JP2003033185A - Enone reductase - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new enone reductase and a gene encoding the enzyme, and to provide a method for selectively reducing the carbon-carbon double bond of an α,β-unsaturated ketone by using the enzyme and a method for producing an optically active ketone having a high optical purity. SOLUTION: Kluyveromyces lactis reduces the α,β-unsaturated bond of an α,β-unsaturated ketone selectively and NADP-dependently has no reduction activity of ketone and reduces 3-methyl-4-(3-pyridyl)-3-buten-2-one, to form approximately 100% of ee of the (S) isomer of the optically active ketone. Further the gene encoding the enzyme is isolated. The carbon-carbon double bond of an α,β-unsaturated ketone can be selectively reduced by the enzyme, its homolog, a cell for producing them.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel enone reductase useful for reducing α, β-unsaturated bonds of α, β-unsaturated ketones (hereinafter abbreviated as enone), and the enzyme. , A method for producing the enzyme, a method for selectively reducing the carbon-carbon double bond of an α, β-unsaturated ketone using the enzyme and a protein having homology to the enzyme,
Particularly, it relates to a method for producing an optically active ketone.

[0002]

BACKGROUND OF THE INVENTION Ketones are extremely versatile compounds as raw materials in organic synthesis. Ketones are also important compounds as raw materials for optically active alcohols and optically active amines, which are important optically active intermediates in drug synthesis. In particular, optically active ketones are useful as raw materials for the synthesis of various pharmaceuticals. As a precursor of these ketones, for example, α, β-unsaturated ketone obtained by condensation reaction of aldehyde and ketone is useful.

For example, by condensing acetaldehyde and 2-butanone, 3-methyl-3-pentene-2-
On (3-methyl-3-penten-2-one; J. Amer. Chem. So
c., 81, 1117-1119 (1959)) can be easily prepared.

Various ketones can be obtained by selectively reducing the α, β-unsaturated bond of an α, β-unsaturated carbonyl compound. As a method for selectively reducing only the α, β-unsaturated bond without involving the reduction reaction of the carbonyl group, a hydrogenation reaction using a Ni catalyst or a Pd-C catalyst is known (see “contact Hydrogenation reaction "p135, Tokyo Kagaku Dojin (1987)). These methods have problems such that a carbonyl group is also reduced by continuing the reaction, a metal having a large load on the environment is used as a catalyst, and high-pressure hydrogen is used. Reduction of the carbonyl group means a decrease in the yield of ketone.

On the other hand, as a method for selectively reducing the carbon-carbon double bond of an α, β-unsaturated ketone by a biological reaction, the following methods using organisms have been reported.・ Plant cells (J. Nat. Prod. 56, 1406-1409 (1993)) ・ Baker's yeast (Tetrahedron Lett. 52, 5197-5200 (1978)
, Bull. Chem. Soc. Jpn. 64, 3473-3475 (1991), Te
trahedron Asym. 6, 2143-2144 (1995) et al.) ・ Mold (J. Org. Chem. 47, 792-798 (1982)) However, in these methods, reduction reaction of carbonyl group is involved, and reactivity is low, There are problems such as difficulty in large-scale preparation of cells.

In addition to the above, the following enzymes have been reported as reductases for α, β-unsaturated carbonyl compounds. None of these enzymes have industrial uses because their substrate specificity has not been clarified, or their stereoselectivity in reducing α, β-unsaturated bonds has been low, or has not been clarified. Not suitable for. Clostridium tyrob
2-enoate reductase from utyricum
ductase, EC1.3.1.31) (J. Biotechnol. 6,13-29 (1
987)) Clostridium kluyver
i) derived acryloyl-CoA reductase (acryloyl-CoA r
eductase) (Biol. Chem. Hoppe-Seyler 366, 953-961
(1985)) Kluyveromyces lactis-derived enone reductase-I (KLER1,
Japanese Patent Application 2001-049363) Enone reductase YER-2 purified from baker's yeast (Kyoto University, Kawai et al., Proceedings of the 4th Biocatalysis Symposium p58 (2001)) Enone reductase EI purified from baker's yeast and EII
(Eur. J. Biochem. 255, 271-278 (1998)) Saccharomyce Carlsbergensis
s carlesbergensis) -derived old yellow enzyme (Old Yellow En
zyme-1, hereinafter abbreviated as OYE1) Tobacco (Nicotiana tabacum) cell-derived enone reductase (verbenone reductase, aka p90) (J. Chem. Soc., Chem. Commun. 1993,1426-1)
427, Chem. Lett. 2000, 850-851) Tobacco (Nicotiana tabacum) cell-derived enone reductase carboxyl reductase (also known as enone reductase-
I, or p44, Phytochemistry 31, 2599-2603
(1992) Enone reductase-II, p74 (Phytochemi), which is an enone reductase derived from tobacco (Nicotiana tabacum) cells.
stry 31, 2599-2603 (1992)), a plant species Euglena gracilis Phytochemistry 49, 4
9-53 (1998)) and Astasia longa
Enone reductase purified from (Phytochemistry 49, 4
9-53 (1998)) Enone reductase purified from rat liver (Arch. Bioc
hem.Biophys. 282, 183-187 (1990))

[0007]

SUMMARY OF THE INVENTION The present invention selectively reduces the α, β-unsaturated bond of an α, β-unsaturated ketone,
It is an object of the present invention to provide a novel enone reductase having an enzymatic activity for producing an α, β-saturated ketone, particularly an optically active ketone having a high optical purity, and a gene encoding the enzyme. Furthermore, the present invention utilizes the enzyme and the organism that produces the enzyme to utilize the carbon-carbon 2 of an α, β-unsaturated ketone.
It is an object of the present invention to provide a method for selectively reducing a heavy bond, particularly a method for producing an optically active ketone having high optical purity.

[0008]

The present inventors have screened an enzyme capable of producing 2-butanone from methyl vinyl ketone for the purpose of searching for an enzyme having an enone-reducing activity. As a result, Kleiberomyces lactis ( Kluyveromy
ces lactis) has the desired activity. Next, an enzyme having a desired activity was purified from Klebromyces lactis cells, and its properties were clarified. This enzyme is an α, β-unsaturated ketone α, β
-The unsaturated bond is selectively reduced in a β-nicotinamide adenine dinucleotide phosphate-dependent manner, and it has substantially no reducing activity of ketone.
Almost 100% ee by reducing (3-pyridyl) -3-buten-2-one
It was confirmed that the (S) -isomer of (1) produced an optically active ketone.

Next, the present inventors analyzed the partial amino acid sequence of the enzyme and, as a result, reported Kluyveromyces Yellow Enzyme (KYE1; Y) reported as a predicted ORF from the genomic sequence.
east11, 459-465 (1995)). Furthermore, this predicted ORF was cloned, expressed in Escherichia coli, and the activity of the expression product was confirmed, whereby it was confirmed that this predicted ORF is a gene encoding the enzyme KLER2 of the present invention. Then, depending on the enzyme, its homolog, or cells that produce them, α, β
The present invention has been completed by finding that it becomes possible to selectively reduce the carbon-carbon double bond of an unsaturated ketone. Below, β-
Nicotinamide adenine dinucleotide phosphate is NADP,
β-nicotinamide adenine dinucleotide is referred to as NAD, and these reduced forms are referred to as NADPH or NADH.

That is, the present invention provides the following enone reductase,
DNA encoding the enzyme, method for producing the enzyme, α, β-using the enzyme and a protein having homology to the enzyme
Selectively reducing the carbon-carbon double bond of an unsaturated ketone,
In particular, it relates to a method for producing an optically active ketone. [1] An enone reductase having the physicochemical properties shown in (A) to (C) below. (A) Action Using reduced β-nicotinamide adenine dinucleotide phosphate as an electron donor, carbon of α, β-unsaturated ketone
The carbon double bond is reduced to produce the corresponding saturated hydrocarbon. (B) Substrate specificity (1) As an electron donor, it has a significantly higher activity for reduced β-nicotinamide adenine dinucleotide phosphate than for reduced β-nicotinamide adenine dinucleotide. (2) The carbon-carbon double bond of the unsaturated ketone is reduced,
There is virtually no reduction activity of the ketone. (3) α, β − of 3-Methyl-4- (3-pyridyl) -3-buten-2-one
Selective reduction of unsaturated bonds, 90% ee or more of (S) -3-met
Generates hyl-4- (3-pyridyl) -3-butan-2-one. (C) Molecular weight sodium dodecyl sulfate-polyacrylamide gel electrophoresis of about 47,000. About 92 by gel filtration,
000. [2] The enone reductase according to [1], which further has the following physicochemical properties (D)-(E). (D) Action pH pH 5.0-8.0 (E) Optimum temperature 37-45 ° C [3] The novel enone reductase according to [1] derived from the genus Kluyveromyces. [4] The novel enone reductase according to [3], wherein the microorganism belonging to the genus Kliberomyces is Kluyveromyces lactis. [5] A method for obtaining the enone reductase according to [1], which comprises culturing a microorganism belonging to the genus Kleiberomyces and having the enone reductase-producing ability according to [1]. [6] Kluyveromyces lactis is a microorganism belonging to the genus Kluyveromyces.
The method according to [5]. [7] The polynucleotide according to any one of (a) to (e) below. (A) a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO: 1, (b) a polynucleotide encoding the amino acid sequence set forth in SEQ ID NO: 2, (c) an amino acid sequence set forth in SEQ ID NO: 2, 1 Alternatively, a polynucleotide consisting of an amino acid sequence in which a plurality of amino acids are substituted, deleted, inserted, and / or added, and encoding a protein having the following physicochemical properties (A) and (B), (d) SEQ ID NO: 1 A polynucleotide which hybridizes with the polynucleotide consisting of the nucleotide sequence described in 1) under stringent conditions and encodes a protein having the following physicochemical properties (A) and (B), (e) described in SEQ ID NO: 2 The amino acid sequence having 90% or more homology with the amino acid sequence of the above, and the following physicochemical properties (A) and (B)
(A) acting reduced β-nicotinamide adenine dinucleotide phosphate as an electron donor, carbon of α, β-unsaturated ketone-
The carbon double bond is reduced to produce the corresponding saturated hydrocarbon. (B) Substrate specificity (1) As an electron donor, it has a significantly higher activity for reduced β-nicotinamide adenine dinucleotide phosphate than for reduced β-nicotinamide adenine dinucleotide. (2) The carbon-carbon double bond of the unsaturated ketone is reduced,
There is virtually no reduction activity of the ketone. (3) α, β − of 3-Methyl-4- (3-pyridyl) -3-buten-2-one
Selective reduction of unsaturated bonds, 90% ee or more of (S) -3-met
Generates hyl-4- (3-pyridyl) -3-butan-2-one. [8] A protein encoded by the polynucleotide according to [7].

