JP2002541823A - Method for determining single nucleic acid polymorphism using bioelectric microchip - Google Patents

Abstract

  (57) [Summary] Methods are provided for analyzing and determining the nature of a single nucleic acid polymorphism (SNP) in a gene target. In one method of the invention, the nature of the SNP in the gene target provides a plurality of hybridization complexes located at a plurality of test sites on an electronically bioactive microchip, wherein the hybridization complexes are , A stabilizing probe having a sequence complementary to at least a nucleic acid target containing a SNP, a target sequence and / or a reporter probe, and a selected sequence complementary to either the stabilizing agent or the same target sequence strand Wherein the selected sequence of the reporter is determined by a step comprising either wild-type nucleotides or nucleotides corresponding to the target SNP. The stabilizers, reporters and target amplicons according to the present invention can be used in electronic microchip systems where base-stacking energies are used, inter alia, to identify the presence of identifying indices, wild-type or polymorphic sequences. Hybridized with assistance. Applications include the identification of polymorphisms in structural genes, regulatory regions, antibiotic or chemotherapeutic drug resistance conferring regions, or SNPs associated with speciation or used to determine genetic linkage. Disease diagnostic methods are included.

Description

DETAILED DESCRIPTION OF THE INVENTION

Related application information
A continuation-in-part of application serial number 09/030156, filed February 25, 1998, entitled "HISMS IN DNA," which is filed under "METHODS AND PARAME
TERS FOR ELECTRONIC BIOLOGICAL DEVICES, which is a continuation-in-part application of application serial number 08 / 986,065, filed on December 5, 1997, the application of which is "APPARATUS AND METHODS FOR ACTIVE PROGRAMMABLE MATRIX DEVICES."
No. 08/534, filed Sep. 27, 1995, entitled "
No. 5,454,957, which is a continuation-in-part application of U.S. Pat.
No. (The application is “CONTROL SYSTEM FOR ACTIVE, PROGRAMMABLE ELECTRONIC M
"AUTOMATED MO" issued under the application No. 8 / 859,644, filed May 20, 1997, entitled "ICROBIOLOGY SYSTEM".
LECULAR BIOLOGICAL DIAGNOSTIC SYSTEM "is a continuation-in-part of serial number 08 / 304,657 filed on September 9, 1994, which is filed as" METHODS FOR ELECTRONIC STRINGENCY CONTROL FOR MOLECULAR BIOLOGICAL. "
, ANALYSIS AND DIAGNOSTICS ”is a continuation-in-part of application Serial No. 08 / 271,882, filed July 7, 1994, which was filed under the title“ ACTIVE PROGRAMMABLE ELECTRONIC DEVICES FOR MOLECULAR BIOLOGIC ”.
US Patent No. 5,605,662, entitled "METHODS FOR ELECTRONIC SYNTHESIS OF POLYMERS," entitled "AL ANALYSIS AND DIAGNOSTICS"
(Continued with Serial No. 08 / 725,976, filed October 4, 1996) Partial continuation of Serial No. 08 / 146,504 filed November 1, 1993 Application and "METHODS AND MATER
1 entitled "IALS FOR OPTIMIZATION OF ELECTRONIC HYBRIDIZATION REACTIONS"
Is a continuation of application Serial No. 08 / 708,262, filed Sep. 6, 996, all of which are hereby incorporated by reference and are hereby incorporated by reference in their entirety as if fully set forth herein. Is considered.

FIELD OF THE INVENTION [0002] The methods of the present invention relate to systems for gene identification for disease states and other gene-related distresses. More particularly, the method relates to a system for the detection of single nucleic acid polymorphisms in nucleic acid sequences for the identification of polymorphisms in the genome of viruses and eukaryotes and prokaryotes.

BACKGROUND OF THE INVENTION [0003] The following description provides an overview of information relevant to the invention. It may be said that any information provided herein is prior art to the claimed invention, or that any publications specifically or implicitly referred to are prior art to the present invention. I do not tolerate that.

[0004] Molecular biology involves a great variety of techniques for the analysis of nucleic acid and protein sequences. Many of these techniques and procedures form the basis for clinical diagnostic assays and tests. These techniques include nucleic acid hybridization analysis, restriction enzyme analysis, genetic sequence analysis, and nucleic acid and protein separation and purification (see, for example,
Sambrook, EF Fritsch, and T. Maniatis, Molecular Cloning: A Labora
tory Manual, 2nd edition, Cold spring Harbor Laboratory Press, Cold Spring Ha
rbor, New York, 1989).

Most of these techniques involve performing multiple operations (eg, pipetting, centrifugation and electrophoresis) on large numbers of samples. They are often complex and time consuming, and generally require a high degree of accuracy. Many techniques are limited in their application by lack of sensitivity, specificity or reproducibility.

[0006] For example, the entire process of performing a DNA hybridization analysis for a genetic or infectious disease is very complex. In short, the whole process can be divided into a number of steps and sub-steps. In the case of genetic disease diagnosis, the first step includes:
Obtaining a sample (eg, saliva, blood or tissue) is involved. Various pre-treatments will be performed, depending on the type of sample. The second step involves separating or lysing cells that release crude DNA material along with other cellular components.

In general, some sub-steps require removing cellular debris and then further purifying the DNA from the crude sample. At this point, several options exist for processing and analysis. Some options include denaturing the DNA and then performing a direct hybridization analysis in one of a number of formats (dot blots, microbeads, microplates, etc.). A second option, called Southern blot hybridization, cuts the DNA with restriction enzymes, separates the DNA fragments on an electrophoresis gel, blots the DNA on a membrane filter, and then hybridizes the blot with a specific DNA probe sequence. Soybeans are included. This procedure effectively reduces the complexity of the genomic DNA sample, thereby helping to improve the specificity and sensitivity of the hybridization. Unfortunately, this procedure is long and difficult. A third option is to perform an amplification procedure such as the polymerase chain reaction (PCR) or strand displacement amplification (SDA). These procedures involve targeting the target D to the non-target sequence.
Amplify (increase) the number of NA sequences. Amplification of the target DNA helps to overcome problems associated with complexity and sensitivity in genomic DNA analysis. After these sample preparation and DNA processing steps, the actual hybridization reaction is performed. Finally, detection and data analysis translate the hybridization events into analytical results.

[0008] Nucleic acid hybridization analysis generally involves the detection of a very small number of specific target nucleic acids (DNA or RNA) with an excess of probe DNA in a relatively large amount of complex non-target nucleic acids. The reduction in the complexity of the nucleic acid in the sample helps to detect low copy numbers (ie, 10,000 to 100,000) of the nucleic acid target. D
Reduction of NA complexity is achieved to some extent by amplification of the target nucleic acid sequence. (S
For DA, see MA Innis et al., PCR Protocols: A Guide to Methods and App.
lications, Academic Press, 1990, Spargo et al., 1996, Molecular & Cel.
lular Probes). This is because amplification of the target nucleic acid results in a large number of target nucleic acid sequences relative to non-target sequences, thereby improving the subsequent target hybridization step.

[0009] The actual hybridization reaction represents one of the most important and major steps of the whole process. The hybridization step involves contacting a DNA sample prepared under optimal set conditions with a specific reporter probe, and hybridization occurring between the target DNA sequence and the probe. Hybridization can be performed in any one of a number of ways. For example, multiple sample nucleic acid hybridization analyzes were performed on various filters and solid support formats (GA Beltz et al., Methods in Enzym
ology, Volume 100, Part B, R. Wu, L. Grossman, K. Moldave, Academic Press
, New York, Chapter 19, pages 266-308, 1985). One style of so-called "
"Dot blot" hybridization involves non-covalent attachment of target DNA to a filter followed by hybridization to a radiolabeled probe (s). "Dot blot" hybridization
Over a period of 0 years, it has gained widespread use, during which many versions have been developed (MLM Anderson and BD Young, Nucleic Acid Hybridization-A Pract
ical Approach, edited by BD Hames and SJ Higgins, IRL Press, Washington,
DC Chapter 4, pages 73-111, 1985). For example, the dot blot method
Multiplex analysis of genomic mutations (D. Nanibhushan and D. Rabin, EPA 02280)
75, July 8, 1987) and for the detection of overlapping clones and construction of a genomic map (GA Evans, US Pat. No. 5,219,726, 199).
3/15/15).

[0010] New techniques have been developed to perform multiple sample nucleic acid hybridization analyzes on microformatted or matrix devices (eg, M. Barinaga, 253 Science, 1489, p. 1489, 1991; W. B
ains, 10 Bio / Technology, pp. 757-758, 1992). These methods usually attach a specific DNA sequence to a very small specific area of a solid support, such as a micro-well of a DNA chip. These hybridization formats are micro-scale versions of conventional "dot blot" and "sandwich" hybridization systems.

Using microformatted hybridization, “sequencing by hybridization” (SBH) can be performed (M. Barinaga,
253 Science, 1489, 1991; W. Bains, 10 Bio / Technology, 75.
7-758, 1992). SBH utilizes any n-nucleotide oligomer (n-mer) to identify the n-mer in an unknown DNA sample, which is subsequently aligned by algorithmic analysis to produce a DNA sequence R. Drmanac and R. Crkvenjakov, Yugoslavia Patent Application No. 570/87, 1987; R. Drman
ac et al., 4 Genomics, 114, 1989; Strezoska et al., 88 Proc. Natl. Acad. S
ci. USA 10089, 1992; and R. Drmanac and RB Crkvenjakov,
(See U.S. Pat. No. 5,202,231, Apr. 13, 1993)

There are two modes for performing SBH. The first format involves creating an array of all possible n-mers on a support, which is then hybridized to a target sequence. The second mode involves attaching the target sequence to a support and subsequently being probed with all possible n-mers. Both formats have the basic problems of direct probe hybridization and the additional difficulties associated with multiple hybridizations.

Southern (UK patent application GB 8810400, 1988; EM Southern et al.,
13 Genomics 1008, 1992) proposed using the first format to analyze or sequence DNA. Southern used PCR amplified genomic DNA to identify known single point mutations. Also, Southern is SB
A method for synthesizing an array of oligonucleotides on a solid support for H has been described. However, Southern does not describe how to achieve optimal stringency conditions for each oligonucleotide on the array.

