JP2003009867A - Method for producing ligand for gp8 polypeptide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an excellent method for producing a ligand for GPR8 polypeptide. SOLUTION: This method for producing a ligand (a salt thereof) for GPR8 polypeptide is characterized in comprising subjecting a fused protein or peptide to cleavage reaction of the peptide linkage on the amino group side of the cysteine residue; wherein the fused protein or peptide is such that a ligand for GPR8 polypeptide optionally having (oxidized) methionine residue on the N-terminal is linked to the N-terminal of a protein or peptide having cysteine on the N-terminal. By this method, the objective ligand for GPR8 polypeptide usable as an appetite promoter or the like can be industrially produced in large quantities.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention comprises producing a fusion protein or polypeptide, and then subjecting the fusion protein or polypeptide to a peptide bond cleavage reaction,
The present invention relates to a method for producing a ligand polypeptide for GPR8 or a salt thereof. Further, an methionine residue which may be oxidized at the N-terminal or a diketone body of the methionine residue may be efficiently removed from a ligand polypeptide for GPR8 having an methionine residue which may be oxidized at the N-terminal or a salt thereof. Regarding the method.

[0002]

2. Description of the Related Art When a peptide is produced by a gene recombination technique, it is often expressed in the form of a fusion protein because the peptide is susceptible to degradation in cells. For excision of the target peptide from the fusion protein, a method of chemically cleaving with bromocyan (Itakura et al., Science, 198 , 1056 (1977)) and a method of enzymatically cleaving with Factor Xa (Nagai et al., Metho
ds in Enzymology, 153 , 46 (1987)) is known. Furthermore, as a method of cleaving the peptide bond in the protein,
Cleavage of the acyl cysteine bond by 2-nitro-5-thiocyanobenzoic acid is known ("Biochemistry Laboratory").
1, Protein Chemistry II, edited by The Biochemical Society of Japan, published by Tokyo Kagaku Dojin, pp. 247-250, 1976). However, regarding excision of the target peptide from the protein,
Not disclosed. It is known that when the protein is biosynthesized in the cell, its N-terminus starts with methionine corresponding to the initiation codon AUG of mRNA. However, since this methionine is removed by subsequent processing, it is usually no longer present in the completed mature protein molecule. Due to advances in gene recombination technology, useful proteins can be transferred to microorganisms, animal cells,
For example, it became possible to produce using E. coli,
An example in which the above-mentioned methionine remains in the protein produced by this method has been found. For example, in human growth hormone expressed in Escherichia coli, the methionine addition rate is almost 100% [Nature, 293, 4].
08 (1981)] and 50% of interferon-α [Journal of Interferon
Research (J. Interferon Res.), 1,381 (198)
1)], in non-glycosylated human interleukin-2, in addition to the molecular species (rIL-2) that begins with alanine as in the case of natural human interleukin-2, methionine was further added to the amino terminus (methionine residue at the N terminus remained). The presence of a molecular species (having a group) (Met-rIL-2) has been observed. On the other hand, as a method for chemically removing the N-terminal amino acid, Dixon reacts DL-alanylglycine with glyoxylic acid, pyridine, and copper acetate to cause transamination reaction to produce pyruvoylglycine. [Biochemistry Journal (Biochem. J),
92,661 (1964)], and further reported that when a compound is reacted with thiosemicarbazide, the amide bond is cleaved to produce glycine [Biochem.J (Biochem.J), 90, 2C].
(1964)]. This reaction is then followed by cytochrome c-
551 (Pseudomonas cytochrome c-551) and reported that the N-terminal glutamic acid is removed [Biochem. J.,
94, 463 (1965)].

[0003]

DISCLOSURE OF THE INVENTION In the conventionally known technique, when cleaving a target peptide from a fusion protein, when bromocyan is used, it cannot be applied to the production of a methionine-containing peptide,
There are many problems such as the yield at the time of cutting. Thus, a method for efficiently cleaving a target peptide from a fusion protein or polypeptide is desired. Furthermore, even for the same protein, the molecular structure with methionine added to the N-terminus and that without methionine may differ in protein conformation, biological activity, and stability.
It is also possible that addition to the terminus may lead to increased antigenicity. Therefore, from the viewpoint of industrial use,
It is considered significant to establish an N-terminal methionine removal method corresponding to this initiation codon. To solve this problem, a method for removing methionine by decomposing cyanogen bromide (BrCN) [Science, 19
8, 1056 (1977)], but in this case it is premised that a methionine residue is not present in the desired mature protein, and in some cases, depending on the method of subjecting the protein to a harsh chemical reaction, Satisfactory results cannot be obtained.
As a chemical method capable of selectively and efficiently removing a methionine residue at the N-terminal from a peptide or protein having a methionine residue at the N-terminal, regardless of the type of the peptide or protein, Japanese Patent Laid-Open No. 10-72
Nothing is known other than the method described in No. 489 (EP-A-812856), but this does not cause denaturation of the final product peptide or protein, and the N-terminal of It is believed to be due to the difficulty in finding a chemical reaction that can remove the methionine residue. In particular, when methionine added to the N-terminus is removed from a protein having a relatively large molecular weight and produced by genetic engineering, especially a protein intended to be used as a medicine, the activity of the protein after removal of methionine Since it is required that the reaction does not decrease, it is necessary to proceed the reaction without heating in an aqueous solution of weakly acidic to weakly alkaline, and there are many restrictions on the chemical reaction conditions. It was the current situation that I could not find.

[0004]

[Means for Solving the Problems] The present inventors have conducted extensive studies on a method for efficiently producing a ligand polypeptide or a salt thereof for GPR8, which is a novel physiologically active peptide, and found that a protein having a cysteine at the N-terminus. It was also found that a ligand protein for GPR8 can be efficiently produced by producing a fusion protein or polypeptide in which a ligand polypeptide for GPR8 is linked to the N-terminus of the polypeptide, and then subjecting this to a reaction that cleaves a peptide bond. It was Furthermore, the inventors have found that genetically engineered GPR8
The present invention was conducted in earnest to provide a method for producing a ligand polypeptide for GPR8 having a natural amino acid sequence by cleaving only the N-terminal methionine residue in the ligand polypeptide for A. As described above, for the ligand polypeptide for GPR8 having an optionally oxidized methionine residue represented by the formula (I), for example, glyoxylic acid which is an α-diketone, copper sulfate capable of donating a transition metal ion, A ligand polypeptide for GPR8 having a diketone body of the methionine residue obtained by reacting a base (for example, amines) pyridine or the like with a transamination reaction is a base (for example, diamines) 3, By reacting 4-diaminobenzoic acid to carry out a hydrolysis reaction Unexpectedly diketone of methionine residue from the ligand polypeptide to GPR8 having a diketone derivative of the methionine residue was found to be able to efficiently removed. That is, the present inventors removed an optionally oxidized methionine residue at the N-terminal from a ligand polypeptide for GPR8 having a methionine residue, and oxidized it at the N-terminal without decreasing its activity. GPR8 without methionine residue
The inventors have found a method for obtaining a ligand polypeptide for γ-l in an unexpectedly high yield, and further researched the present invention to complete the present invention. (Scheme 1)

[Chemical 1] [In the formula (I), m represents an integer of 0 to 2 and X represents GP.
3 shows the peptide chain of the ligand polypeptide for R8. In the present specification, in the above scheme 1, (1) the compound represented by the general formula (I) is referred to as “a ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminus or a salt thereof”. Or “a ligand polypeptide for GPR8 having a methionine residue or a salt thereof”; (2) in the general formula (I)

[Chemical 2] [Wherein, m has the same meaning as defined above], and a partial structure represented by the formula: "Methionine residue which may be oxidized", "methionine residue" or "methionine""A ligand polypeptide for GPR8 having a diketone body of a methionine residue which may be oxidized at the N-terminal or a salt thereof"
Or “GPR8 having a diketone of methionine residue
To the ligand polypeptide or a salt thereof; (4) In the general formula (II)

[Chemical 3] [Wherein, m is the same as defined above], and a partial structure represented by the formula: "diketone body of methionine residue which may be oxidized" or "diketone body of methionine residue"; and (5) general formula ( The compound represented by III) is "G which does not have a methionine residue which may be oxidized at the N-terminal.
A ligand polypeptide for PR8 or a salt thereof "or" a ligand polypeptide for GPR8 which does not have a diketone body of an optionally oxidized methionine residue at the N-terminus or a salt thereof "may be referred to respectively.

The present invention is (1) GP which may have an optionally oxidized methionine residue at the N-terminus of the protein or peptide having a cysteine at the N-terminus.
A method for producing a ligand polypeptide for GPR8 or a salt thereof, which comprises subjecting a fusion protein or peptide to which a ligand polypeptide for R8 is linked to a cleavage reaction of a peptide bond on the amino group side of a cysteine residue,
(2) A vector having a gene encoding a fusion protein or peptide in which a ligand polypeptide for GPR8 that may have a methionine residue at the N-terminus is linked to the N-terminus of a protein or peptide having cysteine at the N-terminus The transformant to be retained is cultured to express a fusion protein or peptide, and the expressed fusion protein or peptide is subjected to a cleavage reaction of the peptide bond on the amino group side of the cysteine residue, which leaves a methionine residue. A method for producing a ligand polypeptide or a salt thereof for GPR8 which may have a group, (3) The cleavage reaction is S-
The production method according to (1) or (2) above, which is a reaction involving a cyanation reaction and then a hydrolysis reaction, (4) a polypeptide in which the ligand polypeptide for GPR8 contains the amino acid sequence represented by SEQ ID NO: 1. The above (1)
Or (2) the production method, (5) a fusion protein in which a ligand polypeptide for GPR8 which may have a methionine residue at the N-terminus is linked to the N-terminus of the protein or peptide having cysteine at the N-terminus, or Peptide, (6) vector having a gene encoding the fusion protein or peptide described in (5) above, (7) transformant containing the vector described in (6) above, (8) N
G having an optionally oxidized methionine residue at the end
Ligand polypeptide for PR8 or salt thereof and α
A method for removing the methionine residue, which comprises reacting with a diketone and then hydrolyzing, (9) a genetically engineered ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminus (8) The method according to the above (8), which is a ligand polypeptide for GPR8 produced by the method, (10) the method according to the above (8), wherein the α-diketone is reacted in the presence of a transition metal ion. (11) The method according to (8) above, which comprises reacting an α-diketone in the presence of a base, and (12) α-diketone in the presence of a transition metal ion and a base.
The method according to (8) above, which comprises reacting a diketone, (13) the method according to (8) above, wherein the α-diketone is glyoxylic acid or a salt thereof, and (14) the transition metal ion is a copper ion. The method according to (10) above, which is
(15) The method described in (11) above, wherein the base is pyridine, (16) the method described in (8) above, characterized in that the base is hydrolyzed, and (17) the method described above in which the base is an amine. 16) The method described in (16) above, wherein (18) the base is a diamine or thio or selenosemicarbazide, and (19) the above diamine is o-phenylenediamine or 3,4-diaminobenzoic acid. (18) The method according to (18), (20) a gene polypeptide produced by genetic engineering, wherein a methionine-added ligand polypeptide for GPR8 or a salt thereof and glyoxylic acid or a salt thereof are reacted in the presence of copper sulfate and pyridine. And then reacting with o-phenylenediamine or 3,4-diaminobenzoic acid, a ligand polypeptide for GPR8 characterized by the following: Or preparation of a salt thereof, (2
1) _{CH 3 -S (O) m -} (CH 2) 2 -CO-CO-X wherein, m is an integer of 0 to 2, X is shows the peptide chain of the ligand polypeptide to GPR8. ] The compound or its salt represented by these, (22) The manufacturing method of the ligand polypeptide or its salt with respect to GPR8 characterized by hydrolyzing the compound as described in said (21), and (23) cysteine at the N terminal. N-terminal of the protein or peptide having
A fusion protein or peptide in which a ligand polypeptide for GPR8 having a methionine residue at the terminal is linked is subjected to a cleavage reaction of a peptide bond on the amino group side of a cysteine residue to give an optionally oxidized methionine residue at the N-terminal. To obtain a ligand polypeptide for GPR8 or a salt thereof, which is further reacted with a ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminal and an α-diketone, and then hydrolyzed. And a method for producing a ligand polypeptide for GPR8 or a salt thereof, and the like.

