly identified polynucleotide.
Tide, the polynucleotide encoded by the polynucleotide
Use of peptides, their polynucleotides and polypeptides
For the production of polynucleotides and polypeptides
About birth. More specifically, the polypeptide of the present invention
Tide is a fibroblast growth factor / heparin binding growth factor
(Hereinafter referred to as "FGF-15")
I have. The present invention relates to inhibiting the action of the polypeptide.
Also related to. [0002] Fibroblast growth factor binds to heparin
Is a family of proteins that
Therefore it is also called heparin binding growth factor (HBGF)
You. The various components of this protein family vary
Expression with unique organization, and its expression
is recieving. These proteins are found in fibroblasts, cornea
And vascular endothelial cells, granulocytes, adrenocortical cells, chondrocytes,
Myoblasts, vascular smooth muscle, lens epithelial cells, melanogenesis
Cells, keratinocytes, oligodendrocytes, astrocytes, bone
Mesodermal, ectodermal and endodermal, including blasts and hematopoietic cells
A powerful mitogen for various cells of origin
is there. [0003] Each component has a function that overlaps with each other.
In addition, each has a unique functional spectrum. FGF-
1 and FGF-2, in addition to their ability to stimulate vascular endothelial cell proliferation,
Is chemotactic for endothelial cells, and FGF-2 is
Have been shown to allow penetration of the basement membrane
You. Consistent with these properties, FGF-1 and FGF-2
Has the ability to stimulate growth. Another of these growth factors
An important feature is that they can promote wound healing.
And Many other members of the FGF family are also blood
Activities similar to FGF-1 and FGF-2, such as promoting tube formation and wound healing
Have sex. Some of the members of the FGF family are medium
Induces germ layer formation, neurons, adipocytes and bone
It has been shown to regulate skeletal muscle cell differentiation. In addition to these biological activities in normal tissues,
When expression of the FGF protein is deregulated, tumors
By promoting tumor angiogenesis,
Promotes carcinoma and sarcoma tumor formation as a mining protein
It also relates to progress. At present, the FGF family is structurally related.
8 types of polypeptides: basic FGF, acidic FGF, int 2,
hst 1 / k-FGF, FGF-5, FGF-6, keratinocyte growth factor
Child, AIGF (FGF-8)
Purified from human glioma cell line culture supernatant
Laria activator is a novel heparin-binding growth factor
(Miyamoto, M. et al., Mol. And Cell.
Biol., 13 (7): 4251-4259 (1993)). Each heredity
The offspring have been cloned and sequenced. Their composition
Two of the elements, FGF-1 and FGF-2, are characterized by many names
Attached, respectively, acidic and basic fibroblasts
Most often called growth factors. Normal gene product
Is the general growth of most endodermal and neuroectodermal cells
Affects ability. They induce angiogenesis in vivo
Can play an important role in early development
(Burgess, WH and Maciag, T., Annu. Rev. Bioche
m., 58: 575-606, (1989)). In addition, many of the above-mentioned components of the FGF family
Or bind to the same receptor and
The second message is guided by the binding that is performed. Eukaryotic expression vector encoding secreted FGF-1
Was introduced into the pig artery by gene transfer.
You. This model demonstrates gene function in the arterial wall in vivo.
To clarify. FGF-1 expression was detected 21 days after gene transfer.
Induced intimal hyperplasia in the human artery (Nabel,
EG et al., Nature, 362: 844-6 (1993)). Furthermore, the base
Fibroblast growth factor regulates glioma growth and progression,
Can regulate independently of its role in tumor angiogenesis
And the release or secretion of basic fibroblast growth factor
Proven to be necessary for their action
(Morrison, RS et al., J. Neurosci. Res., 34: 502-9 (1
993)). [0008] Fibroblast growth factors such as basic FGF
Is also associated with in vitro proliferation of Kaposi's sarcoma cells
(Huang, YQ et al., J. Clin. Invest. 91: 1191-7 (1
993)). In addition, human basic fibroblast growth factor was
The cDNA sequence to be coded is a bacteriophage T7 RNA polymerase.
Downstream of the transcription promoter recognized by
Have been trained. Basic fiber sprouts thus obtained
Cell growth factors are mitogenic, plasminogen active
Human embryos were assayed for virulence factor synthesis and angiogenesis assays.
Have a biological activity indistinguishable from disc fibroblast growth factor
(Squires, CH et al., J. Biol. Che
m., 263: 16297-302 (1988)). US Pat. No. 5,155,214 discloses a substantially pure baby.
Disclose milk basic fibroblast growth factors and their production
ing. Bovine and human basic fibroblast growth factor
Acid sequence and the DNA sequence encoding the bovine polypeptide
Columns are disclosed. [0010] The newly discovered FGF-9 is a member of the FGF family.
Has about 30% sequence similarity to other components. Fami
Two cysteine residues in Lie components and other commonalities
The sequence was also well conserved in the FGF-9 sequence. FGF-9 is
At its N-terminus, typical signals such as acidic and basic FGFs
It has been found that it does not have a file array. However, FGF-9
Post-synthesis despite lacking the typical signal sequence FGF
Is secreted from cells (Miyamoto, M.
Et al., Mol. And Cell. Biol., 13 (7): 4251-4259 (199
3)). In addition, FGF-9 is oligodendrocyte type 2
Stimulates cell proliferation of vesicle precursor cells BALB / c3T3 and PC-12 cells
May not stimulate human umbilical vein endothelial cell proliferation
(Naruo, K. et al., J. Biol. Chem., 268: 2857-28
64 (1993)). Basic FGF and acidic FGF are used for cell growth and cell migration.
Is a potent regulator of motility, differentiation and survival;
Acts on cell types derived from germ and endoderm. this
These two FGFs, together with KGF and AIGF, are used for protein purification.
Therefore, it has been identified. But the other four components are
Isolated as an oncogene, whose expression is consistent with embryogenesis
Type of cancer was restricted. FGF-9 acts on glial cells
It has been proven to be a mitogen. FGF Family
Lee's components have been reported to have tumorigenic potential.
FGF-9 transforms when transformed into BLB / c3T3 cells.
Demonstrates forming ability (Miyamoto, M. et al., Mol. Cell.
Biol., 13 (7): 4251-4259 (1993)). Androgen induction, also known as FGF-8
Sexual growth factor (AIGF) is a testosterone-stimulated marker.
Mouse breast cancer cells (SC-3) were purified from conditioned media. AIGF
Is a unique FGF-like growth factor and putative signal peptide
With 30-40% homology to known FGF family members
is there. Mammalian cells transformed with AIGF are
Significant stimulatory effect on SC-3 cell proliferation in the absence of
Show. Thus, AIGF is associated with SC-3 cells and probably
Mediates androgen-induced proliferation of other cells. why
This is because it is secreted by the tumor cells themselves.
You. [0013] The polypeptide of the present invention is an FGF family.
Amino acid sequence homology with other components
Presumed to be a component of Millie. According to one aspect of the present invention, a novel mature polypeptide
Peptides, and biologically active and useful for diagnosis or therapy
Fragments, analogs and derivatives thereof are provided. Of the present invention
The polypeptide is of human origin. According to another aspect of the present invention,
An isolated nucleic acid molecule (mRN) encoding a polypeptide of
A, DNA, cDNA, genomic DNA) and biologically active
Fragments thereof are provided that are sexual and useful for diagnosis or therapy. According to a further aspect of the present invention, the recombinant vector
(A test for recombinant production of the polypeptide of the present invention)
Cloning and expression vectors useful as drugs)
Recombination comprising a nucleic acid sequence encoding a polypeptide of the invention
By using prokaryotic and / or eukaryotic host cells,
Methods for producing the polypeptides by recombinant techniques are provided.
It is. According to a further aspect of the present invention,
Peptide or polynucleotide encoding the above polypeptide
Otides, agonists and antagonists against them
Method used to burn and e.g. burns and ulcers
Promotes wound healing by
Prevented neuronal damage and promoted neuronal growth
To prevent skin aging and hair loss and to regenerate early embryos and limbs
Purposes such as stimulating angiogenesis and mesoderm induction in
There is provided a method for use with: According to a further aspect of the present invention, the poly
Antibodies to the peptides are provided. According to a further aspect of the present invention, the poly
Antagonists to the peptide, for example
In the treatment of cell transformation (eg tumors)
Reduces scars by inhibiting the action of the above polypeptides
To treat or treat hypervascular disease
Methods of using them are provided. According to another aspect of the present invention,
Specific for polynucleotides encoding different polypeptides
Consists of nucleic acid molecules long enough to hybridize to
A nucleic acid probe is provided. According to a further aspect of the present invention,
A disease associated with a mutation in the nucleic acid sequence or
To detect susceptibility to disease and its sequence
Diagnostics to detect overexpression of polypeptides that are loaded
A specific assay is provided. According to another aspect of the present invention, the above-mentioned
Polypeptide encoding the polypeptide or the above polypeptide
Reotide is used for scientific research, DNA synthesis and DNA vector
Provides methods for use in manufacturing related in vitro purposes
You. These and other aspects of the invention are as follows:
It should be apparent to those skilled in the art from the teachings herein. The following drawings are merely examples of certain embodiments of the invention.
It is only an indication and is not meant to be limiting. FIG.
~ 2 correspond to the deduced cDNA sequence of FGF-15
It is a figure which shows an amino acid sequence. Figures 3-6 show FGF-15 and others
Amino acid sequence homology between FGF family members
FIG. You can easily check the stored amino acids
You. According to one aspect of the present invention, the estimation of FIGS.
A mature polypeptide having an amino acid sequence (SEQ ID NO: 2),
Or deposited as ATCC Deposit No. 97146 on May 12, 1995
Mature polypeptide encoded by the cDNA of the clone
Isolated nucleic acid molecule encoding the peptide (polynucleotide
Is provided. Polynucleotide encoding FGF-15 of the present invention
Pide was initially a cDNA line derived from a human adrenal tumor tissue.