[0014] Drmanac et al. (260 Science 1649-1652, 1993) used the second format to sequence several short (116 base pair) DNA sequences. Target D
NA was attached to a filter support ("dot blot" format). Each filter was subsequently hybridized with 272 labeled 10-mer and 11-mer oligonucleotides. Using a wide range of stringency conditions,
Hybridization specific to each n-mer probe was achieved. The number of washings
The temperature was varied from 5 minutes to overnight using a temperature of 0 ° C to 16 ° C. Most probes required a 3 hour wash at 16 ° C. The filters had to be exposed for 2 to 18 hours to detect the hybridization signal. The overall false positive hybridization rate was 5% despite the use of simple target sequences, a reduced set of oligomer probes and the most stringent conditions available.

[0015] A variety of methods are currently available for detecting and analyzing hybridization events. Depending on the reporter group (fluorescent substance, enzyme, radioisotope, etc.) used to label the DNA probe, detection and analysis are performed fluorometrically, colorimetrically or by autoradiography. . Information by observing and measuring emitted radiation, such as fluorescent emission or particle emission, can be obtained for the hybridization event. Even if the detection method has a very high inherent sensitivity, detection of a hybridization event is difficult due to the presence of a background of non-specific binding substances. Thus, the detection of a hybridization event depends on how specific and sensitive hybridization can be made. For genetic analysis, several methods have been developed that have attempted to increase specificity and sensitivity.

One form of genetic analysis is an analysis focused on elucidating a single nucleic acid polymorphism or (“SNP”). Factors that favor the use of SNPs include their high abundance in the human genome (especially as compared to short tandem repeats (STRs)), the coding or regulatory regions of genes (which can affect protein structure or expression levels). Their frequent placement within, their stability when transitioning from one generation to the next (Land
egren et al., Genome Research, 8, 769-776, 1998).

[0017] SNPs are defined anywhere in the genome that are present in two variants, and the most common variants occur in less than 99% of their lifetimes. In order to use SNPs as a broad range of genetic markers, it is very important that they can be genotyped easily, quickly, accurately and cost-effectively. Multiple locus factors for certain diseases (Risch and Merikaangas, Science, 273, 1516-1517, 1
996), as well as typing both large sets of SNPs to investigate complex disorders in which a small subset of SNPs have been shown to be associated with known pain.

A number of techniques are currently available for typing SNPs, all of which require target amplification (for a review, see Landegren et al., Genome Research, 8
Vol. 769-776, 1998), all of which are required for target amplification.
They include direct sequencing (Carothers et al., BioTechniques, 7, 494-4).
99, 1989), single-stranded conformational polymorphisms (Orita et al., Proc. Natl. Acad. Sci. U
SA, 86, 2766-2770, 1989), allele-specific amplification (Newton
Et al., Nucleic Acids Research, 17, 2503-2516, 1989), restriction digestion (Day and Humphries, Analytical Biochemistry, 222, 389-395).
, 1994) and hybridization assays. In their most basic form, hybridization assays work by identifying short oligonucleotide reporters to matched and mismatched targets. Many adaptations to basic protocols have been developed because of the difficulty in determining optimal denaturing conditions. These include the ligation reaction (Wu and Wallace, Gene, 76, 245-254, 1989) and mini-sequencing (
Syvanen et al., Genomics, 8, 684-692, 1990). Other enhancements include the 5'-nuclease activity of Taq DNA polymerase (Holland et al., Proc. Nat.
l. Acad. Sci. USA, 88, 7276-7280, 1991), Molecular
Beacons (Tyagi and Karamer, Nature Biotechnology, 17, 87-88,
1999), heat denaturation curve (Howell et al., Nature Biotechnology, 17, 87-88).
Pp., 1999) and DNA "chips" (Wang et al., Science, 280, 1077-).
1082, 1998). While each of these assays is functional, they are limited to their practical application in a clinical setting.

An additional phenomenon that has been found to be useful in identifying SNPs is the nucleic acid interaction energy or base-stacking energy from the hybridization of multiple target-specific probes to a single target. (R. Ornstei
n et al., `` An Optimized Potential Function for the Calculation of Nucleic Ac
id Interaction Energies ", Biopolymers, Vol. 17, 2341-2360 (197
8); J. Norberg and L. Nilsson, Biophysical Journal, 74, 394-4.
02, (1998); and J. Pieters et al., Nucleic Acids Research, 17,
12, No. 4551-4565 (1989)). This base-stacking phenomenon is used in a unique manner in the present invention to provide a highly sensitive Tm differential that allows direct detection of SNPs in nucleic acid samples.

Prior to the mode of the invention, other methods were used to identify nucleic acid sequences in related organisms or to sequence DNA. For example, U.S. Pat.
No. 030,557 describes a "probe" oligonucleotide in addition to a "probe" oligonucleotide in which the secondary and tertiary structure of the single-stranded target nucleic acid shows a higher Tm between the probe and the target nucleic acid.
It has been disclosed that it may be affected by attaching a "helper" oligonucleotide. However, that application is limited to that approach that only uses the hybridization energy to alter the secondary and tertiary structure of the self-annealing RNA strand and, if left unchanged, prevents the probe from hybridizing to the target. Will tend to.

For DNA sequencing, see K. Khrapko et al., Federation of European Bioch.
emical Societies Letters, Vol. 256, No. 1, page 2, pages 118-122 (1989), for example, disclosed that double stabilization results from continuous stacking hybridization. Further, J. Kieleczawa et al., Science, 258, 178.
Pp. 7-1791 (1992) disclosed the use of adjacent strings to prime DNA synthesis where the adjacent strings would stabilize priming. Similarly, L. Kotler et al., Proc. Natl. Acad. Sci. USA, 90, 4241-4.
245, (1993) disclosed sequence specificity in priming DNA sequencing reactions by using hexamer and pentamer oligonucleotide modules. Further, S. Parinov et al., Nucleic Acids Research, 24,
No. 15, 2998-3004, (1996), disclosed the use of base-stacking oligomers for DNA sequencing in combination with a passive DNA sequencing microchip. Further, G. Yershov et al., Proc. Natl. Acad. Sci. USA, 93.
Vol., Pp. 4913-4918 (1996) disclosed the application of base-stacking energy in SBH on passive microchips. In the example of Yershov, 10-
The mer DNA probe was immobilized on the surface of the microchip and hybridized to the target sequence in combination with an additional short probe, which combination appeared to stabilize the binding of the probe. In that manner, short segments of the nucleic acid sequence
Can be elucidated for sequencing. Yershov further noted that in those systems, the destabilizing effect of mismatches was increased using short probes (eg, 5-mers). The use of such short probes in DNA sequencing has the ability to distinguish the presence of a mismatch along the sequence to be probed, rather than just a single mismatch, at one particular location of the probe / target hybridization complex. Offered. The use of longer probes (eg, 8-mer, 10-mer and 13-mer oligos) has been less functional for such purposes.

Further examples of methodologies using base-stacking in the analysis of nucleic acids include La
No. 5,770,365 to Ne et al., which includes a single molecule having a single-stranded loop and a double-stranded region that works in combination with a binding target to stabilize duplex formation by stacking energy. A method for capturing a nucleic acid target using a capture probe is disclosed.

[0023] Despite the knowledge of the base-stacking phenomenon, the results of the aforementioned application did not allow commercially acceptable methods and protocols for either DNA sequencing or detection of SNPs for clinical purposes. . The present inventors have developed such a commercially useful method of making such discrimination in a number of genetic and medical applications by combining the base-stacking rule and the use of an electronically addressable microchip format. Provided in the specification.

SUMMARY OF THE INVENTION A method is provided for the analysis and determination of SNPs in a gene target. In one embodiment of the invention, the SNPs in the target nucleic acid are determined using a single capture site on an electronically addressable microchip (eg, an APEX-type microchip). In this embodiment, both the wild-type and mutant alleles, when present in the sample, are hybridized allele-specific probes labeled with fluorophores that are sensitive to various wavelengths of excitation. At a single capture site. In another embodiment, the base-stacking energy of at least two oligonucleotides is used in combination with an APEX-type bioelectric microchip.

When using base-stacking, the electronic enhancement method using an APEX-type microchip offers several advantages over passive-based hybridization assays. First, electronic addressing under low salt conditions in the presence of stabilizer oligomers inhibits re-hybridization of the amplicon strand in situations where amplification of the target nucleic acid occurs. This eliminates the need for asymmetric amplification or other more complex methods of strand separation. The electronically facilitated method allows multiple different amplicons to be addressed to distinct sites, thereby greatly multiplexing multiple amplicons on multiple patients or open microchips. To promote.

In one embodiment of our system, the amplicon of the target nucleic acid is placed on an electronic microchip capture site (ie, an “amplicon down” format) so that multiple amplicons can be located at the same capture site. Can be fixed to The amplicon can be immobilized on a capture site on a microchip by an attachment site located at the 5 'end of the amplicon. Such an attachment site can be a binding agent, such as biotin incorporated into one of the amplification primers. The immobilized nucleic acids can now be probed simultaneously or sequentially.

For example, in an amplicon down manner, the target nucleic acid is useful in each method for attaching at least one amplification product that is labeled at a site useful for attaching the amplification product to a substrate surface. PCR, SDA well understood in the art using at least one amplification primer oligomer labeled at the site
, NASBA, TMA, rolling circle, T7, T3 or SP6. In one embodiment, a biotin site can be attached at the 5 'end of the primer. Following amplification, the labeled and amplified dsDNA product can be denatured electrically or thermally and can address specific capture sites on the microchip surface, thereby acting as an amplicon as an immobilized capture site . In a preferred embodiment, the labeled amplification product (ie, unlabeled strand)
To the product labeled by the "stabilizer" oligomer, which is input into the process during the electrical bias of the target amplicon labeled at the capture site . The use of "stabilizer oligomers" provided in the present invention differs from the previous base-stacking invention in that the use of a complementary amplicon between two purposes (i.e., electrical addressing of a biotinylated target amplicon). This combined functionality effectively reduces the complexity of SNP determination in a microchip format to prevent annealing and to provide base-stacking energy for interaction with the second oligomer). Is unique in that

The application of a site-specific electronic bias can allow for direct control of the ionic environment of the site of hybridization as well as continuous control of hybridization during or after hybridization. Electronic environment (especially dielectric constant of solution)
Such an operation can be used to directly affect the base-stacking energy between the oligonucleotide and the probe. Moreover, hybridization is greatly accelerated by the concentration achieved during local electronic addressing. Also, such systems are highly flexible in that they can take advantage of both thermal and / or electrical identification after hybridization. In addition, electronic biasing identifies hybridization mismatches that occur in hybridized double terminal nucleic acid pairs as well as occurs internally (eg, due to destabilization caused by base pairing misalignment). Encourages destabilization of mismatches.
This ability to detect mismatches generally means that for the purposes of the present invention, it is desirable that the mismatch occur at the terminal base of the probe, but the SNP on the probe
There are few restrictions on the choice for locating the base. For example, if the stabilizer and reporter probe anneal to the amplicon, the SNP
The relevant base is a SNP such that both the stabilizer and the reporter will be adjacent to one of the terminal bases of the stabilizer that anneals adjacent to each other on the target nucleic acid strand.
Related bases can be incorporated as terminal bases of the reporter probe.