The ligand polypeptide for GPR8 used in the method of the present invention is the 7-transmembrane receptor protein G.
PR8 (O'Dowd, BF et al., Genomics, 28, 84-
91, 1995; ligand activity for protein consisting of amino acid sequence represented by SEQ ID NO: 15, eg GP
R8 binding activity, cell stimulating activity on GPR8 expressing cells (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular c
GMP production, inositol phosphate production, cell membrane potential fluctuation, phosphorylation of intracellular proteins, activation of c-fos, p
H reduction, activity promoting GTPγS binding activity, etc.)
Any polypeptide may be used as long as it has Specific examples of the ligand polypeptide for GPR8 include a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. An amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 is:
For example, the amino acid sequence represented by SEQ ID NO: 3, the amino acid sequence represented by SEQ ID NO: 5, the amino acid sequence represented by SEQ ID NO: 7, the amino acid sequence represented by SEQ ID NO: 9, SEQ ID NO: 11. And the amino acid sequence represented by SEQ ID NO: 13. That is, as a specific example of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: : A polypeptide consisting of the amino acid sequence represented by 3: 3, a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5, a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 7, represented by SEQ ID NO: 9 And a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 11, and a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 13. In the peptide in the present specification, the left end is the N-terminal (amino terminal) and the right end is the C-terminal (carboxyl terminal) according to the convention of peptide notation. SEQ ID NO: C-terminus of the peptide represented by 1, a carboxyl group (-COOH), a carboxylate (-COO ^-), amide (-CONH _2), alkyl amide (-CON
HR) or ester (-COOR). Examples of R of ester or alkylamide include C _1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl, phenyl, α-naphthyl. C _6-12 aryl group such as benzyl, phenethyl, phenyl-C _1-2 alkyl such as benzhydryl,
Or α-naphthyl-C such as α-naphthylmethyl
_In addition to C _7-14 aralkyl groups such as _1-2 alkyl, pivaloyloxymethyl ester, which is widely used as an oral ester, and the like can be mentioned. As the salt of the ligand polypeptide for GPR8 of the present invention, salts with physiologically acceptable bases (for example, alkali metals etc.) and acids (organic acids, inorganic acids) are used, and particularly physiologically acceptable. Acid addition salts are preferred. Examples of such salts include salts with inorganic acids (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid), or organic acids (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, Salts such as tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) are used. The protein or peptide having an N-terminal cysteine used in the method of the present invention is not specified. In the case of a protein or peptide that does not have cysteine at its N-terminal, it may be made to have cysteine at its N-terminal by a method known per se.

The protein or peptide having cysteine at the N-terminal preferably has a molecular weight of 100 to 100,000, and further has a molecular weight of 300 to 50,000.
Are preferred. In addition, the protein or peptide having cysteine at the N-terminus is preferably one having 1 to 1000 amino acids, and more preferably one having 3 to 500 amino acids. Examples of the protein or peptide include interferons, interleukins, various growth factors such as fibroblast growth factor (aFGF, bFGF, etc.), (pro) urokinases, lymphotoxin, Tumor Necrosis Factor (TNF), β- Enzyme proteins such as galatosidase, storage proteins, streptavicin, protein A, protein G, Tiss
Examples include ue Plasminogen Activator (TPA), muteins thereof, or parts (fragments) thereof having cysteine at the N-terminal. Among them, fibroblast growth factor (aFGF, bFGF, etc.) or mutein thereof or a part (fragment) thereof (eg, bFGF CS23).
Mutein and the like) are preferably used. bFGF
Examples of CS23 muteins include Pro-Ala-Leu-Pro-
Glu-Asp-Gly-Gly-Ser-Gly-Ala-Phe-Pro-Pro-Gly-His-Ph
e-Lys-Asp-Pro-Lys-Arg-Leu-Tyr-Cys-Lys-Asn-Gly-Gly-
Phe-Phe-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp-Gl
y-Val-Arg-Glu-Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-
Leu-Gln-Ala-Glu-Glu-Arg-Gly-Val-Val-Ser-Ile-Lys-Gl
y-Val-Ser-Ala-Asn-Arg-Tyr-Leu-Ala-Met-Lys-Glu-Asp-
Gly-Arg-Leu-Leu-Ala-Ser-Lys-Ser-Val-Thr-Asp-Glu-Cy
s-Phe-Phe-Phe-Glu-Arg-Leu-Glu-Ser-Asn-Asn-Tyr-Asn-
Thr-Tyr-Arg-Ser-Arg-Lys-Tyr-Thr-Ser-Trp-Tyr-Val-Al
a-Leu-Lys-Arg-Thr-Gly-Gln-Tyr-Lys-Leu-Gly-Ser-Lys-
Thr-Gly-Pro-Gly-Gln-Lys-Ala-Ile-Leu-Phe-Leu-Pro-Me
Examples thereof include a protein containing the amino acid sequence represented by t-Ser-Ala-Lys-Ser (SEQ ID NO: 16) and having a cysteine residue added to its N-terminus.

The gene encoding the fusion protein (including the fusion peptide) used in the method of the present invention may be (1) chemically synthesized from the entire nucleotide sequence, or (2) from the nucleotide sequence encoding the protein. The gene may be constructed by arranging a nucleotide sequence encoding cysteine on the N-terminal side and further arranging a nucleotide sequence encoding a ligand polypeptide for GPR8 on the N-terminal side. (3) When the purpose is to obtain a fragment of the peptide, the amino acid residue immediately after the desired fragment is site-directed mu
The gene substituted with cysteine may be constructed by a technique such as tagenesis. As the manufacturing method in the case of (1) above,
For example, the phosphoamidide method, the phosphotriester method, the diester method, the hydrogenphosphonate method, etc., which are known per se, are used, and the short ones are synthesized at once, and the long ones are divided and synthesized, and then ligated using T4 DNA ligase. It is possible to

As the production method in the case of the above (2), for example, a gene encoding a protein on the C-terminal side can be obtained by cutting the chromosome with an appropriate restriction enzyme and ligating it with a vector,
Alternatively, obtain cDNA. Then, it is cleaved with a restriction enzyme so that the N-terminus becomes cysteine, or synthetic DNA is ligated to the 5'-end of the whole protein or a part of the gene thereof so that the N-terminus becomes cysteine. A gene encoding the protein of interest (either chemically synthesized or cloned from a living body) is connected to the 5'-end thereof. And so on.
Specific examples of the gene encoding the fusion protein obtained in this way, for example, the formula tggtataaacatgtggcgagcccgcgttatcataccgtgggccgtgcggcgggcctgctgatgggcctg -T GC or TGT-R (I) [wherein, R cccgaggatggcggcagcggcgccttcccgcccggccacttcaaggaccccaagcggctgtactgcaaaaac gggggcttcttcctgcgcatccaccccgacggccgagttgacggggtccgggagaagagcgaccctcacatc aagctacaacttcaagcagaagagagaggagttgtgtctatcaaaggagtgagcgctaatcgttacctggct atgaaggaagatggaagattactagcttctaagtctgttacggatgagtgtttcttttttgaacgattggaa tctaataactacaatacttaccggtcaaggaaatacaccagttggtatgtggcactgaaacgaactgggcag tataaacttggatccaaaacaggacctgggcagaaagctatactttttcttccaatgtctgctaagagctgc (fragments of hbFGF mutein CS23) The base sequence consisting of ] DNA represented by the formula: tggtacaagcacgtggcgagtccccgctaccacacggtgggccgcgccgctggcctgctcatggggctg-TG C or TGT-R (II) [wherein R has the same meaning as above. ] DNA represented by the formula: tggtacaagcacacggcgagtccccgctaccacacggtgggccgcgccgcgggcctgctcatggggctct-TG C or TGT-R (III) [wherein R has the same meaning as above. ] DNA represented by the formula: tggtacaagcacgtggcgagccctcgctatcacacagtgggtcgtgcctccgggctgctcatggggctg-TG C or TGT-R (IV) [wherein R has the same meaning as above. ] DNA represented by the formula: tggtacaagcacgtggcgagtccccgctaccacacggtgggccgcgccgctggcctgctcatggggctgcgt cgctcaccctatctgtgg-TGC or TGT-R (V) [wherein R has the same meaning as above. ] DNA represented by the formula: tggtacaagcacacggcgagtccccgctaccacacggtgggccgcgccgcgggcctgctcatggggctgcgc cgctcgccctacatgtgg-TGC or TGT-R (VI) [wherein R has the same meaning as described above. ] DNA represented by the formula: tggtacaagcacgtggcgagccctcgctatcacacagtgggtcgtgcctccgggctgctcatggggctgcgc cgctcgccctacctgtgg-TGC or TGT-R (VII) [wherein R has the same meaning as above. ] The DNA represented by the formula: tggtataagcacgtggcgagtccccgctatcacacagtgggtcgtgcctccgggctgctcatggggctgcgc cgctcgccctaccagtgg-TGC or TGT-R (VIII) [wherein R has the same meaning as above. ] DN represented by
A, etc. can be mentioned.

In the above formula (I), the base sequence (SEQ ID NO: 22) of the DNA encoding the polypeptide containing the ligand polypeptide (23 amino acids) for human GPR8 is linked to the base sequence encoding cysteine. It shows that the base sequence represented by R (SEQ ID NO: 17) is bound. SEQ ID NO: 22 is a nucleotide sequence obtained by modifying the nucleotide sequence of cDNA encoding a polypeptide containing the ligand polypeptide (23 amino acids) for GPR8 represented by SEQ ID NO: 2 so as to be suitable for expression in Escherichia coli. . Formula (II) above is human GPR8
To the base sequence (SEQ ID NO: 2) of the DNA encoding the polypeptide containing the ligand polypeptide (23 amino acids) is bound to the base sequence represented by R (SEQ ID NO: 17) via the base sequence encoding cysteine. Indicates that The above formula (III) is porcine GP
The nucleotide sequence (SEQ ID NO: 17) of the DNA encoding the polypeptide containing the ligand polypeptide (23 amino acids) for R8 is represented by R via the nucleotide sequence encoding cysteine in the nucleotide sequence (SEQ ID NO: 4). Indicates that they are bound. In the above formula (IV), a nucleotide sequence (SEQ ID NO: 6) of a DNA encoding a polypeptide containing a ligand polypeptide (23 amino acids) for rat and mouse GPR8 has a nucleotide sequence encoding cysteine. Through the base sequence indicated by R
It shows that (SEQ ID NO: 17) is bound. The above formula (V) is represented by R via the base sequence encoding cysteine in the base sequence (SEQ ID NO: 8) of the DNA encoding the polypeptide containing the ligand polypeptide (30 amino acids) for human GPR8. Base sequence
It shows that (SEQ ID NO: 17) is bound. The above formula (VI) is represented by R via the base sequence encoding cysteine in the base sequence (SEQ ID NO: 10) of the DNA encoding the polypeptide containing the ligand polypeptide (30 amino acids) for porcine GPR8. It shows that the nucleotide sequence (SEQ ID NO: 17) is bound. The above formula (VII) is a nucleotide sequence of a DNA encoding a polypeptide containing a ligand polypeptide (30 amino acids) for rat GPR8 (SEQ ID NO: 12).
Shows that the nucleotide sequence represented by R (SEQ ID NO: 17) is bound via the nucleotide sequence encoding cysteine. The above formula (VIII) is represented by R via the nucleotide sequence encoding cysteine in the nucleotide sequence (SEQ ID NO: 14) of the DNA encoding the polypeptide containing the ligand polypeptide (30 amino acids) for mouse GPR8. It shows that the nucleotide sequence (SEQ ID NO: 17) is bound. A DNA (plasmid) having an ATG at the 5'end and a region encoding the fusion protein downstream thereof, and then having a translation stop codon, is a cDNA of a known protein produced by chemical synthesis or genetic engineering. Alternatively, it can be produced by processing the DNA of the protein derived from the chromosome. A gene encoding a fusion protein or peptide in which a ligand polypeptide for GPR8 is linked to the N-terminus of the protein or peptide having cysteine at the N-terminus of the present invention is prepared by conventional DNA techniques,
For example, site-directed mutagenesis techniques can be used to convert to a gene encoding the mutein of interest. Site-directed mutagenesis techniques are well known and are
Racer (Lather, RF) and Jay P. Lecoq (L
ecoq, JP), Genetic Engineering (Gen
etic Engineering), Academic Press (1983)
Year) page 31-50. Oligonucleotide-directed mutagenesis is described by Smith, M. and Gillam, S., Genetic Engineering: Principles and Methods, Plenum Phums (1981).
(Year) Vol. 3, pp. 1-32.