[9] A recombinant vector having the polynucleotide according to [7] inserted therein. [10] A polynucleotide encoding a dehydrogenase capable of catalyzing a redox reaction using β-nicotinamide adenine dinucleotide phosphate as a coenzyme was further inserted,

The recombinant vector according to [9]. [11] The recombinant vector according to [10], wherein the dehydrogenase capable of catalyzing the redox reaction is glucose dehydrogenase. [12] The polynucleotide according to [7], or

A transformant carrying the vector according to [9] in an expressible manner. [13] The method for producing the protein according to [8], which comprises a step of culturing the transformant according to [12]. [14] Any of the enzyme active substances selected from the group consisting of the enone reductase according to [1], the protein according to [8], a microorganism producing the enzyme or protein, and a treated product of the microorganism. And a method of producing a saturated ketone by selectively reducing the carbon-carbon double bond of the α, β-unsaturated ketone, the method comprising the step of: [15] An enzyme active substance selected from the group consisting of the enone reductase according to [1], the protein according to [8], a microorganism producing the enzyme or protein, and a treated product of the microorganism. Carbon-carbon double bond of an α, β-unsaturated ketone, which comprises a step of reacting α- and β-unsaturated ketone having a substituent at the α-position and / or β-position with the resulting optically active ketone. A method for producing an optically active saturated ketone by selectively reducing a bond. [16] The method according to [15], wherein the microorganism is the transformant according to [12].

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention provides an enone reductase having the physicochemical properties shown in the following (A)-(C). (A) Action Using reduced β-nicotinamide adenine dinucleotide phosphate as an electron donor, carbon of α, β-unsaturated ketone
The carbon double bond is reduced to produce the corresponding saturated hydrocarbon. (B) Substrate specificity (1) As an electron donor, NADPH rather than NADH
It has a significantly higher activity. (2) The carbon-carbon double bond of the unsaturated ketone is reduced,
There is virtually no reduction activity of the ketone. (3) α, β − of 3-Methyl-4- (3-pyridyl) -3-buten-2-one
Selective reduction of unsaturated bonds, 90% ee or more of (S) -3-met
Generates hyl-4- (3-pyridyl) -3-butan-2-one. (C) Molecular weight sodium dodecyl sulfate-polyacrylamide gel electrophoresis of about 47,000. About 92 by gel filtration,
000.

The enone reductase of the present invention desirably has the following physicochemical properties (D)-(E). (D) Working pH pH 5.0-8.0 (E) Optimum temperature 37-45 ° C

The reactivity of the enzyme of the present invention with NADPH is NAD.
Significantly higher than the reactivity to H means at least 2-fold or higher, preferably 3-fold or higher, and more preferably 5-fold or higher activity. The reactivity to NADPH and NADH is
The comparison can be made by the method as shown in the examples. That is, the same α, β-unsaturated ketone is used as a substrate, and both are used to generate a ketone. The reactivity can be compared by comparing the amount of NADPH or NADH consumed at this time.

In the present invention, the fact that the enone reductase does not substantially act on the substrate means, specifically,
It means that the reduction activity of methyl vinyl ketone for olefins is 1% or less. The selective reduction of the α, β-unsaturated bond means that the ketone is not substantially reduced under the condition for reducing the olefin. In the present invention, the ketone is substantially not reduced when the product in which the ketone moiety is reduced is, for example, 5% or less, usually 2% or less, and preferably 1% or less of the substrate. The activity of reducing the ketone moiety can be compared, for example, by allowing a test enzyme to act on 2-butanone and quantifying the amount of the reduction product. The amount of reduction product is NA
It is also possible to know the decrease in DPH as an index.

The enzyme of the present invention can be purified from a microorganism producing the enzyme by a conventional protein purification method. For example, after crushing the cells, protamine sulfate precipitation is performed, and the supernatant obtained by centrifugation is salted out with ammonium sulfate, and further anion exchange chromatography, hydrophobic chromatography, affinity chromatography,
It can be purified by combining gel filtration and the like.

In the present invention, the reducing activity for enone can be confirmed as follows. In the present invention, enone means α, β unsaturated ketone. Method for measuring reducing activity against enone: 50 mM potassium phosphate buffer (pH 6.5), 0.2 mM NADPH, 20 mM methyl vinyl ketone and enzyme were reacted at 30 ° C in a reaction solution at 340 nm due to decrease of NADPH. The decrease in absorbance of is measured. 1 U was defined as the amount of enzyme that catalyzes the decrease of 1 μmol NADPH in 1 minute. The protein was quantified by the dye binding method using a protein assay kit manufactured by Bio-Rad.

The enone reductase having the above physicochemical properties can be purified from, for example, a culture of yeast of the genus Kleiberomyces. Kluyveromyces lactis (Kluyvero)
myces lactis) is particularly excellent in the ability to produce the enone reductase according to the present invention. Kluyveromyces lactis that can be used to obtain the enone reductase of the present invention includes, for example, IFO0433, IFO 1012, I.
FO 1267, IFO 1673, and IFO 1903 can be obtained from the Fermentation Research Institute Foundation.

The above-mentioned microorganism is cultured in a general medium used for culturing fungi such as YM medium. After sufficiently proliferating, the cells are recovered and crushed in a buffer solution containing a reducing agent such as 2-mercaptoethanol or phenylmethaneflufonyl fluoride or a protease inhibitor to obtain a cell-free extract. Fractionation by protein solubility (precipitation with organic solvent, salting out with ammonium sulfate, etc.), cation exchange, anion exchange, gel filtration, hydrophobic chromatography, chelates, dyes, antibodies, etc. from cell-free extracts Can be purified by an appropriate combination of affinity chromatography and the like. For example, phenyl-
Hydrophobic chromatography on Sepharose, MonoQ
Anion exchange chromatography using phenyl-
It can be electrophoretically purified to a substantially single band through, for example, hydrophobic chromatography using superose.

The enone reductase according to the present invention which can be purified from Kluyveromyces lactis has the above-mentioned physicochemical properties (A)-(C) and (D)-(F). The enone reductase according to the present invention that can be purified from Kleiberomyces lactis is a known α, β-unsaturated carbonyl compound reductase,
Apparently a novel enzyme.

As a reductase for α, β-unsaturated carbonyl compounds, for example, 2-enoate reductase (EC1.3.1.31) derived from Clostridium tyrobutyricum is known. . This enzyme reduces (E) -2-methyl-2-butenoic acid in a NADH-dependent manner to produce (R) -2-methylbutyric acid (J. Biotechnol. 6, 13-29 (1987)). In addition, this enzyme has carbonyl residues such as carboxylic acid, aldehyde,
Alternatively, keto acid is used as a substrate, but no activity against a ketone body has been reported. Furthermore, the molecular weight is 800,000-940,000 in gel filtration, which is clearly different from the enzyme of the present invention (sodium dodecyl sulfate-gel electrophoresis (hereinafter, abbreviated as SDS-PAGE) 43,000 and gel filtration 42,000). .

In addition, Clostridium Kleiberi (Cl
It has been reported that acryloyl-CoA reductase derived from ostridium kluyveri) has ethyl vinyl ketone reducing activity (Biol. Chem. Ho.
ppe-Seyler 366, 953-961 (1985)), but this enzyme utilizes reduced methyl viologen as a coenzyme, and the molecular weight is 28,400 by gel filtration and 14,200 by SDS-PAGE, which is different from the enzyme of the present invention.

An enone reductase cloned from Kleiberomyces lactis filed by the present inventor (Japanese Patent Application 2001-049363, hereinafter abbreviated as KLER1)
Is an enzyme produced by Kleiberomyces lactis, similar to the enone reductase of the present invention (hereinafter abbreviated as KLER2), but has a molecular weight (KLER1 is about 42,000 by gel filtration, SDS-PAGE The molecular weight of the monomer is about 43,0
Although it is a monomeric enzyme of 00, KLER2 is a dimeric enzyme with a molecular weight of about 92,000 in gel filtration and a molecular weight of about 47,000 by SDS-PAGE), substrate specificity (KLER1
, Which does not substantially react with the cyclic enone 2-cyclohexenone, but KLER2 can also serve as a substrate for the cyclic enone).

Further, a plurality of enone reductases have been reported to be purified from baker's yeast. Kawai et al. Of Kyoto University have purified enone reductase (YER-2) from baker's yeast and reported the enzyme chemistry (Proceedings of the 4th Biocatalyst Symposium p58 (2001)). This enzyme is similar to the enzyme of the present invention in that α of 3-Methyl-4- (3-pyridyl) -3-buten-2-one,
Selective reduction of β-unsaturated bond, (S) -3-methyl-4- (3
-pyridyl) -3-butan-2-one, but its molecular weight was 38,000 by gel filtration and 4 by SDS-PAGE.
1,000) is different from the enzyme of the present invention. Wanner et al. Reported the purification and characterization of two enone reductases (EI and EII) from the same baker's yeast (Eur. J. Biochem. 255, 27.
1-278 (1998)). EI (molecular weight in gel filtration is 75,00
0, hetero by molecular weight 37,000 and 34,000 by SDS-PAGE 2
), EII (EI (molecular weight in gel filtration is 130,000,
Both heterodimers having molecular weights of 56,000 and 64,000 by SDS-PAGE) differ from the enzyme of the present invention in molecular weight and the like.

[0024] Also, an old yellow enzyme (Old Yellow Enzyme, hereinafter abbreviated as OYE1) derived from Saccharomyces carlesbergensis or Saccharomyces cerevisiae.
However, it has been reported that cyclohexanone is produced by using Cyclohex-2-enone as an electron acceptor in addition to oxygen as NADPH oxidative activity (J. Biol. Chem. 268,6097). -6106 (1993)). Also Sa
OYE2, which has similar activity to ccharomyces cerevisiae,
OYE3 has been cloned. The OYE1 gene was cloned, its nucleotide sequence and predicted amino acid sequence were clarified, and it was revealed that it has high homology with the enone reductase KLER2 of the present invention (BLAST progra.
71% identity, 84% as a result of homology search using m
similarity). The hydrogenation reaction of enone by OYE1 is based on the Re-face for α-carbon and Si-for β-carbon.
It is presumed that it will take precedence over the surface (Biochemi
stry 34, 4246-4256 (1995)). However, the optical purity of the ketone produced is not specifically shown, and it is clear whether the method for producing an optically active ketone using OYE1 satisfies the industrially required purity (at least 90% ee or higher). It hasn't been.