[0029] Sensitivity and robustness can be further enhanced by the further inclusion of yet another probe (ie, an "interfering" probe) designed to be complementary to the unlabeled strand of the amplicon. The use of this probe helps unlabeled amplicon strands that do not want to re-anneal to the labeled strand to compete apart.

In another version of this system, if the stabilizing probe is immobilized (ie, a “capture down” mode), the system is also simple, and multiple amplicons can be located at the same capture site. . These can then be probed simultaneously or sequentially. Generally, but not exclusively, the stabilizer probe will be immobilized on a substrate at its 5 'end. Such an arrangement necessarily provides that the SNP base is complementary to either the stabilizer / capture 3 ′ base or the 5 ′ base of the reporter probe. Conversely, if the 3 'end of the stabilizer / capture is fixed, the SNP base will be complementary to either the 5' base of the stabilizer / capture or the 3 'base of the reporter probe. .

For example, in a capture down mode, the target nucleic acid is first amplified, as by PCR or SDA. The amplified dsDNA product is then denatured and addressed to specific capture sites on the microchip surface with immobilized stabilizer / capture sites. In a preferred embodiment, the strand complementary to the desired amplification product strand is, as described above, by a stabilizer / capture oligomer that functions as a first probe that also participates in base-stacking with a second reporter probe. Maintained from re-annealing to the desired strand. In the amplicon down method, the stabilizer / capture oligomer as provided in the present invention is unique in that it differs from the previous base-stacking invention, so it is functionally for two purposes (ie, target amplicons). Prevents the re-annealing of the complementary amplicon during electronic addressing of the DNA and provides a base-stacking energy site for interaction with the reporter oligomer, thereby reducing the complexity of SNP determination in a microchip format ). As in the target down mode, interfering probes may be used. In addition, multiple amplicons can be probed at any particular capture site.

In yet another format, multiple SNPs in a target sequence can be detected. In this manner, either the amplicon down or capture down modes described above can be used. In this manner, multiple base-stacking can be used to resolve the presence of closely spaced SNPs at a single locus. For example, two S
If the NPs are closely spaced, at least two short reporter oligonucleotides can be base-stacked with a longer stabilizer oligonucleotide. Each reporter can be labeled with a different fluorophore specific for the allele occurring at each site. For example, if the locus has two SNPs that are in close proximity to each other, the reporter probe will incorporate the wild-type and mutant bases at each SNP site and the allele will be present using each containing a different fluorophore. You can decide to do it.

[0033] In yet another embodiment of the invention, SNPs in the target nucleic acid are determined using complex base-stacking energies derived from both the 5 'and 3' ends of a single reporter probe. In this embodiment, the target nucleic acid is amplified such that two spaced amplicons of the target are generated (by PCR and preferably via strand displacement amplification (SDA) techniques). The two amplicons (first and second amplicons) can be from the same locus where the sequence is closely spaced, or can be from divergent or unrelated loci. In either case, both amplicon down and capture down modes can be used. When the capture down mode is used,
Stabilizer / capture is designed as a "cross-link" stabilizer / capture probe so that at least one reporter probe that may or may not contain SNP sequences at one or the other end is "nested" between the amplicons. Capture both amplicons in separate formats, spaced as possible. When using the amplicon down mode, only one of the amplicons is immobilized, using a "cross-linked" stabilizer / capture probe having sequences complementary to the immobilized and unimmobilized amplicons. Hybridize the amplicons in a separate and spaced manner that allows at least one reporter probe to be nested. Where multiple SNPs are associated with such a locus, reporter probes containing more than one SNP can be nested, taking advantage of multiple base-stacking energies.

In the case where the amplicons are from different loci, the amplicons may be immobilized cross-link stabilizer / capture probes or immobilized amplicons and the cross-link stabilizer / capture Any of the probes can be used to bring close proximity to each other. The presence of both amplicon sequences can be detected using a reporter probe designed to nest between the amplicons captured using base-stacking energy to stabilize the reporter hybridization. As in its earlier described manner, the reporter probe can be incorporated at either and / or both the 5 'and 3' end SNPs or the wild type sequence associated with either or both loci. .

In a further embodiment, the region containing the SNP can contain more than one SNP, and the reporter probe has a 3 ′ of any 3 ′ of each reporter corresponding to the SNP.
Alternatively, the first and second amplicons can be nested using more than one reporter probe to have at least one nucleobase on the 5 'end. Thus, such a system possesses either a single base corresponding to either a SNP or wild type at either the 3 'or 5' end or contains such a base at both the 3 'or 5' end. Both the multiple reporter signals from the nesting probe and the multiple base-stacking energies can benefit, thereby increasing the sensitivity.

In another embodiment, the stabilizer oligomer is generally a 20-44-mer, preferably about a 30-mer, but the reporter probe is generally It is 10 to 12-mer, preferably about 11-mer. Such probe lengths are highly effective depending on their use in an electronically addressable microchip format. Reporter probes shorter than the 8-mer are generally not functional in the ionic environment of the current system.

In a preferred embodiment of the present invention, electronically targeted hybridization is utilized in the process. In one embodiment, during the hybridization of the nucleic acid target with the stabilizing probe and / or the reporter probe, electronically stringent conditions are preferably utilized in conjunction with other stringency affecting conditions. It can assist in hybridization. This technique is particularly advantageous for reducing or eliminating staggered hybridization between the probe and target, and for promoting hybridization more effectively. In yet another embodiment, the electronic stringency conditions can be altered during the hybridization complex stability determination to more accurately or more quickly determine if a SNP is present in the target sequence.

Hybridization stability can be affected by a number of factors, including temperature regulation, chemical regulation, and electronic stringency control, alone or in combination with other listed factors. Rapid completion of the step can be achieved through the use of electronic stringency conditions in either or both the target hybridization step or the reporter oligonucleotide stringency step. One distinction of this method is that electronic stringency hybridization of the target is susceptible to double-stranded DNA, resulting in rapid and accurate hybridization of the target to the capture site. It is an aspect. Target DNA
It is desirable to achieve an indexed hybridization of the maximum number of molecules at the test site that contains the correct hybridization complex. For example, using electronic stringency, the initial hybridization step can be completed in 10 minutes or less, more preferably 5 minutes or less, and most preferably 2 minutes or less. Overall, the analysis process can be completed in less than half an hour.

For the detection of hybridization complexes, the complexes are preferably labeled. Typically, determining the hybridization of the probe to be targeted involves detecting the amount of hybridization complex labeled at the test site or a portion thereof. Any mode or mode of detection consisting of the objects and functionality of the present invention can be utilized, such as optical imaging, electronic imaging, charge coupled devices or other methods of quantification. Labeling can be that of a target, capture or reporter. Various labels can be made by fluorescent labeling, dye labeling or chemiluminescent labeling. In yet another alternative, detection may be through energy transfer between molecules in a hybridization complex. In yet another embodiment, the detection can be made via fluorescence perturbation analysis. In another embodiment, the detection may be through a difference in conductivity between matching or mismatched sites.

[0040] In yet another embodiment, the detection can be performed using mass spectrometry. In such a method, no fluorescent label is required. Rather, detection is obtained by direct measurements, for example, very high levels of mass spectrometry by time of flight or electrospray ionization (ESI). Where mass spectrometry is contemplated, reporter probes having nucleic acids of 50 bases or less are preferred.

It is a further subject of the present invention to provide a method that can be effectively provided for gene identification. It is a further object of the present invention to provide systems and methods for the accurate detection of disease states, particularly clonal tumor disease states, neurological disorders and predisposition to genetic diseases.

It is a further subject of the present invention to provide a fast and effective system and method for identification, such as in the application of law and origin. A further subject of the invention is to identify SNPs that can be used in infectious organisms, such as those responsible for antibiotic resistance, or for the identification of particular organisms.

DETAILED DESCRIPTION OF THE INVENTION FIGS. 1A and 1B show a simplified version of an active programmable electronic matrix hybridization system used in the present invention. Generally, substrate 10 supports a matrix or array of electronically addressable microlocations 12. For ease of explanation, the various micro-positions in FIG.
Labeled with 2B, 12C and 12D. The transmission layer 14 is disposed on each of the electrodes 12. The permeable layer allows the transport of relatively small charged entities through it,
It limits the movement of large charged entities, such as DNA, and keeps the large charged entities from easily contacting the electrode 12 directly during the test. The permeable layer 14 reduces the electrochemical degradation that would occur to the DNA, possibly in part, due to direct contact with the electrode 12 due to extreme pH due to the electrolytic reaction. It further functions to minimize strong non-specific adsorption of DNA to the electrodes. An attachment area 16 is disposed on the permeable layer 14 and provides for a specific binding site for the target substance. Attachment areas 16 are each one to accommodate the identification of electrodes 12A-D.
Labeled 6A, 16B, 16C and 16D.

Operationally, the reservoir 18 includes a space above the attachment area 16 containing desired as well as undesired substances for detection, analysis or use. A charged entity 20, such as charged DNA, is located in the reservoir 18. In one embodiment of the present invention, the active programmable matrix system includes a method for transferring a charged substance 20 to a specific microlocation 12. When activated, the microlocation 12 creates free-field electrophoretic transport of any charged entity 20 that can be functionalized for specific binding to the electrode 12. For example, if the electrode 12A is positive and the electrode 12D is negative,
Will run between electrodes 12A and 12D. Electrophoretic force lines 22 cause transport of charged entities 20 having a net negative charge toward positive electrode 12A. The charged substance 20 having a net positive charge is moved negatively under the electrophoretic force on the charged electrode 12D. If the net negatively charged entity 20 functionalized for binding comes into contact with the attachment layer 16A as a result of its migration under electrophoretic force, the specific binding entity 20 functionalized will It will adhere to layer 16A.