D having a region encoding the fusion protein
As a plasmid used as a vector for producing a plasmid having NA, for example, pBR322 [Gene (Gen) derived from Escherichia coli] is used.
e), 2 , 95 (1977)], pBR313 [Gene,
2 , 75 (1977)], pBR324, pBR325 [Gene, 4 , 124 (1978)], pBR327, pBR3
28 [Gene, 9 , 287 (1980)], pBR329
[Gene, 17 , 79 (1982)], pKY2289
[Gene, 3 , 1 (1978)], pKY 2700 [Biochemistry, 52 , 770 (1980)], pACYC177, pA
CYC184 [Journal of Bacteriology (J
ournal of Bacteriology), 134 , 1141 (197)
8)], pRK248, pRK646, pDF [Methods in Enzymology,
68 , 268 (1979)], pUC18, pUC19 [Yani Shuperon et al., Gene, 33 , 103 (19).
85)] and the like. In addition, bacteriophage, for example, λgt-λC of λgt system using λ phage.
[Proc. Natl. Acad. Sci. USA. 71 4,579
(1974)], λgt · λB [Proc. Natl. Acad. Sci.
USA 72 , 3461 (1975)], λ Dam [Gene, 1 , 255 (1977)] and Sharon Vector [Science, (Science), 196 , 161 (1977); Journal of Beerology (Journal of Virology),
29 , 555 (1979)], filamentous phage was used.
mp18, mp19 [Yani Shuperon et al., Gene (G
ene), 33 , 103 (1985)] vector and the like.

The above DNA preferably has a promoter upstream of ATG, and any promoter may be used as long as it is suitable for the host used for producing the transformant. For example, Escherichia coli (Esche
richia coli), trp promoter, lac promoter,
rec A promoter, λPL promoter, lpp promoter, T7 promoter, etc., such as Bacillus subt
ilis), such as SPO1 promoter, SPO2 promoter, penP promoter, yeast (Saccharomyces cere
visiae) includes PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, and SV40-derived promoter in animal cells. If necessary, an SD (Shine and Dalgarno) sequence may be inserted downstream of the promoter. When using the T7 promoter system, the T7 promoter is
Seventeen promoters found on T7 DNA [JL Oakley et al., Proc. Natl. Acad. Sci, US
A, 74 : 4266-4270 (1977), MD Ros.
a, Cell 16 : 815-825 (1979), N. Panayota.
tos et al., Nature, 280 : 35 (1979), JJ Dunn.
Et al., J. Mol. Biol., 166 : 477-535 (198).
3)], but φ10 promoter [AHR
Osenberg et al., Gene, 56 : 125-135 (198).
7)] is preferred.

As the transcription terminator, a terminator which operates in the system of E. coli, preferably a Tφ terminator [FW Studier et al., J. Mol. Biol., 189 : 1:
13-130 (1986)] is used. As the T7 RNA polymerase gene, the T7 gene [FW Studier
Et al., J. Mol. Biol., 189 : 113-130 (198).
6)] can be mentioned. The vector is preferably constructed by incorporating a T7 promoter and a T7 terminator into the above vector. Examples of such a vector include pET-1, pET-2, pET-3, pET-4, pET
ET-5 [AH Rosenberg, Gene 56 : 125-13
5 (1987)], pTB960-2 [EP-A-499.
990] and the like, but preferably pT
B960-2 is used.

The transformant of the present invention can be obtained by using the expression plasmid obtained by the above method by a method known per se [eg, Cohen S,
N, et al., Proc. Natl. Acad. Sci. U.S.
A.), 69 , 2110 (1972)]. Examples of the host of transformed microorganisms include Escherichia.
ia), Bacillus, yeast, animal cells and the like. Examples of the above Escherichia bacterium include:
Escherichia coli (E. coli), specifically Escherichia coli K12DH1.
[Procedure of National Academy of Sciences (Proc. Natl. Acad. Sci. US
A.), 60 , 160 (1968)], JM-103 [Nucleic Acids Resea, (Nucleic Acids Resea
rch), 9 , 309 (1981)], JA221 [Journal of Molecular Biology (Journal of Mol
ecular Biology), 120 , 517 (1978)], HB
101 [Journal of Molecular Biology, 41 , 459 (1969)], C600 [Genetics, 39 , 440 (1954)], N4
830 [Cell, 25 , 713 (1981)], K-
12MM294 [Proceedings of National Academy of Sciences, 73 , 4174]
(1976)] BL-21 and the like.

Examples of the bacterium of the genus Bacillus include Bacillus subtilis. Specifically, Bacillus subtilis MI114 (Gene, 24 , 2)
55 (1983)), 207-21 [Journal of
Biochemistry (Journal of Biochemistry), 9
5 , 87 (1984)] and the like. Examples of the above-mentioned yeast include Saccharomyces cerevisiae (Sacchar
omyces cerevisiae), and specifically, Saccharomyces cerevisiae AH22 [Proc. Natl. Acad.
Sci. USA, 75 , 1929 (1978)], XSB5
2-23C [Proc. Natl. Acad. Sci. USA, 77 .
2173 (1980)], BH-641A (ATCC 2
8339), 20B-12 [Genetics, 85 , 23 (19
76)], GM3C-2 [Proc. Natl. Acad. Sci. US
A, 78 2258 (1981)] and the like.

Examples of animal cells include monkey cells COS
-7 [Cell, 23 , 175 (1981)], Vero
[(Japanese clinical 21 , 1209 (1963)), Chinese hamster cell CHO [Journal of Experimental Medicin (J. Exp. Med.), 108 , 94.
5 (1985)], mouse L cell [Journal of National Cancer Institute (J. Nat. C
ancer Inst.), 4 , 165 (1943)], human FL cells [Proc.Soc. Exp. Biol. Med.] , 94 , 532 (1
957)], hamster C cells and the like.

When using the T7 promoter system,
As a host for the transformant, T7 RNA polymerase gene (T7 gene 1) [FW Studier et al., J. Mol.
iol. 189 : 113-130 (1986)], for example, E. coli strains such as MM294, DH-1, C600,
Any of JM109, BL21, or an Escherichia coli strain in which the T7 RNA polymerase gene (T7 gene 1) is incorporated with another plasmid may be used. Preferably T7
MM29 in which λ phage incorporating gene 1 was lysogenized
4 strains and BL21 strains are used. In this case, as the promoter of T7 gene 1, a lac promoter whose expression is induced by isopropyl-1-thio-β-D-galactopyranoside (may be abbreviated as IPTG) is used.

For transformation using a Bacillus bacterium as a host, for example, Molecular and General Genetics, 168 ,
It can be carried out according to a known method such as 111 (1979). For transformation using yeast as a host, for example, Pro
c. Natl. Acad. Sci. USA, 75 , 1929 (1978) and the like. For transformation using an animal cell as a host, for example, Virology,
52 , 456 (1973) and the like. The fusion protein is obtained by culturing the above transformant in a medium,
It can be produced by collecting the produced fusion protein. The pH of the medium is preferably about 6-8.

As a medium for culturing Escherichia bacteria, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journal of Experi
ments in Molecular Genetics), 431-433, Cold Spring
Harbor Laboratory, New York 1972)] is preferred. If necessary, a drug such as 3β-indolyl acrylic acid or isopropyl β-D-thiogalactopyranoside (IPTG) can be added to the promoter so that the promoter works efficiently.

When the host is a bacterium belonging to the genus Escherichia, the culture is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary,
Aeration and agitation can also be added. When the host is a bacterium of the genus Bacillus, the culture is usually performed at about 30 to 40 ° C. for about 6 to 24 hours, and aeration and stirring can be added if necessary. When culturing a transformant whose host is yeast, the medium is
For example, Burkholder minimal medium [Bostia
n, KL et al., The Procedures of National
Academy of Science (Proc. Natl. Acad. Sc
i.) USA, 77 , 4505 (1980)]. The pH of the medium is preferably adjusted to about 5-8. Culture is usually about 20 ℃
Perform at ~ 35 ° C for about 24-72 hours, adding aeration and agitation as needed.

When culturing a transformant whose host is an animal cell, the medium is, for example, MEM medium containing about 0.2 to 20%, preferably about 5 to 20% fetal bovine serum [Science, 122 , 501 (1952)], DME medium [Virology, 8 , 396 (1959)], RPMI 16
40 medium [The Journal of the American Medical Association (The Journal of the American
Medical Association), 199 , 519 (1967)], 199 medium [Proceeding of the Society for the Biological Medicine (Proceeding of t
he Society for the Biological Medicine), 73 , 1 (19
50)] and the like. The pH is preferably about 6-8. Culturing is usually about 30 to 40 ° C., and culturing time is about 15 to
Perform for 60 hours, add aeration and agitation as needed.

The fusion protein is prepared by culturing the above transformant,
The fusion protein can be produced by allowing the fusion protein to be produced and accumulated in the culture, and collecting the fusion protein. Examples of the medium include M9 medium containing glucose and casamino acid [Miller, J., Experiments in Molecular Genetics],
431-433 (Cold Spring Horbor Laboratort, New
York 1972)], 2 × YT medium [Messing, Methods in Enzymology,
101 , 20 (1983)] LB medium and the like.

Culturing is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. λc
When using a recombinant having an Its repressor and an expression vector containing a λPL-promoter,
The culturing is carried out at a temperature of about 15 to 36 ° C, preferably about 30 to 36 ° C, and the inactivation of the λc Its repressor is about 37 ° C to
It is preferably carried out at 42 ° C. In addition, in order to make the recA promoter work more efficiently, that is, to reduce the recA gene expression suppression function, agents such as mitomycin C and naldixin acid may be added, if necessary.
It may be irradiated with ultraviolet rays or the pH of the culture solution may be changed to the alkaline side. When using the T7 promoter system, (1) IPTG or the like is added when expressing the T7 gene (RNA polymerase gene) linked downstream of the lac promoter, or (2) downstream of the λPL promoter. T7 gene (RNA
T7 phage RNA produced by raising the temperature of the culture when expressing the polymerase gene)
The T7 promoter is specifically activated by polymerase 1.

