JP2003047471A - Modified yeast having excellent secretory production of foreign protein and method for producing foreign protein by using the yeast - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a yeast enabling the secretion and production of a large amount of an objective gene. SOLUTION: The yeast is characterized by the inactivated gene encoding a principal secretory protein. This invention further provides a method for the production of the objective protein by culturing a yeast transformed by an expression vector supporting a DNA encoding the protein and separating the objective protein from the cultured product.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a technique for secretory production of a protein by genetically modified yeast, and more particularly, to the ability to secrete a heterologous protein by inactivating a gene encoding a major secretory protein. It relates to an improved yeast strain, in particular the Candida utilis strain.

[0002] conventional, production of heterologous proteins using gene recombination technology, E. coli (Escherichia coli), budding yeast (Saccharo
myces cerevisiae) and microorganisms such as Bacillus genus, or animal cells, plant cells or insect cells. Proteins derived from various organisms are considered to be targets of production, and many have already been industrially produced using these organisms and used for pharmaceuticals and the like. However, the method using prokaryotes is not always effective for all proteins, and it is not always easy to reproduce complicated post-translational modifications of eukaryote-derived proteins or the same three-dimensional structures as natural bodies.
In addition, Escherichia coli has a unique endotoxin and may become a contaminant of the final product. On the other hand, the method using an animal cell, a plant cell or an insect cell can be expected to have an accurate post-translational modification of a protein derived from a eukaryote, but it is more difficult to handle than a microorganism, it is costly to culture, and the production efficiency is poor. Therefore, if aiming at cheap protein production, the microbial host will inevitably become a strong candidate, and in order to produce a protein derived from eukaryote, yeast, which is a microorganism and a eukaryote, is the most suitable. Considered good.
Yeast is as easy to handle as E. coli, and the culture method has been established and endotoxin is not included. In addition, since yeast has a developed membrane system, it is highly likely that even a protein having a relatively complicated structure will be properly folded after translation by secretory production to exhibit the original physiological activity. Furthermore, it can be said that it is advantageous to undergo sugar chain modification although it is different from an animal cell type sugar chain in the secretory process. Secretory production of a protein is a desirable method because it is easy to purify. Expression systems using various yeasts as hosts have been developed so far (Romanos, MA et al., Yeast 8,
423-488, 1992).

Since secretory production of proteins by yeast has various advantages, some attempts have been made so far for the purpose of more efficient secretory production. Specifically, studies on secretion signals focusing on efficient secretory production, genetic modification of the yeast host itself, and the like have been conducted as targets for studying the efficiency of secretory production. Regarding secretory signals, various naturally-occurring or artificial secretory signal sequences have been acquired or prepared and studied. The structure of a general secretory signal in a secretory protein of yeast is similar to that of the signal most commonly found in other organisms such as E. coli and animal cells, and has a length of about 20 amino acids and N
It has a structure in which a basic amino acid is present near the end and then hydrophobic amino acids are continuous. This signal peptide is cleaved by a signal peptidase, and an amino acid having a small molecular weight is present at the C-terminal serving as a cleavage site. Furthermore, there is also known a protein having a peptide (pro sequence) which is not found in the mature protein on the C-terminal side of the signal peptide but is essential for maturation in the secretory process. It is known that a basic dipeptide, which serves as a recognition sequence for KEX2 protease, exists near the C-terminal of these prosequences and is decomposed in the Golgi apparatus during the secretion process to be separated from the mature protein. As a signal having such a structure, there is a signal of α factor of Saccharomyces cerevisiae (M
Fα1). The α-factor prosequence is not only essential for α-factor maturation, but also important for efficient production in the secretory production of heterologous proteins, and the amount of secretion is extremely reduced only by the signal lacking the pro-sequence. (Chaudhuri, B. et al. Eur. J. Biochem. 206, 793-
800, 1992. Oka, C. et al. Biosci. Biotechnol. Bioc
hem. 63 1977-1983, 1999). Moreover, not only the α factor but also the pro sequence of other secreted proteins are important for secretory production of heterologous proteins, and the signal sequence (pre-sequence)
It has also been reported that a heterologous protein could be produced only by adding a pro sequence to (Park, CS.
Et al. J. Biol. Chem. 272, 6876-6881, 1997).

Attempts to increase the secretion of heterologous proteins by genetically modifying the yeast host have also been reported. A chaperone protein, which is a type of chaperone protein that does not have the correct three-dimensional structure, is used to disrupt the calnekin gene, which is involved in the degradation of the protein. Example (Arima H. et al., FEBS Lett. 440, 89-
92, 1998), which is also a kind of chaperone protein and has a function of forming a BiP protein or disulfide bond, which is said to bind to a protein that does not form a three-dimensional structure and help to pull that protein into the endoplasmic reticulum. An example in which productivity of a heterologous protein is improved by highly expressing a protein disulfide isomerase, which is important for the formation of the three-dimensional structure of the protein in the endoplasmic reticulum (Sh
usta EV et al. Nature Biotechnol. 16, 773-777, 1
998. Robinson AS et al. Bio / Technol. 12, 381-38
4, 1994), an example in which productivity of a heterologous protein is improved by highly expressing Sso protein, which is a protein involved in secretory vesicle transport between Golgi apparatus and cell membrane (Ruohonen L. et al. Yeast 13, 337-351, 1997), etc. have been reported. In addition, it has been reported that the endogenous protease gene of the yeast host is disrupted to suppress the degradation of the translated target protein, thereby increasing the amount of heterologous protein secretion (Kerry-Williams S.
M. et al. Yeast 14 161-169, 1998. CopleyK.S. Et a
Biochem. J. 330, 1333-1340, 1998).

Aiming at efficient production of a heterologous protein in yeast, budding yeast or a methanol-inducible strong promoter which has been widely used in gene recombination technology in yeast can be used and is often used as a host for producing a heterologous protein. In addition to the Pichia pastoris production system, other yeast host systems have been developed, strong transcription promoters for each host have been searched, secretion signals have been investigated, and host breeding has been investigated. Heterologous protein production technology for Candida utilis has already reached the stage of practical use. It has been revealed that many intracellular proteins can be easily produced and are highly useful as expression systems. (Kondo K., et al. Nat
ure Biotechnol. 15, 453-457, 1997. Miura Y. et al.
J. Mol. Microbiol. Biotechnol. 1, 129-134, 199
9). Candida utilis has excellent assimilation ability against plant-derived sugars such as xylose, and does not produce ethanol under aerobic culture conditions, so it is possible to perform high-density continuous culture and has excellent culture characteristics. Therefore, bacterial cell production using biomass-derived sugar sources such as pulp liquor and molasses is being carried out in various parts of the world including Japan. The bacterium is S
It is used as CP (Single Cell Protein) and has been approved for use as a food additive by the US Food and Drug Administration (FDA). Candida utilis is able to grow using sucrose as a single carbon source, and when it is cultured in the medium without the presence of monosaccharides, the expression of invertase, which is an enzyme that decomposes sucrose into glucose and fructose, is induced. To be done. Invertase is a dimeric glycoprotein that exists on the cell surface and is composed of a subunit with a molecular weight of 150 kDa, and it has been reported that the protein excluding the sugar moiety has a molecular weight of 60 kDa (Chavez F.
P. et al., J. Biotechnol. 53, 67-74, 1997). Also, the gene INV1 encoding invertase was cloned and is said to encode a protein consisting of 533 amino acids, but the secretory signal sequence consisting of 26 amino acids at the N-terminus has few hydrophobic amino acids and differs from a general sequence. It has been reported (Chavez F.
P. et al., Yeast 14, 1223-1232, 1998). However, details of regulation of gene expression and its promoter function have not been clarified. For secretory expression of a heterologous gene in Candida utilis, see Saccharomyces diastaticus.
aticus) glucoamylase has been reported to be secreted (Japanese Patent Laid-Open No. 8-173170), but the expression level is low and there is much room for improvement.

[0006]

SUMMARY OF THE INVENTION The present inventors have now developed a yeast capable of producing a large amount of a heterologous gene in Candida utilis, which is one of the yeasts, by inactivating the gene of invertase, which is its major secretory protein. I got it successfully.

[0007] Therefore, an object of the present invention is to provide a yeast capable of secreting and producing a target gene in a larger amount and a method for producing a target protein using such a yeast.

The yeast according to the present invention is characterized in that the gene encoding the major secretory protein is inactivated.

The method for producing a target protein according to the present invention is
The yeast according to the present invention comprises the steps of culturing yeast transformed with an expression vector carrying a DNA encoding a target protein and then collecting the target protein from the culture.

By using the yeast according to the present invention, the target protein can be secreted and produced in large amounts in yeast. Although not bound by the theory below,
This is probably because the expression of the major secretory protein, which is thought to predominantly use the secretory pathway of yeast, was inactivated and the target protein could utilize the secretory pathway instead.

[0011]

DETAILED DESCRIPTION OF THE INVENTION Yeast In the present invention, the “yeast” in which the gene encoding a major secretory protein is inactivated includes yeast belonging to the genus Candida, budding yeast, Shizosaccharomycespombe, S
hizosaccharomyces pombe, yeast of the genus Kluyveromyces, Yarr
owia lipolytica. Preferred examples of yeast belonging to the genus Candida include Candida utilis. Specific strains of Candida utilis include, for example, ATCC 9256 (IFO 062
6), ATCC 9226 (IFO 1086), ATCC
9950 (IFO 0988), IFO 0396, IF
Examples include O0619, IFO 0639 and KP-2059P strains. The three strains, ATCC 9256, ATCC 9226, and ATCC 9950, were each polymorphic (Stoltenburg et. Al. Curr. Genet. 22 441-446 (199
Although 2)) was observed, a transformant could be obtained and a heterologous gene could be expressed in any of them (WO95 / 32289). From this, it will be easily understood by those skilled in the art that the expression vector according to the present invention described below is applicable to all Candida utilis.

Major secretory protein and gene thereof In the present invention, the term "major secretory protein" means one or more proteins which are originally secreted and produced by yeast (hereinafter referred to as "endogenous secretory protein") and which produce a large amount. means. Since the type and amount of the endogenous secretory protein differ depending on the type of yeast, the gene of the endogenous secretory protein that is inactivated can be selected for each yeast selected.

Whether or not it is a "major secretory protein" can be determined based on the invertase secreted and produced in Candida utilis. Specifically, is the "major secretory protein" equivalent to the ratio of the secretory production amount of invertase to the amount of the endogenous secretory protein secretory produced in Candida utilis?
Alternatively, it can mean an endogenous secretory protein secreted and produced at a higher ratio.

Examples of yeast hosts and their corresponding major secreted proteins are:

Budding yeast: acid phosphatase gene (A
rima, K. et al. Nucleic Acids Res 25, 1657-72, 198
3), invertase gene (Hohmann S, Zimmermann F
K., Curr Genet. 11, 217-25, 1986) Shizosaccharomyces pombe: invertase gene (Tanaka N et al. Biochem Biophys Res Commun
7, 246-253. 1998) Shizosaccharomyces pombe: acid phosphatase gene (Elliott S, et al. J Biol Chem 261 2936-41, 198)
6) Yeast of the genus Kluyveromyces: acid phosphatase gene (Fe
rminan E, Dominguez A., Microbiology. 143, 2615-25.
1997), β-galactosidase gene (Dickson RC, Mar
kin JS. Cell 15, 123-301978) Yarrowia lipolytica: XPR2 gene encoding major alkaline protease (Davidow LS, et al. J Bacter
iol 169, 4621-9, 1987) Candida utilis: invertase gene (Example 2) When two or more endogenous secretory proteins with a large secretory amount are present, the endogenous factor secreted and produced in Candida utilis In order to suppress the production of endogenous secretory protein in an amount equivalent to or higher than the ratio of the amount of secreted invertase to the amount of secreted protein,
Any or all of the genes may be inactivated.

When the yeast inactivation suppressing gene has already been cloned, its expression can be easily inactivated by the method described below. Even if the gene to be inactivated has not been cloned, the protein is purified, the amino acid sequence is determined, gene cloning is performed according to a standard method, and the cloned gene can be used for inactivation of expression (see below. See example).

A particularly preferred embodiment of the present invention is Candida utilis in which the expression of the invertase gene is inactivated. The DNA sequence of the invertase gene from Candida utilis and the amino acid sequence of invertase are shown in SEQ ID NOS: 1 and 2, respectively.

Inactivation of major secretory protein gene In the present invention, means for inactivating the major secretory protein gene is gene disruption using homologous gene recombination technology (Rothstein, R. Methods Enzymology 194, 281).
-301, 1991).

Specifically, gene disruption is performed by inserting a selectable marker gene or the like into a DNA sequence having homology to the target gene sequence on the chromosome to produce a plasmid in which the gene function is lost. Then, the linear DNA fragment obtained by cutting the plasmid at both ends of the homologous DNA sequence is used for transformation. This linearized DNA fragment contains DNA sequences homologous to the target gene and capable of recombination at both ends thereof, that is, 5'region and 3'region of the target gene, and at least one selection sequence between them. D comprising a marker gene
NA construct. Of these, the recombinable DNA part homologous to the target gene, that is, the 5'region and the 3'region of the target gene are arranged in the same direction as when they are present on the chromosome. In this case, the homologous DNA sequences at both ends of the DNA construct are inserted in a form that replaces them by homologous recombination with the target gene on the chromosome, so that the target gene sequence on the chromosome is destroyed and the yeast having a novel trait. The stock is obtained. In the obtained yeast, the target gene is inactivated and the trait of the selectable marker gene is expressed. The DNA sequences of the 5'region and the 3'region may include the open reading frame (ORF) of the target gene, or may include the regulatory region of the target gene beyond the ORF, that is, the promoter region and the terminator region. You may stay.

Further, a plasmid containing a DNA sequence having homology to the target gene sequence and containing a selectable marker gene outside the homologous sequence was prepared and cleaved at an appropriate restriction enzyme site in the homologous DNA sequence. It is also possible to disrupt the homologous gene on the chromosome by carrying out transformation with. In this case, plasmid D
Since the target gene has two copies due to insertion into the NA chromosome, deletion, substitution, and
It is necessary to change the homologous DNA sequence in the plasmid by modification such as insertion. On the other hand, it is also possible to obtain a gene-disrupted strain without using a selectable marker gene for transformant selection. For that purpose, transformation is carried out using a homologous DNA sequence that has been modified so that it no longer functions by introducing mutations such as substitutions, insertions and deletions inside the structural gene, and a gene-disrupted strain that does not show the expression of the target gene is obtained. Select directly. As a vector for this purpose, it is also possible to use a linear DNA fragment which is homologous to the chromosomal target sequence and which contains a heterologous gene inside a DNA sequence capable of homologous recombination. In these cases, the plasmid as a vector is inserted so as to replace the homologous gene on the chromosome. Among these methods, preferably, the target gene sequence on the chromosome is destroyed by carrying out transformation using a DNA fragment containing a selectable marker gene in a DNA sequence homologous to the target gene on the chromosome. be able to.

When the host yeast strain is diploid,
Two kinds of DNA fragments for gene disruption having different selectable marker genes are required, and it is desirable that the homologous DNA sequences contained in each DNA fragment have homology in different regions of the target gene. Specifically, with respect to the two homologous DNA sequences in the DNA fragment used for transformation first, the homologous DNA sequence in the DNA fragment used next has homology in the region inside the target gene. A DNA sequence is used. This allows the first DN
In the transformant obtained using the A fragment, only the remaining wild-type gene is the target of gene disruption by the next DNA fragment, and a transformant in which two genes are disrupted can be efficiently obtained.

These homologous DNA sequences are labeled with P using oligonucleotide primers specific to the target gene.
It can be obtained by the CR method.

The selection marker gene is preferably a drug resistance gene, and transformants in which the gene is disrupted can be selected by drug resistance. As a preferred example of such a drug resistance gene, a G418 resistance gene or a hygromycin resistance gene which can be expressed by a promoter and a terminator functioning in host yeast can be used.

When Candida utilis is used as a yeast host, invertase is a major secretory protein, and therefore the invertase gene is destroyed by homologous recombination. In this case, the recombinant vector used for homologous recombination includes a 5'region sequence of the invertase gene, a selection marker gene, a 3'region sequence of the invertase gene, and a restriction enzyme cleavage site 3'from the 3'side. Mention may be made of DNA constructs comprising in lateral direction. The 5'region sequence and the 3'region sequence of the invertase gene can be selected from the 5'side region and the 3'side region of the DNA sequence of SEQ ID NO: 2, or may further include an upstream region or a downstream region, respectively. .

Expression Vector The yeast according to the present invention may be transformed with an expression vector carrying a DNA encoding the target protein for the purpose of secreting and producing the target protein.

As the procedure and method for constructing the expression vector according to the present invention, those conventionally used in the field of genetic engineering can be used.

As the vector that can be used in the present invention, a known expression vector depending on the yeast to be used can be used, and examples thereof include a vector that is integrated into host chromosomal DNA and a plasmid having an autonomously replicating sequence capable of self-replication. The copy number of the gene existing in the host cell may be one or plural.

The expression vector according to the present invention can be constructed, for example, according to the expression vector described in JP-A-8-173170, re-table 98/007873, and JP-A-11-9276 and the construction method thereof.

The expression vector according to the present invention comprises a promoter sequence, a DNA sequence encoding a target protein, and
The terminator sequence can be constructed so as to include at least an expression unit arranged in a direction from upstream to downstream.