Before making a detailed reference to the invention of this patent, a general question of terminology will be mentioned. The term "single nucleic acid polymorphism" (SNP) as used herein refers to a locus that contains a simple sequence motif that is a mutation of that locus.

The “hybridization complex” as in a sandwich assay is
Typically, it comprises at least two of a target nucleic acid, a stabilizer probe and a reporter probe.

An “array” as used herein typically refers to a plurality of test sites, a minimum of two
The above test sites are referred to here, wherein the discrimination between the wild type and the mutant polymorphism can be made for any target sequence at each individual site. A typical number of test sites would be one for each locus to be tested so that heterozygosity or homozygosity for any allele can be identified at each site. The number of loci required for any particular test will vary depending on the application, generally one for genetic disease analysis, one to five for tumor detection, and 6, 8, 9, 13 or more for paternity and forensic science. is there. The physical location of the test sites relative to each other can be in any convenient arrangement, such as on a straight line, or in a row and column arrangement.

[0048] In one embodiment, labeling the hybridization complex and measuring the amount of hybridization comprises detecting the amount of the labeled hybridization complex at the test site. Detection devices and methods can include, but are not limited to, optical imaging, electronic imaging, imaging with a CCD camera, integrated optical imaging and mass spectral analysis. In addition, detection (labeled or unlabeled) is quantified, which can include statistical analysis. The labeled portion of the complex can be a target, stabilizing agent, reporter, or hybridization complex in situ. Labels include, but are not limited to, Cy3, Cy5, Bodipy Texas Red, Bodi
py fur red, Lucifer yellow, Bodipy 630 / 650-
X, Bodipy R6G-X and 5-CR 6G. Labeling can be further achieved by colorimetric, bioluminescent and / or chemiluminescent labels.
The label can further enhance energy transfer between molecules in the hybridization complex, quenching, and electron transport between donor and acceptor molecules by perturbation analysis, the latter of which can be facilitated by the double-stranded match hybridization complex. (Eg, Tom Meade and Faiz Kayyem, Electron Transfer
Through DNA: Site-Specific Modification of Duplex DNA with Ruthenium
Donors and Accepters, Angrew, Chem. Int. Hen England, Volume 34, Issue 3, 3
52-354, 1995). If desired, if the hybridization complex is unlabeled, detection can be achieved by measuring the difference in conductance between double-stranded and non-double-stranded DNA. In addition, direct detection
It can be achieved by porous silicon-based optical interferometry or by mass spectrometry.

Labels can be amplified and can include, for example, branched or dendritic DNA. If the target DNA is purified, it will either not or can be amplified. Further, if the purified target is amplified and the amplification is an exponential method, it can be, for example, PCR amplified DNA or DNA amplified by strand displacement amplification (SDA). DN such as rolling circle or transfer run-off
A linear method of A amplification can also be used.

The target DNA may be from tissue sources including hair, blood, skin, sputum, feces, semen, epidermal cells, endothelial cells, lymphocytes, red blood cells, crime scene evidence. Sources of target DNA include normal tissues, diseased tissues, tumor tissues, plant materials, animal materials, mammals,
Human, bird, fish, microbial, xenobiotic, viral, bacterial, and protozoan materials can be included. Further, the source of the target material can include RNA. Still further, the source of the target material can include mitochondrial DNA.

Base-stacking relies on the interaction of the ring structure of one base with its nearest neighbor base ring. The strength of this interaction is determined empirically and depends on the type of ring involved. Applicants do not intend to be bound by any theory, but among the possible theoretical explanations for this phenomenon are the number of electrons available between the two bases participating in the Pi binding interaction and the number of spirals The efficiency of the combination of different bases that displace water from the interior (thus increasing the entropy). Although the model fits the current data, the possible mechanisms of stacking interaction are not limited to these concepts.

It has also been observed that modifications of the bases involved in base-stacking interactions can enhance Pi binding, or stacking between them. As would be expected from the model, these modifications provide more electrons to be used in the Pi binding and / or increase on the ring surface area, thereby creating a hydrophobic region between the stacked bases. Increase. This system can be modified as predicted by base-stacking theory, which can be used to predict further changes to alter Pi electron behavior, thereby making the mechanism of the present invention closer It is emphasized that it may depend on the nature of the Pi bond between the bases.

In addition to taking advantage of naturally selected base-stacking interactions, base modifications that increase the number of electrons in the ring or expand the hydrophobic region may also discriminate matches from mismatched hybrids. It can be expected that it will increase. In view of such information, the present inventors have developed a new SNP scoring method. It utilizes a combination of electron-mediated nucleic acid transport of amplified targets, passive thermal denaturation of short fluorescent oligoreporters, and base-stacking energy. Sosnowski et al. (Proc. Natl. Acad. Sci.
USA, Vol. 94, pp. 1119-1123, (1997)) have previously described charged D
It shows that NA molecules can be transported, concentrated and hybridized on a microchip by using a controlled electric field. By utilizing active microchips and base-stacking energy, we can effectively target and analyze large numbers of SNPs with high levels of discrimination.

To demonstrate the efficiency of this new technology, we have developed two model systems. The first is based on hereditary hemochromatosis (autosomal recessive disorder), which can lead to cirrhosis, diabetes, hypermelanoma pigmentation of the skin and heart disease. The disease is associated with a G to A nucleotide transition at position 8445 in the HLA-H gene. (Feder et al., J. Biol. Chem.,
272, pp. 14025-14028, 1997). This locus was subsequently renamed HFE. The second assay focuses on the factor V gene. Mutation at position 1,691 (G to A substitution) leads to increased risk of venous thrombosis (Bertina et al., Nature, 369, pp. 64-67,199).
4). The SNP scoring method, which offers both high throughput and cost efficiency, allows the performance of routine tests to detect these and other ill-risk individuals associated with known SNPs before the disease begins Should be. Thus, the utility of SNPs as genetic markers depends, at least in part, on their ability to rapidly provide accurate scoring of SNPs. We have developed a new scoring method that meets these criteria.

With active microarrays, we can miniaturize and accelerate the process of DNA transport and hybridization. In addition, the equipment on which the experiments are performed is automated, which further streamlines the SNP scoring process. Furthermore, the new method offers a significant advance in the fidelity of SNP scoring. We consider hemochromatosis or V-
Each unknown sample tested, regardless of factor, was called exactly. We have also successfully analyzed Factor V SNPs from each chain (FIGS. 8 and 12), which demonstrates the flexibility of the dual fluorescent step base-stacking assay. We can probe either strand, providing the opportunity to produce the most favorable (ie, most energetic) stacking configuration. This ensures optimal identification.

A frequent problem in analyzing SNPs via conventional hybridization assays is that heterozygosity cannot be called with 100% accuracy. The missing one of the two alleles can be serious as a complete misstatement. This problem usually occurs when one of the allele-specific reporters (wild type or mutant) is slightly more thermodynamically stable, which often leads to ambiguous results.

By discriminating reporters based on both base-stacking energy and number of hydrogen bonds, we can substantially normalize and enhance the stability of the correct reporter, thereby Easy distinction between zygotes and heterozygotes is possible. In general, the amplified homozygous samples, such as for hemochromatosis and factor V, had a 15-fold mismatch between matches and mismatches.
This produces a discrimination value that is more than doubled. In the 46 samples analyzed, the poorest discrimination for homozygotes was almost 6.3-fold. On the other hand, heterozygotes produced a ratio of approximately 1: 1 and never produced a ratio greater than 2: 1. Since the discriminating values do not have too much in common between homozygotes and heterozygotes, we may refer to homozygotes as heterozygotes even if the amplification is biased to one strand. (See FIG. 11).

Because each SNP is associated with a specific and important disease, we have:
First, the hemochromatosis and factor V to be analyzed were selected. (Feder
Bertina et al., 1994; supra) Furthermore, both conditions are relatively dominant in society. Recent reports of AACC bulletin suggest that hemochromatosis may be more dominant than previously thought (American Association for Clinical Chemistry Inc. Clinical Laboratory
News, Vol. 25, No. 2, p. 16, February 1996). Therefore, the use of early genetic testing methods for those at risk for these two diseases should be an important tool in determining who is heterozygous or homozygous for the mutant allele. It is. This allows for early treatment, thereby improving quality of life.

The present inventors have shown that SNP discrimination in a dual fluorescent base-stacking mode works on two different genes. In addition, we have determined that the method should work with a universal approach in that each possible mismatch for the reporter probe and target for the stabilizer probe can be identified (Table 2).
reference). As shown, each combination has a strong discriminating value except for one combination. One example showing a weak discriminant value (2.97) is of little importance.
This is because the opposite chain combination can be replaced in a real test case.

In general, the present invention is best described in combination with FIG. First, a sample containing a population of nucleic acids representing one or both of the wild-type and mutant alleles is amplified with two primers, one being biotinylated (ie, amplicon down mode). Following salt removal, the amplification product 31 with its biotinylation site and the complementary strand 32 are diluted 1: 2 at a final concentration of 50 mM histidine. Also,
This solution also contains 1 μM stabilizer oligomer 33. Stabilizer oligomer 3
3 is generally a 30-mer that is 100% complementary to both wild-type and mutant alleles. This stabilizer is directly adjacent to the polymorphic site of the target amplicon so that when a perfectly matched mutant reporter 34 or wild type 35 is added to the system, base-stacking is present.

Following the introduction of the stabilizer, the reaction solution is heated to 95 ° C. for 5 minutes to denature the amplicon. Then, after cooling, the sample is electronically biased to the selected capture site on the APEX-type microchip. After biasing, the biotinylated amplicon chain 31 is attached to the microchip capture site via a biotin / streptavidin interaction with the permeable layer of the microchip. The 30-mer stabilizer oligomer 33 is hybridized to the amplicon chain 31 via a hydrogen bond.

Because of the relatively high concentration of stabilizer 33, the 30-mer stabilizer 33 effectively blocks the binding of the fully complementary non-biotinylated amplicon strand 32. (The stabilizer is at 1 μM concentration, while amplicons are generally at 500 pM and 5 nM
M).