After culturing, the cells are collected by a known method and suspended in, for example, a buffer solution, and then treated, for example, with a protein denaturant, ultrasonic treatment, enzyme treatment such as lysozyme, glass bead treatment, French press treatment, freezing. The cells are lysed by thawing or the like, and the supernatant is obtained by a known method such as centrifugation. To isolate the fusion protein from the supernatant obtained as described above, a generally known protein purification method may be used. For example, gel filtration, ion exchange chromatography, adsorption chromatography, high performance liquid chromatography, affinity chromatography, hydrophobic chromatography, electrophoresis and the like can be appropriately combined. A methionine derived from the translation initiation codon may be added to the N terminus of the fusion protein obtained here. Further, the fusion protein may proceed to the next reaction step without purification or in the state of partial purification. Next, the fusion protein or peptide thus obtained is subjected to a cleavage reaction of the peptide bond on the amino group side of the cysteine residue. Examples of the cleavage reaction include S-cyanation reaction and hydrolysis reaction. When the amide of the ligand polypeptide for GPR8 or a salt thereof is obtained as the final product, the cleavage reaction is, for example,
S-Cyanation reaction and then ammonolysis can be mentioned. The S-cyanation reaction is carried out by adding S-
It is carried out by acting a cyanating reagent.

Examples of the S-cyanating reagent include 2-nitro-5-thiocyanobenzoic acid (NTCB), 1-cyano-
4-Dimethylaminopyridinium salt (DMAP-CN), C
N ^- ion etc. are mentioned. The amount of the S-cyanation reagent may be about 2 to 50 times the amount of all thiol groups.
More preferably, the amount may be about 5 to 10 times. The reaction temperature may be any temperature between about 0 ° C and 80 ° C, and more preferably between about 0 ° C and 50 ° C. As the solvent to be used, any buffer solution may be used as long as it does not react with the S-cyanation reagent. For example, Tris-hydrochloric acid buffer solution,
Examples include Tris-acetate buffer, phosphate buffer, borate buffer, and the like. The organic solvent may be present as long as it does not react with the S-cyanating reagent. The reaction is preferably carried out between pH 1 and 12. Especially NT
When CB is used, pH 7 to 10, and when DMAP-CN is used, pH 2 is used to prevent S-S exchange reaction.
It is preferably between 7 and 7. A denaturing agent such as guanidine hydrochloride may be present in the reaction solution.

As the above-mentioned hydrolysis reaction, for example, an alkali treatment may be mentioned. As the alkali treatment, the pH of the aqueous solution containing the raw material compound is adjusted to 7 to 14,
It is done by adjusting. The adjustment of the pH includes, for example, a solution of sodium hydroxide, ammonia, an amino compound, tritumabase (tris [hydroxymethyl] -aminomethane), dibasic sodium phosphate, potassium hydroxide, barium hydroxide as a raw material compound. It is carried out by adding an appropriate amount to the aqueous solution, but sodium hydroxide or the like is particularly preferable.
The concentration of the solution in the above reaction is, for example, about 0.01 to 2N in the case of sodium hydroxide, preferably about 0.05.
~ 1 N, about 0,0 for ammonia or amino compounds.
01 to 15 N, preferably about 0.1 to 3 N, and in the case of Trituma base, about 1 mM to 1 M, preferably about 20 mM to 200.
In the case of mM, disodium phosphate, about 1 mM to 1 M, preferably about 10 mM to 100 mM, and in the case of potassium hydroxide, about 0.01 to 4N, preferably about 0.1 to 2N. The reaction temperature may be any temperature between about -20 ° C and 80 ° C, more preferably between about -10 ° C and 50 ° C.

The reaction time is preferably S-cyanation reaction.
The reaction time is about 1 to 60 minutes, preferably about 15 to 30 minutes.
The reaction is about 5 minutes to 100 hours, preferably 10 minutes to 15 hours
In between, ammonolysis is about 5 minutes to 24 hours, preferably about
It takes 10 to 180 minutes. The above S-cyanation
When the reaction shown in [Fig. 1] occurs due to hydrolysis,
Conceivable. In FIG. 1, X is R¹-(NR²) −
(In the formula, R¹And R²Are the same or different, (i) water
Elementary, (ii) C_1-20Alkyl, C_3-8Cycloalkyl, C_6-
14Aryl or C_6-14Aryl-C_1-3Archi
(These have no substituents or 1-3
May have amino groups, hydroxyl groups, etc. on the carbon atom
I), (iii) optionally substituted amino, and (iv) hydroxyl group.
Or C_1-6Indicates an alkoxy group. ) Or OH.
C above_1-20Examples of alkyl include, for example, methyl, ether
Chill, propyl, isopropyl, butyl, sec-butyl,
Pentyl, isopentyl, neopentyl, 1-ethylpe
Methyl, hexyl, isohexyl, heptyl, octyl
Le, nonanil, decanyl, undecanyl, dodecanyl,
Tetradecanyl, pentadecanyl, hexadecanyl, he
Putadecanyl, Octadecanyl, Nonadecanyl and Eth
Examples include Icosanil. C above_3-8Cycloalk
Examples of groups include, for example, cyclopropyl, cyclobutyl
Le, cyclopentyl, cyclohexyl, cyclohepti
And cyclooctyl. C above_6-14Ants
Examples of phenyl include phenyl, naphthyl, anthryl,
Examples include phenanthryl and acenaphthylenyl.
C above_6-14Aryl-C_1-3Examples of alkyl include
For example, benzyl, phenethyl, 3-phenylpropyl,
(1-naphthyl) methyl, (2-naphthyl) methyl, etc.
You can C above_1-6Examples of alkoxy include, for example:
Methoxy, ethoxy, propoxy, butoxy, pentyl
Examples include oxy and hexyloxy.

Examples of the optionally substituted amino substituent in (iii) above include amino acids and peptides consisting of 2 to 10 amino acids. The amino acid may be L-form or D-form, and examples thereof include Ala, Arg, Asp, Asn, Glu, Gln, Gly, H.
is, Ile, Met, Leu, Lys, Phe, Pro, Ser, Thr, Trp, Ty
r, Val, etc. Examples of the above peptide include, for example, HD-Leu-Leu-Arg-Pro-NH-C ₂ H ₅ , H-Val-Ala.
-Leu-D-Ala-Ala-Pro-Leu-Ala-Pro-Arg-OH and the like. When ammonia or an amino compound is used in the reaction, the corresponding amide compound is obtained.

To isolate the excised target peptide, a generally known peptide purification method may be used.
For example, gel filtration method, ion exchange chromatography,
High performance liquid chromatography, affinity chromatography, hydrophobic chromatography, thin layer chromatography, electrophoresis and the like can be appropriately combined and performed. A methionine derived from the translation initiation codon may be added to the N-terminus of the target peptide obtained here, and, for example, α-diketones such as glyoxylic acid are prepared according to the method described in detail below. After reaction (preferably, reaction with a transition metal ion such as copper sulfate in the presence of a base such as pyridine), hydrolysis with a diamine such as o-phenylenediamine removes the N-terminal methionine. It is also possible.

[Method for Removing N-Terminal Methionine of Ligand Polypeptide for GPR8] In the present specification,
The optionally oxidized methionine residue represents a methionine residue or an S-oxidized form thereof, and the S-oxidized form of the methionine residue includes a sulfoxide and a sulfone. A ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminus is represented by the formula CH ₃ -S (O) _m- (CH ₂ ) _2- CH (NH ₂ ) -CO-X [wherein , M represents an integer of 0 to 2, and X represents a peptide chain of the ligand polypeptide for GPR8. ] Peptides represented by the following formula are included, and these may form salts, and examples of the salts include those similar to the salts of the ligand polypeptide for GPR8 described above. GPR8 having an optionally oxidized methionine residue at the N-terminus
It is preferable that the ligand polypeptide or salt thereof for GPR8 having a methionine residue that has been optionally genetically engineered at the N-terminus is a ligand polypeptide or salt thereof.

In the above formula, m is preferably 0. Examples of the peptide chain of the ligand polypeptide for GPR8 represented by X include the above-mentioned ligand polypeptide for GPR8. The ligand polypeptide for GPR8 or a salt thereof described above may be refolded (activated, regenerated) before or after the step of removing an N-terminal oxidizable methionine (Met) residue or a diketone body of the methionine residue. Can be performed.

In the present specification, GPR8 having a diketone body of an optionally oxidized methionine residue at the N-terminal
The ligand polypeptide or salt thereof is a compound of the formula CH ₃ -S (O) _m- (CH ₂ ) ₂ -CO-CO-X [wherein m represents an integer of 0 to 2 and X is a ligand for GPR8. 1 shows the peptide chain of a polypeptide. ] The compound or its salt represented by this is shown. GPR having a diketone of an optionally oxidized methionine residue at the N-terminal
The ligand polypeptide for 8 or a salt thereof can be obtained by various reactions such as chemical reaction or enzymatic reaction. For example, a methionine residue which may be oxidized at the N-terminal by a transamination reaction in which a ligand polypeptide for GPR8 having a methionine residue which may be oxidized at the N-terminal is reacted with α-diketones. It is possible to obtain a ligand polypeptide for GPR8 having the diketone of ## STR00003 ## or a salt thereof. In the present specification, the α-diketone may be any one as long as it can promote the transamination reaction of the ligand polypeptide or a salt thereof with respect to GPR8 described above, for example, the formula R ¹ —CO—CO—R ² [ In the formula, R ¹ represents hydrogen or a lower alkyl or phenyl group which may be substituted with a carboxyl group (preferably hydrogen or methyl, more preferably hydrogen), and R ² is substituted with a hydroxyl group, a lower alkoxy group or a lower alkyl. It represents an optionally substituted amino group (preferably a hydroxyl group). ] The compound represented by these, its salt, etc. are mentioned. In the above formula, the lower alkyl group represented by R ¹ is methyl, ethyl, propyl,
i-propyl, butyl, i-butyl, sec-butyl,
Examples thereof include an alkyl group having 1 to 6 carbon atoms such as t-butyl, and the lower alkoxy group represented by R ² includes methoxy, ethoxy, propoxy, i-propoxy, butoxy, i-butoxy, sec-butoxy, t-
Examples thereof include an alkoxy group having about 1 to 6 carbon atoms such as butoxy. Further, the amino group which may be substituted with lower alkyl represented by R ² includes R ¹ described above.
And an amino group which may have 1 or 2 lower alkyl groups represented by Furthermore, as salt,
Examples thereof include the salts of the ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminus. Specific examples of α-diketones include glyoxylic acid, pyruvic acid, oxalacetic acid, phenylglyoxylic acid, and 2-oxoglutaric acid. Among them, glyoxylic acid is preferably used. The α-diketone may form a salt, and examples thereof include alkali metal salts such as sodium salt and potassium salt, and salts of inorganic acids such as hydrochloride.

Methionine optionally oxidized at the N-terminus
A ligand polypeptide for GPR8 having a residue
Or the transamination reaction of its salt with α-diketones,
Usually, the ligand polypeptide for GPR8 or its
1 to 10,000 mol (preferably 2 mol) per mol of the salt of
000 to 4000 mol) of α-diketones,
At about 0 to 70 ° C (preferably about 20 to 40 ° C)
About 10 minutes to 5 hours (preferably about 20 minutes to 2 hours)
It is preferable that the reaction is performed for (during). The transamination reaction described above
Any buffer solution (eg phosphate
Buffer, acetate buffer, citrate buffer, etc.)
Of these, acetate buffer is preferably used.
The pH of the reaction is about 2 to 9, especially about 4.
Proceed with reaction by adjusting to 7, especially 5 to 6
It is good to let In order to promote the transamination reaction,
Reacting α-diketones in the presence of transition metal ions
It is preferable that 1 mole of α-diketone is usually used
And 0.001 to 0.1 mol (preferably 0.01 mol).
It is recommended to use about 0.05 mol) of transition metal ions.
preferable. Examples of transition metal ions include copper ions
(Cu ⁺， Cu²⁺), Cobalt ion (Co²⁺， Co³⁺), Ni
Kellion (Ni²⁺， Ni³⁺), Iron ion (Fe²⁺， Fe³⁺),
Zinc ion (Zn²⁺), Aluminum ion (Al³⁺), Ma
Nganion (Mn²⁺Etc.), gallium ion (Ga³⁺),
Indium ion (In ³⁺), Magnesium ion (M
g²⁺), Calcium ion (Ca²⁺) Etc.
You can, but above all, copper ion, cobalt ion, etc.
Among other things, copper ions (Cu²⁺) Is preferably used. This
These transition metal ions are usually sulfuric acid, nitric acid, hydrochloric acid, and peroxides.
Salts with inorganic acids such as chloric acid or acetic acid, oxalic acid, queer
Addition to reaction solvent as a salt with organic acids such as acid and carbonic acid
Can be, among others, copper sulfate, copper acetate,
However, copper sulfate is preferably used.