In plants, tobacco (Nicotiana tabacum)
A large number of enone reductases (verbenone reductase (also known as p90), carvone reductase (also known as enone reductase-I, also known as p44), enone reductase-II, p7
4) has been purified and its properties have been reported. Verbenone reductase (p90) has a molecular weight (molecular weight in gel filtration of 90,000, molecular weight by SDS-PAGE of 45,000) close to that of the enzyme of the present invention, but 3-Methy
The reduction activity and stereoselectivity for l-4- (3-pyridyl) -3-buten-2-one are unknown, and the optimum pH for the reduction reaction is
Is 7.2, which is clearly different from 6.2 of the enzyme of the present invention.

Enone reductase-I (p44) has a molecular weight of 44,000 in gel filtration and a molecular weight of 22,00 by SDS-PAGE.
0) and is different from the enzyme of the present invention since it mainly utilizes NADH. Enone reductase-II is α, β-
Compounds that do not have hydrogen at the β-carbon of the unsaturated ketone ((R)
-pulegone) also serves as a substrate, the molecular weight in gel filtration is 132,000, and the molecular weight by SDS-PAGE is 22,000 and 45,00.
Being 0 (Phytochemistry 31,2599-2603 (1992))
Therefore, it is different from the enzyme of the present invention. Since p74 has a molecular weight of 74,000 in gel filtration and a molecular weight of 37,000 by SDS-PAGE, these enzymes are clearly different from the enzyme of the present invention.

In addition, a plant species, Euglena gracilis (gel filtration, molecular weight by SDS-PAGE are both 55,000;) and Astasia longa (Astasia longa)
a; Enone reductase has been purified from the molecular weight of both 35,000 and 36,000 by gel filtration and SDS-PAGE (Phytochemistry 49, 49-53 (1998)), but these enzymes are all NADH as coenzymes. , The molecular weight of which is clearly different from that of the enzyme of the present invention.

In animals, enone reductase was purified from rat liver (Arch. Biochem. Biophys. 282,
183-187 (1990)). This enzyme can be used for gel filtration, SDS-PAGE
Both have a molecular weight of 39,500, which is clearly different from the enzyme of the present invention.

The partial amino acid sequence of the purified enzyme of the present invention is KYE1 (Yeast 11, 459) reported as a predicted ORF.
-465 (1995). KYE1 is Kluyver because the predicted ORF from the nucleotide sequence of the genome has homology with OYE1.
It is named omyces Yellow Enzyme-1 (KYE1). Regarding the function of KYE1, a decrease in NADPH dehydrogenase activity (NADPH oxidative activity in the presence of cytochrome C and menadione) was measured in a diploid crude enzyme solution containing both a KYE1 disrupted gene and a natural gene. Only. That is, the protein encoded by KYE1 itself has not been shown to have direct NADPH dehydrogenase activity. In addition, the enzymatic chemical properties of the protein encoded by KYE1 have not been revealed, in particular, that this protein has a reducing activity for enone and that the reduction reaction has extremely high stereoselectivity.

The present invention relates to polynucleotides encoding enone reductase and homologues thereof. In the present invention, the polynucleotide may be a naturally occurring polynucleotide such as DNA or RNA, or may be a polynucleotide containing an artificially synthesized nucleotide derivative.

The polynucleotide encoding the enone reductase of the present invention comprises, for example, the nucleotide sequence shown in SEQ ID NO: 1. The base sequence shown in SEQ ID NO: 1 is SEQ ID NO: 2
It encodes a protein containing the amino acid sequence shown in, and the protein containing this amino acid sequence constitutes a preferred embodiment of the enone reductase according to the present invention.

The polynucleotide of the present invention includes any base sequence capable of encoding the amino acid sequence set forth in SEQ ID NO: 2. Since there are 1 to 6 codons corresponding to one amino acid, the DNA encoding the protein consisting of the amino acid sequence set forth in SEQ ID NO: 2 is not limited to SEQ ID NO: 1 but SEQ ID NO: 1 DN listed
There are multiple DNAs that can be considered equivalent to A.

The polynucleotide of the present invention has the SEQ ID NO:
In the amino acid sequence of 2, the amino acid sequence has one or more amino acids deleted, substituted, inserted and / or added, and encodes a protein having the physicochemical properties (A) and (B). Contains a polynucleotide. A person skilled in the art would be able to introduce a site-directed mutagenesis method (Nucleic Acid Res. 10, pp. 6487) into the DNA shown in SEQ ID NO: 1.
(1982), Methods in Enzymol. 100, pp.448 (1983), M
olecular Cloning 2nd Ed., Cold Spring Harbor Labor
atory Press (1989), PCR A Practical Approach IRL
Press pp.200 (1991)) and the like can be used to appropriately introduce substitutions, deletions, insertions, and / or addition mutations.

The polynucleotide of the present invention is a polynucleotide that can hybridize with the DNA consisting of the nucleotide sequence of SEQ ID NO: 1 under stringent conditions, and has the above-mentioned physicochemical properties (A) and (B). And a polynucleotide encoding a protein having The polynucleotide capable of hybridizing under stringent conditions means any at least 20, preferably at least 30, for example 40 in SEQ ID NO: 1.
A DNA in which one or a plurality of 60 or 100 continuous sequences are selected is used as a probe DNA, for example, ECL direct nuc
leic acid labeling and detection system (Amersham
Using Pharmaica Biotech, the conditions described in the manual (wash: 42 ° C, primary wash buffe containing 0.5x SSC)
In r), refers to a hybridizing polynucleotide.

SEQ ID NO: 1 under stringent conditions
Polynucleotides that can hybridize with the DNA having the nucleotide sequence described in 1 include those containing a nucleotide sequence similar to SEQ ID NO: 1. Such a polynucleotide is likely to encode a protein functionally equivalent to the protein consisting of the amino acid sequence of SEQ ID NO: 2. Therefore, a person skilled in the art can select a polynucleotide encoding a protein having enone reductase activity from such polynucleotides based on the description in the present specification.

Furthermore, the polynucleotide of the present invention comprises at least 90 amino acid sequences shown in SEQ ID NO: 2.
%, Preferably at least 95% or more homology, and includes a polynucleotide encoding a protein having the physicochemical properties (A) and (B). Homology searches for proteins can be performed, for example, by using databases such as SWISS-PROT, PIR, and other databases concerning protein amino acid sequences and DNA Databa
The FASTA program and B are targeted at databases related to DNA such as nk of JAPAN (DDBJ), EMBL, Gene-Bank, and databases related to predicted amino acid sequences based on DNA sequences.
It can be performed, for example, on the Internet using the LAST program or the like. As a result of performing a homology search using the BLAST program on SWISS-PROT using the amino acid sequence of SEQ ID NO: 2, the highest homology among known proteins was found to be Saccharomyces ca.
rlesbergensis Old Yellow Enzyme 1 (71% of OYE1 (Ide
ntity) and 84% (Positives). 90% or more homology of the present invention means, for example, Pos using the BLAST program.
Indicates the homology value of itive.

The protein encoded by these polynucleotides and containing a mutation in the amino acid sequence is included in the enone reductase homologue of the present invention as long as it has the physicochemical properties (A) and (B). The polynucleotide of the present invention is useful for producing the enone reductase of the present invention by genetic engineering. Alternatively, the polynucleotide of the present invention can be used to genetically engineer a microorganism having an enone reductase activity useful for producing α, β-saturated ketones from α, β-unsaturated ketones.

The present invention is a protein having the amino acid sequence of SEQ ID NO: 2 and having enone reductase activity,
And its homologs. The protein containing the amino acid sequence shown in SEQ ID NO: 2 constitutes a preferred embodiment of the enone reductase according to the present invention.

The homologue of the enone reductase of the present invention is
The amino acid sequence of SEQ ID NO: 2 includes an amino acid sequence in which one or more amino acids have been deleted, substituted, inserted and / or added. A person skilled in the art would be able to use site-directed mutagenesis (Nucleic A
cid Res. 10, pp.6487 (1982), Methods in Enzymol.10
0, pp.448 (1983), Molecular Cloning 2ndEdt., Cold S
pring Harbor Laboratory Press (1989), PCR A Pract
ical Approach IRL Press pp.200 (1991)) and the like, and by appropriately introducing substitutions, deletions, insertions, and / or additional mutations, a DNA encoding a homolog of an enone reductase can be obtained. By introducing the DNA encoding the homolog of the enone reductase into a host and expressing it, the homolog of the enone reductase set forth in SEQ ID NO: 2 can be obtained.

Furthermore, the homolog of the enone reductase of the present invention refers to a protein having a homology of at least 90%, preferably 95% or more with the amino acid sequence shown in SEQ ID NO: 2. For protein homology search, use SW
Databases for amino acid sequences of proteins such as ISS-PROT, PIR, DNA Databank of JAPAN (DDBJ), EMBL, Gen
By using FASTA program, BLAST program, etc. for databases such as e-Bank related databases such as databases related to predicted amino acid sequences based on DNA sequences.
For example, it can be done on the Internet. BL for DDBJ using the amino acid sequence of SEQ ID NO: 2
As a result of homology search using the AST program, the highest homology among known proteins was Saccharomyces carlesbergensis Old Yellow Enzy.
Me 1 (71% (Identity) and 84% (Positives) of OYE1. Homology of 90% or more in the present invention means, for example, BLA.
The value of Positive homology using ST program is shown.

The polynucleotide encoding the enone reductase of the present invention can be isolated, for example, by the following method.

The polynucleotide of the present invention has the SEQ ID NO:
It can also be isolated from other organisms based on the nucleotide sequence described in 1 by PCR cloning or hybridization. The base sequence shown in SEQ ID NO: 1 is that of a gene isolated from Kleiberomyces lactis. A polynucleotide for a protein having an enone reductase activity can be obtained from a microorganism such as yeast of the genus Kleiberomyces by designing a PCR primer using the nucleotide sequence of SEQ ID NO: 1.

It is also possible to isolate the enone reductase having the above-mentioned physicochemical properties (A)-(C) and obtain the polynucleotide of the present invention based on its structural characteristics. After purifying the enzyme of the present invention, the N-terminal amino acid sequence is analyzed, further cleaved with an enzyme such as lysyl endopeptidase, V8 protease, etc., the peptide fragment is purified by reverse phase liquid chromatography and the amino acid sequence is analyzed by a protein sequencer. By doing so, a plurality of amino acid sequences can be determined.

Once the partial amino acid sequence is revealed,
The nucleotide sequence encoding it can be deduced. A primer for PCR was designed based on the deduced nucleotide sequence or the nucleotide sequence shown in SEQ ID NO: 1, and PCR was performed using the chromosomal DNA of the enzyme-producing strain or a cDNA library as a template.
By performing the above, a part of the DNA of the present invention can be obtained.