Once a different amplicon has been electronically biased to its respective capture site (as in a multiplex assay), reporting (using oligomers, which are generally labeled probes) is performed. Both reporter (each 50mM NaPO ₄ / 500mM NaCl (high salt buffer) in 1μM wild-type 35 and mutant 34 to 9 to either terminal base (3 'or 5' (or both)) 11 (Corresponding to either mutant or wild-type bases that are identical with respect to bases) can be incubated on a microchip for 3-5 minutes. Following incubation of the reporter probe 34 and 35, in 50 mM NaPO 4 _(low salt buffer), by heating the microchip from the melting temperature of perfectly matched reporter / amplicon less than about 4 ° C., identified achieved Is done. Imaging is then performed using two different lasers, one corresponding to the fluorophore on the wild-type reporter and one corresponding to the fluorophore on the mutant reporter. The background is subtracted from the intensity of these signals, and the specific activity is taken into account. The ratio of wild-type signal to mutant signal is obtained, and the allelic composition of the amplicon product is determined therefrom.

Example I a. Assay for Single-Nucleotide Polymorphism Discrimination SNP scoring on an active matrix chip was achieved as exemplified by the method shown in FIG. The target was amplified with one biotinylated primer. High concentrations of the 30-mer stabilizer oligo were added to the denatured amplicon, and the mixture was electronically addressed to the capture site of interest on the array. This process was performed in as little as 2 minutes, as the DNA could be rapidly concentrated and hybridized. The stabilizer oligomer was complementary to the biotinylated amplicon chain. (The strand is probed). First, the stabilizer prevents re-hybridization of the complementary target amplicon strand, thereby allowing the two allele-specific fluorescently labeled reporter oligos to gain access to the biotinylated strand. Second, with the reporter oligo, it provided base-stacking energy.

The stabilizer oligo was designed so that its 5′-end was in contact with the polymorphism of interest.
Reporter oligos (one perfectly complementary to the wild-type allele and one completely complementary to the mutant allele) were designed such that their 3'-end contained a polymorphism. Was done. When the stabilizer and reporter oligomer perfectly matched the target in a side-by-side hybridizing manner, a strong base-stacking energy phenomenon was realized. In this system, the reporter is 11 bp in length,
This provided excellent base-stacking discrimination signals between perfect matches and SNP mismatches, despite the results disclosed by the prior art researchers described above. In essence, the mismatched reporter has one less nucleotide hydrogen bonded to its complement than the matched reporter. Under stringent identification conditions, a perfectly matched reporter will remain bound to its complementary pair. On the other hand, a mismatched reporter dissociates easily.

In situations where the region of the target amplicon to be probed is closer to the 5 ′ end of the amplicon, the stabilizer may be designed to anneal to the amplicon at a position closer to the 3 ′ end of the amplicon. And thereby the 3 'of the stabilizer
The end is bound to the polymorphism and the 5'-end of the reporter needs to contain the polymorphism.

B. Stabilizer oligos enhance SNP discrimination by conferring base-stacking energy. In order to examine the importance of using stabilizer oligomers in this SNP scoring method, five unknown Vs in the presence or absence of a stabilizer probe were tested.
The factor samples were analyzed. After electronically addressing the denatured target nucleic acid, the microchip was washed with 0.5 × SSC, pH 12, to remove any rehybridized complementary strand. The stabilizer oligo was then electronically biased at different time intervals to the capture site and its level was measured.

The wild type and mutant reporters coupled to different fluorophores were then passively hybridized to the target: stabilizer complex. Following this, stringent discrimination was achieved by increasing the temperature of the low salt wash buffer. The fluorescent signal was then measured at the two appropriate wavelengths to detect wild type and mutant reporters. FIG. 8 shows the results of this experiment. The identification values are listed in Table 1.

[0069]

[Table 1]

(All discriminating values are reported as wild-type signal intensities relative to mutant signal intensities). The importance of the stabilizer oligo can be most clearly demonstrated in sample C (Factor V heterozygote). Row 5, which did not receive the stabilizing agent, shows a clear mutant signal but substantially no wild-type signal. The identification value is roughly 3.3: 1 (
(Mutant to wild type). Compared to the wild-type samples (D and E), the discriminating values in the absence of stabilizer were almost identical (3.5: 1 and 3.7: 1 (wild-type versus mutant pair), respectively). Yes, this makes it substantially impossible to distinguish factor V heterozygotes from wild type. In contrast, sample C complexed with most of the stabilizer oligos (row 4) is a clear heterozygote (
1: 1.5) (mutant to wild type)), while samples D and E were clearly wild type (13.9: 1 and 12.9: 1, respectively).

These results show that the base provided by the contact of the stabilizer and the reporter-
FIG. 4 shows that stacking energy can be used to enhance the discrimination of perfectly matched and mismatched reporter oligos with as few as one base pair. Furthermore, the results indicate that mismatches involving more than one base pair (ie, at either end of the reporter) would be equally distinguishable.

Also, increased stabilization for perfectly matched conjugates can be shown at the increased signal intensity of samples receiving more stabilizer oligo. (Factor V mutant samples A and B, row 1 (least stabilizer) and row 4 (most stabilizer) (Figure 8) were compared). The discrimination value (Table 1) in the presence of the stabilizer is excellent. The allelic organization of all five unknown Factor V samples is not ambiguous in homozygous mutants A and B, heterozygous C, and homozygous wild-type D and E . All results were independently confirmed by allele-specific amplification.

To clearly show that base-stacking energies give enhanced discriminating values, stabilizing oligomers for hemochromatosis were designed such that a 1 bp or 10 bp gap exists between the stabilizing agent and the reporter. did. These stabilizers were compared to a standard hemochromatosis directly in contact with the reporter. In this experiment, the stabilizer oligomer and the sample, specifically the hemochromatosis wild-type, were simultaneously biased to the dual capture site. FIG. 9 shows the results. In the absence of stabilizer (row 1), the signal of the initial wild-type reporter is substantially reduced. The rows that received the standard stabilizer (row 2), the stabilizer down to a 1 bp gap (row 4) and the stabilizer down to a 10 bp gap (row 5) all had comparable initial signals. However, upon thermal discrimination, only the wild-type reporter of the capture site biased with the standard stabilizer remains, indicating that the base-stacking energy stabilizes the shorter reporter.

C. The stabilizer oligo prevents re-hybridization of the complementary nucleic acid strand. The difficulty in directing one strand of the amplification product to a specific capture site of interest after denaturation is that under most conditions the complementary strand anneals back to its cognate partner. In an attempt to circumvent this problem, a stabilizer oligomer was included with the amplification product during electronic addressing.

[0075] Various concentrations of the hemochromatosis stabilizer oligomer were combined with the wild-type hemochromatosis amplification product sample. These samples were compared to the same wild-type hemochromatosis sample without stabilizer oligomers or non-complementary nucleic acids. After the initial bias, the capture sites addressed without stabilizer were then readdressed with saturating levels of stabilizer. Capture sites initially targeted with amplicon + stabilizer were addressed electronically with buffer solution only. Reporter hybridization was performed, followed by stringent washing. The final result is shown in FIG.

In each case, a high level of discrimination was achieved. All permutations had a wild-type to mutant ratio greater than 5-fold. However, the signal at the capture site where the stabilizer was applied simultaneously with the amplification product was quite crude. This suggests that the stabilizing agent bound to the biotinylated amplicon strand and prevented the opposite amplified strand from re-hybridizing. This result is somewhat surprising. Because the amplification product hybrid (229-mer) is a stabilizer hybrid (30-mer)
Because it was predicted to be much more stable than that. At equimolar ratios (approximately 1 nM), hybridization with complementary amplicon strands will eliminate bound stabilizers and block the reporter oligo from binding to the biotinylated strand. However, at the higher molar ratios and electronic conditions used in this assay, the stabilizer competes with one strand of the amplicon. This result is also confirmed by the data in FIG. The preliminary discriminating signal (initial) is substantially higher in the presence of the complementary stabilizer oligo, even the gap between the stabilizer and the reporter (rows 2, 4, and 5 vs. row 1). Compared).

D. Analysis of Unknown Hemochromatosis Samples The use of SNPs as genetic markers requires that their presence in a sample be accurately and rapidly determined via a high-throughput system. By rapidly enriching and hybridizing nucleic acids using an electric field, we can achieve discrimination results very effectively. The accuracy of this SNP scoring method is shown in the following experiment.

[0078] Sixteen unknown hemochromatosis samples were amplified. Each was electronically targeted to one capture site of a 25-site array, along with a stabilizer oligo. After passively hybridizing both wild-type and mutant hemochromatosis reporter oligos to the amplified sample: stabilizer complex, stringent wash conditions were applied. The results, shown in histogram format, are listed in FIG.

It is clear that three of the unknown samples 1, 7 and 12 were heterozygous, assuming that the heterozygotes had a wild-type signal to mutant signal of approximately 1: 1. . Our criterion for calling homozygotes is that it should have at least 5 times greater signal remaining from a perfectly matched reporter than a mismatched reporter. According to this criterion, samples 3, 4
, 8, 9, 11, 13 and 16 are referred to as hemochromatosis wild type, and sample 2,
It is easy to refer to 5, 6, 10, 14 and 15 as hemochromatosis mutants. In fact, only sample 16 (approximately 6.3 times) had a discriminating value of less than 15 times. All results were independently confirmed by restriction analysis, followed by gel electrophoresis. By identifying SNPs using electro-stacking energy, we were able to correctly call the 37/37 hemochromatosis sample and the 9/9 factor V unknown.

E. Analysis of Hemochromatosis and Factor V Samples at a Single Capture Site In another embodiment of the present invention, by electronically targeting more than one amplicon product to a single capture site, Increase through foot for multiplex analysis. This increases the speed of the assay as well as the information yield of the microarray.

After amplification, we mixed together the known hemochromatosis and factor V samples and their respective stabilizer oligos. Two such combinations were tested in quadruplicate. One contained hemochromatosis wild-type and a factor V mutant (FIG. 12, lanes 1 and 2). Others include hemochromatosis and V
It contained the factor heterozygote (FIG. 12, lanes 4 and 5). Reporting and stringent washes were first performed on a hemochromatosis reporter, and then the process was repeated with a Factor V reporter. In each case, the results were as expected and scoring was easy. Since both sets of reporters contained the same fluorophore, this successful multiplexing required complete removal of all bound hemochromatosis reporters prior to the addition of the Factor V reporter. Note the total lack of signal on the array after stripping, which was achieved by increasing the temperature in a low salt buffer.

The reason that thermal discrimination was achieved at a much higher temperature for Factor V than previously shown (43 ° C. vs. 38 ° C. in FIG. 12) is due to the opposite strand being questioned. It was that. In this case, the Factor V reporter was fairly rich in GC and thus was quite thermally stable. By analyzing two PCR amplicons at a single capture site, we were able to effectively double our throughput per unit time and per chip.