On the 5'side of the DNA sequence encoding the target protein, DN encoding a secretory signal sequence described below is provided.
A may be linked. In the amino acid sequence of this secretory signal, a prosequence portion derived from the same species as the secretory signal sequence may be further added at the C-terminal side.
Designing an expression vector so as to produce a target protein to which a secretory signal sequence is added is advantageous in that the target protein is secreted and produced outside the cells, and the target protein can be easily separated and purified.

The heterologous protein encoded by the gene to be linked for the purpose of secretory production is not particularly limited, but a protein having physiological activity derived from higher animals is preferable. Examples thereof include glycoproteins that are originally secreted and produced in animal cells and are difficult to produce in E. coli, and proteins having a complicated three-dimensional structure.

The promoter and terminator sequences are preferably derived from the gene of Candida utilis, for example, the promoter and terminator of phosphoglycerate kinase (PGK) gene, glyceraldehyde-3-phosphate dehydrogenase (GAP) gene. Arrays etc. can be used. Further, known ADH, ENO, GAL, SU in Saccharomyces yeast and the like.
A promoter and a terminator sequence of a homologous gene in Candida utilis of a gene such as C can also be used. Furthermore, a DNA sequence having promoter activity obtained by a promoter cloning vector or the like can also be used. It can also be constructed by introducing a signal sequence into the expression vector.
The expression vector may be a chromosomally integrated type, or may be one that stably exists with an increased copy number outside the nucleus.

According to the present invention, (a) DN of SEQ ID NO: 3
There is provided a promoter comprising an A sequence or (b) a DNA sequence having a promoter function and hybridizing under stringent conditions with a sequence complementary to the DNA sequence of SEQ ID NO: 3. This promoter is derived from the promoter region of the invertase gene of Candida utilis and is characterized by being suppressed by glucose.

A DNA sequence which hybridizes with a sequence complementary to the DNA sequence of SEQ ID NO: 3 under strict conditions utilizes a polynucleotide containing the DNA sequence of SEQ ID NO: 3 as a probe and is isolated from other yeasts of the genus Candida. It can be obtained according to Example 2. Or DN of SEQ ID NO: 3
The DNA sequence that hybridizes with the sequence complementary to the A sequence under strict conditions has one or more bases missing in the sequence of SEQ ID NO: 3 by chemical synthesis, site-directed mutagenesis or PCR (supra). It can also be a missing, substituted, inserted and / or added DNA sequence. Confirmation of the promoter function of these obtained DNA sequences can be performed, for example, by
An appropriate host is transformed with a vector containing an appropriate reporter gene such as a drug resistance marker gene and a β-galactosidase gene having no promoter sequence for transcription, and cultured under the presence / absence of glucose under culture conditions. It can be easily confirmed by examining the expression of the reporter gene.

The promoter according to the present invention has a promoter function that is suppressed by glucose, and can be used as a promoter whose expression is induced in the latter stage of culture when the glucose concentration in the medium decreases. Generally, in the production of proteins by gene recombination, it is known that large-scale expression of the target protein imposes a burden on the producing cells, and thus has a negative influence on the growth. The expression of the promoter according to the present invention can be controlled by the glucose concentration, and the expression of the target protein can be induced after the cells have sufficiently grown. Therefore, the promoter according to the present invention is advantageous in that the target protein can be effectively produced. The promoter according to the present invention can be widely used for secretory production of proteins in yeast hosts. Those skilled in the art can use the mode, specifically, the construction of an expression vector including selection of a selectable marker gene or a secretory signal sequence, selection of a host, transformation method, culture of transformants, separation and purification of target protein, etc. Would be obvious. The promoter according to the present invention can also be used in a production system using a yeast host in which the expression of the gene encoding the major secretory protein is inactivated.

The expression vector according to the present invention may further have a selectable marker gene for selecting transformation. When the selection marker gene is not included in the expression vector, it can be used by the method of co-transformation with another plasmid carrying the selection marker gene.

Examples of the selectable marker gene include drug resistance genes. For example, a gene imparting cycloheximide resistance (eg, cycloheximide resistance type modified L41).
Gene), a gene imparting antibiotic G418 resistance (for example, aminoglycoside-3′-phosphotransferase (AP derived from bacterial transposon Tn903)
(T) gene), a drug conferring antibiotic hygromycin B resistance (for example, a hygromycin B phosphotransferase (HPT) gene derived from an Escherichia coli plasmid), etc., and a drug capable of selecting a Candida utilis transformant A resistance gene is mentioned. L
The 41 gene encodes the ribosomal protein L41 which is cycloheximide sensitive. The cycloheximide-resistant modified L41 is one in which Pro at the 56th position in the amino acid sequence of L41 is replaced with Gln. By this substitution, L41 cycloheximide resistance is imparted (Japanese Patent Laid-Open Publication No. Hei 8)
No. 173170).

In addition to the G418 resistance gene and the hygromycin B phosphotransferase gene, chloramphenicol acetyl transferase gene (chlorine phenycol transferase gene (black (Rumphenicol resistance) (Hadfield, C. et.al. Gene, 45,149-1
58 (1986)), blasticidin deaminase (blasticidin resistant) (Izumi, M. et. Al. Exp. Cell Res.,
197, 229-233 (1991)), and a phleomycin resistance gene (Wenzel, TJet. Al. Yeast, 8, 667-668 (1992)) and the like. In addition to this, the dehydrofolate reductase gene (methotrexate resistance) (Miyajima, A. et. Al. Mol. Cell Biol. 4,
407-414 (1984)) and a yeast-derived dominant gene sulfometuron methyl resistance gene (Casey, GP. Et. Al. J. Ins.
t. Brew.94, 93-97 (1988)), CUP1 gene (copper resistance) (Henderson, RCA. Et. Al. Current Genet. 9,
133-138 (1985)), CYH2 gene (cycloheximide resistance) (Delgado, M. et. Al. EBC congress, 23, 281-).
Known drug resistance genes such as 288 (1991)) can also be used.

When the marker gene is derived from a heterologous organism such as a bacterium or transposon gene, it is preferable to use the promoter and terminator sequence that function in Candida utilis as described above.

The expression vector according to the present invention may have an origin of replication (ori) derived from E. coli for the convenience of vector construction. When the expression vector is desired to exist in the form of a plasmid in the host cell, it can have an autonomous replication sequence capable of self-replication in the host cell. When the expression vector is efficiently integrated into the host chromosomal DNA, it may have a region homologous to the host chromosome used to promote homologous recombination, instead of such an autonomously replicating sequence. As a preferable homologous region, a region of the ribosomal RNA gene which exists in multiple copies on the chromosome can be mentioned.

Signal Sequence and Pro Sequence In order to express the target gene in a yeast host and produce the product in the culture medium, a secretory signal sequence, ie, a pre-sequence, is added to the N-terminal side of the target protein. Is preferred. In this case, the DNA sequence encoding the secretory signal sequence will be linked to the 5'side of the DNA sequence encoding the target protein in the expression vector. The secretory signal sequence is preferably heterologous to the protein of interest.

On the C-terminal side of the secretory signal sequence, a pro sequence derived from the same species as the secretory signal sequence may be further added. The secretory signal sequence to which a pro sequence is added may be referred to as “prepro sequence” herein.

As the secretory signal sequence, it is preferable to use the signal sequence of the endogenous secretory protein derived from the yeast host to be used, but it is not limited thereto. An artificially modified secretory signal other than yeast or a secretory signal when the target protein is originally a secretory protein can be used as long as it functions in the yeast host to be used. Many cases have been reported where functions other than the secretory signal originally functioning in the yeast used function (eg, Fumio Hishinuma, Chemistry and Biology, 26, 568-576, 1988, Kaiser CA, et al. Scie.
nce 235, 312-317, 1987), those skilled in the art can appropriately select a secretion signal suitable for yeast based on these known information.

For example, when budding yeast is used as the yeast host, the invertase gene (SUC2) signal sequence (Chang, CN, Mol.
Cell. Biol. 6, 1812, 1986) and acid phosphatase gene (PHO5) signal (Smith R., et al. Scienc
e, 229, 1219, 1985), the α-factor gene (MFα1) signal sequence (Bitter, G.
A., et al., Proc. Natl. Acad. Sci. USA 81, 5330, 1
984) and killer toxin gene (KIL128K) signal sequence (To
kunaga M, et al. Eur. J. Biochem., 203, 415-423, 1
992) etc. can be used respectively. Among these signal sequences, the MFα1 signal is Pichia pastoris
It can also be used for heterologous protein production in
C, et al. Biosci Biotechnol Biochem. 63, 1977-83,
1999, Rotticci-Mulder JC, et al. Protein Expr Puri
f. 21,386-92. 2001). Also, the killer toxin signal KIL
128K is Kluyveromyces lactis (Tokunaga M., et al. Ye
ast 13, 699-706 1997) and Pichia pastoris (Kato S, e
T al. Yeast 18, 643-655, 2001). When Kluyveromyces lactis yeast is used as the yeast host, the acid phosphatase (PHO5) signal sequence (Ferminan E, Dominguez A, Appl Environ Microbio
l. 64, 2403-8, 1998) and killer toxin signal sequence (Wal
sh DJ, Bergquist PL, Appl Environ Microbiol. 63, 3
297-300, 1997), inulinase signal sequence (Bergkam
p RJ. Et al. Appl Microbiol Biotechnol 40, 309-17,
1993) and the like can be used. Yar as a yeast host
When using rowia lipolytica yeast, the alkaline protease KPR2 signal sequence (Park CS, et al. J Biol C
hem 272, 6876-81, 1997) and the like can be used.

According to the present invention, (c) SEQ ID NOs: 4, 5,
Or in the amino acid sequence of 6 or the amino acid sequences of (d) and (c), one or more amino acid residues are deleted or substituted,
A secretory signal sequence is provided that consists of an amino acid sequence that is inserted and / or added and that functions as a secretory signal. The present invention also provides a DNA encoding the secretory signal sequence according to the present invention.

DNA encoding the amino acid sequence of (d)
Site-directed mutagenesis and PCR (Nucleic Acid
Res., Vol.10, pp.6487 (1982), Methods in Enzymolog
y, 100, pp448 (1983), Molecular Cloning 2ndEdt., C
old Spring Harbor Laboratory Press (1989), PCR AP
Practical Approach IRL Press pp200 (1991)) can be easily prepared by those skilled in the art. Whether the modified signal sequence thus obtained functions can be easily determined by ligating an appropriate secretory protein and examining the expression thereof.

DNA encoding these secretory signals
Is linked to the N-terminal side of the protein of interest so as to match the reading frame of the codon, so that the expression system of the gene encoding the major secretory protein according to the present invention is inactivated in a production system using a yeast host. Can also be used. The secretory signal sequence according to the present invention can be widely used not only for the secretory production of the target protein according to the present invention but also for the secretory production of the protein in a wide range of yeast hosts. Therefore, the mode of use of the secretory signal sequence according to the present invention, that is, the construction of an expression vector including selection of a selectable marker gene and promoter / terminator, selection of host, transformation method, culture of transformant, isolation of target protein Purification, etc.
Can be appropriately implemented according to the technique described in the present specification.

Transformation of yeast according to the present invention is carried out by transforming a host into an expression vector,
For example, it can be obtained by introducing vector DNA (plasmid DNA) and selecting a transformant that has become drug resistant. As a method for treating a host cell in a state in which extracellular DNA can be taken up, methods conventionally used for yeast transformation such as electric pulse method, protoplast method, lithium acetate method, and modified methods thereof can be used. Can be mentioned.

In the case of the electric pulse method, cells are grown to the logarithmic growth phase, washed, and suspended in 1M sorbitol. The condition of the electric pulse is a time constant value (time until the voltage decays to about 37% of the maximum value).
Is about 10 to 20 milliseconds and the viable cell rate after the pulse is about 10-40%. For example, the above-mentioned time constant value and viable cell ratio are obtained under the conditions of an electric capacity of 25 μF, a resistance value of 600 to 1000 ohms, and a voltage of 3.75 to 5 KV / cm.
00 to 1400 transformants are obtained.

In addition, after applying the electric pulse, if the bacteria were directly applied to the selection plate containing cycloheximide without culturing, colonies might not be obtained. Therefore, YPD medium containing 1M sorbitol was added to the bacterial solution. It is preferable to perform shaking culture at ℃. In this case, the culture time is 4-6
The time is appropriate, and after that, the growth of transformants cannot be ignored. Further, it is preferable to add carrier DNA such as salmon spar DNA or polyethylene glycol when the DNA is brought into contact with the bacterial cells, from the viewpoint of increasing the transformation frequency.

The lithium acetate method (Ito et al. J. Bac
teriol. 153, 163-168 (1983)) is widely used for the transformation of Saccharomyces yeast because of its simplicity, and various improved methods have been reported. Candida utilis can also be transformed using these methods (Japanese Patent Laid-Open No. 8-173170). In particular, a modified lithium method (Soni et. Al. Current Genet.
4,455-459 1993) can be used to transform Candida utilis. Also, the cell density at the time of harvesting,
The optimal conditions for transformation of Candida utilis by the lithium acetate method were determined by trying different conditions such as the concentration of lithium, the type and concentration of polyethylene glycol, the type, form and amount of carrier DNA, and the transformation frequency. Can be increased.

Production of target protein and transformation of
Culturing According to the present invention, culturing a yeast in which the expression of a gene encoding a major secretory protein is inactivated and transformed with an expression vector according to the present invention, and then collecting the target protein from the culture. A method for producing a protein is provided.

The method for culturing the transformant and the medium that can be used can be appropriately selected by those skilled in the art in consideration of the type of yeast host and promoter to be used, the presence or absence of a selection marker gene and the type. In the embodiment in which the expression vector is integrated into the host chromosome, the integrated expression unit is stably retained in the host, and thus in culture, selection pressure corresponding to the selectable marker gene used during transformation is not required. Is advantageous.

In the embodiment in which the secretory signal sequence is added to the target protein, the protein is secreted and accumulated in the culture broth, which is advantageous in that the target protein can be easily purified as compared with intracellular expression. The crude protein solution is obtained by removing the bacterial cells from the culture solution by solid-liquid separation means such as centrifugation or filtration, and the crude protein solution is subjected to salting out method, solvent precipitation method, dialysis method, ultrafiltration method, gel electrophoresis. The target protein can be separated and purified by a method or by combining purification means such as ion exchange chromatography, gel filtration chromatography, reverse phase chromatography, affinity chromatography and the like. In the case of intracellular expression, the target protein can be separated and purified by crushing the bacterial cell to obtain a crude protein solution of the target protein accumulated in the cell and then applying the above-mentioned purification means.

[0055]

Examples Example 1: Purification of invertase and parts thereof
Determination of amino acid sequence Candida utilis ATCC 9950 strain was prepared using SD medium (2% glucose, 0.67% Yeast N).
After culturing overnight in (itrogen Base), the culture supernatant was subjected to SDS polyacrylamide gel electrophoresis, and a clear band was detected at a position of a molecular weight of about 100 kDa. About 250 ml of the culture supernatant of this protein, Q-sepharose Phenyl-seph
After purification by arose chromatography, S
By performing DS polyacrylamide gel electrophoresis, it was confirmed that the protein was purified to a single band. The protein was electroblotted to form a 10 cm x 7 cm PVDF membrane ((ProBl
ot) Applied Biosystems). As an electroblotting apparatus, a semi-dry blotter manufactured by Bio-Rad was used. According to Shimadzu Corporation's "Sample pretreatment method for protein sequencer (1)", electroblotting was performed using 160
It was carried out at mA for 1 hour. After the transcription, the membrane of the transcribed portion of the enzyme was cut out, and a part thereof was directly analyzed by a gas phase protein sequencer to determine the N-terminal amino acid sequence. The remaining membrane is approximately 300 μl of reducing buffer (8M
Guanidine hydrochloride, 0.5M Tris-HCl buffer (pH
8.5), 0.3% EDTA, 2% acetonitrile), 1 mg of dithiothreitol (DTT) was added,
Reduction was carried out under argon at 25 ° C. for about 1 hour. To this, 3.0 mg of monoiodoacetic acid dissolved in 10 μl of 0.5N sodium hydroxide solution was added, and the mixture was stirred for 20 minutes in the dark. After taking out the PVDF membrane and thoroughly washing it with 2% acetonitrile, 0.5% polyvinylpyrrolidone-4
It was immersed in 100 mM acetic acid containing 0 and left for 30 minutes. After that, the PVDF membrane was thoroughly washed with water, and the membrane cut into 1 mm square was used as a digestion buffer (8% acetonitrile, 90 m
M Tris-HCl buffer (pH 9.0)) was added, 1 pmol of Achromobacter protease I (Wako Pure Chemical Industries) was added, and digestion was carried out at room temperature for 15 hours. The digested product was subjected to C18 column (Wako Pure Chemicals Wakosil AR II C18
Separation was performed by reverse phase high performance liquid chromatography (Hitachi L6200) using 300Å2.0 × 150 mm). As a solvent for peptide elution, solvent A (0.05% trifluoroacetic acid), solvent B (2-propanol / acetonitrile containing 0.02% trifluoroacetic acid 7: 3)
Elution was carried out with respect to the solvent B by elution with a linear concentration gradient of 2 to 50% at a flow rate of 0.25 mL / min for 40 minutes. An amino acid sequence determination test for the obtained fragmented peptide was carried out by an automatic Edman degradation method according to a manual using a gas phase protein sequencer PPSO-10 type (Shimadzu Corporation). The partial amino acid sequence and N-terminal amino acid sequence obtained below are shown below. Achromobacter protease I used for the partial amino acid sequence specifically cleaves the carboxyl group side of the lysine residue, so K (lysine) is written in brackets at the N-terminal side in the following sequences.