The α-diketones are preferably reacted in the presence of a base, and usually about 0.1 to 20 mol (preferably 0.5 to 10 mol) per 1 mol of the α-diketones. It is preferable to use a base of Examples of the base include alkylamines such as triethylamine and tributylamine, N, N-dimethylaniline,
Aromatic amines such as pyridine, lutidine, collidine, 4- (dimethylamino) pyridine, and imidazole can be used, and among them, pyridine is preferably used. In addition, GPR having a methionine residue which may be oxidized at the N-terminal during transamination reaction
For the purpose of preventing the precipitation of the ligand polypeptide for GPR8 or a salt thereof, and the ligand polypeptide for GPR8 having a diketone of a methionine residue obtained by transamination reaction of the ligand polypeptide for GPR8 or a salt thereof, or the like Preferably, urea is added to the buffer solution for the transamination reaction. For example, urea in the buffer is preferably about 1 to 8
It is preferable to add M so as to have a concentration of M, more preferably about 3 to 6M.

Further, in the above-mentioned transamination reaction, it is preferable to react α-diketones in the presence of a transition metal ion and a base, and practically, the transition metal ion, the base and the α-diketone 3 are used. A mixed solution containing components (eg, copper sulfate, pyridine, and glyoxylic acid) is added to an aqueous solution containing a ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminus or a salt thereof. , Advance the transamination reaction. Formula CH ₃ -S (O) _m- (CH ₂ ) ₂ -CO-CO-X obtained by the transamination reaction [wherein, m represents an integer of 0 to 2 and X represents a ligand poly with respect to GPR8. The peptide chain of a peptide is shown. ] Or a salt thereof (a ligand polypeptide for GPR8 having a diketone body of a methionine residue or a salt thereof) is a known peptide or protein purification means,
For example, it can be isolated and purified from the reaction solution by extraction, salting out, partitioning, recrystallization, chromatography, etc., but can also be directly subjected to the next hydrolysis reaction.
The ligand polypeptide for GPR8 having a methionine diketone body obtained by a transamination reaction or a salt thereof is usually subjected to a hydrolysis reaction with a base to give an N-terminal methionine residue which may be oxidized or It can be converted into a ligand polypeptide for GPR8 or a salt thereof which does not have a diketone form of a methionine residue.

Examples of the base used for the hydrolysis reaction include alkylamines such as cysteamine, triethylamine and tributylamine or salts thereof, N, N-dimethylaniline, pyridine, lutidine, collidine and 4-.
(Dimethylamino) pyridine, aromatic amines such as imidazole or salts thereof, o-phenylenediamine, tolylene-3,4-diamine, 3,4-diaminobenzoic acid and N-alkyl-substituted compounds thereof (for example, N-methyl). −
1,2-phenylenediamine, N-ethyl-1,2-phenylenediamine, N-isopropyl-1,2-phenylenediamine, etc.), 2,3-diaminophenol, 4
Diamines such as -chloro-o-phenylenediamine (preferably aromatic diamines, especially 3,4-diaminobenzoic acid and its N-alkyl-substituted compounds (e.g., N-methyl-1,2-phenylenediamine, N-ethyl-1,2-phenylenediamine, N-isopropyl-1,2-phenylenediamine, etc.) or salts thereof, thiosemicarbazides, acetone thiosemicarbazide, thiosemicarbazides such as phenylthiosemicarbazide, selenosemicarbazide, acetoneseleno Although amines such as selenosemicarbazides such as semicarbazide or salts thereof can be used, among them,
Amines, especially diamines or thiosemicarbazides or salts thereof, are preferably used, and particularly,
3,4-diaminobenzoic acid or its salt is preferably used. As the salt of the base used in the hydrolysis reaction,
For example, the same salts as the above-mentioned salts of the ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminal may be mentioned.

The amount of the base is usually about 1 to 10,000 mol, preferably about 200 to 3000 mol, and more preferably about 1 mol with respect to 1 mol of the ligand polypeptide or a salt thereof for GPR8 having a diketone body of a methionine residue. It is 500 to 3000 mol. The hydrolysis reaction is usually performed at about 0 to 70 ° C (preferably about 20 to 40 ° C).
It is preferable to proceed at about 1 hour to 7 days (preferably about 10 hours to 5 days) at (° C.). In the reaction, it is preferable to use a buffer solution as a solvent, and examples of the buffer solution include a phosphate buffer solution, an acetic acid buffer solution, a citrate buffer solution, a formic acid buffer solution and the like. Any buffer may be used as long as it does not inhibit the above-mentioned hydrolysis reaction, and among them, acetic acid-sodium formate, formic acid-sodium formate or formic acid-sodium acetate buffer is preferably used. To be The pH of the reaction is preferably adjusted to about 2 to 9, especially about 3 to 7, and more preferably about 4 to 6 to allow the reaction to proceed. These buffers are preferably used in an amount of about 0.1-8 mol / L, more preferably about 0.5-6 mol / L. In addition, during hydrolysis, a ligand polypeptide for GPR8 having a diketone of an optionally oxidized methionine residue at the N-terminal or a salt thereof and GPR8 having no methionine residue produced by the hydrolysis reaction It is preferable to add urea to the buffer solution for the hydrolysis reaction for the purpose of preventing the precipitation of the ligand polypeptide or its salt against the above. For example, it is preferable to add urea to the buffer solution to a concentration of preferably about 1 to 6M, more preferably about 2 to 5M. The ligand polypeptide for GPR8 thus obtained or a salt thereof can be prepared by known purification means such as extraction, salting out, partitioning,
It can be isolated and purified from the reaction solution by recrystallization, chromatography, etc., but as a preferable example, for example, SP-Sepharose (Pharmacia Biotech) is used.
Or a purification method such as ion exchange chromatography through DEAE-5PW (Tosoh Corporation).

The obtained ligand polypeptide for GPR8 can be powdered by freeze-drying, if necessary. Upon lyophilization, stabilizers such as sorbitol, mannitol, dextrose, maltose, trehalose and glycerol can be added.

The ligand polypeptide for GPR8 or a salt thereof produced by the method of the present invention can be mixed with sterilized water, human serum albumin (HSA), physiological saline, and other known physiologically acceptable carriers. It can be administered to a mammal (eg, human) parenterally or locally. For example, its daily dose is
About 0.01 mg-50 mg, preferably about 0.1 mg-10 mg
Can be parenterally administered by intravenous injection or intramuscular injection. The preparation containing the ligand polypeptide for GPR8 or a salt thereof produced by the method of the present invention is
It may also contain other physiologically acceptable active ingredients such as salts, diluents, adjuvants, other carriers, buffers, binders, surfactants and preservatives. For parenteral administration, a sterile aqueous solution or a suspension ampoule with a physiologically acceptable solvent, or a sterile powder that can be diluted with a physiologically acceptable diluent before use (usually a peptide solution is frozen) It is provided as an ampoule (obtained by drying).

GPR8 obtained by the production method of the present invention
The ligand polypeptide for is, for example, anorexia nervosa, hypertension, autoimmune disease, heart failure, cataract, glaucoma, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis, acute viral encephalitis, adult respiratory distress syndrome, alcoholic hepatitis, Alzheimer's disease. Disease, asthma, arteriosclerosis, atopic dermatitis, bacterial pneumonia, bladder cancer, bone fracture, breast cancer, bulimia nervosa, bulimia nervosa, burn healing, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic Pancreatitis, cirrhosis, colon cancer (colon /
Rectal cancer), Crohn's disease, dementia, diabetic complications, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, gastritis,
Helicobacter pylori infection, liver failure, hepatitis A, B
Hepatitis C, hepatitis C, hepatitis, herpes simplex virus infection, varicella zoster virus infection, Hodgkin's disease, AIDS infection, human papillomavirus infection, hypercalcemia, hypercholesterolemia, hyperglyceremia, high Lipemia, infectious disease, influenza infection, insulin-dependent diabetes mellitus (type I), invasive staphylococcal infection, malignant melanoma, cancer metastasis, multiple myeloma, allergic rhinitis,
Nephritis, non-Hodgkin's lymphoma, non-insulin-dependent diabetes mellitus (type II), non-small cell lung cancer, organ transplantation, osteoarthritis,
Osteomalacia, osteopenia, osteoporosis, ovarian cancer, bone Pettet's disease, peptic ulcer, peripheral vascular disease, prostate cancer, reflux esophagitis, renal failure, rheumatoid arthritis, schizophrenia, sepsis, septic shock, Severe systemic fungal infection, small cell lung cancer, spinal cord injury, gastric cancer, systemic lupus erythematosus, transient ischemic attack, tuberculosis, valvular heart disease, vascular / multiple infarction dementia, wound healing, insomnia, arthritis, inferior It can be used as a therapeutic / preventive agent for pituitary hormone deficiency, excretion, uremia, or neurodegenerative disease (particularly anorexia nervosa, etc.), especially as an appetite (feeding) enhancer, etc.).

In the present specification and drawings, amino acids,
When an abbreviation is used for peptides, protecting groups, active groups, etc., these are IUPAC-IUB (Commission on B
The abbreviations based on iochemical Nomenclature) or the abbreviations commonly used in the field are given below. In addition, when an amino acid or the like may have an optical isomer, the L form is shown unless otherwise specified. DNA: deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid EDTA: ethylenediaminetetraacetic acid Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thr: threonine Met: methionine Glu : Glutamic acid Asp: Aspartic acid Lys: Lysine Arg: Arginine His: Histidine Phe: Phenylalanine Tyr: Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine Cys: Cysteine ATP: Adenosine triphosphate