F. Universality of Base-Stacked SNP Scoring Method The present inventors have successfully shown that a SNP scoring method utilizing a reporter stabilized by electronic bias and base-stacking energy is indeed feasible. In addition to the examples shown for hemochromatosis and factor V, we show that this assay can be universally applied to identify any SNP. Specifically, we designed a set of oligos around the hemochromatosis polymorphism so that each possible base-stacking combination could be analyzed. The results from these experiments are summarized in Table 2.

[0084]

[Table 2]

[0085] ^a reporter nucleotide represents the 5'-end of the reporter oligos. ^b Stabilizer nucleotides represent the 3'-end of the stabilizer oligo, ^c nucleotides represent mismatched nucleotides on the target sequence. For example,
If the reporter is A, the match on the target nucleic acid is T and the mismatches are A, C, and G. ^{The d} value is the fold discrimination between the matched target nucleic acid and the named mismatch.

In all but one case, the discrimination between matches and mismatches was greater than 5-fold, and in most cases it was greater than 20-fold. This indicates that it is easy to distinguish homozygous wild type from homozygous mutant from heterozygous for any possible SNP, independent of polymorphism.

One example where this assay resulted in poor discrimination (only 2.8-fold) was to be expected. Base-stacking is 3'- (stabilizer oligo) in contact with 5'-A (reporter oligo), which is the weakest of all base-stacking interactions (R. Sinden, DNA Structure and Function, Academ
ic Press, Inc. 1994). In addition, the mismatch on the target DNA was G (nucleotide known to form a weak bond with the opposite A). The non-optimal discrimination achieved here could easily be overcome by detecting the opposite amplicon strand.

Example II In addition to the amplicon second down mode described in FIG. 2, a second mode is useful where the stabilizer is tethered to a specified capture site (ie, capture down Style). As shown in FIG. 3, amplicon chains 90 and 91 are denatured,
It can be combined with biotin-labeled stabilizer Oligo 92. In addition, further enhancement of the signal was designed to be complementary to the unwanted amplicon strand.
Interference "oligomer 93 can be derived.

Following addressing of the hybridization complex to the capture site, uncard stabilizers annealed to the target allele strands 90 and 90 ′ were combined with a reporter oligo specific for wild type and mutant. Probe. In the drawing, only one reporter remaining after identification is shown. Thus, as shown in FIG.
Samples are homozygous for one allele.

This format has been used successfully for the detection of hemochromatosis, factor V, and EH1 mutations. In a preferred manner, amplicon addressing occurs after denaturation. Adding a specific interfering oligonucleotide to the protocol at the time of addressing to the capture site to prevent re-annealing of the amplicon with its complementary strand at the capture site and favor hybridization to the stabilizing probe Can be. The oligonucleotide is designed to be complementary to the unwanted amplicon strand, which should be present in molar excess. It should be designed to hybridize to regions outside the stabilizer / reporter complementarity region. As such, it will not interfere with the hybridization of the stabilizing agent or reporter oligonucleotide to the desired amplicon. Rather, it serves to "hold the amplicon open", which prevents re-annealing of the amplicon with its complement. The interfering oligonucleotide is 5 'to the base-stacked complex or 3
'Can be put on the side.

Example III FIG. 4 shows that multiple SNP-containing reporter probes can be used together with each other for multiple base-
Describe the manner in which the stacking energy is provided. FIG. 4a shows the capture down mode, while FIG. 4b shows the amplicon down mode. In FIG. 4a, amplicon 42 is stabilized with a stabilizing agent 41 linked to a capture site via a biotin site 40, and the two reporter probes 43 and 44 have at least two SNs.
Hybridized to detect the presence of P. FIG. 4b shows an amplicon 45
Is biotin-labeled 40 ′, and the stabilizer 46 is connected to the capture site without labeling.

This format is useful when there are multiple closely spaced SNPs at a single locus. An example of this is the mannose binding protein locus associated with susceptibility to sepsis in leukopenic patients. In this case, there are four SNPs spaced within 15 bases of each other. Another example is the human HLA locus, where there are a number of natural variants scattered within three exons. In this manner, the reporter probe can be base-stacked against the stabilizer oligo, and each of the reporters can be labeled with a different fluorophore specific for the allele occurring at these sites.

Example IV FIG. 5 shows a nested format in which one can amplify a target nucleic acid using standard primers, one of which can be labeled (eg, 52) for application in an amplicon down format. . As shown, amplicons 50 'and 51
'Is denatured and mixed with a stabilizing agent (and interfering oligos, if desired) to obtain a stabilizing agent: amplicon hybridization complex (50 ″ / 56/51).
''). The complex is then addressed to a specific capture site, followed by the 5
The stabilizing interaction at both 'and 3' ends introduces a reporter probe 58 that favors base-stacking energy. Although only the amplicon down mode is described, nested base-stacking can also be performed using the capture down mode.

This nested method is useful when there are multiple SNPs at a single locus as described in Example III, as well as in situations where it is desired to detect SNPs from distant loci. In addition, this method is functional when it is desired to detect the presence of different and genetically unrelated amplicons whose co-identification can provide useful information. Such information can be defined as "target-specific nucleic acid information" that provides some identification of the properties of the target sequence. For example, a first region of a target nucleic acid can provide an amplicon that is used to identify the source of the nucleic acid (eg, Stapahylococcus vs. E. coli). The second amplicon can be used to identify a particular property, such as antibiotic resistance (eg, methicillin resistance). Nesting of the reporter using base-stacking energy to stabilize its hybridization indicates that both amplicons are present in the sample.

The nesting reporter can provide that the SNPs, in addition, provide additional data associated with one or the other or both of the amplicon-generated loci. An example of this is the identification of bacteria by polymorphisms in conserved gene sequences such as 16S rDNA or dilase a sequences. In each one of these amplicons, there will not be enough genetic diversity to uniquely identify all species or subspecies. Thus, the use of a second independent locus can provide essential data. For example, while dilase A is useful alone, discrimination between closely related bacterial strains can be greatly increased by including polymorphisms at dilase B or at the equivalent C locus.

The unique feature of the nested method is that the reporter probe has its 5 ′ and 3
'The ability to incorporate SNPs or other specific bases at both ends. Thus, the internal base of the reporter oligo can be designed to incorporate a unique sequence complementary to the internal base position of the stabilizer, while the terminal base of the reporter is a base specific to the stabilizer, SNP Or other bases at different loci.

FIG. 6 shows a further embodiment of the nested method, in which a plurality of reporters 63
Can be nested to detect multiple SNPs that can be associated with any of the amplicons 60 and 62, 65 or 66. For a single reporter nesting, both amplicon down and capture down modes can be applied.

FIG. 7 further illustrates a variation of the nested method, wherein the amplification of the target is SDA
This is performed using In this situation, the ends of the amplicon hybridized to the stabilizing agent do not represent the target-specific sequence because the amplification primer incorporates a nucleic acid sequence involved in the amplification process (ie, a restriction endonuclease sequence). This creates the need to design stabilizer oligos so that the SDA primer sequence is in contact with the nesting reporter probe. Specifically, primers 70 and 71 specific for target locus 74 and primers 72 and 73 for target locus 75 each contain the necessary restriction sites (eg, Bso B1). Upon amplification, amplicons 74 'and 75' respectively contain primer sequences 76, 7
7, 81 and 82. Within these flanking sequences can be located specific SNPs containing sequences of interest 78, 79, 83 and 84, which flanking target specific sequences 80 and 85 in close proximity. This arrangement requires that the stabilizer oligo be designed to incorporate each of the sequences and hybridize both the amplicon and the stabilizer to the complex. This in addition means that the stabilizer incorporates SNP-sensitive sequences rather than reporter oligos. Although the capture down mode has been shown, the amplicon mode is equally applicable.

Following anchoring of the complex, the reporter probe 87 is hybridized to the complex in a nested manner. In this situation, the reporter can be designed to be stabilized, where there is no mismatch between the stabilizer and the amplicon. In contrast, if a mismatch is present, hybridization between the stabilizer and the amplicon will necessarily be in a "bubble" fashion, which is necessary so that such mismatches do not hybridize the reporter. To provide a stable destabilization.

In each of the foregoing examples, a base-stacking scheme is provided that achieves discrimination by breaking the long region of hybridization into two or more sequences. This method allows for the identification of specific nucleic acid sequences from relatively short probes.
The fact that short probes are used offers the opportunity to use detection mechanisms that are sensitive to both passive and electronic hybridization techniques. further,
The use of short probes offers the opportunity to use a detection mechanism based solely on the mass of the probe (ie, mass spectral analysis), where extremely high levels of mass resolution are obtained by direct measurement (eg, by flight or ESI). Achieved. In such cases, reporter molecules having a length of 50 bases or less are preferred.
Detection using mass spectrometry could be performed by separating the probe from the hybridization complex and transferring it to a mass spectrometer detector.

While the foregoing invention has been described in some detail by way of illustration and presentation for purposes of clarity and understanding, without departing from the spirit or scope of the appended claims,
It will be apparent to those skilled in the art that certain modifications and variations can be made in light of the present teachings.

[Sequence list]

[Brief description of the drawings]

FIG. 1A is a cross-sectional view of one embodiment of a useful active matrix device according to the method of the present invention.

FIG. 1B is a perspective view of an active array device useful in the method of the present invention.

FIG. 2 shows that the target SN amplicon population is scored by a dual fluorescent base-stacking mode containing wild-type and / or mutant alleles.
It is a typical typical example of one specific example of the method of P. In this manner, one of the target strands is anchored at the capture site ("amplicon down" mode). As shown, wild-type and mutant alleles can be probed at a single capture site. If the target contains both alleles (ie, heterozygotes), a reporter probe corresponding to each allele will be detected. If only one allele is present (ie, homozygous), only one reporter probe will be detected. The figure depicts the detection of a homozygous population.

FIG. 3 shows one embodiment of an electronic SNP method in which the stabilizing probe is scored by a dual fluorescent base-stacking mode immobilized at the capture site (“capture down” mode). This is a representative example. Further, this figure shows that the use of interfering probes competes with unwanted amplicon strands. As shown in FIG. 2, wild-type and mutant alleles can be detected.

FIGS. 4A and 4B illustrate one embodiment of a method that utilizes the base-stacking energy of multiple reporter probes. FIG. 4A shows a capture down mode, while FIG. 4B shows an amplicon down mode. This multiple base-stacking approach is applicable where the target possesses closely spaced SNPs.