Found during the Bully. This is the fibroblast growth factor factor.
Structurally related to all components of the family, 252
Contains an open reading frame encoding a polypeptide
You. Among the main combinations, 1) for human FGF-9,
Over the 129 amino acid interval, 41% identity and 66% alignment
2) has 88 amino acids for human KGF
It has 37% identity and 59% similarity across regions. The characteristics of the FGF / HBGF family, GXLX (S, T, A,
G) X6 (D, E) CXFXE is also conserved in the polypeptides of the present invention.
(X represents any amino acid residue; (D, E) is D residue
Represents a group or an E residue; X6 represents any six amino acid residues
). The polynucleotide of the present invention is of the RNA type.
DNA type including cDNA, genomic DNA and synthetic DNA
It may be. DNA can be double-stranded or single-stranded
It may be. A code encoding a mature polypeptide
The coding sequence (coding sequence) shown in FIGS.
No. 1) or the same as the coding sequence of the deposited clone
One or the DNA (SEQ ID NO: 1) of FIGS.
Encodes the same mature polypeptide as the deposited cDNA,
Different codings due to redundancy or degeneracy of the genetic code
It may be an array. The mature polypeptide of FIG.
2) Alternatively, the mature polynucleotide encoded by the deposited cDNA
The polynucleotide encoding the repeptide is matured
May contain only the polypeptide coding sequence
And the coding sequence and leader of the mature polypeptide
Or additional coding sequences such as secretory sequences or
It may encode a proprotein sequence and
Repeptide (may have additional coding sequence)
And non-coding sequences (introns, mature polypeptides)
On the 5 'and / or 3' side of the coding sequence for the
Non-coding sequences). Thus, "encoding a polypeptide
The term "polynucleotide" refers to the polypeptide
A polynucleotide containing only the coding sequence,
Additional coding sequences and / or non-coding
A polynucleotide that also includes a sequence. Further, the present invention relates to the deduced amino acids shown in FIGS.
A polypeptide having the sequence (SEQ ID NO: 2) or
Of the polypeptide encoded by the cDNA of the deposited clone
The above-described polynucleotide encoding fragments, analogs and derivatives
It is also related to variants of Otide. This polynucleotide variant
Is the naturally occurring allele of the polynucleotide
It may be a variant or a naturally occurring version of the polynucleotide
May be a variant that does not exist. Accordingly, the present invention provides
Polypeptide (SEQ ID NO: 2) or cDNA of the deposited clone
The same mature polypeptide as the mature polypeptide encoded by
Polynucleotides encoding peptides, and FIGS.
2 (SEQ ID NO: 2) or the deposited
Fragments of a polypeptide encoded by the cDNA of the
Derivatives or analogs of the above polynucleotides
Includes variants. As such nucleotide variants
Include deletion variants, substitution variants and addition or insertion variants.
It is. As described above, the polynucleotide of the present invention
Is the coding sequence (SEQ ID NO: 1) shown in FIGS.
Or the coding sequence of the deposited clone
With coding sequences that are allelic variants
Is also good. As is known in the art, allelic
Offspring variants substantially alter the function of the encoded polypeptide.
One or more nucleotide substitutions, deletions or
Is an alternative polynucleotide sequence that may have additional
You. [0034] The present invention relates to the coding of the above-mentioned mature polypeptide.
Expression and secretion of polypeptides by host cells
A polynucleotide sequence (eg, a polypeptide)
That function as secretory sequences that regulate the transport of
Sequence) fused to the same reading frame
Also encompasses tides. A polypeptide having a leader sequence
Preprotein, whose leader sequence is
Is cleaved to form the mature form of the polypeptide.
sell. The polynucleotide of the present invention has a 5 ′
Encoding a proprotein with additional amino acid residues
Is also good. Mature protein with prosequence is proprotein
Quality and the inactive form of the protein. That professional
When the sequence is cleaved, the active mature protein remains. Therefore, the polynucleotide of the present invention
Is a mature protein, a protein with a prosequence, or
Tan with both a pro-sequence and a pre-sequence (leader sequence)
Can code for Parkin. The polynucleotide of the present invention comprises the polynucleotide of the present invention.
Inflation occurs in the marker sequence used for peptide purification.
May have coding sequences fused in frame
No. For bacterial hosts, supplied by the pQE-9 vector
Hexahistidine label to be used as a marker sequence
Prepare for purification of the mature polypeptide fused to the marker
Use a mammalian host such as COS-7 cells
For example, if a hemagglutinin (HA) label is
Can be a column. HA label for influenza blood cells
Corresponding to an epitope from the agglutinin protein (Wilso
n, I. et al., Cell, 37: 767 (1984)). The term “gene” refers to a polypeptide chain
Means the division of DNA involved in the production of
Area (leader and trailer) before and after the area
Intervening sequences between the various coding segments (exons)
(Intron). The full-length FGF-15 gene fragment was
To be used as hybridization probes for
From the full-length gene itself,
Other residues with high sequence similarity or similar biological activity
The gene can be isolated. This type of probe
Preferably consists of at least 30 bases, 50 bases
The above may be included. In addition, this probe
CDNA clones, genomic clones,
Are regulatory and promoter regions, exons and intros
Clone containing the complete FGF-15 gene
Can also be used to In one example of screening,
Known DNA sequence for oligonucleotide probe synthesis
By using the coding region of the FGF-15 gene
Is isolated. Has a sequence complementary to the sequence of the gene of the present invention
Using labeled oligonucleotides, human cDNA and genome
Screen DNA or mRNA libraries and
Construction of library for probe hybridization
Determine the prime. Further, the present invention provides that at least 70
%, Preferably at least 90%, more preferably at least
Hybrid to the above sequence if there is also 95% identity
Related to the polynucleotide to be formed. In particular, the present invention
Hybrid form to the above polynucleotides under dense conditions
The resulting polynucleotide. As used herein
The term "stringent conditions" means that at least 95
%, Preferably at least 97% when there is identity
Means that hybridization occurs. Preferred
In another embodiment, a hybrid to the above-described polynucleotide
The polynucleotide to be formed is the cDNA shown in FIGS.
No. 1) or the mature polyencoded by the deposited cDNA
Retains substantially the same biological function or activity as the peptide
Encodes a polypeptide. [0040] The above-mentioned polynucleotide is as described above.
As described above, hybridization to the polynucleotide of the present invention
And has identity to the polynucleotide
(Activity may or may not be retained), at least
Also 20 bases, preferably 30 bases, more preferably at least
May also contain 50 bases. Such polynucleotides
Refers to, for example, the polynucleotide of SEQ ID NO: 1.
As a probe (eg, for polynucleotide recovery)
As a diagnostic probe or as a PCR primer
Can be used. Accordingly, the present invention provides
Less for polynucleotides encoding peptides
Both 70% identity, preferably at least 90% identity,
More preferably a polynucle with at least 95% identity
Reotide, and at least 30 bases, preferably at least
A fragment consisting of 50 bases, as well as
The present invention relates to polypeptides encoded by leotide. The deposit referred to in this specification may be
Budapest Treaty on International Recognition of Deposits of Microorganisms
Will be maintained based on. These deposits are, for convenience,
It is only provided and is required by 35 U.SC §112.
I do not admit that it is a deposit. Included in the deposit
The sequence of the polynucleotide and the
The amino acid sequence of the polypeptide
Of the sequence described in the present specification.
If it contradicts, this becomes dominant. The above deposit
Consent may be required to manufacture, use or sell,
This specification does not give such a consent. Further, the present invention relates to the deduced amino acids shown in FIGS.
A polypeptide having the sequence (SEQ ID NO: 2) or the deposited cDN
Polypeptide having the amino acid sequence encoded by A
And fragments, analogs and derivatives of such polypeptides.
For conductors. The polypeptide (SEQ ID NO: 2) of FIGS.
Is related to the polypeptide encoded by the deposited cDNA.
When referring to "fragments", "derivatives" and "analogs"
These terms are essentially the same as the polypeptide
Polypeptide that retains a functional function or activity. And
Therefore, analogs may be affected by cleavage of the proprotein part.
That can be activated to produce an active mature polypeptide
Roprotein. The polypeptide of the present invention is a recombinant polypeptide.
Pride, natural and synthetic polypeptides
And a recombinant polypeptide is preferred. The polypeptide of FIGS. 1-2 (SEQ ID NO: 2)
Is a fragment of the polypeptide encoded by the deposited cDNA
The fragment, derivative or analog may comprise (i) one or more amino acids
The acid residue is a conservative or non-conservative amino acid residue (preferably
Conservative amino acid residue) (substitution
Amino acid residues are those encoded by the genetic code
May or may not be)
And (ii) one or more amino acid residues contain a substituent.
Or (iii) mature polypeptide
The peptide is bound to another compound (eg, the polypeptide
Compounds to increase half-life (polyethylene glyco
Or (iv) leader or
Is the secretory sequence, mature polypeptide or proprotein sequence
Additional amino acids, such as sequences used for column purification
May be fused to the mature polypeptide
No. Such fragments, derivatives and analogs are described herein.
From the teachings, it is considered within the skill of the artisan. Polypeptides and Polynucleotides of the Invention
Is preferably provided in an isolated form, and
It is preferably purified to The term "isolated" means that the substance is
Its original environment (for example, if it is a natural product, its natural environment
Means that it is taken out of the border. For example, raw
Naturally occurring polynucleotides or poly
The peptide is not "isolated", but shared in its natural system.
The polynucleus separated from part or all of the existing substance
Reotide or polypeptide is "isolated." That
Such a polynucleotide may be part of a vector,
And / or such a polynucleotide or polypeptide
Such vectors can be used even if the peptide is part of the composition.