Further, using the obtained DNA fragment as a probe, a restriction enzyme digestion product of the chromosomal DNA of the enzyme-producing strain is introduced into a phage, a plasmid, etc., and a library or cDNA library obtained by transforming E. coli is obtained. Utilizing this, the DNA of the present invention can be obtained by colony hybridization, plaque hybridization, or the like.

In addition, the nucleotide sequence of the DNA fragment obtained by PCR is analyzed, and a PCR primer for extending outside the known DNA is designed from the obtained sequence, and the chromosomal DNA of the enzyme-producing strain is appropriately selected. After digestion with restriction enzymes, reverse PCR using DNA as a template by self-cyclization reaction (Genetics
120, 621-623 (1988)) and RACE method (Rapid Amplif
ication of cDNA End, “PCR Experiment Manual” p25-33,
It is also possible to obtain the DNA of the present invention by HBJ Publishing Bureau, etc.

The DNA of the present invention can also be obtained by synthesis in addition to the genomic DNA cloned by the above method or cDNA.

By inserting the thus isolated DNA encoding the enone reductase according to the present invention into a known expression vector, an enone reductase expression vector is provided. Then, the enone reductase of the present invention can be obtained from the recombinant by culturing the transformant transformed with this expression vector. Alternatively, the enone reductase of the present invention can be obtained from the recombinant by culturing the transformant in which the DNA encoding the enone reductase of the present invention is integrated into the genome.

The recombinant vector of the present invention also includes a recombinant vector in which a polynucleotide encoding a dehydrogenase that uses NADP as a coenzyme and catalyzes an oxidation reaction is inserted together with the DNA encoding the enone reductase of the present invention. As these dehydrogenases, glucose dehydrogenase, glutamate dehydrogenase, formate dehydrogenase, malate dehydrogenase, glucose-6-phosphate dehydrogenase, phosphogluconate dehydrogenase, alcohol dehydrogenase, Glycerol dehydrogenase and the like can be mentioned. These enzymes can be used when NADPH, which is a coenzyme of the enone reductase of the present invention, is regenerated from NADP ⁺ .

In order to express an enone reductase having NADPH as a coenzyme in the present invention, the microorganism to be transformed contains a DNA encoding a polypeptide having NADPH as a coenzyme and having an enone reductase activity. There is no particular limitation as long as it is an organism that can be transformed with a recombinant vector and can express an enone reductase activity using NADPH as a coenzyme. Examples of usable microorganisms include the following microorganisms. Escherichia genus Bacillus genus Pseudomonas genus Serratia genus Brevibacterium genus Corynebacterium genus Streptococcus genus Lactobacillus genus host vector systems Bacterium Rhodococcus genus Streptomyces genus Streptomyces genus actinomycete Saccharomyces genus Kluyveromyces genus Schizosaccharomyces genus Tigo Zygosaccharomyces spp.Yarrowia spp.Trichosporon spp.Rhodosporidium spp.Pichia spp.Pichia spp.Candida spp. The yeast Neurospora spp. (Aspergillus) Cephalospori Beam (Cephalosporium) genus Trichoderma (Trichoderma) mold that has been developed host vector system such as the genus

The procedure for producing a transformant and the construction of a recombinant vector suitable for a host can be carried out according to the techniques commonly used in the fields of molecular biology, biotechnology and genetic engineering (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laborat
ories). In order to express the enone reductase gene of NADP ⁺ coenzyme of the present invention in a microorganism, etc., first, this DNA is introduced into a plasmid vector or a phage vector which is stably present in the microorganism, and its genetic information Need to be transcribed and translated. For that purpose, a promoter which is a unit for controlling transcription / translation may be incorporated upstream of the 5′-side of the DNA chain of the present invention, and more preferably, a terminator may be incorporated downstream of the 3′-side thereof.
As the promoter and terminator, it is necessary to use a promoter and terminator known to function in the microorganism used as the host.
Regarding the vectors, promoters, terminators, etc. that can be used in these various microorganisms, "Basic Microbiology Course 8 Genetic Engineering / Kyoritsu Shuppan", especially regarding yeast, see Ad
v. Biochem. Eng. 43, 75-102 (1990), Yeast 8, 423-4
88 (1992), and the like.

For example, in the genus Escherichia, particularly Escherichia coli, pBR and pUC system plasmids can be used as plasmid vectors,
lac (β-galactosidase), trp (tryptophan operon), tac, trc (fusion of lac and trp), λ phage PL, P
A promoter derived from R or the like can be used. Moreover, as the terminator, a terminator derived from trpA, a phage, a rrnB ribosomal RNA, or the like can be used. Among these, the commercially available pSE420 (In
The vector pSE420D (described in JP-A-2000-189170) in which the multi-cloning site of Invitrogen) is partially modified can be preferably used.

In the genus Bacillus, pU is used as a vector.
B110 series plasmids, pC194 series plasmids, etc. are available and can be integrated into the chromosome. Further, apr (alkaline protease), npr (neutral protease), amy (α-amylase) and the like can be used as promoters and terminators.

In the genus Pseudomonas, Pseudomonas putida, Pseudomonas
Host vector systems have been developed such as Pseudomonas cepacia. A plasmid involved in the degradation of toluene compounds. A broad host range vector based on the TOL plasmid.
PKT240 and the like (including a gene necessary for autonomous replication derived from RSF1010 and the like) can be used, and a lipase (JP-A-5-284973) gene and the like can be used as a promoter and a terminator.

Brevibacterium genus, in particular Brevibacterium lactofum
ermentum), a plasmid vector such as pAJ43 (Gene 39, 281 (1985)) can be used. As the promoter and terminator, the promoter and terminator used in E. coli can be used as they are.

In the genus Corynebacterium, particularly Corynebacterium glutamicum, pCS11 (Japanese Patent Laid-Open No. 57-183799) and pCB101 (Mol. Gen.
Plasmid vectors such as Genet. 196, 175 (1984) are available.

In the genus Streptococcus, pHV1301 (FEMS Microbiol. Lett. 26, 239 (19
85), pGK1 (Appl. Environ. Microbiol. 50, 94 (198
5)) and the like can be used as a plasmid vector.

In the genus Lactobacillus, pAMβ1 (J.
Bacteriol. 137, 614 (1979)) and the like, and those used in E. coli as a promoter can be used.

In the genus Rhodococcus, Rhodococcus rhodoch
rous) isolated plasmid vector can be used (J. Gen. Microbiol. 138, 1003 (1992)).

In the genus Streptomyces, Hopwood et al., Genetic Manipulation of Strepto
myces: A Laboratory Manual Cold Spring Harbor Labo
A plasmid can be constructed according to the method described in ratories (1985). Especially in Streptomyces lividans, pIJ486
(Mol. Gen. Genet. 203, 468-478, 1986), pKC1064 (Gen
e 103,97-99 (1991)), pUWL-KS (Gene 165,149-150 (1
995)) can be used. Also, in Streptomyces virginiae, the same plasmid can be used (Actinomycetol. 11,
46-53 (1997)).

Saccharomyces genus, especially Saccharomyces cer
evisiae), YRp-based, YEp-based, YCp-based, and YIp-based plasmids are available, and integration vectors (such as EP 537456) that utilize homologous recombination with multiple copies of ribosomal DNA in the chromosome It is extremely useful because the gene can be introduced in and the gene can be stably retained. Also, ADH (alcohol dehydrogenase), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), PHO (acid phosphatase), GAL (β-galactosidase), PGK (phosphoglycerate kinase), ENO (enolase) Such promoters and terminators are available.

In the genus Kluyveromyces, especially Kluyveromyces lactis, a 2 μm plasmid derived from Saccharomyces cerevisiae and a pKD1 plasmid (J. Bacteriol. 145, 382-390
(1981)), a pGKl1-derived plasmid involved in killer activity, KARS, an autonomous growth gene in Kleiberomyces.
Vector plasmids (such as EP 537456) that can be integrated into the chromosome by homologous recombination with system plasmids and ribosomal DNA are available. Also AD
Promoters and terminators derived from H, PGK, etc. can be used.

Schizosaccharomyc
In the genus es), a plasmid vector containing an ARS (gene involved in autonomous replication) derived from Schizosaccharomyces pombe and a selection marker complementing an auxotrophy derived from Saccharomyces cerevisiae is available (Mol.
Cell. Biol. 6, 80 (1986)). In addition, the ADH promoter derived from Schizosaccharomyces pombe can be used (EMBO J. 6, 729 (1987)). In particular, pAUR224 is commercially available from Takara Shuzo and is easily available.

Zygosaccharomyc
es), Zygosaccharomyces rouxii (Zyg
osaccharomyces rouxii) derived pSB3 (Nucleic Acids R
es.13, 4267 (1985)) and other plasmid vectors are available, including the PHO5 promoter derived from Saccharomyces cerevisiae and GAP-Zr (glyceraldehyde-3-phosphate dehydrogenase) derived from T. saccharomyces rouxii. Promoter (Agri. Biol. Chem. 54, 252
1 (1990)) are available.

In the genus Pichia, a host vector system utilizing genes (PARS1, PARS2) involved in Pichia-derived autonomous replication in Pichia pastoris and the like has been developed (Mol. Cell. Biol. 5, 33
76 (1985)), AO inducible by high concentration culture and methanol.
Strong promoters such as X are available (Nucleic Acids
Res. 15, 3859 (1987)). Also, Pichia Angusta (P
ichia angusta, former name Hansenula Polymorpha Hansen
ula polymorpha) a host vector system has been developed. As the vector, genes (HARS1 and HARS2) involved in autonomous replication derived from Pichia angusta can be used, but since they are relatively unstable, multicopy integration into the chromosome is effective (Yeast 7, 431- 443 (19
91)). In addition, promoters of AOX (alcohol oxidase) and FDH (formate dehydrogenase), which are induced by methanol and the like, can be used.

In the genus Candida, Candida maltosa, Candida albicans, Candida tropicalis, Candida tropicalis
Host vector systems have been developed in Utilus (Candida utilis) and the like. In Candida maltosa, ARS derived from Candida maltosa has been cloned (Agri. Biol. Chem. 51, 51, 1587 (1987)), and a vector utilizing this has been developed. In Candida utilis, a strong promoter has been developed for a chromosome integrated type vector (Japanese Patent Laid-Open No. 08-173170).

In the genus Aspergillus, Aspergillus niger, Aspergillus oryzae, and the like are the most well-studied molds, and plasmid and chromosome integration are available. , Promoters derived from extracellular protease and amylase are available (Trends in Biotechnology 7, 283-287 (198
9)).