The sequence numbers in the sequence listing in this specification show the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of the ligand polypeptide for GPR8 (human type 1-23). [SEQ ID NO: 2] This shows the base sequence of DNA encoding the ligand polypeptide for GPR8 (human type 1-23). [SEQ ID NO: 3] This shows the amino acid sequence of the ligand polypeptide for GPR8 (porcine type 1-23). [SEQ ID NO: 4] This shows the base sequence of cDNA encoding the ligand polypeptide (porcine type 1-23) for GPR8. [SEQ ID NO: 5] This shows the amino acid sequence of the ligand polypeptide for GPR8 (rat mouse / mouse type 1-23). [SEQ ID NO: 6] DNA encoding a ligand polypeptide for GPR8 (rat / mouse type 1-23)
The base sequence of is shown. [SEQ ID NO: 7] This shows the amino acid sequence of the ligand polypeptide for GPR8 (human type 1-30). [SEQ ID NO: 8] This shows the base sequence of DNA encoding the ligand polypeptide for GPR8 (human type 1-30). [SEQ ID NO: 9] This shows the amino acid sequence of the ligand polypeptide (porcine type 1-30) for GPR8. [SEQ ID NO: 10] This shows the base sequence of DNA encoding the ligand polypeptide (porcine type 1-30) for GPR8. [SEQ ID NO: 11] This shows the amino acid sequence of the ligand polypeptide for GPR8 (rat type 1-30). [SEQ ID NO: 12] This shows the base sequence of DNA encoding the ligand polypeptide for GPR8 (rat type 1-30). [SEQ ID NO: 13] This shows the amino acid sequence of the ligand polypeptide for GPR8 (mouse type • 1-30). [SEQ ID NO: 14] This shows the base sequence of DNA encoding the ligand polypeptide (mouse type 1-30) for GPR8. [SEQ ID NO: 15] This shows the amino acid sequence of GPR8. [SEQ ID NO: 16] This shows the amino acid sequence of bFGF CS23 mutein. [SEQ ID NO: 17] This shows the base sequence of the gene encoding the fragment of hbFGF mutein CS23. [SEQ ID NO: 18] This shows the base sequence of oligomer # 1 used in Example 1 later described. [SEQ ID NO: 19] This shows the base sequence of oligomer # 2 used in Example 1 later described. [SEQ ID NO: 20] This shows the base sequence of oligomer # 3 used in Example 1 later described. [SEQ ID NO: 21] This shows the base sequence of oligomer # 4 used in Example 1 later described. [SEQ ID NO: 22] This shows the base sequence of DNA encoding the ligand polypeptide for GPR8 (human type 1-23). The transformant obtained in Example 2 described below, Escherichia co
li MM294 (DE3) / pTFChGPR8L will be deposited at the Fermentation Research Institute (IFO), 2-17-85, Jusohonmachi, Yodogawa-ku, Osaka-shi, Osaka (postal code 532-8686) from March 15, 2001 16588, Chuo No. 6 (Postal code 305-856), 1-1-1 Higashi, Tsukuba-shi, Ibaraki
6) Independent Administrative Institution, National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, deposit number FERM from May 10, 2001
Deposited as BP-7585.

[0043]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention is described in more detail below with reference to Examples, but the present invention is not limited thereto.

[0044]

EXAMPLES Example 1 Preparation of Ligand Polypeptide (hGPRL) Structural Gene for GPR8 Using 4 kinds of DNA fragments shown in # 1 to # 4 below, G
A structural gene for PR8L was prepared. a) Phosphorylation of DNA oligomer # 1: 5,-tatgtggtataaacatgtggcgagcccgcgttatc at -3 '(SEQ ID NO: 18) # 2: 5,-accgtgggccgtgcggcgggcctgctgatgggcctgtgcc -3' (SEQ ID NO: 19) # 3: 5, cgccatgat '(SEQ ID NO: 20) # 4: 5,-tcggggcacaggcccatcagcaggcccgccgcacggcc -3' (SEQ ID NO: 21) 100 μL of phosphorylation reaction solution [50 mM Tris-HCl (pH7) .6), 10 mM MgCl ₂ , 1
mM spermidine, 10 mM dithiothreitol, 0.1 mg / mL
The reaction was carried out in bovine serum albumin, 1 mM ATP, 10 units T4 polynucleotide kinase (Nippon Gene)] at 37 ° C. for 1 hour to phosphorylate the 5 ′ end. After carrying out the phenol treatment, the aqueous layer was recovered and twice the amount of ethanol was added,
After cooling to 70 ° C, the DNA was precipitated by centrifugation. b) Ligation of DNA fragment # 1 and # with the phosphorylated DNA fragment obtained in a) above.
4 1 μg of each was combined to make 120 μL. Add this mixture at 80 ° C for 10
After keeping it for a minute, it was gradually cooled to room temperature and annealed.
Ligation reaction was performed using TaKaRa DNA Ligation Kit ver.2 (Takara Shuzo). II to 30 μL of annealing solution
Add 30 μL of solution and mix well, then add 60 μL of solution I.
Ligation was performed by reacting at 1 ° C for 1 hour. After the phenol treatment, the aqueous layer was recovered, twice the amount of ethanol was added, the mixture was cooled to -70 ° C, and the DNA was precipitated by centrifugation.
c) Phosphorylated precipitate at the 5'end is TE buffer (10 mM Tris-HCl (pH8.0), 1 mM EDTA)
Dissolve in 10 μL and add 100 μL phosphorylation reaction solution [50 mM Tris-
HCl (pH 7.6), 10 mM MgCl ₂ , 1 mM spermidine, 10 mM dithiothreitol, 0.1 mg / mL bovine serum albumin, 1 mM
ATP, 10 units T4 polynucleotide kinase (Nippon Gene)] was reacted at 37 ° C for 1 hour to phosphorylate the 5'end. After phenol treatment, the water layer is collected and 2
Add twice the amount of ethanol, cool to -70 ° C, and then centrifuge.
The DNA was precipitated and dissolved in 20 μL TE buffer.

Example 2 Preparation of hGPR8L Expression Plasmid As a vector for expression, pTFC (Japanese Unexamined Patent Publication No. 2000-27) was used.
No. 0871) was digested with NdeI and AvaI (Takara Shuzo) at 37 ° C. for 4 hours and then a 4.4 kb DNA fragment was subjected to QIAquick Gel by 1% agarose gel electrophoresis.
Extraction using Extraction Kit (Qiagen), 25μ
It was dissolved in 1 TE buffer. NdeI of this pTFC,
The AvaI fragment and the structural gene of hGPR8L prepared as described above were ligated using TaKaRa DNA Ligation Kit ver.2 (Takara Shuzo). That is, Nd of pTFC
eI, AvaI fragment solution 1 μL and hGPR8L structural gene solution
4 μL was mixed, 5 μL of solution I was added, reacted at 16 ° C. for 30 minutes, and ligated. Ligation solution 10 μL
Was used to transform E. coli JM109 competent cells (Toyobo), plated on LB agar medium containing 10 μg / mL tetracycline, and cultured at 37 ° C. for 1 day, and the resulting tetracycline-resistant colonies were selected. This transformant was cultured overnight in LB medium, and a plasmid pTFChGPR8L was prepared using QIAprep8 Miniprep Kit (Qiagen). This h
The nucleotide sequence of the GPR8L structural gene portion was confirmed using Applied Biosystems Model 377 DNA Sequencer. Plasmid pTFChGPR8L was added to E. coli MM294 (DE
3) Transform the strain, seed on LB agar medium containing 10 μg / mL tetracycline, incubate at 37 ° C for 1 day, and hGP
R8LCS23 fusion protein expression strain Escherichia coli MM294 (DE3) / pTFChG
PR8L was obtained (Fig. 2).

Example 3 The transformed cells obtained in Example 2 were transformed into LB medium containing 1 mg of tetracycline (1% peptone, 0.
1 L of 5% yeast extract and 0.5% sodium chloride) was used to perform shaking culture in a 2-liter flask at 37 ° C. for 8 hours. The obtained culture solution was added to 19 liters of the main fermentation medium (1.68% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1% ammonium chloride, 0.05%).
% Sodium chloride, 0.05% magnesium sulfate, 0.
02% antifoaming agent, 0.00025% ferrous sulfate, 0.00
Transfer to a 50-liter fermentor containing 025% thiamine hydrochloride, 1.5% glucose, 1.5% casamino acid, and
Aeration-agitation culture was started at ° C. Turbidity of culture solution is about 500
Isopropyl-β-D-
Thiogalactopyranoside was added so that the final concentration was 12 mg / L, and the cells were further cultured for 4 hours. After the completion of the culture, the culture solution was centrifuged to obtain about 390 g of wet bacterial cells, which were frozen and stored at -80 ° C.

Example 4 Acquisition of Met-hGPR8L The procedure of Example 3 was repeated twice, and 780 g of the obtained bacterial cells
M guanidine hydrochloride, 50 mM Tris / HCL (pH
8.0) Add 1600 ml of solution and stir for about 4 hours,
Centrifugation (10000 rpm, 60 minutes) was performed, and the supernatant was added with 0.6 M arginine, 1 mM dithiothreitol,
Diluted with 40 L of 50 mM Tris / HCL (pH 8.0). After standing overnight at 10 ° C, the pH was adjusted to 6.0 with concentrated hydrochloric acid and equilibrated with a 50 mM phosphate buffer (pH 6.0) on an AF-Heparin Toyopearl 650M column (11.3 cm ID).
X 13 cmL, Tosoh), and after adsorbing and washing, 5
Elution was performed with 0 mM phosphate buffer, 2M NaCl, pH 6.0, and 1750 ml of Met-hGPR8L-C.
The S23 fusion protein fraction was obtained. The eluate was concentrated with a Pellicon mini cassette (Millipore) while adding 0.1 M acetic acid to obtain a 0.1 M acetic acid solution of the Met-hGPR8L-CS23 fusion protein. Urea was added to this solution to a final concentration of 6 M, and then 1-cyano-
4-Dimethylaminopyridinium salt (DMAP-CN)
705 mg was added, and the mixture was reacted at room temperature for 15 minutes. After the reaction, Sephade equilibrated with 10% acetic acid
x G-25 column (46 mm ID x 600 mm L, Pharmacia), 10% acetic acid used for equilibration was developed at a flow rate of 6 ml / min, and S-cyanated Met-hGPR8 was developed.
An L-CS23 fusion protein fraction was obtained. This eluate was concentrated and desalted with a Pellicon mini cassette (Millipore) to obtain a desalted solution of the Met-hGPR8L-CS23 fusion protein. Urea was added to the desalted solution to a final concentration of 6 M, 1N caustic soda was further added to a concentration of 0.06 N, and the mixture was reacted at 0 ° C. for 15 minutes. After the reaction was completed, pH was adjusted to 6.0 with acetic acid, and Met-hGP was used.
R8L was obtained. This reaction solution was equilibrated with 50 mM phosphate buffer (pH 6.5) containing 3 M urea SP-5PW.
(5.5 cm x 30 cm, Tosoh), and after adsorbing and washing, a step gradient of 10-50% B (B = 50 mM phosphate buffer + 1 M NaCl + 3 M urea, pH 6.0) for 100 minutes at 35 ml / Elution at a flow rate of
A t-hGPR8L fraction (elution time: about 70 minutes) was obtained.
This Met-hGPR8L fraction was further equilibrated with 0.1% trifluoroacetic acid (TFA) to C4P-50 (5 cm).
X 50 cm, Showa Denko), after adsorbing and washing,
10-50% B (B: 80% acetonitrile / 0.1
% TFA) with a step gradient of 100 minutes for elution at a flow rate of 25 ml / min, Met-hGPR8L fractions (elution time: about 90 minutes) were pooled, and then lyophilized to give M.
70 mg of lyophilized powder of et-hGPR8L was obtained. a) Amino acid composition analysis Amino acid composition analysis (Hitachi L-8500A
Amino Acid Analyzer). as a result,
It was in agreement with the amino acid composition predicted from the DNA base sequence of hGPR8L with methionine added to the N-terminus (Table 1).

[Table 1] Amino acid composition analysis ------------- Base sequence of hGPR8L amino acid per mol of amino acid Predicted value from the residual cardinal number ------------------ Asx 0 0 Thr ¹⁾ 0.9 1. 0 Ser ¹⁾ 0.8 1.0 Glx 0 0 Pro 1.2 1.0 Gly 2.9 3.0 Ala 2.9 3.0 Cys ²⁾ N.P. D. 0 Val 1.9 2.0 Met 1.9 1.0 Ile 0 0 Leu 3.0 3.0 Tyr 2.0 2.0 2.0 Phe 0 0 His 1.9 2.0 Lys 1.0 1.0 Arg 1.9 2.0 Trp 0.9 1.0 −−−−−−−−−−−−−−−−−−−−−−−−−−−−−− Acid hydrolysis (6N hydrochloric acid -4% thioglycolic acid, 11
Hydrolysis at 0 ° C for 24,48 hours) 1) Value extrapolated at 0 hours 2) Undetected

B) N-terminal amino acid sequence analysis The N-terminal amino acid sequence was determined using a gas phase protein sequencer (Applied Biosystems model 477A). As a result, the obtained hGPR8L was in agreement with the N-terminal amino acid sequence predicted from the DNA base sequence, except that methionine was added to the N-terminal (Table 2).