Or that the composition is not part of its natural environment.
They are "isolated." The polypeptide of the present invention comprises the polypeptide of SEQ ID NO: 2.
Ripeptide (especially its mature polypeptide) and SEQ ID NO:
At least 70% similarity to the two polypeptides (preferably
Or 70% identity), more preferably the sequence of SEQ ID NO: 2.
At least 90% similarity to the peptide (more preferred
Or 90% identity), more preferably the polypeptide of SEQ ID NO: 2.
At least 95% similarity to the peptide (more
Or 95% identity).
Generally at least 30 amino acids, more preferably
One of the above polypeptides containing at least 50 amino acids
Parts. As is known in the art, two
"Similarity" between two polypeptides
Amino acid sequence and its conservative amino acid substitutions
It is determined by comparing to the sequence of the polypeptide. Fragments or portions of the polypeptides of the present invention
For the production of corresponding full-length polypeptides by peptide synthesis
Can be used. That is, these fragments are
Can be used as an intermediate to produce tide. The present invention
A fragment or portion of a polynucleotide may be a full-length polynucleotide of the present invention.
It can be used for the synthesis of oligonucleotides. The present invention includes the polynucleotide of the present invention.
Vector, host genetically engineered with the vector of the present invention
Production of polypeptides of the invention by cells and recombinant techniques
Related to The host cell is a vector of the present invention, which is
For example, it may be a cloning vector or an expression vector.
Gene manipulation (transduction or
Can be transformed or transfected).
Vectors include, for example, plasmids, viral particles,
It can take the form of a dice. The engineered host cells are
Activation of motor, selection of transformants or the present invention
Culture in a conventional nutrient medium modified for gene amplification
Can be nourished. Culture conditions such as temperature and pH
Under conditions previously used for the selected host cell
Yes, and will be apparent to those skilled in the art. The polynucleotide of the present invention can be obtained by a recombinant technique.
Can be used to produce polypeptides. And
Thus, for example, the polynucleotide sequence may vary.
Expression vehicle (specifically, expressing the polypeptide)
Vector or plasmid)
Can be taken. Such vectors include chromosomes
DNA sequences, non-chromosomal DNA sequences and synthetic DNA sequences, such as SV4
0 derivative, bacterial plasmid, phage DNA, yeast plasmid
Derived from a combination of smid, plasmid and phage DNA
Vector, viral DNA (eg, vaccinia,
Virus, fowlpox virus, pseudorabies virus)
Is mentioned. However, other vectors or plasmids
Is replicable and viable in its host
Can be used as long as it is capable. An appropriate DNA sequence can be identified by various techniques.
Can be inserted into the Generally, as known in the art,
Technique to provide appropriate restriction endonuclease sites.
Insert the DNA sequence. Such techniques and others are known to those skilled in the art.
It is considered to be included in the technical range. The DNA sequence in the expression vector
Operable with appropriate expression control sequence (promoter)
Noh is linked. Representative examples of such promoters
LTR or SV40 promoter, E. coli lac or trp,
Phage lambda P _L Promoter, prokaryotic, eukaryotic
Controls gene expression in cells or their viruses
List other promoters known to
be able to. The expression vector is a ribosomal for translation initiation.
Also contains a binding site and a terminator
You. Vectors also contain sequences suitable for amplifying expression.
Is also good. In addition, the expression vector may contain the transformed host cells.
Genetics to confer phenotypic features that can be used for vesicle selection
Offspring (eg neomycin resistance or dihydrogen for eukaryotic cell culture)
Lofolate reductase, tetracycline in Escherichia coli
Resistance, ampicillin resistance, etc.)
No. A suitable DNA sequence as described above and a suitable promoter
Or a vector containing a control sequence and an appropriate host.
By using it for transformation,
The protein can be expressed. Representative examples of suitable hosts
Escherichia coli, Streptomyces, Salmonella typhimurium
Bacterial cells such as yeast, fungal cells such as yeast, yellow ginger
Insect cells such as Drosophila S2 and Spodoptera Sf9, CHO, C
Animal cells such as OS or Bose melanoma, adenovirus,
Plant cells and the like can be mentioned. Choosing the right host
Is within the skill of the artisan from the teachings herein.
it is conceivable that. More specifically, the present invention is broadly described.
Recombinant constructs containing one or more of the well-described sequences.
Also included. In these constructs, the sequence of the invention is
Or, a vector inserted in the reverse direction (such as a plasmid or
Ills vector etc.). Preferred aspects of this embodiment
Now, the construct is further operably linked to the sequence
Contains regulatory sequences (including promoters)
You. Many suitable vectors and promoters are known to those of skill in the art.
And are commercially available. The following vectors are
It is an example. For bacteria: pQE70, pQE60, pQE-9 (Qiagen), p
BS, phagescript, psiX174, pBluescript SK, pBsKS, p
NH8a, pNH16a, pNH18a, pNH46a (Stratagene), pTRC99
A, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmaci
a). For eukaryotic cells: pWLneo, pSV2cat, pOG44, pXT1, pSG
(Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmaci
a). However, other plasmids or vectors
It is replicable and viable in its host
As long as it can be used. The promoter region is CAT (chloramphene).
Nicol transferase) vector and selectable
From the desired gene using another vector
You can choose. Suitable vectors are PKK232-8 and pC
M7. One of the most famous bacterial promoters is lac
I, lacZ, T3, T7, gpt, lambda P _R , P _L And trp
Can be As eukaryotic promoters, CMV immediate early, H
SV thymidine kinase, early and late SV40, retrovirus
LTR and mouse metallothionein-I. Suitable
Selection of the appropriate vector and promoter is well-known in the art.
It is well contained in the ordinary technical level. As a further aspect, the present invention relates to the above-described structure.
The present invention relates to host cells containing structures. The host cell of the present invention
May be a higher eukaryotic cell, such as a mammalian cell.
Alternatively, it may be a lower eukaryotic cell such as a yeast cell.
Prokaryotic cells such as bacterial cells may also be used. Host details
The introduction of the above-described construct into the vesicle is carried out by calcium phosphate trans.
Transfection, DEAE-dextran mediated transfection
Or electroporation
(Davis, L., Dibner, M. Battey, I., Basic Method
s in Molecular Biology (1986)). The construct in the host cell is used conventionally.
Encoded by its recombination sequence
Gene products can be produced. Alternatively,
Synthesize and produce light polypeptides using a conventional peptide synthesizer
You can also. [0062] The mature protein is
Controlled release in mammalian cells, yeast, bacteria and other cells
Can be manifested. Obtained from the DNA construct of the present invention.
Cell-free production of the above proteins using RNA
A translation system can also be used. For use in prokaryotic and eukaryotic hosts
Suitable cloning and expression vectors are available from Sambro
ok et al., Molecular Cloning: A Laboratory Manual (Part 2
Edition, Cold Spring Harbor, NY (198
9)), the disclosure of which is
Form a part of the specification. The DNA encoding the polypeptide of the present invention
Transcription by higher eukaryotes is enhanced by the vector
-Increased by inserting sequences. Enhancer
Is a cis-acting element of DNA, usually 10-300 bp.
Act on the promoter to increase its transcription. Duplicate
SV40 enhancer on the late side (100-270bp) of origin
ー, cytomegalovirus early promoter enhancer
ー 、 Polyoma enhancer and the late side of the replication origin
And adenovirus enhancers are examples. In general, a recombinant expression vector has a replication origin.
Point, a selectable marker that allows transformation of the host cell.
Carr (for example, E. coli ampicillin resistance gene or sucker)
Romyces cerevisiae TRP1 gene) and downstream structural sequences
Including promoters derived from highly expressed genes that direct transcription
right. Such promoters are, above all,
Glycolytic enzymes such as sphoglycerate kinase (PGK)
Element, α-factor, acid phosphatase or heat shock tan
It can be obtained from operons that encode protein. Different
The species structural sequence includes a translation initiation sequence and a termination sequence, and preferably a translation sequence.
Secretion of translated protein into the periplasmic space or extracellular medium
Position appropriate for the leader sequence that can direct
Assembled in phases. Optionally, the heterologous sequence is expressed and
Desired recombinant products, such as stabilization and convenient purification
N-terminal identification peptide (identification p
eptide). Useful expression vectors for bacterial use are
The structural DNA sequence encoding the protein of interest
Together with the translation initiation and translation termination signals,
Reading phas operable for the motor
e) is constructed by inserting vector
Guarantees the maintenance of the vector and, if desired,
One or more to provide amplification in the host.
Would include the above phenotype selectable marker and origin of replication
U. Suitable prokaryotic hosts for transformation include Escherichia coli and Bacillus subtilis.
Fungi, Salmonella typhimurium, Pseudomonas, strain
Various species belonging to the genus Puttomyces and Staphylococcus
Seeds. However, other hosts are also options.
Can be used. Typical Examples of Expression Vectors Useful for Bacterial Use
As a well-known cloning vector pBR322 (ATCC 3
7017) Selection from commercial plasmids containing genetic elements
List those containing selectable markers and bacterial origin of replication
(But not limited to).
Such commercially available vectors include, for example, pKK223-3 (Ph
armacia Fine Chemicals, Uppsala, Sweden) and
GEM1 (Promega Biotec., Madiso, Wisconsin, USA
N). These pBR322 “skeleton” parts are
The appropriate promoter and the structural sequence and set to be expressed
Combine. A suitable host strain is transformed and the host strain is
After growing to the appropriate cell density,
-By appropriate means (eg temperature change or chemical induction)
Release suppression and culture the cells further. Typically, cells are collected by centrifugation
Crushed by physical or chemical means.