[0056] Partial amino acid sequence AP1 (K) GKPSNVDIVASS (SEQ ID NO: 7) AP2 (K) NPVIDVNST (SEQ ID NO: 8) AP4 (K) IQIYTSDNL (SEQ ID NO: 9) AP6 (K) DWSLASXFXT (SEQ ID NO: 10) AP8 (K) DSVTFELR (SEQ ID NO: 11) AP9 (K) EAYTVDQLTVRRLTV (SEQ ID NO: 12) AP10 (K) GYVGYQYECPGLFETIEN (SEQ ID NO: 13)

Regarding the obtained partial amino acid sequence, BLA
Homology search by ST revealed that some of these amino acid sequences showed high homology with S. cerevisiae invertase, strongly suggesting that the protein is Candida utilis invertase.
On the other hand, an attempt was made to determine the amino acid sequence of the purified N-terminal of the invertase protein by the Edman degradation method, but it could not be analyzed due to the modification of the N-terminal amino acid.

Example 2: Candida Utilis Lee
Cloning of the invertase gene The invertase gene was obtained from the Candida utilis IFO 0988 strain and its nucleotide sequence was determined.

(1) Preparation of probe Based on the partial amino acid sequences AP1, AP4, and AP10 of invertase, oligonucleotide mixes in both forward and reverse directions were synthesized, and PCR was performed to obtain AP10.
An amplified DNA fragment was obtained by combining the oligonucleotide mix of F and AP1R. AP10F and AP1R
The sequence of is shown below. AP1R; 5'-GCNACDATRTCNACRT
T-3 ′ (SEQ ID NO: 14) AP10F; 5′-TAYCARTAYGARTGY
CC-3 '(SEQ ID NO: 15)

PCR is performed using the above-mentioned primers AP1R and AP.
10 F and Candida utilis chromosomal DNA were mixed, and using Ex Taq Polymerase (Takara Shuzo), 94 ° C. for 30 seconds, 50 ° C. for 1 minute, and 72 ° C. for 2 minutes for 30 cycles. The amplified DNA fragment of about 0.9 kb was cloned into the SmaI site of pUC18 using SureClone Ligation Kit (Amersham Pharmacia). Amplified DNA using a dye terminator cycle sequence kit (Perkin Elmer)
The base sequence of the fragment was determined. As a result, the amplified DNA fragment consisted of 918 bp, and one ORF consisting of 306 amino acids was detected. Furthermore, among the peptides whose amino acid sequences were determined in the amino acid sequence deduced from the DNA sequence, the sequence of AP8 was present together with AP1 and AP10.
When this deduced amino acid sequence was compared with the SUC2 gene of Saccharomyces cerevisiae, high homology was detected, and it was confirmed that part of the invertase gene of Candida utilis was amplified.

(2) Screening of library This 0.9 kb DNA fragment was used as a probe for screening a DNA library. The probe is Mega
α- using prime DNA labeling systems (Amersham)
DNA with 32P dCTP (110 TBq / mmol)
The fragments were labeled and used for library screening. Candida utilis chromosomal DNA library
5-10 kb DN obtained by partial decomposition with au3AI
The A fragment cloned into the BamHI site of the plasmid pBR322 was used (JP-A-8-17317).
No. 0). About 40.000 clones of the library were subjected to colony hybridization to obtain 6 positive clones. The filter is made by Mole
cular Cloning 2nd edition Sambrook et. al. p2.108
-121, Cold Spring Harbor Laboratory (1989). Hybridization is performed using a hybridization solution (6xSSC, 5xD
enhanced Solution, 0.2% SDS)
After pre-hybridization at 65 ° C. for 2 hours, the labeled probe DNA was added to the hybridization solution, and the mixture was incubated at 65 ° C. for 16 hours. After hybridization, the filter is 1xSSC, 0.1% S
After washing in DS at 65 ° C. for 2 hours, it was subjected to autoradiography to detect the signal. Among the obtained clones, a clone carrying the plasmid pCUINV5 having an inserted DNA fragment of about 7 kb was used in the following analysis.

(3) Determination of DNA sequence The result of restriction enzyme analysis of the plasmid pCUINV5 is shown in FIG. The length of the insert was about 7 kb. As a result of Southern analysis of DNA fragments digested with various restriction enzymes, about 4 kb of ClaI-H containing a region considered to contain the invertase gene was analyzed.
The indIII fragment and the EcoRI fragment of about 1.7 kb were respectively inserted into pBluescript SK (Stratege).
ne) or pUC9. Regarding the insert DNAs of these plasmids, deletion mutants from both directions were obtained using a double-stranded Nested Deletion Kit (Amersham Pharmacia) using exonuclease III and mung bean nuclease. The nucleotide sequence was determined using a dye terminator cycle sequence kit (Perkin Elmer), and the obtained nucleotide sequences were joined together to obtain a nucleotide sequence of 4754 bp as shown in SEQ ID NO: 1. The base sequence of SEQ ID NO: 1 had an open reading frame consisting of 1659 bases starting from the 2182nd position and ending at the 3840th position. It was confirmed that this open reading frame contained the entire determined partial amino acid sequence. Further, the homology between the deduced amino acid sequence and the invertase protein encoded by the SUC2 gene of S. cerevisiae was examined.
% Amino acids were identical. However, the sequence near the N-terminal of the predicted amino acid sequence had low homology, and no sequence considered to be a secretory signal sequence was observed. In the open reading frame, ATG codons encoding methionine were recognized at the 2221th and 2275th positions in addition to the 2182nd position. Therefore, the presence or absence of a secretory signal sequence was examined for the polypeptides starting from each. The existence of a typical continuous hydrophobic amino acid sequence could not be confirmed.

Example 3: Candida utilisin
Determination of transcription start point and translation start point of the invertase gene There are three Met codons in the same frame near the N-terminal of the open reading frame of the invertase gene, and clear secretion is obtained when any of them is used as the translation start point. No signal sequence was found. Therefore, we decided to predict the translation start point by determining the transcription start point of this gene. 5'RACE is used to determine the transcription start point
It was done by law.

Experiments (Preparation of High Molecular Weight RMA;
Methods in Enzymology, vol. 194, p398, Academic Pr
Total RNA was prepared according to the method described in (ess). Oligotex ^TM -dT30 <Super> mR from the obtained total RNA
MRNA using NA Purification Kit (Takara Shuzo)
Was purified. Invertase cDNA using 5'RACE System, version 2.0 (Lifetech Oriental)
The 5'upstream region of was analyzed. 1 μg of mRNA was used as a template, and 1st strand cDNA was Oligod
The PCR reaction was carried out using the T primer and the combination of the attached primer and the invertase gene-specific primer shown below. INV200; 5'-CGATTCTCTGTTTCT
GGTCTTGGTTG-3 ′ (SEQ ID NO: 16) INV300; 5′-CATCTGGTAAGTTA
TTGGTA-3 '(SEQ ID NO: 17)

About 400 bp for INV300 primer and about 350 bp for INV200 primer by PCR
A bp DNA fragment was amplified. INV300 of these
The DNA fragment of about 400 bp amplified by the primer is S
Sure of pUC18 using ureClone Ligation Kit (Amersham Pharmacia).
Cloned into the site. 1 using a dye terminator cycle sequence kit (Perkin Elmer)
The base sequence of the amplified DNA fragment of 0 clone was determined. As a result, the 5'terminal bases of all the clones were SEQ ID NO: 1.
It was shown to be located between the 2254th and 2262nd positions of the invertase, revealing that the invertase mRNA is transcribed from this region. As shown in Example 2,
2182nd and 2nd in the open reading frame
ATG codons were found at the 221st and 2275th positions, and this result suggested that the 3rd ATG functions as the start codon of the invertase protein. SEQ ID NO: 2 shows the deduced amino acid sequence of the invertase protein.

Example 4: Candida utilisin
Acquisition of promoter region of vertase gene and heterogeneous inheritance
Expression of offspring Since the expression of invertase is inhibited by glucose in the medium and the expression is induced by the consumption of glucose, the utility value of the promoter is high in the expression of the heterologous protein. Therefore, the three initiation codons ATG (21) found in the open reading frame described in Example 2 were used as the promoter region of the gene.
(82nd, 2221st, 2275th) 5 ′ immediately before the base to 5 ′ upstream, 1290th of SEQ ID NO: 1,
PCR of 3 kinds of DNA fragments (about 0.9-1.0 kb)
And the promoter activity of each amplified DNA fragment was examined. The primer sequences used for PCR are shown below. INV No. 1; 5'-GGGGCGCGCGCTTA
GAGTACATCGTCTTG-3 '(SEQ ID NO: 1
8) INV No. 2; 5'-GGTCTAGAGGGAA
TGCTCTCCGAATTCT-3 ′ (SEQ ID NO: 1
9) INV No. 3; 5'-GGTCTAGACCCTG
TGCTGCTTTTATAGT-3 '(SEQ ID NO: 2
0) INV No. 4; 5'-GGTCTAGACGTGA
GACTCTTGATGTCTT-3 ′ (SEQ ID NO: 2
1)

Among the above primers, INVNo. 1 and I
NV No. 2, INV No. 1 and INVNo. 3, IN
VNo. 1 and INVNo. PCR in which any of the combinations of 4 and Candida utilis IFO 0988 strain chromosomal DNA was mixed, and PCR was performed using Ex Taq polymerase (Takara Shuzo) ((94 ° C. for 30 seconds, 50 ° C. for 1 second).
Min., 72 ° C. for 2 minutes) × 25 cycles). These amplified DNA fragments were digested with NotI and XbaI, and then the expression plasmid p of β-galactosidase gene was digested.
CLLAC1 (Japanese Patent Laid-Open No. 8-173170) is NotI
And ligated to a DNA fragment that had been digested with XbaI and had the PGK promoter fragment removed, and three expression plasmids p
LACINV1, pLACINV2, pLACINV3
Was built. Each of the plasmids contains 1290-218 of the nucleotide sequence of SEQ ID NO: 1 as a promoter fragment.
Up to the first (pLACINV1), 1290-2220
Up to the (pLACINV2) and 1290 to 2274th (pLACINV3) are included.

The three types of plasmids are AflII, respectively.
Candida Utilis IFO 09 after cutting at
88 strains were transformed to obtain a transformant showing cycloheximide resistance. The transformation is described in JP-A-8-173.
It was performed according to the electric pulse method described in No. 170. The obtained transformed colony was subjected to Methods in YeastGe
netics-A laboratory Course Manual-Rose MD et
al. P181-182 Cold Spring Harbor Laboratory Press N
When applied on an X-gal plate for detecting β-galactosidase activity prepared according to the method described in Y (1990), a blue color showing the presence of β-galactosidase activity only in the transformant obtained with pLACINV3. Was confirmed. This result showed that only the DNA fragment containing the transcription initiation point predicted in Example 3 had promoter activity. The sequence of a DNA fragment having promoter activity is shown in SEQ ID NO: 3. This sequence corresponds to the 1290-2274th position in the nucleotide sequence of SEQ ID NO: 1. This result also shows that 3 of the 3 ATG codons found in the open reading frame
Th ATG (2275th in the nucleotide sequence of SEQ ID NO: 1)
Was confirmed to function as the start codon of the invertase protein.

Furthermore, β-galactosidase activity was measured for each of the three transformants obtained by pLACINV3. β-galactosidase activity is in Methods in Yea
st Genetics-A laboratory Course Manual-Rose M.
D et al. P155-159 Cold Spring Harbor Laboratory Pr
It was measured according to the method described in ess NY (1990). That is, the cells were cultured in 10 ml of YPD liquid medium for 8 hours until the logarithmic growth phase (OD600 was 2 to 3), and then 5 ml.
The culture solution was collected, and the remaining culture solution was further cultured for 10 hours and further cultured until the stationary phase was reached (OD600 was 11 to 12). 0.2 for each bacterial cell collected
After suspending in 5 ml of breaking buffer, glass beads were added and the cells were crushed by vortexing for 2 minutes. 0.25 ml of breaking
After adding the buffer, the mixture was centrifuged at 15,000 rpm for 15 minutes and the supernatant was collected to give a crude enzyme solution. The protein concentration of the crude enzyme solution was measured by the Bradford method using a protein assay kit manufactured by Bio-Rad. β
-Galactosidase activity was measured by adding Zbu to 0.1 ml of enzyme solution.
After adding 0.9 ml of FER and incubating at 28 ° C. for 5 minutes, 0.2 ml of ONPG solution was added,
After incubation for 30 minutes, 0.5 ml Na ₂ C
The reaction was stopped by adding O ₃ liquid. After measuring OD ₄₂₀ , β-galactosidase activity was determined according to the calculation formula. The β-galactosidase activity was defined as 1 unit of the activity of producing 1 nmol of ortho-nitrophenol for 1 minute at 28 ° C. per mg of protein. The activity values obtained were as shown in Table 1. From this result, it was shown that almost no promoter activity of the invertase gene was observed in the logarithmic growth phase, but high activity was recognized in the stationary phase.

[0070]

[Table 1]

Example 5: Invertase gene disrupted strain
Construction (1) Construction of plasmid for invertase gene disruption Four types of DNA fragments used as targets for homologous recombination of plasmid into invertase gene, 5
A, 5B, 3B and 3A were cloned by PCR. 5A is 388-1 of the DNA sequence of SEQ ID NO: 1.
Corresponding to 231 bp, 5B is 1341-2138
bp, 3B is 2966-3770bp, 3A is 382
It corresponds to 8-4677 bp (Fig. 2). The oligonucleotide used as a primer is: 5AF; 5'-GGGTCGCACATCATCACC
ACGCTCCA-3 '(SEQ ID NO: 22) 5AR; 5'-GGAGATCTAGCAGGATC
GAACTGCTG-3 ′ (SEQ ID NO: 23) 5BF; 5′-GGGTCGACTGTGGTTCA
AAAGCTACGT-3 '(SEQ ID NO: 24) 5BR; 5'-GGAGATCTCAAGCCCTT
TGACAACAG-3 ′ (SEQ ID NO: 25) 3BF; 5′-GGAGATCTTAGCAATCA
ATCCAGGCTC-3 ′ (SEQ ID NO: 26) 3BR; 5′-GGGGTACCCGTCGACCGTT
TGATGGCTTGCC-3 '(SEQ ID NO: 27) 3AF; 5'-GGAGATCTCACTGTTTTG
ACGAATACGC-3 '(SEQ ID NO: 28) 3AR; 5'-GGGTACCGTCGACGTCT
CAAAGTTCCAGGT-3 '(SEQ ID NO: 29).

Of the above primers, 5AF, 5AR and 5
Candida Utilis IFO with any combination of BF and 5BR, 3BF and 3BR, 3AF and 3AR
The chromosomal DNA of the 0988 strain was mixed, and PCR was performed using Ex Taq polymerase (Takara Shuzo) ((
0 seconds, 1 minute at 50 ° C, 2 minutes at 72 ° C) x 25 cycles)
Was done. SureClone L with 4 types of amplified DNA fragments
igation Kit (Amersham Pharmacia), p
It was cloned into the SmaI site of UC18. The base sequence of the amplified DNA fragment was confirmed using a dye terminator cycle sequence kit (Perkin Elmer).

From the plasmids obtained subsequently, 5A and 5B
With SalI-BglII and 3A and 3B with BglII-.
It was cut out with KpnI. 5 of the obtained fragments
Incorporating A and 3A between SalI and KpnI of pUC19, pINVA1 and 5B and 3B of SalI of pUC18.
PINVB1 was constructed by incorporating between -KpnI.

G4 used as a marker in transformation
18 resistance gene and hygromycin resistance gene expression cassette
A plasmid pGKAPH1 capable of expression with a Utilis PGK gene promoter and terminator,
It was cloned by PCR using pGKHPT1 (WO95 / 32289) as a template. The oligonucleotide used as a primer was RS42; 5'-GGGATCCTTGATGAAAG.
AATAACGTATTTCTTCATCATCAAGGAG
ACTCTTCACACTGTTGGC-3 '(SEQ ID NO: 30) RS3402; 5'-GGGATCCTTGATGAA
AGAATACGTTATTTCTTTCCATCAAGG
CAGATGAGCTCATCAACCAC-3 ′ (SEQ ID NO: 31).

G418 resistance gene expression unit (PGK
p-G418r-PGKt) is the plasmid pGKAPH.
It was obtained by PCR using 1 as a template and primers RS42 and RS3042. In addition, a hygromycin resistance gene expression unit (PGKp-HYGr-PGK
t) was obtained by PCR using plasmid pGKHPT1 as a template and primers RS42 and RS3042. PCR is LA Taq polymerase (Takara Shuzo)
At ((94 ℃ 30 seconds, 50 ℃ 1 minute, 72 ℃ 2 minutes)
× 30 cycles). The amplified DNA fragments were respectively pT7 Blue (Stratagene).
Cloned into.