[Table 2] N-terminal amino acid sequence ------------------ Base sequence residue of hGPR8L detected --------------------------- No. (PTH ¹⁾ -amino acid predicted (pmol) amino acid -------------------------- 19) Trp 3 Tyr (23) Tyr 4 Lys (23) Lys 5 His (12) His 6 Val (22) Val 7 Ala (22) Ala 8 Ser (12) Ser 9 Pro (10) Pro 10 Arg (8) Arg 11 Tyr (10) Tyr 12 His (5) His 13 Thr (5) Thr 14 Val (8) Val 15 Gly (7) Gly 16 Arg (6) Arg 17 Ala (6) Ala 18 Ala (9) Ala 19 The analysis was carried out using Gly (4) Gly20Leu (2) Leu ---------------------------. 1) Phenylthiohydantoin

C) C-terminal amino acid analysis The C-terminal amino acid was analyzed using an amino acid analyzer (Hitachi L-8500A).
It was analyzed using Amino Acid Analyzer (Table 3). [Table 3] C-terminal amino acid analysis --------------- C-terminal amino acid recovery hGPR8L (%) ---------- ------------- Leu 34.5 ------------------------------- Gas phase hydrazine decomposition method (100 ° C., 6 hours ) From the above results, the hGPR8L obtained in Example 4 is a molecular species (Met-hG) in which methionine is added to its N-terminus.
It was found to be PR8L).

Example 5 (Measurement of biological activity) Using the Met-hGPR8L obtained in Example 4, the activity was measured by the method described in Example 5 of Japanese Patent Application No. 2001-116000, and an activity equivalent to that of the synthetic product was measured. Was confirmed to have.

Example 6 (Removal of N-terminal methionine residue) 10 mg of Met-hGPR8L obtained in Example 4 was dissolved in 1.6 ml of 3M urea solution, and then 0.12 ml of 0.1M copper sulfate and 0 glyoxylic acid. A mixed solution of 0.092 g and pyridine 0.2 ml was added, and the mixture was reacted at 25 ° C. for 1 hour. After completion of the reaction, Sephadex (Sepdex) equilibrated with 3M urea + 10 mM phosphate buffer (pH 5.5) was used.
hadex) G-25 column (1.5 cm x 50 cm)
The solution used for equilibration was developed at a flow rate of 1 ml / min, and the diketone body fraction of Met-hGPR8L was pooled (20 ml). Subsequently, 80 mM 3, 4 was added to this fraction.
-Diaminobenzoic acid, 0.2 M methionine, 10 mM
After adding 20 ml of EDTA, 2M acetic acid, 4M sodium formate and 3M urea solution, the mixture was reacted at 25 ° C for 5 days.
After completion of the reaction, the reaction solution was treated with 50 mM phosphate buffer (pH 6.
0) equilibrated with Sephadex G-25 column (2.
5 cm × 50 cm), the buffer used for equilibration was developed at a flow rate of 2 ml / min, and hGPR8L fractions without methionine added to the N-terminus were pooled. The pooled hGPR8L fractions were adjusted to pH 6.0 and SM-equilibrated with 50 mM phosphate buffer + 3 M urea (pH 5.0).
After adsorbing on 5PW (2.15 cm × 15 cm, Tosoh Corporation), 0-50% B (B = 50 mM phosphate buffer +
Elution was performed with a step gradient of 1.0 M NaCl + 3 M urea, pH 6.0 for 60 minutes at a flow rate of 6 ml / min, and hGP was used.
The R8L fractions (elution time: about 50 minutes) were pooled. In addition, hGPR8L was equilibrated with 0.1% TFA to C4P.
After adsorption to -50 (21.5 cm x 30 cm, Showa Denko KK), a flow rate of 6 ml / min for 60 minutes with a step gradient of 20-50% B (B = 80% acetonitrile / 0.1% TFA). Eluted at. After pooling the hGPR8L fractions (elution time: about 35 minutes), lyophilization was performed,
hGPR8L (3 mg) was obtained. a) Amino acid composition analysis Amino acid composition analysis (Hitachi L-8500A
Amino Acid Analyzer). As a result, it was in agreement with the amino acid composition predicted from the DNA base sequence of hGPR8L (Table 4).

[Table 4] Amino acid composition analysis ------------- Base sequence of hGPR8L per mol Amino acid Predicted value from the residual cardinal number ------------------------------------------ Asx 0.30 Thr ¹⁾ 0.9 1.0 Ser ¹⁾ 0.9 1.0 Glx 0.3 0 Pro 1.3 1.0 Gly 3.1 3.0 Ala 2.8 3.0 Cys ²⁾ N.V. D. 0 Val 1.9 2.0 Met 1.8 1.0 Ile 0.1 0 Leu 3.0 3.0 Tyr 1.9 2.0 Phe 0.2 0 His 1.8 2.0 Lys 1.2 1.0 Arg 2.0 2.0 Trp 0.9 1.0 −−−−−−−−−−−−−−−−−−−−−−−−−−−−−−− Acid hydrolyzed Decomposition (6N hydrochloric acid-4% thioglycolic acid, 11
Hydrolysis at 0 ° C for 24,48 hours) 1) Value extrapolated at 0 hours 2) Undetected

B) N-terminal amino acid sequence analysis The N-terminal amino acid sequence was determined using a gas phase protein sequencer (Applied Biosystems model 477A). As a result, it was in agreement with the N-terminal amino acid sequence predicted from the obtained DNA base sequence of hGPR8L (Table 5).

[Table 5] N-terminal amino acid sequence ------------- Base sequence residue No. of detected hGPR8L. PTH ¹⁾ -amino acid predicted (pmol) amino acid ------------------------------------- 1 Trp (33) Trp 2 Tyr ( 47) Tyr 3 Lys (34) Lys 4 His (17) His 5 Val (44) Val 6 Ala (43) Ala 7 Ser (20) Ser 8 Pro (18) Pro 9 Arg (9) Arg 10 Tyr (17) Tyr 11 His (7) His 12 Thr (8) Thr 13 Val (14) Val 14 Gly (12) Gly 15 Arg (8) Arg 16 Ala (12) Ala 17 Ala (21) Ala 18 Gly (9) Gly The analysis was carried out using Leu (6) Leu 20 Leu (11) Leu −−−−−−−−−−−−−−−−−−−−−−−− 50 pmol. 1) Phenylthiohydantoin

C) C-terminal amino acid analysis The C-terminal amino acid was analyzed by an amino acid analyzer (Hitachi L-8500A).
Amino Acid Analyzer) was used for analysis (Table 6). [Table 6] C-terminal amino acid analysis C-terminal amino acid recovery hGPR8L (%) Leu gas-phase hydrazine decomposition method (100 ° C, 6 hours)

Example 7 (Measurement of biological activity) Using the hGPR8L obtained in Example 6, a patent application 200
The activity was measured by the method described in Example 5 of No. 1-1116000, and it was confirmed to have the same activity as the synthetic product.

[0059]

When the manufacturing method of the present invention is used, for example,
Anorexia nervosa, hypertension, autoimmune disease, heart failure, cataract, glaucoma, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis,
Acute viral encephalitis, adult respiratory distress syndrome, alcoholic hepatitis, Alzheimer's disease, asthma, arteriosclerosis, atopic dermatitis, bacterial pneumonia, bladder cancer, bone fracture, breast cancer, bulimia nervosa, polyphagia, burn healing, cervix Cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic pancreatitis, cirrhosis, colorectal cancer (colorectal cancer), Crohn's disease, dementia, diabetic complications, diabetic nephropathy, diabetic neuropathy, diabetes Retinopathy, gastritis, Helicobacter pylori infection, liver failure, A
Hepatitis B, hepatitis B, hepatitis C, hepatitis, herpes simplex virus infection, varicella zoster virus infection, Hodgkin's disease, AIDS infection, human papillomavirus infection, hypercalcemia, hypercholesterolemia, hyperglycerides , Hyperlipidemia, infectious disease, influenza infection, insulin-dependent diabetes mellitus (type I), invasive staphylococcal infection, malignant melanoma, cancer metastasis, multiple myeloma, allergic rhinitis, nephritis , Non-Hodgkin's lymphoma, non-insulin dependent diabetes mellitus (type II), non-small cell lung cancer, organ transplant,
Osteoarthritis, osteomalacia, osteopenia, osteoporosis, ovarian cancer,
Bone-Petett disease, peptic ulcer, peripheral vascular disease, prostate cancer, reflux esophagitis, renal failure, rheumatoid arthritis, schizophrenia, sepsis, septic shock, severe systemic fungal infection, small cell lung cancer, spinal cord injury, Gastric cancer, systemic lupus erythematosus, transient cerebral ischemic attack, tuberculosis, valvular heart disease, vascular / multiple infarction dementia, wound healing, insomnia, arthritis, pituitary hormone deficiency, impure urine, or neurodegeneration A polypeptide that can be used as a therapeutic / preventive agent for diseases (particularly anorexia nervosa, etc.) and can be used as an appetite (feeding) enhancer, etc.) can be produced industrially and in large quantities.

[0060]