The extract is reserved for further purification. Microbial cells used for protein expression
Is a freeze-thaw cycle, sonication, mechanical disruption or
Break down in any convenient way, such as using a cell lysing agent.
Can be broken. For expression of the recombinant protein, various mammalian
Cell-like culture systems can also be used. Examples of mammalian expression systems
Is the monkey kidney fiber described in Gluzman, Cell, 23: 175 (1981).
Expression of COS-7 system of fibroblasts and compatible vector
Other cell lines (eg C127, 3T3, CHO, HeLa
And BHK cell lines). Mammalian expression vectors
Should include an origin of replication, an appropriate promoter and enhancer.
Polyadenyl, an additional, essential ribosome binding site
Site, splice donor and splice acceptor,
It will also include the transcription termination sequence and the 5 'flanking non-transcribed sequence. necessary
SV40 viral genomics
DNA sequence (eg, SV40 origin, early promoter)
Ter, enhancer, splice site and polyadenyl
Site). The polypeptide of the present invention comprises ammonium sulfate
Or ethanol precipitation, acid extraction, anions or cations
Exchange chromatography, phosphocellulose chromatography
Raffy, hydrophobic interaction chromatography, affinity
Tea chromatography, hydroxyapatite chromatography
Including mattography and lectin chromatography
Recovered and purified from recombinant cell culture by conventional methods
Wear. If necessary, to complete the configuration of the mature protein,
A protein regeneration step may be used. Finally, finally
High performance liquid chromatography (HP)
LC) can be used. The polypeptide of the present invention is a natural purified product
Or a product of a chemical synthesis method.
And prokaryotic or eukaryotic hosts (eg,
For example, cultured bacterial cells, yeast cells, higher plant cells,
Insect cells and mammalian cells).
You may. Depending on the host used for the recombinant production method,
Light polypeptides are found in mammals and other eukaryotic carbohydrates.
May be lysosylated or not glycosylated
Sometimes. The polypeptide of the invention may comprise an initiator methionine.
It may include amino acid residues. The polypeptide of the present invention can be used for vascular endothelial cell formation.
Because it can stimulate the length, various disease states (eg,
Ischemia due to thrombosis, arteriosclerosis, and other cardiovascular diseases)
It can be used in procedures to stimulate revascularization of knowledge. this
These polypeptides are also used to stimulate angiogenesis and limb regeneration.
Can be used. The polypeptide of the present invention is useful for injuries, burns,
Can also be used for later tissue repair and ulcer wound treatment
You. This is because the polypeptide of the present invention has a different origin.
For various cells (eg fibroblasts and skeletal muscle cells)
Mitogenic and therefore injured tissue or
It promotes the repair or replacement of pathological tissues. The polypeptide of the present invention can be used for neuronal growth.
Stimulation or certain neuronal disorders or neurodegenerative diseases (A
No Ruzheimer's disease, Parkinson's disease and AIDS-related complications
Also used to treat and prevent neuronal damage
Wear. Since FGF-15 has the ability to stimulate chondrocyte growth,
Using them to improve bone and periodontal regeneration,
It can be an aid for grafts. If the polypeptide of the present invention is used,
Sunburn by stimulating the growth of tin-producing cells
It can also prevent skin aging. [0077] FGF-15 polypeptides are also used to prevent hair loss.
Can be used. Because the FGF family members are hair
Activates hair-forming cells and stimulates the growth of melanocytes
Because you do. Similarly, a polypeptide of the present invention can be used in other
Proliferation of hematopoietic cells and bone marrow cells when used in combination with cytokines
And can stimulate differentiation. [0078] The FGF-15 polypeptide maintains the organ before transplantation.
Used to support primary tissue cultures.
Can also be used. The polypeptide of the present invention
It can also be used to induce differentiation of endoderm-derived tissue. According to a further aspect of the present invention, a scientific research
In vitro for research, DNA synthesis, and DNA vector production
The purpose of providing therapeutics and diagnostics for human diseases
And encodes the peptide or the polypeptide
Methods for using the polynucleotides are provided. The present invention relates to a polypeptide for the present invention.
Provided is a method for identifying a scepter. Encodes a receptor
Genes include, for example, ligand pannin
g) and FACS sorting (Coligan et al., Current Protocol
s in Immun., 1 (2), Chapter 5 (1991)).
Can be identified by a number of methods. Preferably,
Cells that respond to the light polypeptide (eg, the FGF family
It is known that it contains multiple receptors for proteins.
NIH3T3 cells and SC-3 cells)
CDNA library prepared from prepared RNA
Into several pools and use them to
Transform COS cells and other cells that do not respond to
Use the expression cloning method of
You. Transfected cells on glass slide
The polypeptide of the present invention which has been grown on and labeled with
Exposed. Polypeptides can be iodinated or site-specific
Incorporation of recognition sites for protein kinases, etc.
Labeling can be performed by various means. After fixing and culturing, slide the slides
Subject to geographic analysis. Identify the positive pool and
Prepared, retransfected, and
Re-screening and re-screening
And, ultimately, a single
Obtain a clone. Another Way to Identify Receptors
As a method, the labeled polypeptide is
Photoaffinity (phot)
o-affinity). PAGE of crosslinked material
Separated by precipitation and exposed to X-ray film. That polype
Cut the labeled complex containing the peptide receptor
Out, split into peptide fragments, and protein microsequencing
Can be used. Amides obtained by microsequencing
Screening of cDNA library using no acid sequence
A set of degenerate oligonucleotide probes to
By measuring, the residual encoding the putative receptor
Identify the gene. [0098] The present invention provides an effect of the polypeptide of the present invention.
Compound screening method to identify compounds that knot
I will provide a. In one example of such an assay, fibroblasts
Mammalian fibroblasts under cell culture conditions in which the cells
Cells, polypeptides of the invention, to be screened
Compounds, and ³ [H] Thymidine is mixed. Screenini
Perform a control assay in the absence of the
Of fibroblast proliferation in the presence of different compounds
If so, in each case ³ Measures [H] thymidine incorporation
Determines whether the compound stimulates growth.
Can be determined. The amount of fibroblast proliferation was determined by liquid scintillation.
By chromatography ³ [H] Thymidine uptake
It is measured by measuring only This method
Agonist (agonist) compound and antagonist (antagonist)
Both anti-drug compounds can be identified. As another method, the polypep of the present invention
Mammalian cells or membranes that express receptors for tide
The preparation is prepared in the presence of the test compound in the presence of the labeled
Incubate with peptide. That way, the compound
The ability to increase or block the interaction of
Will be able to Alternatively, screening
After the interaction of the compound with the FGF-15 receptor,
2 Measure the response of the messenger system and
Receptor binding ability and second messenger response induction
The ability of the compound to measure potential agonists
Or an antagonist. this
Such a second messenger system includes cAMP guanylate
Cyclase, ion channel or phosphoinositide
Such as, but not limited to, water splitting.
No. Examples of antagonist compounds include the compounds of the present invention.
Binds to the receptor of the polypeptide but is a second messenger
-Does not induce a response or binds to FGF-15 polypeptide itself
Antibodies or (optionally) oligopeptides
You. It also binds to its receptor,
Does not induce a jar response.
Mutant polypeptides that effectively block
May be a local antagonist. [0087] The FGF-15 gene and gene product
One antagonist compound uses antisense technology
This is an antisense construct created. Antisen
Technology uses antisense DNA or RNA or triple helix
These methods can be used to control gene expression by formation.
Are both involved in binding polynucleotides to DNA or RNA.
Based on. For example, a mature polypeptide of the invention
Encoding the 5 'coding portion of the polynucleotide sequence
Using antisense RNA oligonucleotides of about 10-40 base pairs in length.
Design cleides. DNA oligonucleotides are
Designed to be complementary to the region of the gene involved in transcription
(Triple helix-Lee et al., Nucl. Acids. Res., 6:
3073 (1979); Cooney et al., Science, 241: 456 (1988);
Dervan et al., Science, 251: 1360 (1991)).
Interfering with transcription and production of the polypeptide. Antisense
RNA oligonucleotides hybridize to mRNA in vivo
The translation of the mRNA molecule into a polypeptide of the invention.
Block (antisense-Okano, J. Neurochem., 56: 5
60 (1991); Oligodeoxynucleotides as AntisenseInhi
bitors of Gene Expression, CRC Press, Bo, Florida
Karaton (1988)). Antisense RNA or DNA
Can be expressed in vivo to inhibit polypeptide production
Delivering the above-described oligonucleotide to cells
You can also. [0088] Potential antagonist compounds include receptor
Binds to the binding site of the receptor, occupies that site, and
By bringing the protein closer to the polypeptide.
And small molecules that interfere with normal biological activity. That
Examples of such small molecules include small peptides or small peptides.
Include, but are not limited to, tide-like molecules
Absent. Antagonist compounds include neoplastic cells and
Cell growth and proliferation effects of the polypeptide of the present invention on tissues
To inhibit the outcome (ie, stimulation of tumor angiogenesis)
More abnormal cells, eg, in tumor formation or growth
Can be used to slow or prevent growth and proliferation. The above-mentioned antagonists are useful for treating hypervascular diseases.
Epithelial lens for prevention and after extracapsular cataract surgery
It can also be used to prevent vesicle growth. The present invention
Prevention of the mitogenic activity of the peptide after balloon angioplasty
It may be desirable in cases such as restenosis of the stomach. The above antagonists may be used for scars during wound healing.
It can also be used to prevent organizational growth. [0092] The above-mentioned antagonists can be used
It can be used as a composition comprising a pharmaceutically acceptable carrier. The polypeptides, agonists and agonists of the present invention
In combination with an appropriate pharmaceutical carrier, the
It can be a pharmaceutical composition for oral administration. Such pairs
The composition is a therapeutically effective amount of the peptide, agonist or agonist.