FIG. 5 depicts one embodiment of the present invention in which base-stacking energy is provided by nesting a reporter probe between two target amplicons. In this example, the stabilizer probe has a nucleobase sequence that is complementary to both target amplicons. The figure describes the amplicon down mode, but capture down is equally applicable. Stabilization of the reporter probe in a nested fashion indicates the presence of both target species and / or any SNPs integrated at or at the 5 'or 3' end of the reporter probe.

FIG. 6 shows that the nested embodiment shown in FIG. 5 can utilize multiple base-stacking energies of multiple reporter probes, each of which contains a SNP. As in other formats, both amplicon and capture down formats are useful.

FIG. 7 shows a nested format in which amplification is performed using SDA. In this embodiment, the end point of the amplicon always possesses the sequence associated with the primer used in SDA, including an endonuclease restriction site. In this embodiment, the SNP may be in the reporter terminus or in an amplicon sequence immediately internal to the SDA primer sequence. In either case, the mismatch can be detected by destabilizing the hybridization of the reporter probe due to a mismatch in the reporter itself or a mismatch in the amplicon sequence. In addition, amplicons generated using SDA can use either amplicons or a capture down mode (indicating capture down) and can use multiple reporter stacking.

FIGS. 8A and 8B relate to the same microchip capture site using reporter probes corresponding to wild type and mutant alleles labeled with two different wavelength sensitive fluorophores. 4 is a photograph showing a hybridization result. The results show that homozygous mutants, wild-type and heterozygous homozygotes are clearly detectable. In particular, the importance of stabilizer oligomers for scoring Factor V SNPs is shown. Five unknown Factor V samples (labeled A through E
) Was amplified using primers SEQ ID NO: 1 (biotin-TGTTATCACACTGGTGCTAA) and SEQ ID NO: 2 (ACTACAGTGACGTGGACATC). The amplification product is then 2
Using 400 nanoamps / site of DC current per minute, the four capture sites (row 1,
2, 4 and 5) were targeted electronically. Row 3 was a mock target and served as a background control. The array was then treated with 0.5 × SSC, pH 12, for 5 minutes to denature any rehybridized amplification products. Next, 125nM Vth
SEQ ID NO: 3 of the factor stabilizer oligo (TAATCTGTAAGAGCAGATCCCTGGACAGGC)
All capture sites in row 1 were electronically biased for 15 seconds, 30 seconds in row 2 and 60 seconds in row 4 using a direct current of 0 nanoamps / site. In row 5, the buffer alone was biased for 60 seconds. Final identification of the allele-specific reporter for each capture site was achieved at 32 ° C. in our low salt buffer. The reporter oligomer is SEQ ID NO: 4 (GAGGAATACAG) of the CR6G-labeled wild-type reporter.
-CR6G) and the far-infrared labeled mutant reporter SEQ ID NO: 5 (AAGGAA
TACAG-far infrared). The results show that samples A and B are homozygous for the mutant, sample C is heterozygous for the mutant and wild type, and D and E
Indicates homozygous for the wild type.

FIG. 9 is a photograph showing that base-stacking energy stabilizes an oligo reporter. The wild-type hemochromatosis sample is SEQ ID NO: 6 (biotin-T
GAAGGATAAGCAGCCAAT) and SEQ ID NO: 7 (CTCCTCTCAACCCCCAATA). The amplified samples were then (i) without stabilizer oligo (row 1); (ii)
1) lμM of a standard hemochromatosis stabilizer oligomer, in which case the stabilizer is SEQ ID NO: 8 of the reporter probe (lane 2) (iii) SEQ ID NO of the stabilizer and reporter probe (lane 4) 9 (GGGCTGATCCAGGCCTGGGTGCTC
CACCTG), a stabilizer oligomer that hybridizes to target at a single base gap between; or (iv) and the sequence of the stabilizer oligomer that creates a 10 base pair gap between itself and the reporter (lane 5) Number 10 (CACAATGAGGGG
CTGATCCAGGCCTGGGTG). The obtained sample was “+” for 38 milliseconds.
And 10 milliseconds "-" were biased simultaneously to the two capture sites using a biased modified current protocol using 700 nanoamps / site. Row 3 was a mock target and served as a background control. Wild type reporter
After passive reporting with the oligomer SEQ ID NO: 11 (CACGTATATCT-CR6G), temperature discrimination of the reporter probe was achieved at 32 ° C. in our low salt buffer. The images represent only the wild-type reporter both before (initial signal) and after heat denaturation (after discrimination). Stable hybridization was achieved only in situations where the stabilizer and reporter probe were adjacent. Identical results can be obtained with the mutant (data not shown).

FIG. 10 shows the impact of stabilizer oligo on signal intensity. The amplified wild-type hemochromatosis sample was prepared at three concentrations (10 nM, 100 nM and 1 nM).
μM), mixed with standard 30-mer stabilizer oligo (SEQ ID NO: 8), non-complementary random DNA (six different 20-mer to 24-mer oligos) or no DNA (water) Was. Each combination is 38 ms "+" and 10 ms "-"
Using a biased modified current protocol of 800 nanoamps / site
Duplicate capture sites were biased for minutes. No DNA or random DNA
Capture sites that were subsequently subjected to either were subsequently biased for 1 minute with 125 nM of stabilizing oligo, while capture sites that had already received stabilizer were biased for 1 minute with buffer alone. . The histogram represents the signal intensity of both the wild type (SEQ ID NO: 11) and the mutant (SEQ ID NO: 12, TACGTATATCT-far infrared) reporters achieved at 28 ° C. after discrimination. Background from capture sites addressed without DNA was subtracted.

FIG. 11 is a chart showing that the allele content of an unknown hemochromatosis sample can be readily determined. Sixteen amplified unknown hemochromatosis samples were tested with 1 μM hemochromatosis stabilizer oligo (SEQ ID NO: 8). Samples and stabilizers electronically targeted individual capture sites on the 25-site microarray. 700 for 38 ms "+" and 10 ms "-"
A bias was applied for 4 minutes with a changing current of nanoamps / site. Following passive reporting of two allele-specific reporters (ie, wild-type SEQ ID NO: 11 or mutant SEQ ID NO: 12), temperature discrimination was achieved at 29 ° C. Histogram is average fluorescence intensity-background (signal intensity from simulated target site)
Represents The results show that Samples 1, 7, and 12 are heterozygous and Samples 3, 4, 8,
9, 11, 13 and 16 are homozygotes for wild type,
, 6, 10, 14 and 15 indicate homozygosity for the mutant.

FIG. 12 is a photograph showing multiplex analysis of hemochromatosis and factor V.
In this figure, the results for Factor V were derived from the use of the opposite strand to the results shown in FIG. Two known hemochromatosis and factor V samples were each individually amplified. In this case, the factor V sample contains primers SEQ ID NO: 13 (biotin-ACTACAGTGACGTGGACATC) and SEQ ID NO: 14 (TGTTATCACA
CTGGTGCTAA). The amplification products were then converted to their 30-mer stabilizer oligos (ie, SEQ ID NO: 8 and SEQ ID NO: 15 (TTACTTCAAGGACAAAAT
ACCTGTATTCCT))). Each mixture was electronically biased for 4 minutes in quadruplicate using a biased modified current of 700 nanoamps / site for 38 ms "+" and 10 ms "-". Columns 1 and 2
Capture sites have received hemochromatosis wild-type and factor V mutants, whereas the sites in rows 4 and 5 were targeted at both hemochromatosis and factor V heterozygotes. Row 3 was the background control. Reporting is done sequentially,
First, the allele-specific hemochromatosis reporter (SEQ ID NOS: 11 and 12), and then the allele-specific factor V reporter, SEQ ID NO: 16 (CGCC
TGTCCAG-CR6G) and SEQ ID NO: 17 (TGCCTGTCCAG-far infrared). Before the Factor V reporter was passively hybridized, all remaining hemochromatosis reporters were stripped from the microarray. In this experiment, temperature discrimination in low salt buffer was achieved at 28 ° C for hemochromatosis and 43 ° C for Factor V. Stripping is performed in our low salt buffer at 5%.
Performed at 5 ° C. The images show the fluorescent signals from both wild-type and mutant reporters after heat discrimination.

[Procedure amendment]

[Submission date] November 5, 2001 (2001.1.5)

[Procedure amendment 1]

[Document name to be amended] Drawing

[Correction target item name] All figures

[Correction method] Change

[Contents of correction]

FIG. 1A

FIG. 1B

FIG. 2

FIG. 3

FIG. 4

FIG. 5

FIG. 6

FIG. 7

FIG. 8

FIG. 9

FIG. 10

FIG. 11

FIG.

──────────────────────────────────────────────────続 き Continuation of front page (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE ), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID , IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, (72) Invention NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, UZ, VN, YU, ZA, ZW Inventor Ray Earl Ratchie, USA 92120 Carsage Street 6859 (72) San Diego, California James P. O'Connell USA 92075 Solana Beach, Solana Point Circle 166 (72) Inventor Lyn Wan United States 92129 Isocoma Street 13946 (72) San Diego, California Ronald G. Sosnowski United States 92118 Of California State co-Ronado, Adela Avenue 1013 No. F-term (reference) 4B024 AA11 AA20 CA09 HA12 HA19 4B063 QA12 QA13 QA19 QQ01 QQ42 QR08 QR32 QR42 QR55 QR62 QR66 QR84 QS24 QS25 QS34 QS36 QX04

Claims (34)