PCR-amplified 418 resistance gene expression unit (PGKp-G418r-PGKt) and hygromycin resistance gene expression unit (PGKp-HY)
Whether Gr-PGKt) functions as a marker for transformation was confirmed as follows. That is, for each 5 clones of the obtained plasmid, both ends of the expression unit were cleaved with BamHI, and then Candida utilis IFO 0988 strain was transformed, and transformed with YPD plate containing 200 μg / ml G418 or hygromycin. Was selected. As a result, DNA fragments that gave a strain resistant to G418 or HYG were selected and used in the following plasmid construction. Approximately 2 kb containing a G418 resistance gene expression unit (PGKp-G418r-PGKt)
Bgl of pINVB1 constructed previously with the BamHI fragment of
The plasmid pINVBG1 was constructed by incorporating it into the II site. Also, a BamHI fragment of about 2 kb containing a hygromycin resistance gene expression unit (PGKp-HYGr-PGKt) was previously constructed, and BglI of pINVA1 was constructed.
The plasmid pINVAH1 was constructed by incorporating it into the I site (FIG. 2).

(2) Preparation of Candida utilis invertase gene-disrupted strain The constructed plasmid pINVAH1 was used to transform the Candida utilis IFO0988 strain. The transformation was performed according to the method described in JP-A-8-173170.

PINVAH1 was used for transformation after cutting with SalI. Selection of transformants is 200 μg / m
Performed on YPD plates containing 1 hygromycin.
Chromosomal DNA was prepared from the resulting hygromycin resistant strain and confirmed by PCR. The oligonucleotide used as a primer was INV-F; 5'-CACGGTCTTGGAGAAC.
CCAACCACGGCCAT-3 ′ (SEQ ID NO: 32) INV-R; 5′-CAGATACCAGAGCTGT
TTGTCAAAGGCC-3 '(SEQ ID NO: 33). INV-F is the 5'of DNA fragment 5A derived from the invertase gene obtained in Example 3- (1).
Side, corresponding to 301-330 of SEQ ID NO: 1, INV-R
Is 3700 of the 3A fragment, 4700 of SEQ ID NO: 1
Corresponds to -4727. PCR was carried out with LA Taq polymerase (Takara Shuzo) ((30 seconds at 94 ° C, 1 hour at 50 ° C).
Min, 72 ° C., 2 minutes) × 30 cycles). As a result, in addition to the 4.4 kb band derived from the invertase wild gene on the chromosome, a band of about 3.8 kb indicating that one of the alleles was replaced by the DNA fragment used for transformation by homologous recombination. Was confirmed (Fig. 3).

One strain was selected from these hygromycin resistant strains and further transformed with pINVBG1. PINVBG1 was used for transformation after cutting with SalI. Chromosomal DNA was prepared from the obtained G418-resistant strain and confirmed by PCR. The oligonucleotides used as primers were INV-R and PGK-T; 5'-TAATCATAATGATATT.
GACATATAATCCCG-3 '(SEQ ID NO: 34). PGK-T is a 418 resistance gene expression unit (PGKp-G418r-PGKt) and a hygromycin resistance gene expression unit (PGKp-HYGr-).
Anneal with the PGK terminator sequence in PGKt). PCR is LA Taq polymerase (Takara Shuzo)
At ((94 ℃ 30 seconds, 50 ℃ 1 minute, 72 ℃ 2 minutes)
× 30 cycles). No band was observed in the wild strain used as a control, but in the hygromycin resistant strain used as a parent strain for transformation,
A band of about 2.3 kb was observed because one of the invertase genes was destroyed. Furthermore, by using the genomic DNA of the G418 resistant strain obtained by transformation as a template, in addition to the band of 2.3 kb, about 3.2
A new kb band was observed (Fig. 3). This indicates that the invertase gene remaining without being destroyed in the hygromycin resistant strain was replaced with the DNA fragment containing the G418 resistant gene used for transformation.

The invertase gene 1 gene-disrupted strain (hygromycin resistance), 2 gene-disrupted strains (hygromycin, G418 resistance) and wild strains obtained by the above transformation operation were examined for growth in YPD medium. No difference was observed in the growth curves among the three strains, and it was considered that the disruption of the invertase gene had no effect on the growth. To measure the invertase activity in the medium,
50 of each culture supernatant cultured in YPD medium for about 28 hours
200 μl of 0.1M acetic acid (pH 5.0) and 15% to μl
Add 250 μl of sucrose and incubate at 60 ° C for 5 minutes,
The reaction was stopped by further treating at 95 ° C. for 5 minutes. The produced glucose was measured using a glucose measurement kit (Wako Pure Chemical Industries, Ltd.). 1 unit of invertase activity is 60 ℃
In the above, the amount of enzyme that produces 1 μmol of glucose per minute was defined as the amount of enzyme. About 2 per 1 ml of medium in the wild strain
About 30 units of 1 gene-disrupted strain showed activity of about 100 units, but 2 gene-disrupted strain did not show activity, indicating that the invertase gene was completely disrupted.

Example 6: Invertase gene disruption strain
Expression of heterologous gene in Saccharomyces cerevisiae-derived acid phosphatase and Acremoni in the invertase gene-disrupted strain prepared in Example 5
An attempt was made to express a um-derived glycosyltransferase (an enzyme having an activity of producing an oligosaccharide such as nigerose (3-O-α-glucopyranosylglucose)).

(1) Construction of expression plasmid and acquisition of transformant The acid phosphatase gene expression plasmid was constructed as follows. Report by Arima et al. (Arima, K. et al., Nuc
leic Acids Res., 11, 1657 (1983)), the acid phosphatase structural gene derived from Saccharomyces cerevisiae was obtained by PCR. The following two types of oligonucleotides were synthesized as PCR primers. SCAP5; 5'-GGGTCTAGATGTTTTA
AATCTGTTGTTTTATTCAATTTTTAG-
3 '(SEQ ID NO: 35) SCAP3; 5'-GGGGGATCCTATTTTGT
TTTAATAGGGTATCATTGTAGTG-
3 '(SEQ ID NO: 36)

Chromosome D prepared from S. cerevisiae S288C strain
NA and the primers SCAP5 and SCAP3 are mixed,
PC using Ex Taq Polymerase (Takara Shuzo)
R ((94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 2 minutes)
(× 25 cycles). The reaction product was subjected to agarose gel electrophoresis to collect the amplified DNA fragment. The amplified DNA fragment was cloned into the SmaI site of pUC18 using SureClone Ligation Kit (Amersham Pharmacia). Amplify DN using Dye Terminator Cycle Sequence Kit (Perkin Elmer)
The nucleotide sequence of the A fragment was determined, and a clone that was correctly amplified was selected. A DNA fragment containing the acid phosphatase structural gene was obtained by digestion with XbaI and BamHI, and then the expression vector pGAPPT10 (Kondo, K. et al., Natur.
e Biotechnology, vol. 15, 453 (1997)) XbaI and B
It was introduced during amHI. The obtained acid phosphatase expression plasmid under the control of GAP promoter and terminator was designated as pGAPPH05. Gene expression cassette Not from plasmid pGAPPHO5
It was isolated as an I-PstI fragment and introduced between NotI and PstI of pURAL10 (Re-published Publication 98-7873), the transformant selection marker gene was the cycloheximide resistance gene, and the integration site was the Candida utilis URA3 locus. A gene expression plasmid pU
PHO10 was constructed.

On the other hand, regarding the glycosyltransferase gene expression plasmid, the Acremonium-derived glycosyltransferase expression plasmid pGA under the control of the GAP promoter and terminator is used.
The gene expression cassette region was isolated as a NotI-PstI fragment from PNG1 (JP-A-11-9276),
Similarly, the gene expression plasmid pUNG10 was constructed by introducing it between NotI and PstI of pURAL10.

Candida Utilis IFO 098
8 strains and invertase gene 2 gene disruption strain
plasmid pUPHO10, pUNG cleaved with II
Transformed in 10 to obtain a transformant showing cycloheximide resistance. In addition, the transformation is described in JP-A-8-1731.
The electric pulse method described in No. 70 was used. Chromosomal DNA was prepared from each transformant,
The copy number of the expression plasmid integrated into the chromosome was measured by Southern analysis. The chromosomal DNA digested with EcoRI and NotI was digested with SalI from pURAL10.
Hybridization was carried out using the cycloheximide-resistant gene DNA fragment isolated by digestion with PstI as a probe DNA. As a result of autoradiography, in addition to the band (4 kb) derived from the endogenous L41 gene of Candida utilis, D which was used for transformation
A band (pUPHO10; 5.2k) produced by integration of the NA fragment into the chromosomal URA3 locus.
b, pUNG10; 6.6 kb) was detected. Candida utilis L41 gene is 2 per cell
Since it has already been shown that a copy exists, it was determined that the band derived from the endogenous L41 gene corresponds to two copies of the L41 gene, and the copy number of the integrated plasmid was determined by comparing the band intensities. . The band density was measured using an imaging analyzer BAS2000 (Fujifilm).

(2) Confirmation of expression of acid phosphatase gene Among the transformants obtained from the wild strain and the invertase gene-disrupted strain, 9 to 12 acid phosphatase genes were detected.
The acid phosphatase expression level was examined for each of the two strains into which the copy had been incorporated. YPD medium (2%
Glucose, 1% Yeast extract, 2%
The precultured cells that had been shake-cultured in peptone) at 30 ° C. for 24 hours were inoculated into a YPD medium so that the OD600 was 0.1, and further cultured at 30 ° C. with shaking. The method for measuring acid phosphatase activity is the method of Toh-e et al.
e, A. et al., J. Bacteriol., 113, 727 (1973)), the washed bacterial cell suspension was directly used for activity measurement. One unit of enzyme activity was the amount of enzyme that produced 1 μmol of p-nitrophenol in 1 minute at 30 ° C. The growth and acid phosphatase specific activities of the transformants at each culture time are shown in FIG. It was shown that the transformant derived from the invertase gene-disrupted strain had a higher acid phosphatase expression level than the transformant derived from the wild strain.

(3) Confirmation of expression of glycosyltransferase derived from genus Acremonium Among wild strains and invertase gene-disrupted strains, 3 to 4 copies of the glycosyltransferase gene were incorporated, respectively.
The expression level of glycosyltransferase was examined for each strain. YPD medium (2% glucose, 1% Yeast extra
The pre-cultured cells that had been shake-cultured for 24 hours at 30 ° C. in ct, 2% peptone were inoculated into the YPD medium so that the OD600 was 0.1, and further cultured at 30 ° C. with shaking. Using the culture supernatant obtained by centrifugation, glycosyltransferase activity was measured as follows. 500 μl of 20
mM sodium phosphate buffer, 250 μl of 20
Culture supernatant diluted with mM sodium phosphate buffer was mixed with 250 μl of 2% maltose dissolved in 20 mM sodium phosphate buffer, and the mixture was reacted at 37 ° C. for 20 minutes. After adding 250 μl of 4 M Tris-HCl buffer (pH 7.0) to stop the reaction,
100 μl GOD reagent (100 mg glucose AP
II color former; Wako Pure Chemical, 0.04 g of aminoantipyrine, 2 ml of 5% phenol solution, 48 ml of 0.1
M Tris-HCl buffer (pH 7.0)) was added, and the mixture was further reacted at 37 ° C. for 40 minutes. The amount of glucose excised from maltose was determined by measuring the absorbance at 505 nm. 1 unit of enzyme activity is 37
It was defined as the amount of enzyme that liberates 1 μmol glucose per minute at ° C. The glycosyltransferase activity of the transformant at each culture time is shown in FIG. It was shown that the transformant derived from the invertase gene-disrupted strain had a higher enzyme expression level than that derived from the wild strain.

From these, it was shown that the invertase gene-disrupted strain is a host strain excellent in secretory production of a heterologous protein.

Example 7: Glucanase and glucosidase
Of Candida utilis IFO0988 strain in SD medium
(2% glucose, 0.67% Yeast Nit
SDS with respect to the supernatant cultured in Rogen Base)
-When polyacrylamide gel electrophoresis was performed, four protein bands were detected in addition to invertase. A total of 1 of 10 μl per lane for the culture supernatant of Candida utilis concentrated 500 times
0 lane SDS-polyacrylamide gel electrophoresis was performed. After the electrophoresis gel was transferred to a PVDF membrane, the partial amino acid sequence of the protein corresponding to each band was determined according to the method described in Example 1. When the obtained partial amino acid sequence was subjected to a homology search by BLAST, two of the four examined proteins were found to be exo-1,3-β-glucanase and glucan 1,3-β-glucosidase of budding yeast. It was found to be a protein with high homology.

The partial amino acid sequence and N-terminal amino acid sequence obtained below are shown below.

Protein 1 (β-glucanase) N-terminal sequence FDYDNDKIRGVNIGG (SEQ ID NO: 37) DN-3 DSLQFQN (SEQ ID NO: 38) DN-7 DHHHY (SEQ ID NO: 39) DN-11 DNHRRYIEAQL (SEQ ID NO: 40) DN-12QYDPYDEYGDYPY (SEQ ID NO: 41) AP-4 (K) LAYNGIFPQPL (SEQ ID NO: 4
2)

Protein 2 (β-glucosidase) N-terminal sequence VGDLAFNLGV (SEQ ID NO: 43) DN-2 DGAAHPAIAA (SEQ ID NO: 44) DN-9 LEVLSA (SEQ ID NO: 45) AP-4 LAFNLGV (SEQ ID NO: 46) AP-6 (K) AITVGSEAL (SEQ ID NO: 47)

Example 8: Candida utilis β
-Cloning of glucanase gene β- from Candida utilis IFO 0988 strain
The glucanase gene was obtained and its nucleotide sequence was determined.

(1) Preparation of probe The following oligonucleotide EX corresponding to the N-terminal sequence FDYDNDKI (SEQ ID NO: 48) and the partial amino acid sequence DPYIQGQ (SEQ ID NO: 49) of β-glucanase was prepared.
O1-1F and EXO1-2R were synthesized. EXO1-1F; 5'-TTYGAYTAYGAYAA
YGAYAARAT-3 ′ (SEQ ID NO: 50) EXO1-2R; 5′-TGNCCYTGDATRTA
HGGRTC-3 '(SEQ ID NO: 51)

The above primers EXO1-1F, EXO1
-2R and Candida utilis chromosomal DNA were mixed, and PCR using Ex Taq Polymerase (Takara Shuzo) ((30 seconds at 94 ° C, 1 minute at 50 ° C, 2 minutes at 72 ° C) x 30 cycles) was performed. I did. Amplified about 0.
The 3 kb DNA fragment was digested with SureClone Ligation Kit (Amersham Pharmacia) to obtain SmaI of pUC18.
Cloned into the site. Using a dye terminator cycle sequence kit (Perkin Elmer), the nucleotide sequence of the amplified DNA fragment was determined, and the deduced amino acid sequence was used as the amino acid sequence of exo-1,3-β-glucanase of Saccharomyces cerevisiae (Genbank accession number; P23776), high homology was observed, and it was confirmed that a part of β-glucanase gene was amplified.

(2) Construction and screening of DNA library Candida utilis chromosomal DNA was cleaved with various restriction enzymes, and then Southern hybridization was carried out using the DNA fragment obtained in Example 8 (1) as a probe. I did. Radiolabels on the probes are EcoRI and XbaI.
The DNA fragment isolated by cleavage was used as a megaprimer DN.
A labeling system (Amersham Pharmacia) was used. Southern hybridization is carried out by a conventional method (Molecular cloning 2nd edn., Ed. Sambrook, J.,
et al., Cold Spring Harbor Laboratory USA, 198
9). As a result, about 5 kb ClaI
It was considered that the β-glucanase gene was present in the -HindIII fragment. Therefore, a library was constructed in order to clone the DNA fragment. Candida
The chromosomal DNA of Utilis was labeled with ClaI and HindIII.
After digestion with agarose gel, DNA around 5 kb
The fragment was recovered from the gel. The recovered DNA fragment is pBl
ClaI and Hind of uescript II SK +
It was introduced between III and the resulting recombinant plasmid was
E. coli DH based on Han's method (Gene, 10, 63 (1980))
The 5α strain was transformed to construct a library. These libraries were screened by colony hybridization using the DNA fragment obtained in (1) as a probe. A clone carrying the plasmid pCUEXO1 was selected as a positive clone by autoradiography.

(3) Determination of DNA sequence A restriction enzyme map of the plasmid pCUEXO1 (Fig. 6) was prepared. From the result of the genomic Southern analysis of Example 8 (2), it was considered that the β-glucanase structural gene existed between SalI and HindIII in FIG. 6, so the nucleotide sequence of this region was determined. pCUEXO1 was digested with SalI, and double-strande was obtained for plasmid pCUEXO1ΔsalI obtained by self-ligation.
Various deletion mutants were obtained using d Nested Deletion Kit (Amersham Pharmacia). The base sequence was determined using a dye terminator cycle sequence kit (Perkin Elmer), and the base sequences obtained were joined together to obtain the base sequence shown in SEQ ID NO: 52.

The base sequence of SEQ ID NO: 52 has an open reading frame consisting of 1263 base pairs starting from the 1268th position and ending at the 2530th position. The amino acid sequence (SEQ ID NO: 53) deduced from this open reading frame and exo-1, derived from Saccharomyces cerevisiae,
When the homology with 3-β-glucanase was examined, it was found to be 56.
% Amino acids were identical. Signal sequence breakpoint prediction (von Heijine, Nucleic. Acids Res., 14, 4683 (198
The signal sequence deduced by 6)) is 1 of SEQ ID NO: 53.
It was 17 amino acids from the 23rd methionine to the 17th alanine (SEQ ID NO: 4). The signal sequence and the N-terminal amino acid sequence of the secreted β-glucanase obtained in Example 7 FDYDNDKIRGVNIGG (SEQ ID NO: 5
Between 4), a pro-sequence consisting of 16 amino acids presumed to be excised by a pro-sequence cleaving protease that recognizes the sequence KR, like the exo-1,3-β-glucanase of Saccharomyces cerevisiae, was present. The amino acid sequence of a peptide consisting of the prepro sequence of β-glucanase is shown in SEQ ID NO: 5.