Antagonist and a pharmaceutically acceptable carrier or excipient
It contains. Such carriers include saline, buffered salt
Water, dextrose, water, glycerol, ethanol and
And combinations thereof, but are not limited to
Not necessarily. The formulation should be compatible with the mode of administration.
You. The present invention relates to one or more of the pharmaceutical compositions of the present invention.
Consists of one or more containers filled with the above ingredients
A pharmaceutical pack or kit is also provided. In such a container
Regulates the manufacture, use or sale of pharmaceuticals or biological products.
For human administration in a format prescribed by regulatory agencies
Reflect the agency's authorization to manufacture, use, or sell
Information can be attached. Furthermore, the polypep of the present invention
Peptides, agonists and antagonists can be used in other therapeutic compounds.
It may be used in combination with a product. The above pharmaceutical composition can be administered orally, topically,
Intravenous, intraperitoneal, intramuscular, subcutaneous, nostrils
Can be administered by any convenient method, such as intra- or intradermal routes
You. The pharmaceutical composition may be used to treat certain indications and / or
It is administered in a prophylactically effective amount. Generally, at least
Administered in an amount of about 10 mg / kg body weight, most often about 8 mg
/ kg body weight / day will not be administered. Almost
In this case, the daily dose should be about
10 mg / kg to about 1 mg / kg body weight, 1 cm ² About 0.1 μg per
Preferably, a dose of up to 9 mg is administered. The polypeptide of the present invention and a polypeptide
Certain agonist and antagonist compounds are useful in the present invention.
Therefore, when used, it should be
It can also be done by expressing the peptide. This is often
Often called "gene therapy". Thus, for example, cells can be transferred in vitro
A polynucleotide encoding a polypeptide (DNA or R
NA) and the patient to be treated with the polypeptide
Can be given the manipulated cells. This
Such methods are well known in the art. For example,
Leto containing RNA encoding the polypeptide of the present invention
Techniques known in the art using virus particles
Can manipulate the cells. Further, the polypeptide is expressed in vivo.
For example, by techniques known in the art,
Cells can also be manipulated in vivo. Cells in vivo
Manipulation and expression of polypeptides in vivo
As is known in the art, the polypeptides of the invention
Produces Retroviral Particles Containing RNA Encoding
The production cells may be administered to the patient. Like that
And other administration methods of the polypeptide of the present invention by simple methods
Should be apparent to those skilled in the art from the teachings of the present invention.
You. For example, expression vehicles for manipulating cells are suitable.
Manipulate cells in vivo when combined with the right delivery vehicle
Retroviruses, such as adenoviruses that can be used to
Other than the loose particles may be used. The above retroviral plasmid vector
Moloney is a retrovirus that can be a source of
Murine leukemia virus, spleen necrosis virus, retrovirus
Lus, for example, Rous sarcoma virus, Harvey sarcoma ui
Ruth, avian leukemia virus, gibbon leukemia virus
Virus, human immunodeficiency virus, adenovirus, spinal cord increase
Reproductive sarcoma virus and breast cancer virus.
It is not limited to these. In one embodiment, retro
Ills plasmid vector for Moloney murine leukemia
Derived from Luz. The vector may contain one or more promoters.
including. Suitable promoters that can be used include
Rovirus LTR, SV40 promoter, Miller et al., Biotech
niques, Vol. 7, No. 9, 980-990 (1989)
Itomegalovirus (CMV) promoter and other options
Promoters (eg histone promoter, pol II
I promoter, β-actin promoter (however
Such as eukaryotic cell promoters
Vesicular promoter), but are not limited to
Do not mean. Other virus promoters you can use
-Adenovirus promoter, thymidine
Nase (TK) promoter and B19 parvovirus pro
Motors, but not limited to
No. The selection of an appropriate promoter depends on the teachings herein.
Will be apparent to those skilled in the art. Nucleic acid sequence encoding the polypeptide of the present invention
The rows are under the control of a suitable promoter. Can be used
Suitable promoters include adenovirus promoters.
(Such as adenovirus major late promoter)
Seed promoter (cytomegalovirus (CMV) promoter
Respiratory syncytial virus (RSV) promoter
Promoter, inducible promoter (MMT promoter or metallo
Thionein promoter), heat shock promoter
ー, albumin promoter, ApoAI promoter, human
Toglobin promoter, viral thymidine kinase
Promoter (herpes simplex thymidine kinase promoter)
), Retrovirus LTR (modified retrovirus described above)
Lus LTR), β-actin promoter, human growth
Hormone promoters, but only
Not only. The promoter cooperates with the polypeptide of the present invention.
A natural promoter that controls the gene
Is also good. The above retroviral plasmid vector was
To transduce packaging cells
To create a production cell line. Transfectable
Examples of packaging cells include Miller, Human Ge
ne Therapy, Volume 1, pages 5-14 (1990) (of this publication
The contents are incorporated by reference into this specification)
DAN, PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, V
T-19-17-H2, ψCRE, ψCRIP, GP + E-86 and GP + envAm12
Cell system, but is not limited to these. Baek
The packager can be packaged by any means known in the art.
Zing cells can be transduced. As such means
Include electroporation, the use of liposomes and
Calcium carbonate precipitation method, but not limited to these.
Not only. Alternatively, retrovirus programs
Enclose the rasmid vector in liposomes, or
After coupling, it may be administered to a host. The above-mentioned production cell line contains the polypeptide of the present invention.
Infectious retroviral vector containing the encoding nucleic acid sequence
-Generate particles. Such retroviral vectors
Particles can be used to transduce eukaryotic cells in vitro or in vivo.
Can be used. The transduced eukaryotic cell is a polypeptide of the present invention.
The nucleic acid sequence encoding the peptide will be expressed. Trait
Eukaryotic cells that can be introduced include embryonic stem cells, embryonic cancer cells,
Blood stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes
Adult cells, endothelial cells and bronchial epithelial cells,
However, it is not limited to these. The present invention encodes the polypeptide of the present invention.
A disease associated with the presence of a mutation in the nucleic acid sequence
A diagnostic assay to detect susceptibility to the disease
Related to the use of the gene of the present invention as part of
I do. An individual having a mutation in the gene of the present invention
It can be detected at the DNA level by various techniques. Diagnostic
Nucleic acids include blood, urine, saliva, tissue biopsy and autopsy.
Can be obtained from the cells of a patient. Genomic DNA is analyzed
Can be used directly for PCR, or use PCR prior to analysis.
And enzymatic amplification (Saiki et al., Nautre, 324: 1
63-166 (1986)). RNA and cDNA can be used for the same purpose
You. For example, a nucleic acid encoding the polypeptide of the present invention
Identify mutations using complementary PCR primers
And analyze. For example, deletions and insertions
The size of the product differs from the normal genotype
Can be detected. Point mutations can be caused by radiolabeled RNA sequences
Is the radiolabeled antisense DNA sequence and the amplified DNA
Can be identified by hybridization. Complete
Completely matched sequences are those for RNase A digestion or melting temperature.
Differences can be used to identify mismatched double-stranded molecules.
Can be. Genetic testing based on DNA sequence differences
DNA fragments in gels with (or without) sexual agents
Achieved by detecting changes in electrophoretic mobility
it can. Small sequence deletions and insertions can be achieved by high resolution gel electrolysis.
It can be visualized by electrophoresis. DNA fragments with different sequences
It can be identified on a denaturing formamide gradient gel. In this case,
The mobility of DNA fragments is determined by their melting temperatures or fractions.
Is slowed down at different locations in the gel according to the specific melting temperature
(See, eg, Myers et al., Science, 230: 1242 (1985).
thing). Sequence changes at specific positions may be
Cleavage methods and nuclease protection such as RNase and S1 protection
(See, for example, Cotton et al., PNAS, US
A, 85: 4397-4401 (1985)). Therefore, detection of a specific DNA sequence is
Hybridization, RNase protection, chemical cleavage, direct DNA sequencing
Determination, or the use of restriction enzymes (eg, restriction
Restriction Fragment Length Polymorphi
sms; RFLP)) and for Southern blotting of genomic DNA
Thus it can be achieved. More conventional gel electrophoresis and DNA sequencing
In addition, in situ analysis can detect mutations.
Can be. The present invention also relates to FGF-
Diagnostic assays to detect changes in levels of 15 polypeptides
Related to Lee. Compared to a normal control tissue sample,
Excessive protein expression can indicate abnormal cell growth
(Eg, a tumor). From the host
Assay for detecting protein levels in the obtained sample
Lee is well known to those skilled in the art and
Say, competitive binding assay, western blot analysis, EL
ISA assays and “sandwich” assays
You. ELISA assays (Coligan et al., Current Protocols in
Immunology, 1 (2), Chapter 6 (1991))
Antibodies specific to the antigen of the light polypeptide (preferably
Clonal antibody). Furthermore, its monochrome
Prepare a reporter antibody against the null antibody. Reporter
-Antibodies include detectable reagents (such as radioactivity or fluorescence)
Example of binding horseradish peroxidase enzyme)
You. Next, a sample is taken from the host, and the
On a solid support (eg, a polystyrene dish) that binds the substrate
Incubate with Next, non-specific proteins (C
With serum albumin)
Cover all free protein binding sites on the dish.
U. Next, the monoclonal antibody was ink-injected in the dish.
Lab. During this time, monoclonal antibodies are
Binding to all of the polypeptides of the invention bound to the styrene dish
Combine. Wash off unbound monoclonal antibody with buffer
You. Next, liposome bound to horseradish peroxidase
Protein antibody in the dish and bind to the protein of interest.
The reporter antibody is bound to the monoclonal antibody. Next, the unbound reporter antibody is washed away.
You. Next, a peroxidase substrate is added to the dish and
By comparing the amount of color developed during the period of
Determination of the amount of polypeptide present in a fixed volume of patient sample
A constant value is obtained. When using a competition assay, the invention
An antibody specific for the polypeptide is bound to a solid support.