In the genus Trichoderma, a host vector system utilizing Trichoderma reesei has been developed, and an extracellular cellulase gene-derived promoter or the like can be used (Biotechnol
ogy 7, 596-603 (1989)).

In addition to microorganisms, various host-vector systems have been developed in plants and animals, especially insects using silkworms (Nature 315, 592-594 (1985)), rapeseed, corn, potato and the like. A system for expressing a large amount of a heterologous protein in a plant has been developed and can be preferably used.

Further, the transformant expressing the enone reductase of the present invention obtained by the above method can be used for the production of the enzyme of the present invention and the carbon-carbon double bond of α, β-unsaturated ketone described below. Can be used for the production of α, β-saturated ketones.

That is, the present invention provides the enone reductase,
A step of reacting an α, β unsaturated ketone with any enzyme active substance selected from the group consisting of a microorganism producing the enzyme or protein, and a treated product of the microorganism,
The present invention relates to a method for selectively reducing a carbon-carbon double bond of an α, β-unsaturated ketone. By bringing the enzyme of the present invention, the culture containing the enzyme, and the treated product thereof into contact with the reaction solution, the desired enzyme reaction can be carried out.

In the method of the present invention, the enone reductase is a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, a homolog thereof, or an enone reductase having the physicochemical properties (A)-(C). Can be used. The enone reductase can be used not only as a purified enzyme but also as a crudely purified enzyme. Furthermore, in the present invention, cells capable of producing enone reductase can be used as the enone reductase. The cell having the ability to produce enone reductase used in the present invention is prepared by utilizing all strains, mutants, variants and gene manipulation techniques belonging to the genus Kleiberomyces having the ability to produce NADPH-dependent enone reductase. And a transformant having the ability to produce the enzyme of the present invention.

The form of contact between the enzyme and the reaction solution is not limited to these specific examples. The reaction solution is prepared by dissolving NADPH, which is a substrate and a coenzyme required for an enzymatic reaction, in a suitable solvent that provides a desired environment for expression of the enzymatic activity. The treated product of a microorganism containing an enone reductase in the present invention, specifically, a microorganism whose permeability of a cell membrane is changed by treatment with an organic solvent such as a surfactant or toluene,
Alternatively, it includes glass beads, a cell-free extract obtained by crushing bacterial cells by enzyme treatment, or a partially purified product thereof.

The α, β-unsaturated ketone in the present invention is not limited. For example, the compound represented by the following general formula I can be represented as an α, β-unsaturated ketone.

Formula I

[Chemical 1]

In the formula, R1 is hydrogen, an alkyl group, an allyl group, an alkenyl group, an aralkyl group, or an alkoxy group (provided that the alkyl group, the allyl group, the alkenyl group, the aralkyl group, and the alkoxy group are substituted. R2, R3, and R4 represent hydrogen, or an optionally substituted short-chain alkyl group.

Examples of the alkyl group, allyl group, alkenyl group, aralkyl group and alkoxy group for R1 include those having 1 to 8 carbon atoms. Further, these substituents may be substituted with halogen, nitro group, amino group, alkoxy group or the like. On the other hand, examples of the short-chain alkyl group for R2-R4 include methyl, ethyl, butyl, or propyl. These short chain alkyl groups may also be substituted with halogen, nitro group, amino group, alkoxy group or the like. R2-R4 is
The substituents may be independent or simultaneously.

Specifically, compounds having the following substituents as R1 to R4 are desirable as the substrate compound in the present invention. R1 = H, methyl group, ethyl group, phenyl group, 3-pyridyl group, 2-pyridyl group, 3-nitrophenyl group, 3-methoxyphenyl group, and 4-methoxyphenyl group R2 = H, methyl group, and ethyl Group R3 = H, methyl group, and ethyl group R4 = H, methyl group, and ethyl group

More specifically, methyl vinyl ketone, ethyl vinyl ketone, 3-penten-2-one, 3-methyl-3-penten-2-one, 2-hexenone, 2-methyl-2-hexenone, 3 -Methyl-4- (3-pyridyl) -3-buten-2-one, 3-methyl-4-phenyl-3-buten-2-one, 3-methyl-4- (3-nitrophenyl) -3- Butene-2-one and the like are preferably used.

Furthermore, the enzyme of the present invention, or a microorganism producing the enzyme or a treated product thereof is allowed to act on an α, β-unsaturated ketone having an α-substitution to synthesize an optically active saturated ketone. Available. For example, 3-methyl-4- (3-pyridyl) -3-buten-2-one to (S) -3-methyl-4- (3-pyridyl) -butan-2-one, 3-methyl-4-one (3-nitrophenyl)
From (3-buten-2-one) (S) -3-methyl-4-
(3-Nitrophenyl) -3-butan-2-one and the like can be synthesized.

In the above-mentioned method for producing a ketone according to the present invention, a regeneration system of NADPH can be combined. NADPH to NADP ⁺ accompanying the reduction reaction by enone reductase
Is generated. Regeneration from NADP ⁺ to NADPH can be carried out by an enzyme (system) that regenerates NADP ⁺ from NADP ⁺ contained in the microorganism. These NADP ⁺ reducing ability can be enhanced by adding glucose or ethanol to the reaction system. Further, an enzyme having an ability to generate NADPH from NADP ⁺ , for example, glucose dehydrogenase, glutamate dehydrogenase, formate dehydrogenase, malate dehydrogenase, glucose-6-phosphate dehydrogenase, phosphogluconate NADPH can be regenerated by using a microorganism containing a dehydrogenase, an alcohol dehydrogenase, a glycerol dehydrogenase and the like, a treated product thereof, and a partially purified or purified enzyme. For example, in the case of the glucose dehydrogenase, NADPH is regenerated by utilizing the conversion of glucose into δ-gluconolactone.

These components constituting the reaction required for NADPH regeneration can be added to the reaction system for producing the ketone according to the present invention or immobilized. Alternatively, they can be contacted via a membrane that allows exchange of NADPH.

When a microorganism transformed with the recombinant vector containing the DNA of the present invention is used in the above-mentioned method for producing a ketone in a living state, an additional reaction system for NADPH regeneration is unnecessary. Sometimes you can. That is, NADP
By using a microorganism having a high H-regenerating activity as a host, an efficient reaction can be performed in a reduction reaction using a transformant without adding an enzyme for NADPH regeneration. In addition, glucose dehydrogenase available for NADPH regeneration,
Formate dehydrogenase, alcohol dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (malate dehydrogenase, etc.)
It is also possible to perform more efficient expression and reduction reaction of NADPH regenerating enzyme and NADPH-dependent enone reductase by introducing such genes into the host at the same time as the DNA encoding the NADPH-dependent enone reductase of the present invention. It is possible. In order to avoid incompatibility in Escherichia coli, introduction of these two or more genes into a host is carried out by transforming the host with a recombinant vector into which a plurality of genes having different origins of replication are separately introduced. Or a method of introducing both genes into a single vector, one of them, or
For example, a method of introducing both genes into the chromosome can be used.

As a glucose dehydrogenase that can be used for NADPH regeneration in the present invention, Bacillus subtilis (Ba
glucose dehydrogenase derived from Cillus subtilis). The gene encoding this enzyme has already been isolated. Alternatively, it can be obtained from the microorganism by PCR or hybridization screening based on the already revealed nucleotide sequence.

When a plurality of genes are introduced into a single vector, a method for linking regions involved in expression control such as promoter and terminator to each gene, or expression as an operon containing a plurality of cistrons such as lactose operon It is also possible to let.

The reduction reaction using the enzyme of the present invention can be carried out in water or in two phases of an organic solvent which is difficult to dissolve in water and water. As the organic solvent which is difficult to dissolve in water, for example, ethyl acetate, butyl acetate, toluene,
Chloroform, n-hexane, isooctane, etc. can be used. Alternatively, it can also be carried out in a mixed system of an organic solvent such as ethanol, acetone, dimethylsulfoxide and acetonitrile and an aqueous medium.

The reaction of the present invention can also be carried out using an immobilized enzyme, a membrane reactor or the like. In particular, since the α, β-unsaturated ketone that is the substrate for this reaction is mostly poorly soluble in water, it contains the enzyme of the present invention and the enzyme of the present invention through a hydrophobic membrane such as polypropylene. The inhibitory action by the substrate and the product can be reduced by bringing the aqueous phase containing the microorganism and the treated product thereof into contact with the organic solvent phase containing the substrate α, β-unsaturated ketone and reacting them.

The enzymatic reaction with the enone reductase of the present invention can be carried out under the following conditions. -Reaction temperature: 4-55 ° C, preferably 15-45 ° C-pH: 4-9, preferably 5.0-8.0, more preferably pH 6.
0-7.0 ・ Substrate concentration: 0.01-90%, preferably 0.1-20%

When the solubility of the nitrile compound as the substrate in the aqueous medium is extremely small, a surfactant can be added to the reaction solution. As a surfactant, 0.1
~ 5.0 wt% Triton X-100 or Tween 60 is used. The use of a mixed solvent with an organic solvent is also effective for improving the solubility of the substrate. Specifically, for example, the reaction can be efficiently performed by adding methanol, ethanol, dimethyl sulfoxide, or the like. Alternatively, in an organic solvent that is difficult to dissolve in water, or in a two-phase system of an organic solvent that is difficult to dissolve in water and an aqueous medium,
The reaction of the present invention can be carried out. As the organic solvent which is difficult to dissolve in water, for example, ethyl acetate, butyl acetate, toluene, chloroform, n-hexane, cyclohexane, octane, or 1-octanol can be used.

With respect to this substrate concentration, the enone reductase of the present invention, or the enzyme active substance comprising the microorganism having the enzyme activity and / or a treated product thereof is, for example, 1 mU / mL to 100 U / mL, preferably By setting the amount of enzyme activity to 100 mU / mL or more, the enzyme reaction can be efficiently advanced. When microbial cells are used as the enzyme active substance, the amount of the microorganisms used with respect to the substrate is preferably 0.01 to 5.0% by weight as dry cells. Enzymes and enzyme active substances such as bacterial cells can be brought into contact with the substrate by dissolving or dispersing in the reaction solution. Alternatively, an enzyme active substance immobilized by a method such as chemical bonding or entrapment can be used.
Further, the substrate solution can be permeated, but the substrate solution and the enzyme active substance can be reacted in a state of being separated by a porous membrane that restricts permeation of enzyme molecules and bacterial cells.

If necessary, the coenzyme NADP ⁺ or NADPH can be added to the reaction system in an amount of 0.001 mM-100 mM, preferably 0.01-10 mM. The substrate can be added all at once at the start of the reaction, but it is desirable to add it continuously or discontinuously so that the substrate concentration in the reaction solution does not become too high.