Example 9: Candida utilis β
-Cloning of glucosidase gene β- from Candida utilis IFO 0988 strain
The glucosidase gene was obtained and its nucleotide sequence was determined.

(1) Preparation of probe Saccharomyces cerevisiae and Candida albicans glucan 1,3-β
-Based on the amino acid sequence of glucosidase (Genbank accession number; P15703 and P43070, respectively), the amino acid sequence VGSEALYR (SEQ ID NO: 5) conserved in both
5) and the following oligonucleotides EXO2-2F, EXO2 corresponding to WVGETGWP (SEQ ID NO: 56):
-4R was synthesized. EXO2-2F; 5'-GTNGGNWSNGARG
CNYTNTAYMG-3 ′ (SEQ ID NO: 57) EXO2-4R; 5′-GGCCANCCNGTYT
CNCCNANNCA-3 ′ (SEQ ID NO: 58)

The above primers EXO2-2F and EXO2
-4R and Candida utilis chromosomal DNA were mixed, and PCR using Ex Taq Polymerase (Takara Shuzo) ((30 seconds at 94 ° C, 1 minute at 50 ° C, 2 minutes at 72 ° C) x 30 cycles) was performed. I did. Amplified about 0.
The 3 kb DNA fragment was digested with SureClone Ligation Kit (Amersham Pharmacia) to obtain SmaI of pUC18.
Cloned into the site. Using the dye terminator cycle sequence kit (Perkin Elmer), the nucleotide sequence of the amplified DNA fragment was determined, and the deduced amino acid sequence was compared with glucan 1,3-β-glucosidase of Saccharomyces cerevisiae, showing high homology. It was confirmed that a part of the β-glucosidase gene was amplified.

(2) Construction and screening of DNA library Candida utilis chromosomal DNA was cleaved with various restriction enzymes, and then Southern hybridization was carried out using the DNA fragment obtained in Example 9 (1) as a probe. I did. A DNA fragment isolated by digestion with EcoRI and PstI was used as a probe. As a result, about 4.5
The β-glucosidase gene was considered to be present in the ClaI fragment of kb. Therefore, in order to clone the DNA fragment, the chromosomal DNA of Candida utilis was cleaved with ClaI, and the DNA fragment near 4.5 kb was pB.
A library introduced into ClaI of luescript II SK + was constructed.

The DNA library was screened by colony hybridization using the DNA fragment obtained in Example 9 (1) as a probe. A clone carrying the plasmid pCUUXO2 was selected as a positive clone by autoradiography.

(3) Determination of DNA sequence A restriction enzyme map of plasmid pCUEXO2 (Fig. 7) was prepared. From the result of the genomic Southern analysis of Example 9 (2), it was considered that the β-glucosidase structural gene exists between ClaI and BglII in FIG. 7, so the nucleotide sequence of this region was determined. After blunting the 2 kb ClaI-BglII fragment into the SmaI site of pUC18,
Each was cloned in both directions. Various deletion mutants were obtained from each plasmid using the double-stranded Nested Deletion Kit (Amersham Pharmacia). The base sequence was determined using a dye terminator cycle sequence kit (Perkin Elmer), and the base sequences obtained were joined together to obtain the base sequence shown in SEQ ID NO: 5.

A partial amino acid sequence of β-glucosidase determined in Example 7 was found in the amino acid sequence deduced from the 345 to 1202nd region of SEQ ID NO: 59, and this region is a glucan 1 of other yeasts. It showed high homology with 3-β-glucosidase. However, although a stop codon (TAA) was found in the upstream region of the same reading frame, the start codon (ATG) could not be found. Since an intron was considered to exist in the β-glucosidase gene of Candida utilis, 5'RAC
The cDNA was analyzed by E.

Experiments (Preparation of High Molecular Weight RMA; Me from Candida utilis IFO0988 strain grown in YPD medium until mid-logarithmic growth phase)
thods in Enzymology, vol. 194, p398, Academic Pres
Total RNA was prepared according to the method described in s).
From the obtained total RNA, Oligotex ^™ -dT30
<Super> mRNA Purificatio
mRNA was purified using n Kit (Takara Shuzo). 5'RACE System, version
2.0 (Life Tech Oriental Co., Ltd.)
The 5'upstream region of the cDNA of β-glucosidase gene was analyzed. As the β-glucosidase gene-specific primer, EX2R; 5′-TTCGAACGTTACATAG
CAGTTTCTTCCCTC-3 ′ (SEQ ID NO: 60) was used. About 0.7 kb D amplified by PCR
The NA fragment was cloned into the SmaI site of pUC18 using the Sure Clone Ligation Kit (Amersham Pharmacia). The base sequence of the amplified DNA fragment was determined using a dye terminator cycle sequence kit (Perkin Elmer). As a result, the start codon of the β-glucosidase gene was ATG starting from the 133rd position of SEQ ID NO: 59, and 196 to 3 of SEQ ID NO: 59.
The 44th region was found to be an intron. SEQ ID NO: 61 shows the nucleotide sequence of the coding region of β-glucosidase gene cDNA, and SEQ ID NO: 62 shows the deduced amino acid sequence. This deduced amino acid sequence (SEQ ID NO: 62) and the budding yeast-derived glucan 1,3-β-
When the homology with glucosidase was examined, 65% of the amino acids were the same. N-terminal amino acid sequence (VGDLAFNLGV) (SEQ ID NO: 63) obtained in Example 7 and signal sequence breakpoint prediction (von Heijine, Nuclei
c. Acids Res., 14, 4683 (1986)), the secretory signal sequence of β-glucosidase was considered to be 18 amino acids from the 1st methionine to the 18th alanine (SEQ ID NO: 6).

Example 10: Candida utilis min.
Expression of heterologous genes using secretion signals Candida utilis β-glucanase and β
Saccharomyces cerevisiae-derived glucoamylase was expressed using the secretory signal sequence of glucosidase.

(1) Construction of Expression Plasmid and Acquisition of Transformant The following oligonucleotides were synthesized to replace the sequence (SEQ ID NO: 5), the β-glucosidase secretion signal sequence (SEQ ID NO: 6). EXP1-
5 is a pre-sequence of β-glucanase (SEQ ID NO: 4), EX
PP1-5 is a β-glucanase pre / pro sequence (SEQ ID NO: 5), EXPP2-5 is a β-glucanase pre / pro sequence
Part of the pro sequence (sequences 1-31 of SEQ ID NO: 5), EX2-5 is an oligonucleotide for substituting the β-glucosidase secretion signal sequence (SEQ ID NO: 6), respectively, and ST-3 is gluco. It is an oligonucleotide corresponding to the complementary strand of the amylase gene.

EXP1-5; 5-CCCTCTAGA
TGCTACTTTCGCTATTGACCTTATC
CTTTTTGACGTTTGTGATCAATGCC
TTGGGGTTTTCCAACTGCACTAGTTTC
CTAGAG-3 ′ (SEQ ID NO: 64) EXPP1-5; 5′-CCCTCTAGATGCT
ACTTTCGCTATTGACCTTATCCTTT
TTGACGTTTGTTGATCAATGCCACTC
CTATCCCATCCCGTGGCGGTCACCA
GCTGTACAAGAGAGGGTGGCTTGGGGT
TTTCCAACTGCACTAGTTCCTAGAG
-3 '(SEQ ID NO: 65) EXPP2-5; 5'-CCCTCTAGATGCT
ACTTTCGCTATTGACCTTATCCTTT
TTGACGTTTGTTGATCAATGCCACTC
CTATCCCATCCCGTGGCGGTCACCA
GCTGTACAAGAGATTGGGGTTTTCCA
ACTGCACTAGTTCCTAGAG-3 ′ (SEQ ID NO: 66) EX2-5; 5′-CCCTCTAGATGCGTT
TTTCCCACTCTCGCTGCTACCGCTGC
TGTTCTCTCTTCTGTTCACGCCCTTG
GGTTTTCCAACTGCACTAGTTCCTA
GAGG-3 '(SEQ ID NO: 67) ST-3; 5'-GGTGACAAATGTAGTT
GTAATTTCACCACC-3 ′ (SEQ ID NO: 68)

EXP1-5, EXPP1-5, EXPP
A plasmid pUS having a glucoamylase gene of Saccharomyces diastaticus using any of 2-5 and EX2-5 and ST-3 as primers.
PC using TA2 <JP-A-8-173170> as a mold
R ((94 ° C for 30 seconds, 55 ° C for 1 minute, 72 ° C for 1 minute)
(× 20 cycles). Amplified about 0.5 k
The DNA fragment of b was cloned into the SmaI site of pUC18 using SureClone Ligation Kit (Amersham Pharmacia). Amplification D using Dye Terminator Cycle Sequence Kit (Perkin Elmer)
The nucleotide sequence of the NA fragment was determined, and a clone that was correctly amplified was selected. From each selected clone,
The region containing the signal sequence is approximately 0.2 kb of XbaI-H
isolated as an indIII fragment, H from pUSTA2
pUPHO1 along with the indIII-BglII fragment
0 (Example 6) was introduced between XbaI and BamHI. The resulting plasmid, the secretion signal sequence is one of the β-glucanase pre-sequence (SEQ ID NO: 4), β-glucanase pre / pro sequence (SEQ ID NO: 5) and β-glucanase pre / pro sequence of Candida utilis Parts (sequences from 1 to 31 of SEQ ID NO: 5), pU was used for glucoamylase expression plasmids substituted with β-glucosidase secretion signal sequence (SEQ ID NO: 6), respectively.
STAP1, pUSTAP1, pUSTAP2, p
It was named USTAEX2.

Candida Utilis IFO 098
Plasmid pUSTAP1 obtained by digesting 8 strains with BglII,
pUSTAP1, pUSTAP2, pUSTAEX
2 was transformed to obtain cycloheximide-resistant transformants. Chromosomal DNA was prepared from each transformant, and the copy number of the expression plasmid integrated into the chromosome was measured by Southern analysis. Eco
Chromosomal DNA digested with RI is S from pURAL10
Hybridization was carried out using the cycloheximide resistance gene DNA fragment isolated by digestion with alI and PstI as a probe DNA. As a result of autoradiography, in addition to the 4 kb band derived from the L41 gene endogenous to Candida utilis, 4.5 kb and 6.4 kb bands containing the incorporated plasmid were detected. Of the two bands containing the integrated plasmid, the 4.5 kb band corresponds to one copy, so the 4 kb band derived from the endogenous L41 gene and the 6.4 kb band containing the integrated plasmid were concentrated. Comparison of the strength of the clones The copy number of the integrated plasmid was determined.
Band density is based on Imaging Analyzer BAS200
0 (Fuji Film Co., Ltd.) was used for the measurement.

(2) Confirmation of glucoamylase expression pUSTAP1, pUSTAP1, pUSTAP
The glucoamylase expression level was examined for each of 3 independent transformants in which 2 and 4 copies of pUSTAEX2 were incorporated. YPD medium (2% glucose, 1
% Yeast extract, 2% peptone) 3
Pre-cultured cells that had been shake-cultured at 0 ° C for 24 hours were OD
The cells were inoculated into a YPD medium so as to be 600 = 0.1, and further cultured by shaking at 30 ° C. for 36 hours. The glucoamylase activity was measured as follows using the culture supernatant obtained by centrifugation. 400 μl of culture supernatant,
With 500 μl of reaction solution containing 5% soluble starch and 100 mM sodium acetate buffer (pH 5.0),
The reaction was carried out at 50 ° C for 60 minutes. After the reaction, the enzyme was inactivated by heat treatment at 95 ° C. for 5 minutes, and the released glucose was measured using a glucose concentration measurement kit (Glucose B-test (Wako Pure Chemical Industries)). 1 unit of enzyme activity is 30
It was defined as the amount of enzyme that produced 1 mmol of p-nitrophenol per minute at ° C. The activity value per 1 ml of culture supernatant is shown in Table 2, and the secretory signal sequences of β-glucanase and β-glucosidase derived from Candida utilis obtained by the present invention can be used for secretory expression of a heterologous protein. Was shown.

[0113]

[Table 2]

[0114]