Next, labeled FGF-13 and a sample obtained from the host were
Through the support, for example liquid scintillation chromatography
The amount of label detected by laffy etc.
Of the polypeptide of the present invention. The "sandwich" assay is an ELISA
Similar to Say. In the “sandwich” assay,
Passing the polypeptide of the invention over a solid support;
Bind to the antibody attached to Next, aim for the secondary antibody
To the polypeptide. Next, specific for the secondary antibody
A tertiary antibody which is labeled
Once bound to the secondary antibody, the amount can be quantified.
Can be. The sequence of the present invention is also effective for chromosome identification.
You. The sequences of the present invention may be located at specific locations on individual human chromosomes.
Specifically induced by and hybridize to
Can be. Also, to identify specific sites on the chromosome
Is also what is needed now. Current location
Actual sequence data that can be used to label chromosomal locations
(Repeat polymorphism's) based staining
There are few body labeling reagents. For chromosomes according to the present invention
DNA mapping maps their sequences to disease
This is an important first step in correlating with genes. [0115] Briefly, the sequence was converted from its cDNA to PC
To prepare an R primer (preferably 15 to 25 bp)
Therefore, mapping can be performed for chromosomes. Genomic DNA
Amplification process by straddling more than two exons
Quick selection of primers without complexity
Uses computer analysis of the 3 'untranslated region. Next
Of somatic cell hybrids containing individual human chromosomes
These primers are used for PCR screening.
A hive containing the human gene corresponding to the primer
Only the lid will generate an amplified fragment. The PCR mapping of somatic cell hybrids
A quick way to assign specific DNA to specific chromosomes
You. Using the present invention with the same oligonucleotide primer
Then, in a similar way, the fragment
Pool of cells or large genomic clones
Sub-localization can be achieved. On the chromosome
Other mapping methods that can be used for mapping to
Include in situ hybridization, chromosome specific
Hybridization for Construction of Dynamic cDNA Library
Pre-selection and label flow sorting (labeled flow-sor)
ted) Preliminary screening by chromosome. Fluorescence of cDNA clones against metaphase chromosomes
Using one-stage hybridization (FISH)
The exact chromosome location can be obtained at the floor. This technology
A cDNA of about 50 or 60 bases can also be used. Overview of this technology
In summary, see Verma et al., Human Chromosomes: a Manual
of Basic Techniques, Pergamon Press, New York
(1988). Sequences mapped to exact chromosomal locations
The genetic location of the sequence on the chromosome
Data can be correlated. Such data is
For example, V. McKusick, Mendelian Inheritance in Man
(Johns Hopkins University Welch Medical Rye
(Available online from Bally).
Next, diseases and genes mapped to the same chromosomal region
Relationship analysis (linkage analysis)
(Simultaneous inheritance of the genes to be performed) Next, between the patient and the non-patient, the cDNA or
It is necessary to determine genomic sequence differences. A mutation
Is observed in some or all of the patients and in normal individuals
If not observed, the mutation is the causative agent of the disease.
Might be. Physical mapping technology and gene mapping
At the current resolution of the technology, the chromosomal regions involved in the disease
The exact location of the cDNA in the region is 50-500
One of the potential causative factors (1 megabase
Ping resolution and one gene per 20 kb). The polypeptides of the present invention, fragments thereof and other derivatives
Conductors, their analogs, or cells that express them
As an immunogen to produce antibodies against them
Can be used. These antibodies are, for example, polyclonal antibodies.
It can be a body or a monoclonal antibody. The invention relates to chimeras
Antibodies, single-chain antibodies, humanized antibodies and Fab fragments or Fab expression
Also includes the products of the library. Such antibodies and
Fragments are produced using various methods known in the art.
Can be used. For polypeptides corresponding to the sequences of the present invention,
Antibodies (preferably non-human animals)
Direct injection or administration of the polypeptide to
Therefore, it can be obtained. The antibodies so obtained are
Will bind to the polypeptide itself. using this method
Uses sequences that encode only fragments of that peptide.
To generate an antibody that binds the all-natural polypeptide
You can also. Such an antibody may comprise the polypeptide
To isolate the polypeptide from tissues that express
Can be used for For the production of monoclonal antibodies, continuous serial
Any technique that provides antibodies produced by cell culture
You can use art. Examples include hybridoma technology
(Kohler and Milstein, 1975, Nature, 256: 495-49
7), trioma technology, human B cell hybrid
Technology (Kozbor et al., 1983, Immunology Today 4:72)
And EBV high to produce human monoclonal antibodies
Bridoma technology (Cole et al., 1985, Monoclonal Antibodie
s and Cancer Therapy, Alan R. Liss, Inc., 77-96
Page). Techniques Described for the Production of Single Chain Antibodies
(U.S. Pat. No. 4,946,778) describes an immunogenic polypeptide of the invention.
Adapted for the production of single-chain antibodies to tide products
it can. In addition, using the transgenic mouse,
Expressing anthropomorphic antibodies to a protogenic polypeptide product
You can also. The present invention will be further described with reference to the following examples.
explain. However, the present invention is limited to these Examples.
It should be understood that there is no. Unless specified otherwise,
All amounts are based on weight. To facilitate understanding of the following examples,
Describe some methods and / or terms used for
Good. “Plasmids” are indicated by a lower case “p” and before and after the lower case “p”.
Specified in uppercase letters and / or numbers. In this specification
Starting plasmids are commercially available or publicly available without restriction
Published from available or available plasmids
It can be built according to the method. Furthermore, in the technical field
Is a plasmid equivalent to the plasmid described herein.
Are known and will be apparent to those skilled in the art. “Digestion” of DNA refers to specific arrangements in the DNA.
Refers to catalytic cleavage of DNA by a restriction enzyme that acts only on the
To taste. The various restriction enzymes used herein are commercially available.
The reaction conditions, cofactors and other requirements
Was used as would be known to those skilled in the art. Minute
For analysis, 1 μg of plasmid or DNA fragment is usually
Used in about 20 μl of buffer solution. plus
When isolating DNA fragments for construction of the mid
5 to 50 μg of DNA in a critical volume with 20 to 250 units of enzyme
Become Suitable amounts of buffer and substrate for a particular restriction enzyme
Specified by the manufacturer. Usually at 37 ° C for about 1 hour
Use the incubation time, which is
Can be changed as indicated. After digestion, the reaction
Direct electrophoresis on polyacrylamide gel
Isolate the pieces. Goeddel,
8 described in D. et al., Nucleic Acids Res., 8: 4057 (1980).
Perform using a% polyacrylamide gel. “Oligonucleotide” is a chemical compound.
A single-stranded polydeoxynucleotide or two phases
Means a complementary polydeoxynucleotide chain. Like that
No synthetic oligonucleotides have a 5 'phosphate group
Does not add a phosphate group with ATP in the presence of kinase
Will not ligate to another oligonucleotide
U. Synthetic oligonucleotides are not dephosphorylated
Will be linked to the new fragment. "Ligation" is defined as the connection between two double-stranded nucleic acid fragments.
Refers to the step of forming a phosphodiester bond (Maniat
is, T. et al., ibid., p. 146). Consolidated unless otherwise noted
Is likely to be ligated using known buffers and conditions.
10 units of T4 DNA ligase per 0.5 μg of equimolar DNA fragment
(“Ligase”). Unless otherwise stated, transformation was performed according to Graham,
F. and Van der Eb, A., Virology, 52: 456-457 (1973)
Was performed in the following manner. EXAMPLES Example 1 Bacterial Expression of FGF-15 Protein and Purification The DNA sequence encoding FGF-15 (ATCC No. 97146) was
No processed protein (signal peptide
5 'sequence (lacking the sequence) and the vector on the 3' side of the gene
-PCR oligonucleotide primers corresponding to the sequence
To amplify. Additional nucleons corresponding to the gene
A tide is added to the 5 'and 3' sequences. 5 'oligonucus
Reotide primer is 5 'GCCAGA CCATGG TAAAACCG GT
It has the sequence GCCCCTC3 '(SEQ ID NO: 3) and is an NcoI restriction enzyme.
Contains elementary sites (bold). 3 'sequence (5' GGCAGG AG
ATCT TGTTGTCTTACTCTTGTTGAC 3 ′; SEQ ID NO: 4) is BglI
Contains a sequence complementary to the I site (bold), followed by
Followed by 21 nucleotides of the FGF-15 coding sequence
I have. These restriction enzyme sites are compatible with bacterial expression vectors.
-PQE60 (Quiagen, Inc., Cha, California, 91311)
(Wattsworth). pQE-60 is anti-
Biomaterial resistance (Amp ^r ), Bacterial origin of replication (ori), IPTG
Controllable promoter operator (P / O), Riboso
Site binding site (RBS), 6-His label and restriction enzyme site
To load. Next, pQE-60 was digested with NcoI and BglII. Increase
The width sequence was ligated into pQE-60, histidine-labeled and
Insert it in frame with the ribosome binding site (RBS). Next
Using the ligation mixture, Sambrook, J. et al., Molecu
lar Cloning: ALaboratory Manual, Cold Harbor Labor
E. coli M15 / rep4 by the method described in atory Press (1989).
Transform the strain (Qiagen, Inc.). M15 / rep4 is lacI
Expresses a suppressor and has kanamycin resistance (Kan ^r )
Contains multiple copies of plasmid pREP4. L
Transform by their ability to grow on B plates
Identify body, ampicillin / kanamycin resistant colonies
Select Isolate plasmid DNA and perform restriction analysis.
Check it. Clones containing the desired construct
Supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml)
Culture overnight (O / N) in the LB liquid medium. O / N culture
The inoculation is inoculated into a large culture at a ratio of 1: 100 to 1: 250.