Compounds added to the reaction system for NADPH regeneration, such as glucose when glucose dehydrogenase is used, formic acid when formate dehydrogenase is used, ethanol when alcohol dehydrogenase is used, or
2-Propanol, L-glutamic acid when using glutamate dehydrogenase, L-malic acid when using malate dehydrogenase, etc., are used in a molar ratio of 0.1 to the substrate α, β-unsaturated ketone. -20, preferably 0.5-5 times in excess. Enzymes for NADPH regeneration, such as glucose dehydrogenase, formate dehydrogenase, alcohol dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (malate dehydrogenase, etc.), are NADPH-dependent enones of the present invention. 0.1-100 times more enzymatic activity than reductase, preferably
About 0.5 to 20 times can be added.

The purification of the ketone produced by reduction of the α, β-unsaturated ketone of the present invention is carried out by centrifugation of bacterial cells and proteins,
It can be carried out by appropriately combining separation by membrane treatment and the like, solvent extraction, distillation, chromatography and the like.

The enzymes of the present invention used in these various synthetic reactions are not limited to the purified enzymes, but include partially purified enzymes, microbial cells containing the enzymes, and processed products thereof. The term "treated product" as used in the present invention is a generic term for cells, purified enzymes, partially purified enzymes and the like that have been immobilized by various methods. Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited thereto.

[0095]

[Example 1] Purification of enone reductase Klaveromyces lactis IFO 1267 strain was treated with 1.2 L of YM medium (glucose 20 g / L, yeast extract 3 g / L, malt extract 3 g / L, peptone 5 g). / L,
The cells were cultured at pH 6.0) and centrifuged to prepare the cells. The obtained wet bacterial cells were treated with 50 mM potassium phosphate buffer (p
H8.0), 0.02% 2-mercaptoethanol and 2 mM phenylmethanesulfonyl fluoride (PMSF).
The suspension was suspended in, and after crushing with a bead beater (manufactured by Biospec), the cell debris was removed by centrifugation to obtain a cell-free extract. Protamine sulfate was added to this cell-free extract, and the supernatant was obtained by removing the nucleic acid by centrifugation. Ammonium sulfate was added to the supernatant until it became 30% saturated, and a standard buffer solution containing 10% ammonium sulfate (10 mM Tris-hydrochloric acid buffer solution (pH 8.5), 0.
Phenyl-Sepharose HP (2.6) equilibrated with 01% 2-mercaptoethanol, 10% glycerol).
cm × 10 cm), and gradient elution was performed with an ammonium sulfate concentration of 30% -0%.

The NADPH-dependent methyl vinyl ketone reducing activity had two peaks in the gradient elution portion. Of these peaks, the peak portion eluted to the front was collected and concentrated by ultrafiltration. After the concentrated enzyme solution was dialyzed against a standard buffer solution, MonoQ (0.5
cm × 5 cm). After washing the column with standard buffer, a gradient elution of 0-0.5M sodium chloride was performed. The active fraction eluted was collected and concentrated by ultrafiltration.

Ammonium sulfate was added to the concentrated enzyme solution to a saturated concentration of 30%, and
Phenyl-equilibrated with a standard buffer containing 0% saturated ammonium sulfate
Added to superloose (0.5 cm x 5 cm). After washing with the same buffer, gradient elution was performed with 30% -0% saturated ammonium sulfate. The eluted active fraction was collected. The concentrated enzyme solution was dialyzed against a standard buffer solution, and then added to Blue Sepharose (5 mL) equilibrated with the same buffer solution. After washing the column with standard buffer, a gradient elution of 0-0.5M sodium chloride was performed. The active fraction eluted was collected and concentrated by ultrafiltration.

The active fraction obtained by Blue Sepharose was analyzed by SDS-PAGE and as a result, it was found to have a substantially single band (FIG. 1). The specific activity of the purified enzyme for methyl vinyl ketone was about 1.3 U / mg. A summary of the purification is shown in Table 1.

[0099]

[Table 1]

[Example 2] Measurement of molecular weight of enone reductase The molecular weight of the subunit of the enzyme obtained in Example 1 was measured by SDS-
The result of PAGE was about 47,000. The molecular weight was about 92,000 when measured with a gel filtration column of Superdex G200.
From these results, the enone reductase of the present invention was expected to be a homodimer.

[Example 3] Optimal pH of enone reductase Example 1 was carried out by changing the pH using a potassium phosphate buffer solution, a Tris-hydrochloric acid buffer solution, a sodium acetate buffer solution, and a broad-range buffer solution of Britton Robinson. The methyl vinyl ketone reducing activity of the enzyme obtained in 1 was examined, and the activity was expressed as a relative activity with the maximum activity being 100, and is shown in FIG. The optimum pH for the reaction is 6.
It was 2, and showed 80% or more of the maximum activity in an extremely wide range of pH 5.0-8.0.

[Example 4] Optimum temperature of enone reductase The enzyme obtained in Example 1 was subjected to standard reaction conditions except for the temperature to measure the methyl vinyl ketone reducing activity.
The maximum activity is defined as 100, and the relative activity is shown in FIG. The optimum temperature for the reaction was 37 ° C, and 80% or more of the maximum activity was shown at 37-45 ° C.

[Example 5] Substrate specificity of enone reductase The enzyme obtained in Example 1 was reacted with various enones, ketones and aldehydes, and the activity of the reduction reaction was set to 100 for the reduction of methyl vinyl ketone. The relative activity is shown in Table 2.

[0104]

[Table 2]

[Example 6] Partial amino acid sequence of enone reductase Using the enzyme obtained in Example 1, a gel fragment containing the enone reductase was cut out from the gel of SDS-PAGE, washed twice, and lysylized. In-gel digestion was performed overnight at 35 ° C. using endopeptidase. The digested peptide was analyzed by reverse phase HPLC (TSK gel ODS-80-Ts, 2.0 manufactured by Tosoh Corporation).
mm x 250 mm) and 0.1% trifluoroacetic acid (TF
The peptides were separated and fractionated by gradient elution of acetonitrile in A).

The two peaks of the separated peptides were labeled lep_59, l
ep_78 and the protein sequencer (Hewlett
The amino acid sequence was analyzed by Packard G1005A Protein Sequencer System. The amino acid sequences of lep_59 and lep_78 are shown in SEQ ID NOs: 3 and 4, respectively. Using this amino acid sequence, a homology search was performed on SWISS-PROT using the BLAST program, and it was found to be consistent with the ORF (KYE1) expected to be NADPH-Dehydrogenase of Kleiberomyces lactis.

[0107] SEQ ID NO: 3: lep_59 Met-Ser-Ala-Glu-Gly-Tyr-Ile-Asp-Tyr-Pro-Thr-Tyr SEQ ID NO: 4: lep_65 Arg-Leu-Ala-Tyr-Val-Asp-Leu-Val-Glu-Pro-Arg-Val

[Example 7] Purification of chromosomal DNA from Kleiberomyces lactis The Kleiberomyces lactis IFO 1267 strain was cultured in YM medium to prepare cells. Purification of chromosomal DNA from bacterial cells was performed by Meth. Cell Biol. 29, 39-44 (1975).
It was performed by the method described in.

[Example 8] Cloning of the enone reductase gene KYE1 (SWISS-PROT Accession N registered in DDBJ)
o., P40952) corresponding DNA sequence (DDBJ Accession No.,
L37452) was used to synthesize PCR primers KYE1-ND (SEQ ID NO: 5) and KYE1-Cu (SEQ ID NO: 6). 25 pmol of each primer, 10 nmol of dNTP, 50 ng of Kleiberomyces lactis-derived chromosomal DNA, Pfu
Buffer for DNA polymerase (STRATAGENE), Pfu DNA pol
Using 50 μL reaction solution containing ymerase 2U (manufactured by STRATAGENE), denaturation (95 ° C, 45 seconds), annealing (50 ° C,
1 minute), extension (75 ° C, 6 minutes) for 30 cycles, GeneAmp
As a result of PCR using PCR System 2400 (manufactured by Applied Biosystems Japan), a specific amplification product was obtained.

The obtained DNA fragment was extracted with phenol / chloroform and recovered as an ethanol precipitate. DN
The A fragment was double-digested with the restriction enzymes Afl III and Xba I, subjected to agarose gel electrophoresis, the target band portion was excised, and purified by Sephaglas BandPrep Kit (Pharmacia). The obtained DNA fragment was ligated with pSE420D double-digested with NcoI and XbaI and Takara Ligation Kit. E. coli JM1 with ligated DNA
09 strain was transformed and L containing ampicillin (50 mg / L)
A plasmid was grown from the transformant obtained by growing in B medium.
Purified by FlexiPrep.

The nucleotide sequence of the inserted DNA portion of the plasmid was analyzed. BigDye Terminato for DNA sequence analysis
PCR was carried out using a r Cycle Sequencing FS ready Reaction Kit (manufactured by Perkin Elmer) and a DNA sequencer ABI PRISM ^™ 310 (manufactured by Perkin Elmer). The obtained DNA base sequence is shown in SEQ ID NO: 1 and the encoded protein sequence is shown in SEQ ID NO: 2. For ORF searches from DNA sequences, translation into predicted amino acid sequences, etc.
It was performed using x-WIN (manufactured by Software Development Co., Ltd.). As a result, 766-GTT (Val) was registered in DDBJ, but it was 766-GGT (Gly). Everything else was a perfect match. The resulting plasmid was designated as pSE-KYE1.

[0112] KYE1-ND / SEQ ID NO: 5 ACGACATGTCATTTATGAACTTTGAAC KYE1-Cu / SEQ ID NO: 6 TGTTCTAGATTATTTCTTGTAACCCTTGGC

Example 9 Partial Purification of Recombinant Enone Reductase The Escherichia coli HB101 strain transformed with the plasmid pSE-KYE1 expressing the enone reductase was cultured overnight at 30 ° C. in 50 mL of liquid LB medium containing ampicillin, 0.1 mM IPTG was added, and the cells were further cultured for 4 hours.