[Claims] 1. A method for determining a single nucleic acid polymorphism in a target nucleic acid of interest using a base-stacking energy and an electronically addressable microchip, comprising: a. Subjected to an amplification reaction using either at least one amplification primer for linear amplification or at least one pair of amplification primers for exponential amplification,
Alternatively, providing a target nucleic acid of interest unapplied to form an amplification product of said target; b. In the presence of a first set of "stabilizer" oligonucleotides that are complementary to at least one nucleic acid strand of the target nucleic acid or the amplification product, the target nucleic acid or the amplification product Electronically addressing one of the capture sites to further form a hybridized complex of the stabilizer oligonucleotide and a target or amplification product strand to which the stabilizer oligonucleotide is complementary; c. Capturing the hybridized complex at the capture site; d. A second set of "reporter" oligonucleotides, wherein the stabilizer is complementary to the same strand of the target nucleic acid or amplification product to which it is complementary, is hybridized to the complex to form a tertiary structure and the reporter An oligonucleotide is further hybridized to the complex such that the stabilizer and the reporter oligonucleotide anneal to the target nucleic acid or amplification product at positions adjacent to each other; e. If there is at least one base pair mismatch between the reporter and the target nucleic acid or amplification product, the tertiary structure is subjected to destabilizing conditions sufficient to cause the reporter to separate from the tertiary structure; f. Detecting the loss or retention of the reporter from the capture site. 2. The method according to claim 1, wherein the amplification reaction is performed using an amplification method selected from the group consisting of PCR, SDA, NASBA, TMA, rolling circle, T7, T3 and SP6. Method. 3. The method of claim 1, wherein the interfering oligonucleotide is included in step (b) of claim 1, wherein the interfering oligonucleotide is the same strand on which the stabilizing oligonucleotide is complementary. The method has a sequence complementary to the target nucleic acid or the amplification product strand that is not. 4. The method according to claim 1, wherein at least one primer used in the amplification reaction is biotinylated. 5. The method according to claim 4, wherein the amplicon chain derived from the biotinylated primer is fixed to the capture site in step (c) of claim 1 by the biotinylated site. the method of. 6. The method of claim 1, wherein said stabilizing oligonucleotide is biotinylated. 7. The method of claim 6, wherein said biotinylated stabilizer oligonucleotide is immobilized at said capture site during a process by its biotin site. 8. The method of claim 1, wherein said reporter oligonucleotide is labeled with a label selected from the group consisting of a fluorescein derivative, a bodipy derivative, a rhodamine derivative and a Cy dye. Method. 9. The method of claim 1, wherein the destabilizing condition comprises: providing an electrical bias;
The method of claim 1, wherein the method results from a method selected from the group consisting of performing ionic strength adjustment and adjusting pH. 10. The method according to claim 10, wherein said reporter oligonucleotides have their 3 ', 5'
2. The method according to claim 1, wherein the 3 ′ and 5 ′ terminal bases have nucleobases complementary to either a wild-type base or a mutant base found in the target nucleic acid. 11. The method of claim 1, wherein a plurality of said target nucleic acids or amplification products forming said complex are electronically biased to a single capture site. 12. A method for determining a single nucleic acid polymorphism in a target nucleic acid of interest using a base-stacking energy and an electronically addressable microchip, comprising: a. Using at least one amplification primer for linear amplification or at least one pair of amplification primers for exponential amplification for each of the regions, the two intervals of the target nucleic acid of interest, which may or may not be subjected to the amplification reaction. Providing nucleic acids from the separated discrete regions to form amplification products of the regions, wherein the regions are further (i) susceptible to containing a single nucleic acid polymorphism and / or (ii) target Including a target nucleic acid sequence located 3 'or 5' to a sequence in said target susceptible to containing specific nucleic acid information; b. In the presence of a first set of "stabilizer" oligonucleotides containing a nucleic acid sequence that is complementary to the region of the target nucleic acid or its amplification product, the region of the target nucleic acid or its amplification product is A nucleic acid sequence that electronically addresses at least one capture site on the chip and wherein the stabilizing oligonucleotide spans at least one terminal portion of each of the spaced apart regions of the target nucleic acid or amplification product thereof Further comprising a nucleic acid sequence complementary to the target along a region of the target located between the separated regions separated by the space, wherein the target nucleic acid or the amplification product thereof and the stabilizer oligonucleotide Further forming a hybridized complex of the components; c. Capturing the ternary hybridized complex at the capture site; d. At least one second complementary to a portion or all of the stabilizing oligonucleotide along a section of the stabilizing agent that is complementary to the portion of the stabilizing oligonucleotide that is complementary to the two spaced apart regions; A set of "reporter" oligonucleotides is hybridized to the ternary complex to form at least a quaternary structure, wherein the reporter oligonucleotide is adjacent to and within the spaced apart regions. Annealing the stabilizer at e. If there is at least one base pair mismatch between the reporter and the stabilizing oligonucleotide, the quaternary structure is subjected to destabilizing conditions sufficient to cause any of the reporter to separate from the quaternary structure. Attached; then f. Detecting the loss or retention of the reporter from the capture site. 13. The method according to claim 12, wherein the amplification reaction is performed using an amplification method selected from the group consisting of PCR, SDA, NASBA, TMA, rolling circle, T7, T3 and SP6. Method. 14. The method of claim 12, wherein the interfering oligonucleotide is included in step (b) of claim 12, wherein the interfering oligonucleotide is the same strand on which the stabilizing oligonucleotide is complementary. The method has a sequence complementary to the target nucleic acid or the amplification product strand that is not. 15. The method according to claim 12, wherein at least one primer used in the amplification reaction is biotinylated. 16. An amplicon chain derived from a biotinylated primer,
16. The method according to claim 15, wherein the capture site in step (c) of step 12 is immobilized by the biotinylation site. 17. The method of claim 12, wherein said stabilizing oligonucleotide is biotinylated. 18. The method of claim 17, wherein said biotinylated stabilizer oligonucleotide is immobilized on said capture site by its biotin site. 19. The method of claim 12, wherein said reporter oligonucleotide is labeled with a label selected from the group consisting of a fluorescein derivative, a bodipie derivative, a rhodamine derivative and a Cy dye. 20. The method of claim 1, wherein the destabilizing condition is caused by a method selected from the group consisting of providing an electrical bias, adjusting a temperature, adjusting an ionic strength, and adjusting a pH. Item 13. The method according to Item 12. 21. The method according to claim 19, wherein the reporter oligonucleotides have their 3 ', 5'
Or a nucleic acid complementary to any of the wild-type base found in the target nucleic acid, the mutated base found in the target nucleic acid, or the base in the stabilizing oligonucleotide as both 3 ′ and 5 ′ terminal bases 13. The method according to claim 12, having a base. 22. The method of claim 12, wherein a plurality of said target nucleic acids or amplification products thereof forming said complex are electronically biased to a single capture site. 23. A method for determining a single nucleic acid polymorphism in a target nucleic acid of interest using a base-stacking energy and an electronically addressable microchip, comprising: a. Using at least one primer for linear amplification or at least one pair of amplification primers for exponential amplification for each locus, at least two loci of the target nucleic acid of interest, which may or may not be subjected to an amplification reaction. To form an amplification product of said locus, wherein said locus is (i) susceptible to containing a single nucleic acid polymorphism and / or (ii) a target-specific nucleic acid Further comprising a target nucleic acid sequence located 3 'or 5' to a sequence in said target susceptible to containing information; b. In the presence of a first set of "stabilizer" oligonucleotides containing a nucleic acid sequence that is complementary to the target locus or its amplification product, the target locus or its amplification product is at least on the microchip. Electronically addressing one capture site, wherein the stabilizing oligonucleotide further comprises a nucleic acid sequence that is complementary to five or more 5 'or 3' terminal region bases of the target locus or its amplification product. ,
A ternary hybridized complex, wherein the stabilizer further comprises a nucleic acid sequence complementary to at least one second set of reporter oligonucleotides, wherein the target locus or its amplification product and the stabilizer oligonucleotide are ternary Further forming; c. Capturing the ternary hybridized complex at the capture site; d. At least one of the set of "reporter" oligonucleotides is hybridized to the ternary complex to form at least a quaternary structure, wherein the reporter oligonucleotide comprises a sequence from each of the target locus or its amplification product. And the reporter oligonucleotide further hybridizes to the ternary complex so as to anneal to the stabilizer oligonucleotide at locations on the stabilizer adjacent to each other, and wherein the reporter oligonucleotide is Hybridizing to said stabilizing oligonucleotide between target loci or amplification product sequences; e. If there is at least one base pair mismatch between the reporter and the stabilizer or between the stabilizer and the target locus or amplification product, the quaternary structure will cause any of the reporters to Subject to destabilizing conditions sufficient to separate from the quaternary structure; then f. Detecting the loss or retention of the reporter from the capture site. 24. The method according to claim 23, wherein the amplification reaction is performed using an amplification method selected from the group consisting of PCR, SDA, NASBA, TMA, rolling circle, T7, T3 and SP6. Method. 25. The method of claim 23, wherein the interfering oligonucleotide is included in step (b) of claim 23, wherein the interfering oligonucleotide is the same strand on which the stabilizing oligonucleotide is complementary. The method comprises a sequence complementary to the target locus or the amplification product nucleic acid strand that is not. 26. The method according to claim 23, wherein at least one primer used in the amplification reaction is biotinylated. 27. The amplicon chain derived from the biotinylated primer,
27. The method of claim 26, wherein the capture site in step (c) of step 23 is immobilized by its biotinylation site. 28. The method of claim 23, wherein said stabilizing oligonucleotide is biotinylated. 29. The method of claim 28, wherein said biotinylated stabilizer oligonucleotide is immobilized on said capture site by its biotin site. 30. The method of claim 23, wherein said reporter oligonucleotide is labeled with a label selected from the group consisting of a fluorescein derivative, a bodipie derivative, a rhodamine derivative and a Cy dye. 31. The method of claim 31, wherein the destabilizing condition is caused by a method selected from the group consisting of providing an electrical bias, adjusting a temperature, adjusting an ionic strength, and adjusting a pH. Item 24. The method according to Item 23. 32. The method according to claim 32, wherein the reporter oligonucleotides have their 3 ', 5'
Or a nucleobase complementary to any of the wild-type base found at the target locus, the mutated base found at the target locus, or the stabilizing oligonucleotide as both 3 ′ and 5 ′ terminal bases The method of claim 23, comprising: 33. The method of claim 23, wherein a plurality of said target nucleic acids or amplification products thereof forming said complex are electronically biased to a single capture site. 34. A method for multiplex analysis of single nucleic acid polymorphisms in a target nucleic acid of interest using a base-stacking energy and an electronically addressable microchip, comprising: a. Providing a plurality of samples containing the target nucleic acid of interest; b. Subjecting the sample to an amplification reaction to produce an amplification product of the target nucleic acid in the sample; c. In the presence of a stabilizing probe having a sequence complementary to the amplification product, the amplification product is electronically addressed to a specific capture site to provide a high level between the amplification product and the stabilizing agent. Forming a hybridization complex; d. Immobilizing the complex at the capture site; e. Detecting the stabilization of hybridization of a reporter probe that anneals to either the amplification product or the stabilizing probe and anneals adjacent to or adjacent to the stabilizing probe, respectively. Detecting simultaneously or sequentially the presence of SNPs in the nucleic acids of the plurality of samples.