Optical density 600 (OD ⁶⁰⁰ Until the cell is 0.4-0.6
To grow. Next, IPTG (“Isopropyl-β-D-thioga
Lactopyranoside ") to a final concentration of 1 mM
You. IPTG, by inactivating the lacI repressor,
Cleans P / O and induces increased gene expression. cell
Grow for an additional 3-4 hours. Next, centrifuge to
Collect the vesicles. Cell pellet with chaotropic reagent 6M salt
Solubilize in guanidine acid. After cleaning, this solution
Tight binding by proteins containing 6-His label
Chromatography on a nickel-chelate column
Purify solubilized FGF-15 by chromatography
(Hochuli, E. et al., J. Chromatography 411: 177-184 (19
84)). Is the protein on a column with 6M guanidine hydrochloride pH 5.0?
3M guanidine hydrochloride, 100 mM for regeneration
Sodium phosphate, 10mM glutathione (reduced) and 2m
Adjust to M-glutathione (oxidized form). 12:00 this solution
After incubation for 10 minutes, the protein is
Dialyze against lium. Example 2 Cloning of FGF-15 Using Baculovirus Expression System and
DNA sequence encoding the expressed full-length FGF-15 protein (ATCC N
o. 97146) is replaced by the PC corresponding to the 5 'and 3' sequences of the gene.
Amplify using R oligonucleotide primers. [0135] The FGF-15 5 'primer was a 5' CTAGT GG.
ATCC GCCATCATGGTAAAACC GGTGCCC 3 '(SEQ ID NO: 5)
Sequence and contains a Bam HI restriction enzyme site (bold)
And, in part, the efficiency of translation initiation in eukaryotic cells.
4 nucleotides similar to a good signal (Kozak, M., J. Mo
l. Biol., 196: 947-950 (1987))
Just after the first 18 nucleotides of the gene
The start codon "ATG" is underlined). The 3 'primer was 5' CGACT GGTACC AGCCACGG
AGCAGGAATGTCT 3 '(SEQ ID NO: 6)
Cleavage site of restriction endonuclease Asp718 (bold part)
And 21 nucleotides complementary to the 3 'untranslated sequence of the above gene
Contains The amplified sequence was prepared using a commercially available kit (“Genecl
ean ", BIO 101 Inc., La Jolla, CA)
And isolated from a 1% agarose gel. Then, the fragment
After digestion with each endonuclease, 1% agarose
Again. This fragment is named F2. Baculovirus expression system (Su
mmers, MD and Smith, GE, 1987, A manual of meth
ods for baculovirus vectors and insect cell cultur
e procedures, Texas Agricultural Experimental Stat
protein by ion Bulletin No. 1555)
For quality expression, the vector pA2 (modified from the pVL941 vector)
Used later). This expression vector is
grapha californica nuclear polyhedrosis virus (AcMNPV)
Powerful polyhedrin promoter and it
Recognition sites for restriction endonucleases BamHI and XbaI following
Containing For efficient polyadenylation,
Uses the simian virus (SV) 40 polyadenylation site
I do. For easy selection of recombinant virus,
The original β-galactosidase gene, polyhedrin
Polyhedrinp preceding the offspring polyadenylation signal
Insert in the same direction as the motor. Of the polyhedrin sequence
At both ends, wild-type transfected
Viral sequences for cell-mediated homologous recombination of ils DNA
Are adjacent. Instead of pA2, pRG1, pAc373, pVL941
And pAcIM1 (Luckow, VA and Summers, MD, Virolog
y, 170: 31-39) and many other baculoviruses
Vectors can also be used. The plasmid was digested with the above restriction enzymes.
Later known in the art using bovine intestinal phosphatase.
Dephosphorylation by the method described below. Next, a commercially available kit ("Ge
neclean ", BIO 101 Inc., La Jolla, CA)
Is used to isolate the DNA from a 1% agarose gel.
This vector is named V2. The fragment F2 and the dephosphorylated plasmid V2 were replaced with T4 DNA
Connect with ligase. Next, transform E. coli DH5α cells.
Bacteria containing the plasmid (pBacFGF-15)
Is identified using each restriction enzyme. Cloned fragment
Is confirmed by DNA sequencing. Lipofection method (Felgner et al., Proc. N
atl. Acad. Sci. USA, 84: 7413-7417 (1987)).
5 μg of plasmid pBacFGF-15 was commercially linearized.
Baculovirus ("BaculoGold ^TM baculovirus DN
A ", Pharmingen, San Diego, CA 1.0
Transfect simultaneously with μg. 1 μg of BaculoGold ^TM 5 μg with viral DNA
Of the above plasmid in a serum-free Grace's medium (Life T
echnologies Inc., Gaithersburg, MD 5
In a sterile well of a microtiter plate containing 0 μl
Mix with. Then, add 10 μl of Lipofectin and Grace
Add 90 μl of medium, mix and incubate at room temperature for 15 minutes.
To Next, 1 ml of Grace's medium without serum
Sf9 insect cells (A
Add the above transfection mixture to TCC CRL 1711).
Drip. Shake the plate back and forth to add the newly added solution
Mix the liquids. Next, incubate the plate at 27 ° C for 5 hours
I do. After 5 hours, plate the transfection solution
Grace Kon, supplemented with 10% fetal bovine serum
Add 1 ml of insect medium. Return the plate to the incubator and culture
Feeding is continued at 27 ° C. for 4 days. After 4 days, the supernatant was collected, and Summers and Smith were collected.
Perform a plaque assay as described (above).
U. Improvements include “Blue Gal” (Life Technologies
Inc., Inc., Gaisersburg)
I do. This facilitates the isolation of blue-stained plaques.
You. For a detailed description of the “plaque assay”, see Life
Technologies Inc. (Gaithersburg)
Users on insect cell culture and baculovirology
It is also found on pages 9-10 of the guide. Four days after serial dilution, the virus was added to the cells.
The blue stained plaque is transferred to an Eppendorf pipette.
Pick up with chips. Next, the cold containing the recombinant virus
Fill the eppendorf tube with 200 μl of Grace's medium.
Resuspend in the tube. Remove agar by short centrifugation
Using the supernatant containing the recombinant baculovirus, 35
Infect Sf9 cells inoculated in mm dishes. 4 days later, these
Collect the culture dish supernatant and store at 4 ° C. Sf9 cells were cultured in cells supplemented with 10% heat-inactivated FBS.
Grow on race medium. Transform the cells into recombinant baculoils
V-FGF-15 at a multiplicity of infection (MOI) of 2. 6 hours
Later, the medium was removed and SF90 lacking methionine and cysteine
0 II medium (Life Technologies Inc., Gaithersburg
H). 42 hours later, 5 μCi ³⁵ S-methionine
And 5μCi ³⁵ Add S-cysteine (Amersham). Fine
Incubate cells for an additional 16 hours and collect by centrifugation
And label the protein with SDS-PAGE and autoradiography.
Visualize with Raffy. Example 4 Expression of recombinant FGF-15 in COS cells 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) large
Intestinal replication origin, 4) CMV promoter followed by polylysine
Anchor region, SV40 intron and polyadenylation site.
Derived from the containing vector pcDNA3 / Amp (Invitrogen)
Expression of plasmid FGF-15-HA. All FGF-15 precursors,
HA label fused to its 3 'end in frame
And the DNA fragment encoding
Cloned into the region. Therefore, the recombinant
Protein expression is controlled by the CMV promoter. HA mark
Knowledge, as already described, influenza hemagglutinin
Corresponding to an epitope derived from the protein (I. Wilso
n, H. Niman, R. Heighten, A. Cherenson, M. Connoll
y and R. Lerner, Cell, 37: 767 (1984)). Target tamper
When HA tag is fused to protein,
The recombinant protein in the body.
You. The plasmid construction method is as follows. FGF-
The following two DNA sequences (ATCC No. 97146)
Constructed by PCR using the primers. 5 'ply
Marker (5 'CTAGT GGATCC GCCATC ATGGTAAAACCGGTGCCC
3 ′; SEQ ID NO: 7) is a BamHI site followed by a start site.
18 nucleotides of the coding sequence starting from the don
contains. 3 'sequence (5' GTCGAC CTCGAGTGTGTGCTTACTCTTG
TT 3 ′; SEQ ID NO: 8) is an XhoI site, a translation stop codon, HA
Last 18 nucleotides of label and FGF-15 coding sequence
Contains a sequence complementary to the sequence (excluding the stop codon)
You. Therefore, the PCR product contains a BamHI site,
Labeling sequence followed by an in-frame fused HA label,
Contains a translation termination stop codon following the HA label, and an XhoI site
I do. The PCR-amplified DNA fragment and the vector pcDNA3 / Amp
Is digested with each restriction enzyme and ligated. In that linked mixture
E. coli SURE strain (Stratagene Cloning Systems, 92037
(Available from La Jolla, California)
The transformed culture is cultured on an ampicillin medium plate.
To select resistant colonies. Transform plasmid DNA
Isolated from the recombinant and the presence of the correct fragment
Find out. To express this recombinant FGF-15, DEAE-
Dextran method (J. Sambrook, E. Fritsch, T. Maniati
s, Molecular Cloning: A Laboratory Manual, Cold Sp
ring Laboratory Press (1989))
Transfect with the above expression vector. FGF-15
-HA protein expression was determined by radiolabeling and immunoprecipitation (E.
Harlow, D. Lane, Antibodies: A Laboratory Manual, C
old Spring Harbor Laboratory Press (1988))
Detected. Two days after transfection, cells
To ³⁵ Label with S-cysteine for 8 hours. Next, the culture medium
And collect the cells with detergent (RIPA buffer (150 mM NaCl,
1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.