After collecting the bacterial cells by centrifugation, 0.02%
Suspended in 30 mL of 50 mM potassium phosphate buffer (pH 8.0) containing 2-mercaptoethanol, 2 mM PMSF and 10% glycerin, and treated with a closed ultrasonic crusher UCD-200TM (manufactured by Cosmo Bio) for 3 minutes. The cells were disrupted by repeating 4 times. The disrupted cell suspension was centrifuged and the supernatant was collected as a cell extract. Protamine sulfate was added to this cell-free extract, and the supernatant was obtained by removing the nucleic acid by centrifugation. Ammonium sulfate was added to the supernatant until 30% saturation, and a buffer containing 30% ammonium sulfate (10 mM Tris-hydrochloric acid buffer (pH 8.
5), 0.01% 2-mercaptoethanol, 10%
Phenyl-Sepharose H equilibrated with glycerol)
P (2.6 cm x 10 cm) and added ammonium sulfate concentration of 30%-
A 0% gradient elution was performed. The NADPH-dependent methylenone reduction activity had a peak in the gradient elution portion, and the eluted peak portion was collected and concentrated by ultrafiltration. The specific activity of partially purified enzyme for methyl vinyl ketone is about 1.
It was 68 U / mg. A summary of the purification is shown in Table 3.

[0115]

[Table 3]

[Example 10] Comparison with host only The activity of the recombinant enone reductase obtained in Example 9 against various substrates was measured. In addition, Escherichia coli HB101 strain containing no plasmid was cultured overnight in 50 mL of LB medium to give 0.1
The cells cultured for 4 hours after the addition of mM IPTG were crushed in the same manner as in Example 9, and the activity against various substrates was measured. The results are shown in Table 4.

[0117]

[Table 4]

[Example 11] Synthesis of 3-pentanone using recombinant enone reductase Recombinant enone reductase 0.5 obtained in Example 9
U (relative to ethyl vinyl ketone), 200 mM potassium phosphate buffer (pH 6.5), 44 mg NADPH, 0.2%
A reaction solution containing 1 mL of ethyl vinyl ketone was reacted overnight at 25 ° C. The produced 3-pentanone was quantified by gas chromatography, and the yield with respect to ethyl vinyl ketone as a starting material was determined. The conditions of gas chromatography are as follows. That is, Porapak
Using PS (Waters, mesh 50-80, 3.2 mm × 210 cm), the column temperature was set to 130 ° C., and the analysis was carried out using a hydrogen flame ionization detector (FID). As a result, reaction yield 1
3-Pentanone was produced at 00%.

Reference Example 1 4- (3-pyridyl) -3-methyl-3-
Synthesis of buten-2-one 25 mmol nicotinaldehyde and 50 mmol 2-butanone in acetic acid
Dissolve in 35 mL, add 4 mL of concentrated sulfuric acid dropwise with stirring, and
Heated to 0 ° C. After 4 hours, 50 mL of water was added, and the mixture was made basic with a 20% aqueous sodium hydroxide solution. The aqueous layer was extracted with ethyl acetate, the organic layers were combined, washed with a saturated aqueous solution of sodium chloride, and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure and the concentrated residue was purified by silica gel column chromatography to give 4- (3-pyridyl) -3-methyl-
3-Buten-2-one was obtained with a yield of 75%.

Reference Example 2 Synthesis of 4- (3-nitrophenyl) -3-methyl-3-buten-2-one 25 mmol of 3-nitrobenzaldehyde and 50 mmol of 2-butanone
Was dissolved in 35 mL of acetic acid, and 2 mL of concentrated sulfuric acid was added dropwise with stirring. After 22 hours, 50 mL of water was added and neutralized with a 20% aqueous sodium hydroxide solution. The aqueous layer was extracted with ethyl acetate, and the organic layers were combined, washed with a saturated sodium hydrogen carbonate aqueous solution and a saturated sodium chloride aqueous solution, and then dried with anhydrous sodium sulfate. The solvent was removed under reduced pressure and the concentrated residue was purified by silica gel column chromatography to give 4- (3-
81% yield of nitrophenyl) -3-methyl-3-buten-2-one
Got with.

Reference Example 3 Racemic 4- (3-pyridyl) -3-
Synthesis of methyl-2-butanone 4- (3-pyridyl) -3-methyl-3-buten-2-one (0.91 mmol) was dissolved in ethanol (5 mL), 5% palladium-carbon (10 mg) was added, and the mixture was added under hydrogen atmosphere to 4 It was stirred for a day. After removing palladium carbon by filtration, the filtrate was concentrated under reduced pressure. The concentrated residue was purified by silica gel column chromatography to obtain racemic 4- (3-pyridyl) -3-methyl-2-butanone in a yield of 84%.

Reference Example 4 Synthesis of racemic 4- (3-nitrophenyl) -3-methyl-2-butanone 30 mL of dry tetrahydrofuran was cooled to 0 ° C. in an ice bath, and 20 mmol of copper (I) chloride was added. And lithium aluminum hydride 5
mmol was added and the mixture was vigorously stirred. After 10 minutes, 5 mmol of 4- (3-nitrophenyl) -3-methyl-3-buten-2-one was added, and
Stir for 1 hour. After adding a very small amount of water, the mixture was filtered, and the filtrate was concentrated under reduced pressure. The concentrated residue was purified by silica gel column chromatography to obtain racemic 4- (3-nitrophenyl) -3-methyl-2-butanone in a yield of 12%.

Example 12 Synthesis of (S) -3-Methyl-4- (3-pyridyl) -2-butanone by Recombinant Enone Reductase Recombinant enone reductase 0.5 obtained in Example 9
U (3-methyl-4- (3-pyridyl) -3-butene-
As a reducing activity for 2-one), 200 mM potassium phosphate buffer (pH 6.5), 44 mg NADPH, 0.2
% 3-Methyl-4- (3-pyridyl) -3-butene-
1 mL of reaction solution containing 2-one (prepared in Reference Example 1)
The reaction was carried out overnight at 5 ° C. After the reaction, the resulting 3-methyl-4- (3-pyridyl) was extracted with 1 mL of ethyl acetate.
2-Butanone was quantified by gas chromatography, and the starting material was 3-methyl-4- (3-pyridyl) -3-.
The yield based on buten-2-one was determined.

The conditions of gas chromatography are as follows. That is, Cp-Cyclodextri
n-β-2,3,6-M-19 (GL Science,
0.25 mm x 25 m), the column temperature is 150 ° C,
The injection temperature was 250 ° C., the detector temperature was 260 ° C., and analysis was performed using a hydrogen flame ionization detector (FID). Helium was used as the carrier gas, and the flow rate was set to 1.6 mL / min. Under this condition, as a result of analyzing the racemate synthesized in Reference Example 3, the R-isomer was 12.59 minutes, and the S-isomer was 12.7.
Detected at 4 minutes. As a result, the yield of the reaction was 100%, and the obtained 3-methyl-4- (3-pyridyl) -2 was obtained.
-Butanone was an S-isomer having an optical purity of 99% ee or higher.

Example 13 (S) -3-Methyl-4- (3-nitrophenyl) -2 by Recombinant Enone Reductase
-Synthesis of butanone 0.5 recombinant enone reductase obtained in Example 9
U (as activity against 3-methyl-4- (3-nitrophenyl) -3-buten-2-one), 200 mM potassium phosphate buffer (pH 6.5), 44 mg NADPH, 0.2
Reaction liquid containing 1% of 3-methyl-4- (3-nitrophenyl) -3-buten-2-one (prepared in Reference Example 2)
L was reacted overnight at 25 ° C. After the reaction, after extraction with 1 mL of ethyl acetate, the produced 3-methyl-4- (3-nitrophenyl) -2-butanone was quantified by gas chromatography, and 3-methyl-4- (3 as a starting material was used. The yield based on -nitrophenyl) -3-buten-2-one was determined.

The gas chromatography conditions were the same as in Example 12 except that the column temperature was 160 ° C.
Under these conditions, as a result of analyzing the racemate synthesized in Reference Example 4, the R form was detected at 46.67 minutes and the S form was detected at 48.25 minutes. As a result, the yield of the reaction was 100%, and the obtained 3-methyl-4- (3-nitrophenyl)-
The optical purity of 2-butanone was S-isomer with 99% ee or more.

[0127]

INDUSTRIAL APPLICABILITY A novel enzyme for reducing an enone to produce a ketone and an optically active ketone is provided. The enone reductase of the present invention reduces a carbon-carbon double bond of an α, β-unsaturated ketone to produce a corresponding saturated hydrocarbon.
Its optical specificity is extremely high, for example 3-Methyl-4-
When (3-pyridyl) -3-buten-2-one is used as a substrate, its α, β-unsaturated bond is selectively reduced to 90% ee or more.
(S) -3-methyl-4- (3-pyridyl) -3-butan-2-one is produced. It is of great significance to realize such an enzymatic method for producing an optically active ketone having high optical purity.

[0128]