[Sequence list]                                SEQUENCE LISTING         <110> Kirin Beer Kabushiki Kaisha <120> Modified yeasts producing a foreign protein and methods       for producing the foreign protein using the same <130> 131773 <140> <141> <160> 68 <170> PatentIn Ver. 2.1 <210> 1 <211> 4754 <212> DNA <213> Candida utilis <220> <221> CDS <222> (2182) .. (3840) <400> 1 atcgatacaa ccttggaaag gagagccacc taacctttca gttccaaaga tcttccccaa 60 tgaaaagaaa taactcgaag ccttgttggc aaagcacaga ttgctagcag ctaaccccca 120 tctaatgtca tccaaatcgg taaagaacct ccacggtaag aacccccaca taaacggatc 180 atcaaccacg gacatatggt tcatcacagt cacaaggccc ctattctcct cacgtgcttt 240 tgataatgcc ctgtccaagt tctccagccc gtggagatgg ggttcataga acaagttcaa 300 cacggtcttg gagaacccaa ccacggccat acacgtggct tgagaagccc aattccacca 360 cacggatctt cttggaaggt ccgacaagac atcatcacca cgctccagta cctgtggaag 420 tgacatttgc ctctactctt tctccttgat cgggtcctct taatgtctaa tggagcaact 480 cgtaggaaaa acactatctg gataaatgtc caacatacac ataaaaagtt ttctcggggg 540 tgcctcgcaa cgctgtgtgt gcatacgcat ggacataatt gacgaggaaa cgggtattaa 600 atcacgatct cggtataatt tgacgaattt gtatgtgtta tgggcctatg tgaggatact 660 gctggtgtga gtacctgaac gttttcagaa gaatgtgtat tagctgtatt gtgccttgtc 720 tgagtagtga aagtccggag acttaggagc cgaccccagg tttcattgat tctggtgcta 780 tgtatcaacg accaggctta taagacctgt taaatcggct ttaatggtgg ctttacgcag 840 ttagttcaat gatttatcta tcaattcatg tatattgtgt atttatttta tgttagtaga 900 aggaatagct gtaacattaa aagttttgaa taatttaaca tggacatttt tgaaagaaac 960 cttgaacaaa aaaatcccaa aaagtgacga aaatcatttg aaatttctcc aaaatgatcg 1020 gtaaaagtta ttataaacat ataaacacat cctggtacat tgtaattggt attttatatt 1080 caatattttg ctccacgtca ctattatgaa ctacttacac agcacatatc tcccaccgag 1140 aaacaggtcc cttggcccag ttggttaagg cgtggtgcta ataacgccaa gatcagcagt 1200 tcgatcctgc tagggaccat tctttatttt ttcgtttcgg cttcacttgg gcttcatttg 1260 ggttggtgtt tggatgtatt ggacccaatg cttagagtac atcgtcttga tgctaatacg 1320 aacacagatg gcagctacaa gactgtggtt caaaagctac gtcaccccac gttgtattgt 1380 tatttactat agcacctatc aaataactat ttgaataatt gctcattatg agcaataaag 1440 ggtggcccct gctatccgca cagaagcgga cactgatgtc ctccgtctaa aactcatcgt 1500 ttaataactt ctgcattggc agctccggag cacactcaat tgggactaaa agaagtaaca 1560 tttgtactac aatgagtcgt atagagtcat cgtataagaa gaacagcaag aaaagaaaat 1620 attggtgcag aattcaacag cttctgagat cgtaagaaca gccaatcatt taccggaatt 1680 cattatgata cctatagaaa gacacaaatt gttgggtaaa acaacagaac atacctctat 1740 aggggtttat acgagaattt tcttagacgt ctcccccagt gtccgccaaa gcaacttaca 1800 tgtggagttt gaatttggat gcgccttttc ctttaaacgg tcacctgagg tctgaatctc 1860 aatgcaaata tcattacacc aataataaag gtgcatataa ccccataacc tgtacataaa 1920 gaacggcaca tgatccaatt tatgacgtta tgccttgtca gaccatgtcg tgaacttttc 1980 taaaccggat aaactctcgc acggatttat aacgtgcgtc tgtgatatgc acctccggaa 2040 aaaacccccg tggagaagtg aagcggccac ctgtggagca gaaatttcga tcgacgtttc 2100 aagttcaaat ggtttcctgt tgtcaaaggg cttgagattt accacttgag catttgtgct 2160 cagaattcgg agagcattcc c atg agt ggt gtc caa aaa cac tat aaa agc 2211                         Met Ser Gly Val Gln Lys His Tyr Lys Ser                           1 5 10 agc aca ggg atg tcg ttg aca aaa gat gcc tca gag gac caa gaa gac 2259 Ser Thr Gly Met Ser Leu Thr Lys Asp Ala Ser Glu Asp Gln Glu Asp                  15 20 25 atc aag agt ctc acg atg aac act agt tta gtt gat tcc agc att tac 2307 Ile Lys Ser Leu Thr Met Asn Thr Ser Leu Val Asp Ser Ser Ile Tyr              30 35 40 aga cca tta gtc cat cta acg cca cca gtg ggg tgg atg aac gac cct 2355 Arg Pro Leu Val His Leu Thr Pro Pro Val Gly Trp Met Asn Asp Pro          45 50 55 aat ggt ctc ttc tac gat tca tat gaa tct acc tac cat gtg tac tac 2403 Asn Gly Leu Phe Tyr Asp Ser Tyr Glu Ser Thr Tyr His Val Tyr Tyr      60 65 70 caa tac aac cca aac gat acg att tgg gga ttg cct cta tat tgg gga 2451 Gln Tyr Asn Pro Asn Asp Thr Ile Trp Gly Leu Pro Leu Tyr Trp Gly 75 80 85 90 cat gcc acc tct gat gat ttg tta acg tgg gac cac cat gcg cct gca 2499 His Ala Thr Ser Asp Asp Leu Leu Thr Trp Asp His His Ala Pro Ala                  95 100 105 att gga cct gaa aat gat gat gag ggt att tac tct gga tct ata gtc 2547 Ile Gly Pro Glu Asn Asp Asp Glu Gly Ile Tyr Ser Gly Ser Ile Val             110 115 120 ata gac tac aat aat acc tca ggg ttc ttt gac gat tca aca aga cca 2595 Ile Asp Tyr Asn Asn Thr Ser Gly Phe Phe Asp Asp Ser Thr Arg Pro         125 130 135 gaa cag aga atc gtt gcc att tat acc aat aac tta cca gat gtc gag 2643 Glu Gln Arg Ile Val Ala Ile Tyr Thr Asn Asn Leu Pro Asp Val Glu     140 145 150 acg caa gac att gcc tat tcc acg gac ggt ggt tat act ttc gaa aag 2691 Thr Gln Asp Ile Ala Tyr Ser Thr Asp Gly Gly Tyr Thr Phe Glu Lys 155 160 165 170 tat gaa aaa aac cca gtt ata gac gtc aat tcg acc caa ttt agg gat 2739 Tyr Glu Lys Asn Pro Val Ile Asp Val Asn Ser Thr Gln Phe Arg Asp                 175 180 185 ccg aag gtg att tgg tat gag gaa act gaa caa tgg gtc atg act gtg 2787 Pro Lys Val Ile Trp Tyr Glu Glu Thr Glu Gln Trp Val Met Thr Val             190 195 200 gca aag agt caa gag tac aag atc cag att tac acc tct gac aat ttg 2835 Ala Lys Ser Gln Glu Tyr Lys Ile Gln Ile Tyr Thr Ser Asp Asn Leu         205 210 215 aaa gac tgg agt ttg gcc tcg aat ttc tca acc aag ggt tat gtt ggt 2883 Lys Asp Trp Ser Leu Ala Ser Asn Phe Ser Thr Lys Gly Tyr Val Gly     220 225 230 tat cag tat gaa tgt cca ggt cta ttc gaa gcc act att gaa aac cca 2931 Tyr Gln Tyr Glu Cys Pro Gly Leu Phe Glu Ala Thr Ile Glu Asn Pro 235 240 245 250 aag agt ggt gac cca gag aag aaa tgg gtt atg gtc tta gca atc aat 2979 Lys Ser Gly Asp Pro Glu Lys Lys Trp Val Met Val Leu Ala Ile Asn                 255 260 265 cca ggc tca cct ctt ggt ggt tcc ata aat gaa tac ttt gtt ggt gat 3027 Pro Gly Ser Pro Leu Gly Gly Ser Ile Asn Glu Tyr Phe Val Gly Asp             270 275 280 ttc aac ggt act gaa ttc att cca gat gat gac gct aca aga ttt atg 3075 Phe Asn Gly Thr Glu Phe Ile Pro Asp Asp Asp Ala Thr Arg Phe Met         285 290 295 gat act ggt aag gac ttc tat gcc ttc caa gcg ttc ttc aat gca ccg 3123 Asp Thr Gly Lys Asp Phe Tyr Ala Phe Gln Ala Phe Phe Asn Ala Pro     300 305 310 gag aat cgg tca att gga gtt gcc tgg tca tcg aac tgg cag tat tcc 3171 Glu Asn Arg Ser Ile Gly Val Ala Trp Ser Ser Asn Trp Gln Tyr Ser 315 320 325 330 aac cag gtt ccg gat cct gat gga tat aga agc tcc atg tca tca atc 3219 Asn Gln Val Pro Asp Pro Asp Gly Tyr Arg Ser Ser Met Ser Ser Ile                 335 340 345 aga gag tac act ctg aga tat gtc agt acg aat cca gaa tct gaa cag 3267 Arg Glu Tyr Thr Leu Arg Tyr Val Ser Thr Asn Pro Glu Ser Glu Gln             350 355 360 ttg atc ctt tgt caa aaa cca ttc ttt gtg aac gag aca gac ttg aag 3315 Leu Ile Leu Cys Gln Lys Pro Phe Phe Val Asn Glu Thr Asp Leu Lys         365 370 375 gtg gtt gaa gag tac aag gtt tca aac agt tct ttg acc gtg gac cac 3363 Val Val Glu Glu Tyr Lys Val Ser Asn Ser Ser Leu Thr Val Asp His     380 385 390 acg ttt gga agt agc ttt gca aac tcc aac acc act gga ctg ttg gat 3411 Thr Phe Gly Ser Ser Phe Ala Asn Ser Asn Thr Thr Gly Leu Leu Asp 395 400 405 410 ttc aac atg act ttc acg gtt aac ggt aca act gac gtt acg cag aag 3459 Phe Asn Met Thr Phe Thr Val Asn Gly Thr Thr Asp Val Thr Gln Lys                 415 420 425 gac tcc gtc acc ttt gag ctc aga atc aaa tct aac caa agc gac gag 3507 Asp Ser Val Thr Phe Glu Leu Arg Ile Lys Ser Asn Gln Ser Asp Glu             430 435 440 gca att gcg ctt ggt tac gat tac aac aac gag caa ttc tac atc aac 3555 Ala Ile Ala Leu Gly Tyr Asp Tyr Asn Asn Glu Gln Phe Tyr Ile Asn         445 450 455 aga gcc aca gag agc tac ttc cag aga acc aac cag ttc ttc cag gag 3603 Arg Ala Thr Glu Ser Tyr Phe Gln Arg Thr Asn Gln Phe Phe Gln Glu     460 465 470 aga tgg tcc acg tac gtc cag cct ctc aca atc acc gaa tct ggt gat 3651 Arg Trp Ser Thr Tyr Val Gln Pro Leu Thr Ile Thr Glu Ser Gly Asp 475 480 485 490 aaa cag tac cag ctc tac gga ttg gtt gat aac aac atc ctt gag ttg 3699 Lys Gln Tyr Gln Leu Tyr Gly Leu Val Asp Asn Asn Ile Leu Glu Leu                 495 500 505 tac ttc aac gac ggg gca ttc aca tcc aca aac acc ttc ttc ttg gag 3747 Tyr Phe Asn Asp Gly Ala Phe Thr Ser Thr Asn Thr Phe Phe Leu Glu             510 515 520 aag ggc aag cca tca aac gtc gat atc gtg gca agc tcc tcc aag gag 3795 Lys Gly Lys Pro Ser Asn Val Asp Ile Val Ala Ser Ser Ser Lys Glu         525 530 535 gct tac acc gtg gac cag ctg act gtg aga cgt ctc act gtt tga 3840 Ala Tyr Thr Val Asp Gln Leu Thr Val Arg Arg Leu Thr Val     540 545 550 cgaatacgca cgtgaaagct atataaggga tcacgtggtc tagccacccc agtctaaaag 3900 cttcagcaaa ccgccactat ataaacagac aggtttgtca cttttcaaca aaacaaatat 3960 gcttcttctt ttacccttca gcgtagtttg tacgagtgct tttttcaatt atatatacaa 4020 caacgtgagc tgcctttgga tagcaatcaa cagcgctctc tttgttgaag agaaccggtt 4080 gcccgtgtta tcccgcgtat ccccggttat cgaaagatga gatataactt aacattctgc 4140 tgtctctacc attatgctgc cttatgcagc tatatgtagt aatgtgctgt atttgctgta 4200 gtagtgggta agaaggagag agtagtggtc cgtttctatg gatacaagag ggatccagcc 4260 gcgctcttcc ggtgaaatat ggttggttat acaactgagg aactatcaag aatacattga 4320 tcattatagt actctgtgag gagtctgcat gaaagccacc ttatgttggt tgccagttca 4380 ttggatctgc tccagcttct tccataagat tttcagtctt ctaattcctc ttctattctg 4440 actttcttgg tcgtcctcgt cctctcttct gttctgactt tcttggtcgt cctcgtcctc 4500 tcttcttctc aaccttggaa ggatttctat tggaagcacc cgcgaccctc tggttcttct 4560 tagtcttctt tttgatgcgc tgcatagtgt cgtgatgctc ttttaacact tgaaccgtct 4620 tcaggagaac cgctttgttg aatgtcttca ccgctgacct ggaactttga gacgtcgtct 4680 tgcgtatgat acatctattg gcctttgaca aacagctctg gtatctgaat actggtgggc 4740 agtaactgga attc 4754 <210> 2 <211> 552 <212> PRT <213> Candida utilis <400> 2 Met Ser Gly Val Gln Lys His Tyr Lys Ser Ser Thr Gly Met Ser Leu   1 5 10 15 Thr Lys Asp Ala Ser Glu Asp Gln Glu Asp Ile Lys Ser Leu Thr Met              20 25 30 Asn Thr Ser Leu Val Asp Ser Ser Ile Tyr Arg Pro Leu Val His Leu          35 40 45 Thr Pro Pro Val Gly Trp Met Asn Asp Pro Asn Gly Leu Phe Tyr Asp      50 55 60 Ser Tyr Glu Ser Thr Tyr His Val Tyr Tyr Gln Tyr Asn Pro Asn Asp 65 70 75 80 Thr Ile Trp Gly Leu Pro Leu Tyr Trp Gly His Ala Thr Ser Asp Asp                  85 90 95 Leu Leu Thr Trp Asp His His Ala Pro Ala Ile Gly Pro Glu Asn Asp             100 105 110 Asp Glu Gly Ile Tyr Ser Gly Ser Ile Val Ile Asp Tyr Asn Asn Thr         115 120 125 Ser Gly Phe Phe Asp Asp Ser Thr Arg Pro Glu Gln Arg Ile Val Ala     130 135 140 Ile Tyr Thr Asn Asn Leu Pro Asp Val Glu Thr Gln Asp Ile Ala Tyr 145 150 155 160 Ser Thr Asp Gly Gly Tyr Thr Phe Glu Lys Tyr Glu Lys Asn Pro Val                 165 170 175 Ile Asp Val Asn Ser Thr Gln Phe Arg Asp Pro Lys Val Ile Trp Tyr             180 185 190 Glu Glu Thr Glu Gln Trp Val Met Thr Val Ala Lys Ser Gln Glu Tyr         195 200 205 Lys Ile Gln Ile Tyr Thr Ser Asp Asn Leu Lys Asp Trp Ser Leu Ala     210 215 220 Ser Asn Phe Ser Thr Lys Gly Tyr Val Gly Tyr Gln Tyr Glu Cys Pro 225 230 235 240 Gly Leu Phe Glu Ala Thr Ile Glu Asn Pro Lys Ser Gly Asp Pro Glu                 245 250 255 Lys Lys Trp Val Met Val Leu Ala Ile Asn Pro Gly Ser Pro Leu Gly             260 265 270 Gly Ser Ile Asn Glu Tyr Phe Val Gly Asp Phe Asn Gly Thr Glu Phe         275 280 285 Ile Pro Asp Asp Asp Ala Thr Arg Phe Met Asp Thr Gly Lys Asp Phe     290 295 300 Tyr Ala Phe Gln Ala Phe Phe Asn Ala Pro Glu Asn Arg Ser Ile Gly 305 310 315 320 Val Ala Trp Ser Ser Asn Trp Gln Tyr Ser Asn Gln Val Pro Asp Pro                 325 330 335 Asp Gly Tyr Arg Ser Ser Met Ser Ser Ile Arg Glu Tyr Thr Leu Arg             340 345 350 Tyr Val Ser Thr Asn Pro Glu Ser Glu Gln Leu Ile Leu Cys Gln Lys         355 360 365 Pro Phe Phe Val Asn Glu Thr Asp Leu Lys Val Val Glu Glu Tyr Lys     370 375 380 Val Ser Asn Ser Ser Leu Thr Val Asp His Thr Phe Gly Ser Ser Phe 385 390 395 400 Ala Asn Ser Asn Thr Thr Gly Leu Leu Asp Phe Asn Met Thr Phe Thr                 405 410 415 Val Asn Gly Thr Thr Asp Val Thr Gln Lys Asp Ser Val Thr Phe Glu             420 425 430 Leu Arg Ile Lys Ser Asn Gln Ser Asp Glu Ala Ile Ala Leu Gly Tyr         435 440 445 Asp Tyr Asn Asn Glu Gln Phe Tyr Ile Asn Arg Ala Thr Glu Ser Tyr     450 455 460 Phe Gln Arg Thr Asn Gln Phe Phe Gln Glu Arg Trp Ser Thr Tyr Val 465 470 475 480 Gln Pro Leu Thr Ile Thr Glu Ser Gly Asp Lys Gln Tyr Gln Leu Tyr                 485 490 495 Gly Leu Val Asp Asn Asn Ile Leu Glu Leu Tyr Phe Asn Asp Gly Ala             500 505 510 Phe Thr Ser Thr Asn Thr Phe Phe Leu Glu Lys Gly Lys Pro Ser Asn         515 520 525 Val Asp Ile Val Ala Ser Ser Ser Lys Glu Ala Tyr Thr Val Asp Gln     530 535 540 Leu Thr Val Arg Arg Leu Thr Val 545 550 <210> 3 <211> 985 <212> DNA <213> Candida utilis <400> 3 gcttagagta catcgtcttg atgctaatac gaacacagat ggcagctaca agactgtggt 60 tcaaaagcta cgtcacccca cgttgtattg ttatttacta tagcacctat caaataacta 120 tttgaataat tgctcattat gagcaataaa gggtggcccc tgctatccgc acagaagcgg 180 acactgatgt cctccgtcta aaactcatcg tttaataact tctgcattgg cagctccgga 240 gcacactcaa ttgggactaa aagaagtaac atttgtacta caatgagtcg tatagagtca 300 tcgtataaga agaacagcaa gaaaagaaaa tattggtgca gaattcaaca gcttctgaga 360 tcgtaagaac agccaatcat ttaccggaat tcattatgat acctatagaa agacacaaat 420 tgttgggtaa aacaacagaa catacctcta taggggttta tacgagaatt ttcttagacg 480 tctcccccag tgtccgccaa agcaacttac atgtggagtt tgaatttgga tgcgcctttt 540 cctttaaacg gtcacctgag gtctgaatct caatgcaaat atcattacac caataataaa 600 ggtgcatata accccataac ctgtacataa agaacggcac atgatccaat ttatgacgtt 660 atgccttgtc agaccatgtc gtgaactttt ctaaaccgga taaactctcg cacggattta 720 taacgtgcgt ctgtgatatg cacctccgga aaaaaccccc gtggagaagat gaagcggcca 780 cctgtggagc agaaatttcg atcgacgttt caagttcaaa tggtttcctg ttgtcaaagg 840 gcttgagatt taccacttga gcatttgtgc tcagaattcg gagagcattc ccatgagtgg 900 tgtccaaaaa cactataaaa gcagcacagg gatgtcgttg acaaaagatg cctcagagga 960 ccaagaagac atcaagagtc tcacg 985 <210> 4 <211> 17 <212> PRT <213> Candida utilis <400> 4 Met Leu Leu Ser Leu Leu Thr Leu Ser Phe Leu Thr Leu Leu Ile Asn   1 5 10 15 Ala <210> 5 <211> 33 <212> PRT <213> Candida utilis <400> 5 Met Leu Leu Ser Leu Leu Thr Leu Ser Phe Leu Thr Leu Leu Ile Asn   1 5 10 15 Ala Thr Pro Ile Pro Ser Arg Gly Gly His Gln Leu Tyr Lys Arg Gly              20 25 30 Gly <210> 6 <211> 18 <212> PRT <213> Candida utilis <400> 6 Met Arg Phe Ser Thr Leu Ala Ala Thr Ala Ala Val Leu Ser Ser Val   1 5 10 15 His Ala <210> 7 <211> 13 <212> PRT <213> Candida utilis <400> 7 Lys Gly Lys Pro Ser Asn Val Asp Ile Val Ala Ser Ser   1 5 10 <210> 8 <211> 10 <212> PRT <213> Candida utilis <400> 8 Lys Asn Pro Val Ile Asp Val Asn Ser Thr   1 5 10 <210> 9 <211> 10 <212> PRT <213> Candida utilis <400> 9 Lys Ile Gln Ile Tyr Thr Ser Asp Asn Leu   1 5 10 <210> 10 <211> 11 <212> PRT <213> Candida utilis <400> 10 Lys Asp Trp Ser Leu Ala Ser Xaa Phe Xaa Thr   1 5 10 <210> 11 <211> 9 <212> PRT <213> Candida utilis <400> 11 Lys Asp Ser Val Thr Phe Glu Leu Arg   1 5 <210> 12 <211> 16 <212> PRT <213> Candida utilis <400> 12 Lys Glu Ala Tyr Thr Val Asp Gln Leu Thr Val Arg Arg Leu Thr Val   1 5 10 15 <210> 13 <211> 19 <212> PRT <213> Candida utilis <400> 13 Lys Gly Tyr Val Gly Tyr Gln Tyr Glu Cys Pro Gly Leu Phe Glu Thr   1 5 10 15 Ile Glu Asn <210> 14 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer AP1R <400> 14 gcnacdatrt cnacrtt 17 <210> 15 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer AP10F <400> 15 taycartayg artgycc 17 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV200 <400> 16 cgattctctg ttctggtctt gttg 24 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV300 <400> 17 catctggtaa gttattggta 20 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV No.1 <400> 18 gggcggccgc ttagagtaca tcgtcttg 28 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV No.2 <400> 19 ggtctagagg gaatgctctc cgaattct 28 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV No.3 <400> 20 ggtctagacc ctgtgctgct tttatagt 28 <210> 21 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV No.4 <400> 21 ggtctagacg tgagactctt gatgtctt 28 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 5AF <400> 22 gggtcgacat catcaccacg ctcca 25 <210> 23 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 5AR <400> 23 ggagatctag caggatcgaa ctgctg 26 <210> 24 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 5BF <400> 24 gggtcgactg tggttcaaaa gctacgt 27 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 5BR <400> 25 ggagatctca agccctttga caacag 26 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 3BF <400> 26 ggagatctta gcaatcaatc caggctc 27 <210> 27 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 3BR <400> 27 ggggtaccgt cgacgtttga tggcttgcc 29 <210> 28 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 3AF <400> 28 ggagatctca ctgtttgacg aatacgc 27 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer 3AR <400> 29 gggtaccgtc gacgtctcaa agttccaggt 30 <210> 30 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer RS42 <400> 30 gggatccttg atgaaagaat aacgtattct ttcatcaagg agactcttca cactgttggc 60 <210> 31 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer RS3402 <400> 31 gggatccttg atgaaagaat acgttattct ttcatcaagg cagatgagct catcaaccac 60 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV-F <400> 32 cacggtcttg gagaacccaa ccacggccat 30 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer INV-R <400> 33 cagataccag agctgtttgt caaaggcc 28 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer PGK-T <400> 34 taatcataat gatattgaca tataatcccg 30 <210> 35 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer SCAP5 <400> 35 gggtctagat gtttaaatct gttgtttatt caattttag 39 <210> 36 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer SCAP3 <400> 36 gggggatcct tattgtttta atagggtatc attgtagtg 39 <210> 37 <211> 15 <212> PRT <213> Candida utilis <400> 37 Phe Asp Tyr Asp Asn Asp Lys Ile Arg Gly Val Asn Ile Gly Gly   1 5 10 15 <210> 38 <211> 7 <212> PRT <213> Candida utilis <400> 38 Asp Ser Leu Gln Phe Gln Asn   1 5 <210> 39 <211> 5 <212> PRT <213> Candida utilis <400> 39 Asp His His His Tyr   1 5 <210> 40 <211> 11 <212> PRT <213> Candida utilis <400> 40 Asp Asn His Arg Arg Tyr Ile Glu Ala Gln Leu   1 5 10 <210> 41 <211> 10 <212> PRT <213> Candida utilis <400> 41 Asp Pro Tyr Ile Gln Gly Gln Ala Glu Tyr   1 5 10 <210> 42 <211> 12 <212> PRT <213> Candida utilis <400> 42 Lys Leu Ala Tyr Asn Gly Ile Phe Pro Gln Pro Leu   1 5 10 <210> 43 <211> 10 <212> PRT <213> Candida utilis <400> 43 Val Gly Asp Leu Ala Phe Asn Leu Gly Val   1 5 10 <210> 44 <211> 10 <212> PRT <213> Candida utilis <400> 44 Asp Gly Ala Ala His Pro Ala Ile Ala Ala   1 5 10 <210> 45 <211> 6 <212> PRT <213> Candida utilis <400> 45 Leu Glu Val Leu Ser Ala   1 5 <210> 46 <211> 7 <212> PRT <213> Candida utilis <400> 46 Leu Ala Phe Asn Leu Gly Val   1 5 <210> 47 <211> 10 <212> PRT <213> Candida utilis <400> 47 Lys Ala Ile Thr Val Gly Ser Glu Ala Leu   1 5 10 <210> 48 <211> 8 <212> PRT <213> Candida utilis <400> 48 Phe Asp Tyr Asp