[Sequence list] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Method for Producing Ligand for GPR8 polypeptide <130> B01194 <150> JP2001-129929 <151> 2001-04-26 <160> 22 <210> 1 <211> 23 <212> PRT <213> Human <400> 1 Trp Tyr Lys His Val Ala Ser Pro Arg Tyr His Thr Val Gly Arg Ala 1 5 10 15 Ala Gly Leu Leu Met Gly Leu             20 23 <210> 2 <211> 69 <212> DNA <213> Human <400> 2 tggtacaagc acgtggcgag tccccgctac cacacggtgg gccgcgccgc tggcctgctc 60 atggggctg 69 <210> 3 <211> 23 <212> PRT <213> Porcine <400> 3 Trp Tyr Lys His Thr Ala Ser Pro Arg Tyr His Thr Val Gly Arg Ala 1 5 10 15 Ala Gly Leu Leu Met Gly Leu             20 23 <210> 4 <211> 69 <212> DNA <213> Porcine <400> 4 tggtacaagc acacggcgag tccccgctac cacacggtgg gccgcgccgc gggcctgctc 60 atggggctg 69 <210> 5 <211> 23 <212> PRT <213> Rat / Mouse <400> 5 Trp Tyr Lys His Val Ala Ser Pro Arg Tyr His Thr Val Gly Arg Ala 1 5 10 15 Ser Gly Leu Leu Met Gly Leu             20 23 <210> 6 <211> 69 <212> DNA <213> Rat / Mouse <400> 6 tggtacaagc acgtggcgag ccctcgctat cacacagtgg gtcgtgcctc cgggctgctc 60 atggggctg 69 <210> 7 <211> 30 <212> PRT <213> Human <400> 7 Trp Tyr Lys His Val Ala Ser Pro Arg Tyr His Thr Val Gly Arg Ala 1 5 10 15 Ala Gly Leu Leu Met Gly Leu Arg Arg Ser Pro Tyr Leu Trp             20 25 30 <210> 8 <211> 90 <212> DNA <213> Human <400> 8 tggtacaagc acgtggcgag tccccgctac cacacggtgg gccgcgccgc tggcctgctc 60 atggggctgc gtcgctcacc ctatctgtgg 90 <210> 9 <211> 30 <212> PRT <213> Porcine <400> 9 Trp Tyr Lys His Thr Ala Ser Pro Arg Tyr His Thr Val Gly Arg Ala 1 5 10 15 Ala Gly Leu Leu Met Gly Leu Arg Arg Ser Pro Tyr Met Trp             20 25 30 <210> 10 <211> 90 <212> DNA <213> Porcine <400> 10 tggtacaagc acacggcgag tccccgctac cacacggtgg gccgcgccgc gggcctgctc 60 atggggctgc gccgctcgcc ctacatgtgg 90 <210> 11 <211> 30 <212> PRT <213> Rat <400> 11 Trp Tyr Lys His Val Ala Ser Pro Arg Tyr His Thr Val Gly Arg Ala 1 5 10 15 Ser Gly Leu Leu Met Gly Leu Arg Arg Ser Pro Tyr Leu Trp             20 25 30 <210> 12 <211> 90 <212> DNA <213> Rat <400> 12 tggtacaagc acgtggcgag ccctcgctat cacacagtgg gtcgtgcctc cgggctgctc 60 atggggctgc gccgctcgcc ctacctgtgg 90 <210> 13 <211> 30 <212> PRT <213> Mouse <400> 13 Trp Tyr Lys His Val Ala Ser Pro Arg Tyr His Thr Val Gly Arg Ala 1 5 10 15 Ser Gly Leu Leu Met Gly Leu Arg Arg Ser Pro Tyr Gln Trp             20 25 30 <210> 14 <211> 90 <212> DNA <213> Mouse <400> 14 tggtataagc acgtggcgag tccccgctat cacacagtgg gtcgtgcctc cgggctgctc 60 atggggctgc gccgctcgcc ctaccagtgg 90 <210> 15 <211> 333 <212> PRT <213> Human <400> 15 Met Gln Ala Ala Gly His Pro Glu Pro Leu Asp Ser Arg Gly Ser Phe 1 5 10 15 Ser Leu Pro Thr Met Gly Ala Asn Val Ser Gln Asp Asn Gly Thr Gly             20 25 30 His Asn Ala Thr Phe Ser Glu Pro Leu Pro Phe Leu Tyr Val Leu Leu         35 40 45 Pro Ala Val Tyr Ser Gly Ile Cys Ala Val Gly Leu Thr Gly Asn Thr     50 55 60 Ala Val Ile Leu Val Ile Leu Arg Ala Pro Lys Met Lys Thr Val Thr 65 70 75 80 Asn Val Phe Ile Leu Asn Leu Ala Val Ala Asp Gly Leu Phe Thr Leu                 85 90 95 Val Leu Pro Val Asn Ile Ala Glu His Leu Leu Gln Tyr Trp Pro Phe             100 105 110 Gly Glu Leu Leu Cys Lys Leu Val Leu Ala Val Asp His Tyr Asn Ile         115 120 125 Phe Ser Ser Ile Tyr Phe Leu Ala Val Met Ser Val Asp Arg Tyr Leu     130 135 140 Val Val Leu Ala Thr Val Arg Ser Arg His Met Pro Trp Arg Thr Tyr 145 150 155 160 Arg Gly Ala Lys Val Ala Ser Leu Cys Val Trp Leu Gly Val Thr Val                 165 170 175 Leu Val Leu Pro Phe Phe Ser Phe Ala Gly Val Tyr Ser Asn Glu Leu             180 185 190 Gln Val Pro Ser Cys Gly Leu Ser Phe Pro Trp Pro Glu Gln Val Trp         195 200 205 Phe Lys Ala Ser Arg Val Tyr Thr Leu Val Leu Gly Phe Val Leu Pro     210 215 220 Val Cys Thr Ile Cys Val Leu Tyr Thr Asp Leu Leu Arg Arg Leu Arg 225 230 235 240 Ala Val Arg Leu Arg Ser Gly Ala Lys Ala Leu Gly Lys Ala Arg Arg                 245 250 255 Lys Val Thr Val Leu Val Leu Val Val Leu Ala Val Cys Leu Leu Cys             260 265 270 Trp Thr Pro Phe His Leu Ala Ser Val Val Ala Leu Thr Thr Asp Leu         275 280 285 Pro Gln Thr Pro Leu Val Ile Ser Met Ser Tyr Val Ile Thr Ser Leu     290 295 300 Ser Tyr Ala Asn Ser Cys Leu Asn Pro Phe Leu Tyr Ala Phe Leu Asp 305 310 315 320 Asp Asn Phe Arg Lys Asn Phe Arg Ser Ile Leu Arg Cys                 325 330 333 <210> 16 <211> 146 <212> PRT <213> Human <400> 16 Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His 1 5 10 15 Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu             20 25 30 Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp         35 40 45 Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser     50 55 60 Ile Lys Gly Val Ser Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly 65 70 75 80 Arg Leu Leu Ala Ser Lys Ser Val Thr Asp Glu Cys Phe Phe Phe Glu                85 90 95 Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr             100 105 110 Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser         115 120 125 Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala     130 135 140 Lys Ser 145 146 <210> 17 <211> 432 <212> DNA <213> Human <400> 17 cccgaggatg gcggcagcgg cgccttcccg cccggccact tcaaggaccc caagcggctg 60 tactgcaaaa acgggggctt cttcctgcgc atccaccccg acggccgagt tgacggggtc 120 cgggagaaga gcgaccctca catcaagcta caacttcaag cagaagagag aggagttgtg 180 tctatcaaag gagtgagcgc taatcgttac ctggctatga aggaagatgg aagattacta 240 gcttctaagt ctgttacgga tgagtgtttc ttttttgaac gattggaatc taataactac 300 aatacttacc ggtcaaggaa atacaccagt tggtatgtgg cactgaaacg aactgggcag 360 tataaacttg gatccaaaac aggacctggg cagaaagcta tactttttct tccaatgtct 420 gctaagagct gc 432 <210> 18 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 tatgtggtat aaacatgtgg cgagcccgcg ttatcat 37 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 accgtgggcc gtgcggcggg cctgctgatg ggcctgtgcc 40 <210> 20 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 cacggtatga taacgcgggc tcgccacatg tttataccac a 41 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 21 tcggggcaca ggcccatcag caggcccgcc gcacggcc 38 <210> 22 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> <400> 22 tggtataaac atgtggcgag cccgcgttat cataccgtgg gccgtgcggc gggcctgctg 60 atgggcctg 69

[0061]

[Brief description of drawings]

FIG. 1 shows a reaction mechanism in a reaction process of the present invention.

FIG. 2 shows a construction diagram of the plasmid pTFChGPR8L obtained in Example 2.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12N 1/21 C12P 21/02 C 5/10 A61P 1/00 C12P 21/02 1/14 // A61K 38 / 00 3/00 A61P 1/00 9/00 1/14 11/00 3/00 13/00 9/00 17/00 11/00 19/00 13/00 25/00 17/00 27/02 19 / 00 29/00 101 25/00 31/00 27/02 35/00 29/00 101 37/00 31/00 C12N 15/00 ZNAA 35/00 5/00 A 37/00 A61K 37/02 (72) Invention who Osamu Nishimura Tsukuba, Ibaraki Prefecture, Oaza Higashihiratsuka 586 address 2 F-term (reference) 4B024 AA01 BA80 CA04 CA06 CA07 DA06 EA04 GA11 HA03 HA08 4B064 AG01 CA02 CA19 CC24 DA01 4B065 AA01X AA26X AA57X AA72X AA90X AB01 BA02 CA24 CA44 4C084 AA06 BA01 BA08 BA18 BA19 CA59 DC50 NA14 ZA022 ZA332 ZA362 ZA592 ZA662 ZA752 ZA812 ZA892 ZA942 ZB072 ZB112 ZB152 ZB262 ZB322 ZC212 4H045 AA10 AA20 AA30 BA17 BA18 BA41 CA40 EA20 EA27 FA16 FA74

Claims (23)

[Claims] 1. A fusion protein or peptide in which a ligand polypeptide for GPR8 which may have an optionally oxidized methionine residue at the N-terminus is linked to the N-terminus of a protein or peptide having a cysteine at the N-terminus. Is subjected to a cleavage reaction of a peptide bond on the amino group side of a cysteine residue, and a method for producing a ligand polypeptide for GPR8 or a salt thereof. 2. A gene encoding a fusion protein or peptide in which a ligand polypeptide for GPR8, which may have a methionine residue at the N-terminus, is linked to the N-terminus of a protein or peptide having a cysteine at the N-terminus. A transformant carrying a vector is cultured to express a fusion protein or peptide, and the expressed fusion protein or peptide is subjected to a cleavage reaction at the peptide bond on the amino group side of a cysteine residue. A method for producing a ligand polypeptide for GPR8, which may have a methionine residue, or a salt thereof. 3. The method according to claim 1 or 2, wherein the cleavage reaction is an S-cyanation reaction followed by a hydrolysis reaction. 4. The method according to claim 1 or 2, wherein the ligand polypeptide for GPR8 is a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1. 5. A fusion protein or peptide in which a ligand polypeptide for GPR8, which may have a methionine residue at the N-terminus, is linked to the N-terminus of a protein or peptide having a cysteine at the N-terminus. 6. A vector having a gene encoding the fusion protein or peptide according to claim 5. 7. A transformant containing the vector according to claim 6. 8. A methionine residue characterized by reacting a ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminus or a salt thereof with α-diketones, and then hydrolyzing the α-diketone. Removal method. 9. The method according to claim 8, wherein the ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminus is a genetically engineered ligand polypeptide for GPR8. 10. The method according to claim 8, wherein the α-diketone is reacted in the presence of a transition metal ion. 11. The method according to claim 8, wherein the α-diketone is reacted in the presence of a base. 12. α in the presence of a transition metal ion and a base
-The method according to claim 8, characterized in that the diketones are reacted. 13. The method according to claim 8, wherein the α-diketone is glyoxylic acid or a salt thereof. 14. The method according to claim 10, wherein the transition metal ion is a copper ion. 15. The method according to claim 11, wherein the base is pyridine. 16. The method according to claim 8, which comprises hydrolyzing with a base. 17. The method according to claim 16, wherein the base is an amine. 18. The method according to claim 16, wherein the base is a diamine or thio or selenosemicarbazide. 19. The method according to claim 18, wherein the diamine is o-phenylenediamine or 3,4-diaminobenzoic acid. 20. A gene polypeptide produced by genetic engineering and having a methionine-added N-terminal ligand for GPR8 or a salt thereof and glyoxylic acid or a salt thereof are reacted in the presence of copper sulfate and pyridine, and then o- A method for producing a ligand polypeptide for GPR8 or a salt thereof, which comprises reacting with phenylenediamine or 3,4-diaminobenzoic acid. 21. A formula CH ₃ -S (O) _m- (CH ₂ ) ₂ -CO-CO-X [in the formula,
m represents an integer of 0 to 2, and X represents a peptide chain of the ligand polypeptide for GPR8. ] The compound or its salt represented by these. 22. A method for producing a ligand polypeptide for GPR8 or a salt thereof, which comprises hydrolyzing the compound according to claim 21. 23. A fusion protein or peptide in which a ligand polypeptide for GPR8 having a methionine residue at the N-terminus is linked to the N-terminus of a protein or peptide having a cysteine at the N-terminus and a peptide bond on the amino group side of the cysteine residue is used. To obtain a ligand polypeptide for GPR8 having an optionally oxidized methionine residue at the N-terminal or a salt thereof, and further having a GP having an optionally oxidized methionine residue at the N-terminal
R8 ligand polypeptide or salt thereof and α-
A method for producing a ligand polypeptide for GPR8 or a salt thereof, which comprises reacting a diketone and then hydrolyzing the same.