[Sequence list]                                SEQUENCE LISTING <110> DAICEL CHEMICAL INDUSTRIES, LTD. <120> Enone reductase. <130> D1-A0108 <140> <141> <160> 6 <170> PatentIn Ver. 2.1 <210> 1 <211> 1197 <212> DNA <213> Kluyveromyces lactis <400> 1 atgtcattta tgaactttga accaaagcca ttggctgata ctgatatctt caaaccaatc 60 aagattggta acactgaatt gaagcacagg gttgtcatgc ctgcattgac aagaatgaga 120 gcgttgcatc caggcaacgt tccaaaccct gactgggctg ttgaatatta cagacaacgt 180 tcccaatatc caggtactat gattatcact gaaggtgctt tcccatcagc tcagtcaggt 240 ggttacgata acgcaccagg tgtttggagc gaagaacaac tggctcaatg gagaaagatc 300 ttcaaggcaa ttcacgacaa caagtctttt gtttgggtac aattgtgggt tctaggtaga 360 caagcttttg ctgataactt ggcaagagat ggattgcgtt atgatagtgc ttccgatgaa 420 gtgtacatgg gtgaagatga aaaggaacgt gccatcagat ctaacaaccc tcagcatggt 480 atcaccaagg atgaaattaa gcagtatatc agggactatg ttgatgctgc taagaagtgt 540 atcgatgctg gtgcagatgg tgttgaaatc cattccgcta acggttattt gttgaatcaa 600 ttcctagacc caatctccaa caaaagaact gatgaatacg gtggatccat tgagaaccgt 660 gctagattcg tcttggaagt cgtcgatgcc gttgtcgatg ccgttggtgc cgaaagaacc 720 agtatcagat tctcaccata cggtgtattt ggtaccatgt caggtggttc agaccctgtc 780 ttggtggctc aattcgccta tgtacttgct gaattggaaa agagggcaaa ggctggtaag 840 agattagcat acgtcgattt agtcgaacct cgtgtcacat cgccattcca accggaattt 900 gaaggctggt ataaaggtgg taccaatgaa ttcgtatact ctgtttggaa gggtaacgtg 960 ctaagagttg gtaactacgc tttggaccca gatgctgcca ttacggactc aaagaatcca 1020 aacactttga tcggttacgg tagagccttc attgccaacc cagatcttgt tgaacgtctc 1080 gaaaagggtt tgccattgaa tcaatacgat agaccctctt tctacaaaat gtctgcggaa 1140 gggtatatcg actacccaac atacgaggaa gctgttgcca agggttacaa gaaataa 1197 <210> 2 <211> 398 <212> PRT <213> Kluyveromyces lactis <400> 2 Met Ser Phe Met Asn Phe Glu Pro Lys Pro Leu Ala Asp Thr Asp Ile   1 5 10 15 Phe Lys Pro Ile Lys Ile Gly Asn Thr Glu Leu Lys His Arg Val Val              20 25 30 Met Pro Ala Leu Thr Arg Met Arg Ala Leu His Pro Gly Asn Val Pro          35 40 45 Asn Pro Asp Trp Ala Val Glu Tyr Tyr Arg Gln Arg Ser Gln Tyr Pro      50 55 60 Gly Thr Met Ile Ile Thr Glu Gly Ala Phe Pro Ser Ala Gln Ser Gly  65 70 75 80 Gly Tyr Asp Asn Ala Pro Gly Val Trp Ser Glu Glu Gln Leu Ala Gln                  85 90 95 Trp Arg Lys Ile Phe Lys Ala Ile His Asp Asn Lys Ser Phe Val Trp             100 105 110 Val Gln Leu Trp Val Leu Gly Arg Gln Ala Phe Ala Asp Asn Leu Ala         115 120 125 Arg Asp Gly Leu Arg Tyr Asp Ser Ala Ser Asp Glu Val Tyr Met Gly     130 135 140 Glu Asp Glu Lys Glu Arg Ala Ile Arg Ser Asn Asn Pro Gln His Gly 145 150 155 160 Ile Thr Lys Asp Glu Ile Lys Gln Tyr Ile Arg Asp Tyr Val Asp Ala                 165 170 175 Ala Lys Lys Cys Ile Asp Ala Gly Ala Asp Gly Val Glu Ile His Ser             180 185 190 Ala Asn Gly Tyr Leu Leu Asn Gln Phe Leu Asp Pro Ile Ser Asn Lys         195 200 205 Arg Thr Asp Glu Tyr Gly Gly Ser Ile Glu Asn Arg Ala Arg Phe Val     210 215 220 Leu Glu Val Val Asp Ala Val Val Asp Ala Val Gly Ala Glu Arg Thr 225 230 235 240 Ser Ile Arg Phe Ser Pro Tyr Gly Val Phe Gly Thr Met Ser Gly Gly                 245 250 255 Ser Asp Pro Val Leu Val Ala Gln Phe Ala Tyr Val Leu Ala Glu Leu             260 265 270 Glu Lys Arg Ala Lys Ala Gly Lys Arg Leu Ala Tyr Val Asp Leu Val         275 280 285 Glu Pro Arg Val Thr Ser Pro Phe Gln Pro Glu Phe Glu Gly Trp Tyr     290 295 300 Lys Gly Gly Thr Asn Glu Phe Val Tyr Ser Val Trp Lys Gly Asn Val 305 310 315 320 Leu Arg Val Gly Asn Tyr Ala Leu Asp Pro Asp Ala Ala Ile Thr Asp                 325 330 335 Ser Lys Asn Pro Asn Thr Leu Ile Gly Tyr Gly Arg Ala Phe Ile Ala             340 345 350 Asn Pro Asp Leu Val Glu Arg Leu Glu Lys Gly Leu Pro Leu Asn Gln         355 360 365 Tyr Asp Arg Pro Ser Phe Tyr Lys Met Ser Ala Glu Gly Tyr Ile Asp     370 375 380 Tyr Pro Thr Tyr Glu Glu Ala Val Ala Lys Gly Tyr Lys Lys 385 390 395 <210> 3 <211> 12 <212> PRT <213> Kluyveromyces lactis <400> 3 Met Ser Ala Glu Gly Tyr Ile Asp Tyr Pro Thr Tyr   1 5 10 <210> 4 <211> 12 <212> PRT <213> Kluyveromyces lactis <400> 4 Arg Leu Ala Tyr Val Asp Leu Val Glu Pro Arg Val   1 5 10 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially       synthesized primer sequence <400> 5 acgacatgtc atttatgaac tttgaac 27 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially       synthesized primer sequence <400> 6 tgttctagat tatttcttgt aacccttggc 30

[Brief description of drawings]

FIG. 1 is a diagram showing a pattern in SDS-PAGE. Lane 1 is a molecular weight marker, lane 2 is Example 1
The enzyme obtained in 1. is shown.

FIG. 2 is a graph showing the pH dependence of the methyl vinyl ketone reduction activity of the enzyme obtained in Example 1.

FIG. 3 is a graph showing the temperature dependence of the methyl vinyl ketone reduction activity of the enzyme obtained in Example 1.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ identification code FI theme code (reference) C12N 9/06 C12R 1: 645 C12P 7/26 C12N 15/00 ZNAA // (C12N 9/06 5/00 (AC12R 1: 645) (72) Inventor Motoko Hayashi 35-1 Honda Ueno, Momoyama-cho, Fushimi-ku, Kyoto, Kyoto 1401 Etoile Sakurai 1401 (72) Inventor Yasushi Kawai 2-9-15 (72) Aoyama, Otsu, Shiga Prefecture ) Inventor Norihiro Toki, Gokasho, Uji City, Kyoto Prefecture, Arichi Kyoto University Employee Dormitory No. 354 F-term (reference) 4B024 AA03 BA08 CA03 DA06 GA11 4B050 CC01 CC03 DD02 LL05 4B064 AG37 CA02 CA19 CA21 CB17 CC24 CD05 DA16 4B065 AA26 AC14 BA02Y AB01 BB07 CA09 CA28 CA44

Claims (16)

[Claims] 1. An enone reductase having the physicochemical properties shown in (A) to (C) below. (A) Action Using reduced β-nicotinamide adenine dinucleotide phosphate as an electron donor, carbon of α, β-unsaturated ketone
The carbon double bond is reduced to produce the corresponding saturated hydrocarbon. (B) Substrate specificity (1) As an electron donor, it has a significantly higher activity for reduced β-nicotinamide adenine dinucleotide phosphate than for reduced β-nicotinamide adenine dinucleotide. (2) The carbon-carbon double bond of the unsaturated ketone is reduced,
There is virtually no reduction activity of the ketone. (3) α, β − of 3-Methyl-4- (3-pyridyl) -3-buten-2-one
Selective reduction of unsaturated bonds, 90% ee or more of (S) -3-met
Generates hyl-4- (3-pyridyl) -3-butan-2-one. (C) Molecular weight sodium dodecyl sulfate-polyacrylamide gel electrophoresis of about 47,000. About 92 by gel filtration,
000. 2. The following physicochemical properties (D)-
The enone reductase according to claim 1, which has (E). (D) Working pH pH 5.0-8.0 (E) Optimum temperature 37-45 ° C 3. Kluyveromyces
The novel enone reductase according to claim 1, which is derived from a genus. 4. A microorganism belonging to the genus Kluyveromyces is Kluyveromyces lact.
is)), The novel enone reductase according to claim 3. 5. The method according to claim 1, which belongs to the genus Kleiberomyces.
The method for obtaining an enone reductase according to claim 1, wherein the microorganism having the ability to produce the enone reductase according to claim 1 is cultured. 6. A microorganism belonging to the genus Kluyveromyces is Kluyveromyces.
lactis), The method according to claim 5. 7. The polynucleotide according to any one of (a) to (e) below. (A) a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO: 1, (b) a polynucleotide encoding the amino acid sequence set forth in SEQ ID NO: 2, (c) an amino acid sequence set forth in SEQ ID NO: 2, 1 Alternatively, a polynucleotide consisting of an amino acid sequence in which a plurality of amino acids are substituted, deleted, inserted, and / or added, and encoding a protein having the following physicochemical properties (A) and (B), (d) SEQ ID NO: 1 A polynucleotide which hybridizes with the polynucleotide consisting of the nucleotide sequence described in 1) under stringent conditions and encodes a protein having the following physicochemical properties (A) and (B), (e) described in SEQ ID NO: 2 The amino acid sequence having 90% or more homology with the amino acid sequence of the above, and the following physicochemical properties (A) and (B)
(A) acting reduced β-nicotinamide adenine dinucleotide phosphate as an electron donor, carbon of α, β-unsaturated ketone-
The carbon double bond is reduced to produce the corresponding saturated hydrocarbon. (B) Substrate specificity (1) As an electron donor, it has a significantly higher activity for reduced β-nicotinamide adenine dinucleotide phosphate than for reduced β-nicotinamide adenine dinucleotide. (2) The carbon-carbon double bond of the unsaturated ketone is reduced,
There is virtually no reduction activity of the ketone. (3) α, β − of 3-Methyl-4- (3-pyridyl) -3-buten-2-one
Selective reduction of unsaturated bonds, 90% ee or more of (S) -3-met
Generates hyl-4- (3-pyridyl) -3-butan-2-one. 8. A protein encoded by the polynucleotide according to claim 7. 9. A recombinant vector having the polynucleotide according to claim 7 inserted therein. 10. The recombinant according to claim 9, further comprising a polynucleotide encoding a dehydrogenase capable of catalyzing a redox reaction using β-nicotinamide adenine dinucleotide phosphate as a coenzyme. vector. 11. The recombinant vector according to claim 10, wherein the dehydrogenase capable of catalyzing the redox reaction is glucose dehydrogenase. 12. The polynucleotide according to claim 7,
Alternatively, a transformant carrying the vector according to claim 9 in an expressible manner. 13. The method for producing the protein according to claim 8, which comprises the step of culturing the transformant according to claim 12. 14. An enzyme selected from the group consisting of the enone reductase according to claim 1, the protein according to claim 8, a microorganism producing the enzyme or the protein, and a treated product of the microorganism. A step of allowing an active substance to act on an α, β unsaturated ketone, and recovering the formed ketone;
A method for producing a saturated ketone by selectively reducing a carbon-carbon double bond of an α, β-unsaturated ketone. 15. An enzyme selected from the group consisting of the enone reductase according to claim 1, the protein according to claim 8, a microorganism producing the enzyme or the protein, and a treated product of the microorganism. The active substance is allowed to act on an α, β unsaturated ketone having a substituent at the α-position and / or the β-position,
Α, β including a step of recovering the optically active ketone produced
A method of selectively reducing the carbon-carbon double bond of an unsaturated ketone to produce an optically active saturated ketone. 16. The method according to claim 15, wherein the microorganism is the transformant according to claim 12.