Asn Asp Lys Ile   1 5 <210> 49 <211> 7 <212> PRT <213> Candida utilis <400> 49 Asp Pro Tyr Ile Gln Gly Gln   1 5 <210> 50 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EXO1-1F <400> 50 ttygaytayg ayaaygayaa rat 23 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EXO1-2R <400> 51 tgnccytgda trtahggrtc 20 <210> 52 <211> 2940 <212> DNA <213> Candida utilis <220> <221> CDS <222> (1268) .. (2530) <400> 52 gtcgaccgga actatggttt gtaatcccac atagtgagat cagcgtgctg ggtgtcctct 60 gggatcgcca aagtaaacaa aaggctgaaa tttcctccca catgttccaa cataaaactc 120 tggtggcata cgaaattgta cgcttttggg agccactgag ccaagcaacg ggatggcttg 180 tagccgagaa aacttgtttc agtgaaacca gacgcacaag gtgtgtttttc catgtggcct 240 tcaaccccga ttgaactgct cggtgtgttt gttagcttat cattgcttcg ttgaggtgtc 300 atcacacgct acgctcaggt agcgtagccg tccactcatc aaaggcggaa gttagagttt 360 tatttttcgc tattttcgtt ataaattcgt gttctaaaga taaatcccac gcactggaaa 420 aaaaggagcg aaacgcgtaa acttgaaacg atttataatt agtacttgtt gcaccggcac 480 ccgtgcgccc actggtttag gtcccagagc gaaattacgg accacaagtc acggtatacg 540 cgcgcagtgc gtacctttga aaggataact gaataattac aaccgcctga tctaacgttt 600 acaacgacag ttactgggta tgtcatccta aacgaatcac tcgataactg tagagctttc 660 caacgcatgt attatcaaag ggatacgctt tccacctata catccacgtt gtcgatctct 720 gaagactgta tccccaagta cgtattcctt tataacttgt aagcctcacg tgtgtttacg 780 gatgtgggtg ttcaagttcc atgacaaact gtcttcacgc ccttgttggt tgtgttaact 840 gtacggcctt cccacccaca cccagaagtg cggttccaaa ttagggaaca atactatgca 900 ttgctggtta aaaaagcgta cacgcaccgc atgtgacggc cgatagcatg cctgcacagt 960 ttcaggacac aaatcaagac gtcagtctca cctgaattcc tgatccagat atgagcacct 1020 tgtagtgaat tagctgggtt gaaagtttgt atataaatca atggtgcctc gctctagaac 1080 aacccacccc cttttatgcc ccttcaagcc cttttccgat tcccttgcac aaggacataa 1140 aacttagtta aggagttaaa gaggccaacg caaatcattt gacaaaagag aggataatta 1200 ttgtaccctt cttctagact ctttcctact cctctaacaa tcaattgccc acataccatc 1260 tacagct atg cta ctt tcg cta ttg acc tta tcc ttt ttg acg ttg ttg 1309         Met Leu Leu Ser Leu Leu Thr Leu Ser Phe Leu Thr Leu Leu           1 5 10 atc aat gcc act cct atc cca tcc cgt ggc ggt cac cag ctg tac aag 1357 Ile Asn Ala Thr Pro Ile Pro Ser Arg Gly Gly His Gln Leu Tyr Lys 15 20 25 30 aga ggt ggc ttt gac tac gac aat gac aag ata cga ggc gtc aac att 1405 Arg Gly Gly Phe Asp Tyr Asp Asn Asp Lys Ile Arg Gly Val Asn Ile                  35 40 45 ggt ggt tgg ctt gtg ctt gaa ccg tac atc acc cct tcg tta ttt gaa 1453 Gly Gly Trp Leu Val Leu Glu Pro Tyr Ile Thr Pro Ser Leu Phe Glu              50 55 60 gtt ttt ggc gac acc atc cct gtg gat gaa tac cat tac cat cag act 1501 Val Phe Gly Asp Thr Ile Pro Val Asp Glu Tyr His Tyr His Gln Thr          65 70 75 ttg ggt aaa cag ttg act gca tcg aga ctt gag caa cac tgg agc tca 1549 Leu Gly Lys Gln Leu Thr Ala Ser Arg Leu Glu Gln His Trp Ser Ser      80 85 90 tgg atc act gag tcc gac ttt gag agc atc aag ggg act ggt ctt aac 1597 Trp Ile Thr Glu Ser Asp Phe Glu Ser Ile Lys Gly Thr Gly Leu Asn 95 100 105 110 atg gtt aga atc cca att ggt tac tgg gct ttc caa act ttg gat tct 1645 Met Val Arg Ile Pro Ile Gly Tyr Trp Ala Phe Gln Thr Leu Asp Ser                 115 120 125 gat cct tat atc caa ggc cag gct gaa tac ttg gac aag gca att caa 1693 Asp Pro Tyr Ile Gln Gly Gln Ala Glu Tyr Leu Asp Lys Ala Ile Gln             130 135 140 tgg gcc aga aac caa ggc tta tac gtc tgg atc gac ttg cac ggt gct 1741 Trp Ala Arg Asn Gln Gly Leu Tyr Val Trp Ile Asp Leu His Gly Ala         145 150 155 cca ggt tct caa aac ggt ttt gat aac tct ggt ttg aga gac agc ttg 1789 Pro Gly Ser Gln Asn Gly Phe Asp Asn Ser Gly Leu Arg Asp Ser Leu     160 165 170 cag ttc cag aac aac ggt aat gac caa gtc act ttg aat gtt ttg aag 1837 Gln Phe Gln Asn Asn Gly Asn Asp Gln Val Thr Leu Asn Val Leu Lys 175 180 185 190 act atc ttt gag aaa tac gga ggc tca gac tat gac gat gtg atc att 1885 Thr Ile Phe Glu Lys Tyr Gly Gly Ser Asp Tyr Asp Asp Val Ile Ile                 195 200 205 ggt atc gaa ctc ctg aac gag cca ctg ggt cct tcc ttg gat ttg acc 1933 Gly Ile Glu Leu Leu Asn Glu Pro Leu Gly Pro Ser Leu Asp Leu Thr             210 215 220 aag ttg aac gaa ttc tgg gac acc gca tac tgg aac gcc cgt aac gct 1981 Lys Leu Asn Glu Phe Trp Asp Thr Ala Tyr Trp Asn Ala Arg Asn Ala         225 230 235 ggt tca aga caa aac gtc att gtc cat gat ggg ttc cag agc atg ggc 2029 Gly Ser Arg Gln Asn Val Ile Val His Asp Gly Phe Gln Ser Met Gly     240 245 250 tac ttc aac gat aag ttc caa ttg gct gat gga tac tgg ggt gtt gtg 2077 Tyr Phe Asn Asp Lys Phe Gln Leu Ala Asp Gly Tyr Trp Gly Val Val 255 260 265 270 att gat cac cac cac tac cag gtg ttc tct act ggt gag ttg tcc aga 2125 Ile Asp His His His Tyr Gln Val Phe Ser Thr Gly Glu Leu Ser Arg                 275 280 285 act att gat gaa cac gtc caa gtt gcc tgc gaa tgg ggt gaa caa tcc 2173 Thr Ile Asp Glu His Val Gln Val Ala Cys Glu Trp Gly Glu Gln Ser             290 295 300 acc gct gag aac ttg tgg aac gtt tgt ggt gaa tgg tcc gct gct ctc 2221 Thr Ala Glu Asn Leu Trp Asn Val Cys Gly Glu Trp Ser Ala Ala Leu         305 310 315 act gat tgt gca cca tgg ctt aac ggt gtg tac cgt ggc gct cgt tac 2269 Thr Asp Cys Ala Pro Trp Leu Asn Gly Val Tyr Arg Gly Ala Arg Tyr     320 325 330 gat gca act tac caa tcg agc acc tac tat ggt acc tgc gat ggt tct 2317 Asp Ala Thr Tyr Gln Ser Ser Thr Tyr Tyr Gly Thr Cys Asp Gly Ser 335 340 345 350 caa gac att tcg tct tgg gat caa acc aca aga gat aac cac aga cgt 2365 Gln Asp Ile Ser Ser Trp Asp Gln Thr Thr Arg Asp Asn His Arg Arg                 355 360 365 tat att gag gca caa ttg gat gcc ttc gag aag ggc gct ggt tgg atc 2413 Tyr Ile Glu Ala Gln Leu Asp Ala Phe Glu Lys Gly Ala Gly Trp Ile             370 375 380 ttc tgg tgt tgg aag aca gag agt gcc ggt gag tgg gat ttc cag aaa 2461 Phe Trp Cys Trp Lys Thr Glu Ser Ala Gly Glu Trp Asp Phe Gln Lys         385 390 395 ttg gcc tac aac ggt atc ttc cca caa cct ctc gat aac aga cag tat 2509 Leu Ala Tyr Asn Gly Ile Phe Pro Gln Pro Leu Asp Asn Arg Gln Tyr     400 405 410 cca aac caa tgt ggg tat tag tttatcaatc caccaaaaat gtttttgaac 2560 Pro Asn Gln Cys Gly Tyr 415 420 ttcttcacgt gcttagtcac tttttctttc tctttgggtc aatatacagc aaatcgttgt 2620 ttgttttggg gcggtttctt tttattaata taatgagctt taatactatt agcttctact 2680 tgtagaccac ttacatttta tgcttagacg atgaagtaaa aacatttggt attcaacagt 2740 ttatagtgcg aaagaaaacg gtataaacaa taagacgggt gtgattacaa gtctgcgtca 2800 tcttcatctg gcaatggcat ggcggtggcg gcatccattt cttgttggta ttgagccatc 2860 aattgggcgt caacttgaac ctcaggtgga gccaaggctg gagcagcaac gaactccaat 2920 tgtgggttac caacaagctt 2940 <210> 53 <211> 420 <212> PRT <213> Candida utilis <400> 53 Met Leu Leu Ser Leu Leu Thr Leu Ser Phe Leu Thr Leu Leu Ile Asn   1 5 10 15 Ala Thr Pro Ile Pro Ser Arg Gly Gly His Gln Leu Tyr Lys Arg Gly              20 25 30 Gly Phe Asp Tyr Asp Asn Asp Lys Ile Arg Gly Val Asn Ile Gly Gly          35 40 45 Trp Leu Val Leu Glu Pro Tyr Ile Thr Pro Ser Leu Phe Glu Val Phe      50 55 60 Gly Asp Thr Ile Pro Val Asp Glu Tyr His Tyr His Gln Thr Leu Gly 65 70 75 80 Lys Gln Leu Thr Ala Ser Arg Leu Glu Gln His Trp Ser Ser Trp Ile                  85 90 95 Thr Glu Ser Asp Phe Glu Ser Ile Lys Gly Thr Gly Leu Asn Met Val             100 105 110 Arg Ile Pro Ile Gly Tyr Trp Ala Phe Gln Thr Leu Asp Ser Asp Pro         115 120 125 Tyr Ile Gln Gly Gln Ala Glu Tyr Leu Asp Lys Ala Ile Gln Trp Ala     130 135 140 Arg Asn Gln Gly Leu Tyr Val Trp Ile Asp Leu His Gly Ala Pro Gly 145 150 155 160 Ser Gln Asn Gly Phe Asp Asn Ser Gly Leu Arg Asp Ser Leu Gln Phe                 165 170 175 Gln Asn Asn Gly Asn Asp Gln Val Thr Leu Asn Val Leu Lys Thr Ile             180 185 190 Phe Glu Lys Tyr Gly Gly Ser Asp Tyr Asp Asp Val Ile Ile Gly Ile         195 200 205 Glu Leu Leu Asn Glu Pro Leu Gly Pro Ser Leu Asp Leu Thr Lys Leu     210 215 220 Asn Glu Phe Trp Asp Thr Ala Tyr Trp Asn Ala Arg Asn Ala Gly Ser 225 230 235 240 Arg Gln Asn Val Ile Val His Asp Gly Phe Gln Ser Met Gly Tyr Phe                 245 250 255 Asn Asp Lys Phe Gln Leu Ala Asp Gly Tyr Trp Gly Val Val Ile Asp             260 265 270 His His His Tyr Gln Val Phe Ser Thr Gly Glu Leu Ser Arg Thr Ile         275 280 285 Asp Glu His Val Gln Val Ala Cys Glu Trp Gly Glu Gln Ser Thr Ala     290 295 300 Glu Asn Leu Trp Asn Val Cys Gly Glu Trp Ser Ala Ala Leu Thr Asp 305 310 315 320 Cys Ala Pro Trp Leu Asn Gly Val Tyr Arg Gly Ala Arg Tyr Asp Ala                 325 330 335 Thr Tyr Gln Ser Ser Thr Tyr Tyr Gly Thr Cys Asp Gly Ser Gln Asp             340 345 350 Ile Ser Ser Trp Asp Gln Thr Thr Arg Asp Asn His Arg Arg Tyr Ile         355 360 365 Glu Ala Gln Leu Asp Ala Phe Glu Lys Gly Ala Gly Trp Ile Phe Trp     370 375 380 Cys Trp Lys Thr Glu Ser Ala Gly Glu Trp Asp Phe Gln Lys Leu Ala 385 390 395 400 Tyr Asn Gly Ile Phe Pro Gln Pro Leu Asp Asn Arg Gln Tyr Pro Asn                 405 410 415 Gln Cys Gly Tyr             420 <210> 54 <211> 15 <212> PRT <213> Candida utilis <400> 54 Phe Asp Tyr Asp Asn Asp Lys Ile Arg Gly Val Asn Ile Gly Gly   1 5 10 15 <210> 55 <211> 8 <212> PRT <213> Saccharomyces cerevisiae <400> 55 Val Gly Ser Glu Ala Leu Tyr Arg   1 5 <210> 56 <211> 8 <212> PRT <213> Candida albicans <400> 56 Trp Val Gly Glu Thr Gly Trp Pro   1 5 <210> 57 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EXO2-2F <400> 57 gtnggnwsng argcnytnta ymg 23 <210> 58 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EXO2-4R <400> 58 ggccanccng tytcnccnan nca 23 <210> 59 <211> 1963 <212> DNA <213> Candida utilis <400> 59 atcgatcgag caccggtttt gttttttttt tggcctcctc catcgttttc ctttttcttc 60 aacacttttg gcctttcttt ccctttttcc cattgtttac gttccatcgg atcaacactt 120 tatagaacaa acatgcgttt ttccactctc gctgctaccg ctgctgttct ctcttctgtt 180 cacgccgttg gtgatgtaag tattggcttc tttggctggc gtgttgggat ggcgcttcct 240 ggttttcgac tcttgtttac tttgtgtgct ttgttgttgc tgcctaacgg aaccgccagc 300 tctcgcgctg ttatctgttg ataaactaac ccctttcgct ccagttggca ttcaacttgg 360 gtgtccaaaa ctctgctggt tgtaaaaccg ctgccgacta caagaaggag ctcgaggtgt 420 tgtcagccta cacaagcgct gtcagagttt acgctgcatc tgactgtaac actctacaaa 480 tcctcggtcc agttgctgag gaagctggtt tctcaatctt ccaaggtatc tggccaaacg 540 acgatgccca ctttgaggct gagcaagagg cattgaagac ctacttgcca actttgaaga 600 agtcaacgat caaggccatc actgttggtt ccgaagcgtt gtaccgtgat gatatgaccg 660 ccagcgactt ggcctctcgt atccaaacag tcaaggattt gattgctgat attaaggact 720 ccgagggtaa ctcctacgct ggtaccccag ttggtttcgt tgactcttgg aacgttttgg 780 ttgacggtgc cgctcaccca gctatcgctg catctgacat tgtctttgcc aacgccttct 840 cctactggca aggtcagaca aaggctaact ccaccttctc cttctttgac gatatcatgc 900 aagctttgca aaccatccaa accgacaagg gtgagactga tatcactttc tgggtcggtg 960 aaactggctg gccaaccgat ggttccgctt ttgaggcttc tgttccatcg gtggagaatg 1020 ctgctcactt ctggcaagat gccatcggtg ccatgagagg atggggtgtt aacgtcatcg 1080 tctttgaggc ctttgacgag tcctggaaac cagatacctc tggtacctct gacgttgaaa 1140 agtactgggg tgtctgggac tcggactacc aattgaagta cgatttgact tgtaatttct 1200 aaaatattta actcaaatac tctataatga ccataaatac tccttcgtga aagatgtctc 1260 tatctaatgg agaaaatgtg tagttctccc aataacgtct gcttatgcct ttccaaggtt 1320 gtcaatggca tcaaacatgt cctccaactt gtcatctttc tctcctgtta agccactctc 1380 gttgtccttc gctgaatcct ccttcactgc tgcaatccaa ttcaccacct ggttgacaaa 1440 gctcttgcta ttcggtacga aatgcccacc ttggtgcttc aacaagtgtc gatgatcttc 1500 acgacaggaa tcgtaaagct ttatggatct cgactcttca accactgtat ccagctcacc 1560 aagcacatgg agagttggta acgatatctt tggttcgtaa tgctcctgga acctctctgg 1620 catcagtttg aacccagaga agtagatagc ccactgtaag tgtggcaaaa actccttata 1680 ccttgcagtg agatagccag aaagcccagc accttgtgag aatccaacaa tcccttccac 1740 gtcctcaata tcgtgcttgt ccaattcctt cttgatggtt tgttctgccg tctctaattc 1800 atagtctggt gcgccgtatg gccaccatcc ataaagctcg gaatctgtta atgaggagtg 1860 aggcatatct ccttgtagta acaacggcgc atttacatac acagtttcat acccagactt 1920 ctgtagagcc ttacgcagcc cacctgtctt tgcagagaag atc 1963 <210> 60 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: prmer EX2R <400> 60 ttcgaacgta ctatagcagt ttcttcctc 29 <210> 61 <211> 1814 <212> DNA <213> Candida utilis <220> <221> CDS <222> (133) .. (1050) <400> 61 atcgatcgag caccggtttt gttttttttt tggcctcctc catcgttttc ctttttcttc 60 aacacttttg gcctttcttt ccctttttcc cattgtttac gttccatcgg atcaacactt 120 tatagaacaa ac atg cgt ttt tcc act ctc gct gct acc gct gct gtt ctc 171               Met Arg Phe Ser Thr Leu Ala Ala Thr Ala Ala Val Leu                 1 5 10 tct tct gtt cac gcc gtt ggt gat ttg gca ttc aac ttg ggt gtc caa 219 Ser Ser Val His Ala Val Gly Asp Leu Ala Phe Asn Leu Gly Val Gln      15 20 25 aac tct gct ggt tgt aaa acc gct gcc gac tac aag aag gag ctc gag 267 Asn Ser Ala Gly Cys Lys Thr Ala Ala Asp Tyr Lys Lys Glu Leu Glu 30 35 40 45 gtg ttg tca gcc tac aca agc gct gtc aga gtt tac gct gca tct gac 315 Val Leu Ser Ala Tyr Thr Ser Ala Val Arg Val Tyr Ala Ala Ser Asp                  50 55 60 tgt aac act cta caa atc ctc ggt cca gtt gct gag gaa gct ggt ttc 363 Cys Asn Thr Leu Gln Ile Leu Gly Pro Val Ala Glu Glu Ala Gly Phe              65 70 75 tca atc ttc caa ggt atc tgg cca aac gac gat gcc cac ttt gag gct 411 Ser Ile Phe Gln Gly Ile Trp Pro Asn Asp Asp Ala His Phe Glu Ala          80 85 90 gag caa gag gca ttg aag acc tac ttg cca act ttg aag aag tca acg 459 Glu Gln Glu Ala Leu Lys Thr Tyr Leu Pro Thr Leu Lys Lys Ser Thr      95 100 105 atc aag gcc atc act gtt ggt tcc gaa gcg ttg tac cgt gat gat atg 507 Ile Lys Ala Ile Thr Val Gly Ser Glu Ala Leu Tyr Arg Asp Asp Met 110 115 120 125 acc gcc agc gac ttg gcc tct cgt atc caa aca gtc aag gat ttg att 555 Thr Ala Ser Asp Leu Ala Ser Arg Ile Gln Thr Val Lys Asp Leu Ile                 130 135 140 gct gat att aag gac tcc gag ggt aac tcc tac gct ggt acc cca gtt 603 Ala Asp Ile Lys Asp Ser Glu Gly Asn Ser Tyr Ala Gly Thr Pro Val             145 150 155 ggt ttc gtt gac tct tgg aac gtt ttg gtt gac ggt gcc gct cac cca 651 Gly Phe Val Asp Ser Trp Asn Val Leu Val Asp Gly Ala Ala His Pro         160 165 170 gct atc gct gca tct gac att gtc ttt gcc aac gcc ttc tcc tac tgg 699 Ala Ile Ala Ala Ser Asp Ile Val Phe Ala Asn Ala Phe Ser Tyr Trp     175 180 185 caa ggt cag aca aag gct aac tcc acc ttc tcc ttc ttt gac gat atc 747 Gln Gly Gln Thr Lys Ala Asn Ser Thr Phe Ser Phe Phe Asp Asp Ile 190 195 200 205 atg caa gct ttg caa acc atc caa acc gac aag ggt gag act gat atc 795 Met Gln Ala Leu Gln Thr Ile Gln Thr Asp Lys Gly Glu Thr Asp Ile                 210 215 220 act ttc tgg gtc ggt gaa act ggc tgg cca acc gat ggt tcc gct ttt 843 Thr Phe Trp Val Gly Glu Thr Gly Trp Pro Thr Asp Gly Ser Ala Phe             225 230 235 gag gct tct gtt cca tcg gtg gag aat gct gct cac ttc tgg caa gat 891 Glu Ala Ser Val Pro Ser Val Glu Asn Ala Ala His Phe Trp Gln Asp         240 245 250 gcc atc ggt gcc atg aga gga tgg ggt gtt aac gtc atc gtc ttt gag 939 Ala Ile Gly Ala Met Arg Gly Trp Gly Val Asn Val Ile Val Phe Glu     255 260 265 gcc ttt gac gag tcc tgg aaa cca gat acc tct ggt acc tct gac gtt 987 Ala Phe Asp Glu Ser Trp Lys Pro Asp Thr Ser Gly Thr Ser Asp Val 270 275 280 285 gaa aag tac tgg ggt gtc tgg gac tcg gac tac caa ttg aag tac gat 1035 Glu Lys Tyr Trp Gly Val Trp Asp Ser Asp Tyr Gln Leu Lys Tyr Asp                 290 295 300 ttg act tgt aat ttc taaaatattt aactcaaata ctctataatg accataaata 1090 Leu Thr Cys Asn Phe             305 ctccttcgtg aaagatgtct ctatctaatg gagaaaatgt gtagttctcc caataacgtc 1150 tgcttatgcc tttccaaggt tgtcaatggc atcaaacatg tcctccaact tgtcatcttt 1210 ctctcctgtt aagccactct cgttgtcctt cgctgaatcc tccttcactg ctgcaatcca 1270 attcaccacc tggttgacaa agctcttgct attcggtacg aaatgcccac cttggtgctt 1330 caacaagtgt cgatgatctt cacgacagga atcgtaaagc tttatggatc tcgactcttc 1390 aaccactgta tccagctcac caagcacatg gagagttggt aacgatatct ttggttcgta 1450 atgctcctgg aacctctctg gcatcagttt gaacccagag aagtagatag cccactgtaa 1510 gtgtggcaaa aactccttat accttgcagt gagatagcca gaaagcccag caccttgtga 1570 gaatccaaca atcccttcca cgtcctcaat atcgtgcttg tccaattcct tcttgatggt 1630 ttgttctgcc gtctctaatt catagtctgg tgcgccgtat ggccaccatc cataaagctc 1690 ggaatctgtt aatgaggagt gaggcatatc tccttgtagt aacaacggcg catttacata 1750 cacagtttca tacccagact tctgtagagc cttacgcagc ccacctgtct ttgcagagaa 1810 gatc 1814 <210> 62 <211> 306 <212> PRT <213> Candida utilis <400> 62 Met Arg Phe Ser Thr Leu Ala Ala Thr Ala Ala Val Leu Ser Ser Val   1 5 10 15 His Ala Val Gly Asp Leu Ala Phe Asn Leu Gly Val Gln Asn Ser Ala              20 25 30 Gly Cys Lys Thr Ala Ala Asp Tyr Lys Lys Glu Leu Glu Val Leu Ser          35 40 45 Ala Tyr Thr Ser Ala Val Arg Val Tyr Ala Ala Ser Asp Cys Asn Thr      50 55 60 Leu Gln Ile Leu Gly Pro Val Ala Glu Glu Ala Gly Phe Ser Ile Phe 65 70 75 80 Gln Gly Ile Trp Pro Asn Asp Asp Ala His Phe Glu Ala Glu Gln Glu                  85 90 95 Ala Leu Lys Thr Tyr Leu Pro Thr Leu Lys Lys Ser Thr Ile Lys Ala             100 105 110 Ile Thr Val Gly Ser Glu Ala Leu Tyr Arg Asp Asp Met Thr Ala Ser         115 120 125 Asp Leu Ala Ser Arg Ile Gln Thr Val Lys Asp Leu Ile Ala Asp Ile     130 135 140 Lys Asp Ser Glu Gly Asn Ser Tyr Ala Gly Thr Pro Val Gly Phe Val 145 150 155 160 Asp Ser Trp Asn Val Leu Val Asp Gly Ala Ala His Pro Ala Ile Ala                 165 170 175 Ala Ser Asp Ile Val Phe Ala Asn Ala Phe Ser Tyr Trp Gln Gly Gln             180 185 190 Thr Lys Ala Asn Ser Thr Phe Ser Phe Phe Asp Asp Ile Met Gln Ala         195 200 205 Leu Gln Thr Ile Gln Thr Asp Lys Gly Glu Thr Asp Ile Thr Phe Trp     210 215 220 Val Gly Glu Thr Gly Trp Pro Thr Asp Gly Ser Ala Phe Glu Ala Ser 225 230 235 240 Val Pro Ser Val Glu Asn Ala Ala His Phe Trp Gln Asp Ala Ile Gly                 245 250 255 Ala Met Arg Gly Trp Gly Val Asn Val Ile Val Phe Glu Ala Phe Asp             260 265 270 Glu Ser Trp Lys Pro Asp Thr Ser Gly Thr Ser Asp Val Glu Lys Tyr         275 280 285 Trp Gly Val Trp Asp Ser Asp Tyr Gln Leu Lys Tyr Asp Leu Thr Cys     290 295 300 Asn Phe 305 <210> 63 <211> 10 <212> PRT <213> Candida utilis <400> 63 Val Gly Asp Leu Ala Phe Asn Leu Gly Val   1 5 10 <210> 64 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EXP1-5 <400> 64 ccctctagat gctactttcg ctattgacct tatccttttt gacgttgttg atcaatgcct 60 tgggttttcc aactgcacta gttcctagag 90 <210> 65 <211> 138 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EXPP1-5 <400> 65 ccctctagat gctactttcg ctattgacct tatccttttt gacgttgttg atcaatgcca 60 ctcctatccc atcccgtggc ggtcaccagc tgtacaagag aggtggcttg ggttttccaa 120 ctgcactagt tcctagag 138 <210> 66 <211> 132 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EXPP2-5 <400> 66 ccctctagat gctactttcg ctattgacct tatccttttt gacgttgttg atcaatgcca 60 ctcctatccc atcccgtggc ggtcaccagc tgtacaagag attgggtttt ccaactgcac 120 tagttcctag ag 132 <210> 67 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer EX2-5 <400> 67 ccctctagat gcgtttttcc actctcgctg ctaccgctgc tgttctctct tctgttcacg 60 ccttgggttt tccaactgca ctagttccta gagg 94 <210> 68 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer ST-3 <400> 68 ggtgacaaat gtagttgtaa tttcaccacc 30