5) (Wilson, I. et al., Supra, 37: 767 (198
Four)). Replace both cell lysate and culture medium with HA-specific
Precipitate with clonal antibody. Remove 15 precipitated proteins
Analyze on a% SDS-PAGE gel. In view of the above teachings, the present invention has numerous features.
Can be improved or changed.
In addition to the embodiments described above, the present invention may be practiced within the scope of the appended claims.
can do. [Sequence listing] (1) General information: (i) Applicant: Green et al. (Ii) Title of the invention: Fibroblast growth factor-15 (iii) Number of sequences: 8 (iv) Contact: (A) Address: Carrera, Bahiaan, Bain, Zylphyra
St., Stewart and Olstein (B) Street: Becker Farm Road No. 6 (C) City: Roseland (D) State: New Jersey (E) Country: United States (F) ZIP: 07068 (v) Computer reading / reading ceremony: (A) Medium type: 3.5 inch diskette (B) Computer: IBM PS / 2 compatible (C) Operating system: MS-DOS (D) Software: Word Perfect 5.1 (vi) Data of this application: (A) Application number: (B) Filing date: Submitted at the same time (C) Classification: (vii) Priority claim application data: (A) Application number: 08 / 207,412 (B) Filing date : March 8, 1994 (viii) Patent attorney / agent Information: (A) Name: Ferraro, Gregory D (B) Registration number: 36,134 (C) Reference / Reference number: 325800-268 (ix) Telephone chain Contact information: (A) Phone number: 201-994-1700 (B) Fax number: 201-994-1744 (2) Information of SEQ ID NO: 1 (i) Sequence characteristics: (A) Length: 680 base pairs (B) Type: nucleic acid (C) Number of chains: single-stranded (D) Topology: linear (ii) Sequence type: cDNA (xi) Sequence: SEQ ID NO: 1 ATGGTAAAAC CGGTGCCCCT CTTCAGGAGA ACTGATTTCA AATTATTATT ATGCAACCAC 60 AAGGATCTCT TCTTTCTCAG GGTGTCTAAG CTGCTGGATT GCTTTTCGCC CAAATCAATG 120 TGGTTTCTTT GGAACATTTT CAGCAAAGGA ACGCATATGC TGCAGTGTCT TTGTGGCAAG 180 AGTCTTAAGA AAAACAAGAA CCCAACTGAT CCCCAGCTCA AGGGTATAGT GACCAGGTTA 240 TATTGCAGGC AAGGCTACTA CTTGCAAATG CACCCCGATG GAGCTCTCGA TGGAACCAAG 300 GGTGACAGCA CTAATTCTAC ACTCTTCAAC CTCATACCAG TGGGACTACG TGTTGTTGCC 360 ATCCAGGGAG TGAAAACAGG GTTGTATATA ACCATGAATG GAGAAGGTTA CCTCTACCCA 420 TCAGAACTTT TTACCCCTGA ATGCAAGTTT AAAGAATCTG TTTTTGAAAA TTATTATGTA 480 ATCTACTCAT CCATGTTGTA CAGACAACAG GAATCTGGTA GAGCCTGGTT TTTGGGAT TA 540 AATAAGGAAG GGCAAGCTAT GAAAGGGAAC AGAGTAAAGA AAACCAAACC AGCAGCTCAT 600 TTTCTACCCA AGCCATTGGA AGTTGCCATG TACCGAGAAC CATCTTTGCA TGATGTTGGG 660 GAAACGGTCC CGAAGCCTGG GGTGACCA CAAGTGCGTCAGAGCAAGAGCATCAGAGCAAGAGCAGA 225 amino acids (B) Type: amino acid (C) Number of chains: (D) Topology: linear (ii) Sequence type: protein (xi) Sequence: SEQ ID NO: 2: Met Val Lys Pro Val Pro Leu Phe Arg Arg Thr Asp Phe Lys Leu 5 10 15 Leu Leu Cys Asn His Lys Asp Leu Phe Phe Leu Arg Val Ser Lys 20 25 30 Leu Leu Asp Cys Phe Ser Pro Lys Ser Met Trp Phe Leu Trp Asn 35 40 45 Ile Phe Ser Lys Gly Thr His Met Leu Gln Cys Leu Cys Gly Lys 50 55 60 Ser Leu Lys Lys Asn Lys Asn Pro Thr Asp Pro Gln Leu Lys Gly 65 70 75 Ile Val Thr Arg Leu Tyr Cys Arg Gln Gly Tyr Tyr Leu Gln Met 80 85 90 His Pro Asp Gly Ala Leu Asp Gly Thr Lys Gly Asp Ser Thr Asn 95 100 105 Ser Thr Leu Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Ala 110 115 120 Ile Gln Gly Val Lys Thr Gly Leu Tyr Ile Thr Met Asn Gly Glu 125 130 135 Gly Tyr Leu Tyr Pro Ser Glu Leu Phe Thr Pro Glu Cys Lys Phe 140 145 150 Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val Ile Tyr Ser Ser Met 155 160 165 Leu Tyr Arg Gln Gln Glu Ser Gly Arg Ala Trp Phe Leu Gly Leu 170 175 180 Asn Lys Glu Gly Gln Ala Met Lys Gly Asn Arg Val Lys Lys Thr 185 190 195 Lys Pro Ala Ala His Phe Leu Pro Lys Pro Leu Glu Val Ala Met 200 205 210 Tyr Arg Glu Pro Ser Leu His Asp Val Gly Glu Thr Val Pro Lys 215 220 225 Pro Gly Val Thr Pro Ser Lys Ser Thr Ser Ala Ser Ala Ile Met 230 235 240 Asn Gly Gly Lys Pro Val Asn Lys Ser Lys Thr Thr 245 250 (2) Information of SEQ ID NO: 3 (i) Sequence characteristics: (A) Length: 32 base pairs (B) Type: Nucleic acid (C) Number of strands: Single strand (D) Topology: Linear (ii) Type of sequence: Oligonucleotide (xi) Sequence: SEQ ID NO: 3: GCCAGACCAT GGTAAAACCG GTGCCCCTC 29 (2) SEQ ID NO: 4 Emotion Information: (i) Sequence characteristics: (A) Length: 33 base pairs (B) Type: Nucleic acid (C) Number of chains: single-stranded (D) Topology: linear (ii) Sequence type: oligo Nucleotide (xi) sequence: SEQ ID NO: 4: GGCAGGAGAT CTTGTTGTCT TACTCTTGTT GAC 33 (2) information of SEQ ID NO: 5: (i) sequence characteristics: (A) length: 33 base pairs (B) type: nucleic acid (C) chain Number: single-stranded (D) Topology: linear (ii) Sequence type: oligonucleotide (xi) Sequence: SEQ ID NO: 5: CTAGTGGATC CGCCATCATG GTAAAACCGG TGCCC 35 (2) Information of SEQ ID NO: 6: (i) Sequence Features: (A) Length: 30 base pairs (B) Type: Nucleic acid (C) Number of strands: Single strand (D) Topology: Linear (ii) Sequence type: Oligonucleotide (xi) Sequence: SEQ ID NO: 6: CGACTGGTAC CAGCCACGGA GCAGGAATGT CT 32 (2) Information of SEQ ID NO: 7: (i) Sequence characteristics: (A) Length: 33 base pairs (B) Type: Nucleic acid (C) Number of chains: single strand (D) Topologyー: Linear (ii) Sequence type: Oligonucleotide (xi) Sequence: SEQ ID NO: 7: CTAGTGGATC CGCCATCATG GTAAAACCGG TGCCC 35 (2) Information of SEQ ID NO: 8: (i) Sequence characteristics: (A) Length: 33 base pairs (B) Type: Nucleic acid (C) Number of strands: Single strand (D) Topology: Linear (ii) Sequence type: Oligonucleotide (xi) Sequence: SEQ ID NO: 8: GTCGACCTCG AGTGTGTGCT TACTCTTGTT 30

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 FGF-15 cDNA sequence and corresponding deduced (deduce)
d) It is a figure which shows an amino acid sequence. FIG. 2. cDNA sequence of FGF-15 and corresponding deduced (deduce)
d) It is a figure which shows an amino acid sequence. FIG. 3 shows amino acid sequence homology between FGF-15 and other FGF family members. The conserved amino acids can be easily confirmed. FIG. 4 shows amino acid sequence homology between FGF-15 and other FGF family members. The conserved amino acids can be easily confirmed. FIG. 5 shows amino acid sequence homology between FGF-15 and other FGF family members. The conserved amino acids can be easily confirmed. FIG. 6 shows amino acid sequence homology between FGF-15 and other FGF family members. The conserved amino acids can be easily confirmed.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 17/14 A61P 25/00 17/16 C07K 14/50 25/00 16/22 C07K 14/50 C12P 21 / 02 C 16/22 C12Q 1/68 A C12P 21/02 C12N 15/00 ZNAA C12Q 1/68 A61K 37/24 (72) Inventor John M. Green United States 20878 Diamond Drive, Gay Saarsburg, MD 782 872 Number (72) Inventor Craig A. Rosen United States 20882 Rolling Hill Road, Raytonsville, MD 22400 F Term (Reference) 4B024 AA01 AA11 BA61 CA04 DA02 DA06 EA02 EA04 GA13 HA01 4B063 QA01 QA05 QA18 QQ42 QR32 QS25 QS33 QS34 QX02 QX07 4B064 AG13 AG26 CA02 CA10 CA12 CA19 CC24 CE12 DA01 DA13 4C084 AA02 AA07 AA17 BA01 BA02 BA08 BA22 CA04 CA59 DB54 NA14 ZA012 ZA892 ZA922 4H045 AA10 AA11 AA20 AA30 BA10 CA40 EA20 EA50 FA74 GA26

Claims (1)

[Claims] 1. The invention described in any of the present specification.