[Brief description of drawings]

1 is a restriction map of plasmid pCUINV5, showing the position of the open reading frame of the invertase gene.

FIG. 2 is a diagram showing the construction of a plasmid for invertase gene disruption.

FIG. 3 is a conceptual diagram showing the structure of the invertase gene region in the 1-gene disrupted strain and the 2-gene disrupted strain of the invertase gene. The positions of the homologous DNA sequences used in the plasmid for gene disruption are shown in the upper figure. In addition, the position of the primer used for confirmation of gene disruption and the size of the DNA fragment amplified by PCR are shown.

FIG. 4 is a diagram showing the time course of acid phosphatase activity of transformants.

[Fig. 5] Fig. 5 is a view showing a time-dependent change in glycosyltransferase activity of a transformant culture solution.

FIG. 6 is a restriction map of plasmid pCUEXO1, showing the position of the open reading frame of the β-glucanase gene.

FIG. 7 is a restriction map of plasmid pCUEXO2, showing the position of the open reading frame of the β-glucosidase gene.

   ─────────────────────────────────────────────────── ─── Continued front page    F-term (reference) 4B024 AA20 BA80 CA04 DA12 EA04                       FA02 FA10 FA18 GA11 GA25                       HA01 HA03                 4B064 AG01 CA06 CA19 CC24                 4B065 AA73X AA73Y AB01 BA01                       BA21 CA24

Claims (10)

[Claims] 1. A yeast characterized in that a gene encoding a major secretory protein is inactivated. 2. The yeast according to claim 1, wherein the gene encoding the major secretory protein is inactivated by disrupting the gene encoding the major secretory protein by homologous recombination. 3. A DNA construct in which the gene encoding the major secretory protein comprises the 5'region of the gene encoding the major secretory protein, a selectable marker gene, and the 3'region of the gene encoding the major secretory protein. The yeast according to claim 1, which is inactivated by the incorporation of 4. The yeast according to any one of claims 1 to 3, wherein the yeast belongs to the genus Candida. 5. The yeast is Candid utilis.
a yeast) according to claim 4, which is a utilis). 6. The yeast according to claim 5, wherein the major secretory protein is invertase. 7. The method according to any one of claims 1 to 6, which has been transformed with an expression vector carrying a DNA encoding a target protein.
The yeast according to any one of 1. 8. The yeast according to claim 7, wherein a secretory signal sequence is added to the N-terminal side of the target protein. 9. The yeast according to claim 8, wherein a pro sequence portion derived from the same species as the secretory signal sequence is further added to the C-terminal side of the secretory signal sequence. 10. A method for producing a protein, which comprises the steps of culturing the yeast according to any one of claims 7 to 9 and then collecting the target protein from the culture.