JP2002531121A - Glucoamylase having N-terminal extension - Google Patents

Abstract

  (57) [Summary] The present invention relates to variants of the parent fungal glucoamylase that exhibit improved thermostability.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION [0001] The present invention relates to glucoamylase variants of the parent glucoamylase, DNA sequences encoding the variant glucoamylases, and methods of using the mutant enzymes to hydrolyze starch.

[0002] More particularly, the invention relates to glucoamylase variants with improved thermostability.

BACKGROUND OF THE INVENTION Glucoamylase (1,4-α-D-glucan glucohydrolase, EC 3
. 2.1.3) is an enzyme that catalyzes the release of D-glucose from the non-reducing end of starch or related oligo- and polysaccharide molecules. Glucoamylase is produced by several filamentous fungi and yeasts, as well as from Aspergillus, which is the most important commercially.

[0004] Commercially, glucoamylase enzymes are used to convert corn starch, which has already been partially hydrolyzed by α-amylase, to glucose. Glucose is further converted by glucose isomerase from glucose and fructose into a nearly equal mixture. This mixture, or a mixture richer in fructose, is a commonly used high fructose corn syrup that is commercialized throughout the world. This syrup is the world's largest tonnage product produced by an enzymatic process. 3 related to the conversion of starch to fructose
One enzyme is one of the most important industrial enzymes produced.

[0005] One of the major problems that exists with the commercial use of glucoamylase in the production of high fructose corn syrup is the relatively low thermostability of glucoamylase. Glucoamylase is not as thermally stable as α-amylase or glucose isomerase, which is lower than α-amylase or glucose isomerase
Most active and stable at pH. Therefore, it must be used in a separate vessel at lower temperatures and pH.

SUMMARY OF THE INVENTION Accordingly, it is an object of the present invention to improve the properties of an enzyme having glucoamylase activity, and in particular to improve the thermostability of the enzyme. Surprisingly, it has been found that the thermal stability of an enzyme having glucoamylase activity can be significantly increased by linking a peptide extension to the N-terminus of the enzyme.

[0007] Consequently, in a first aspect, the present invention relates to a variant of the parent glucoamylase having a peptide extension at the N-terminus. In the present context, the term "peptide extension" is intended to indicate that a stretch of one or more contiguous amino acid residues has been added to the N-terminus of the parent (mature) glucoamylase.

The term “mature glucoamylase” is used in its conventional sense, ie by the producer organism in question (to carry out glycosylation and to remove N- and / or C-terminal sequences, such as pre- and propeptide sequences. Used to indicate the active form of glucoamylase that occurs after post-translational and post-secretory processing. More specifically, this means that the amino acid sequence, eg, the pre- and pro-peptide sequences, if present, have been removed from the originally translated glucoamylase, ie, the non-processing glucoamylase. Mature glucoamylases included in the definition of the present invention include those described in A.I. Nigel glucoamylase (see SEQ ID NO: 1) at position 3, ie, Leu and Asp
Glucoamylase cleaved (processed) by tripeptidyl aminopeptidase (TPAP) that cleaves between

[0009] The term "parent glucoamylase" is intended to indicate a glucoamylase to be modified according to the present invention. The parent glucoamylase can be a natural (or wild-type) glucoamylase or a variant thereof prepared by any suitable means. For example, the parent glucoamylase may have one or more amino acid residue substitutions,
By deletion or truncation, or of one or more amino acid residues,
It may be a variant of a naturally occurring glucoamylase that has been modified, typically in the structural part of the glucoamylase, by addition or insertion into the amino acid sequence of the naturally occurring glucoamylase.

In another aspect, the invention relates to a DNA sequence encoding a glucoamylase as defined above, a DNA construct comprising a DNA sequence of the invention and a recombinant expression vector,
And a host cell having the DNA sequence of the present invention or the vector of the present invention. The glucoamylase variants of the present invention can be conveniently used in a process for converting starch, and thus, in yet another aspect, the present invention provides a method for converting starch or partially hydrolyzed starch into dextrose. A syrup comprising converting the starch hydrolyzate to syrup in the presence of the glucoamylase variant of the invention.

In a last aspect, the invention provides a method for improving the thermostability of a parent glucoamylase by creating an extension at the N-terminus. The inventors of the present invention provide some improved variants of the parent glucoamylase with improved thermostability. The improved thermostability is obtained by linking the peptide extension to the parent glucoamylase. This will be described in detail below.

DETAILED DESCRIPTION OF THE INVENTION Peptide Extensions As mentioned above, surprisingly, glucoamylase variants, especially those with improved thermostability, have preferred peptide extensions found at the N-terminus of the parent glucoamylase. It has been found that it can be achieved if it can. The present invention is based on this finding.

[0013] In the context of the present invention, "found at the N-terminus" means that the mature glucoamylase has a peptide extension at the N-terminus. In one embodiment, the peptide extension is native to the parent glucoamylase, ie, before post-translational processing to remove pro- and / or pre-sequences. Thus, the peptide extension may be a pre- and / or pro-sequence of the unprocessed parent glucoamylase that is normally removed or cleaved after expression and post-translational processing.

In another embodiment, the extension comprises an N sequence identical to the peptide sequence normally cut off by the donor cell during processing, eg, the pre- and / or pro-sequence.
Terminal peptide. In most cases, the peptide extension differs from the pre- and / or pro-sequence. This will be described further below. If the extension is linked to the N-terminus, it can be done by any protein engineering method known in the art.

The term “glucoamylase variant with improved thermostability” refers in the context of the present invention to a higher T _1/2 (half-life) or a fixed incubation time than the corresponding parent glucoamylase. Glucoamylase variant with residual enzymatic activity after Measurements of thermal stability, such as T _1/2 and residual activity, are described in the Materials and Methods section below.

The term “suitable peptide extension” is used to indicate that the peptide extension to be used is one that can exhibit improved thermal stability as defined above. The “validity” of a peptide extension can be checked by comparative analysis of the thermal stability of each of the modified glucoamylase to which the peptide extension is linked and the corresponding parent glucoamylase. Thermal stability can be determined by any suitable technique, for example, the thermal stability assay described herein.

[0017] The ability of the peptide extension to provide the required effect, eg, improved thermostability, may include, for example, the identity of the parent glucoamylase to be modified, the structure (including length) of the peptide extension, It is presently believed that the effect of the peptide extension on the overall structure of the glucoamylase variant enzyme, the nature or functionality of the amino acid residues in the peptide extension, etc. A prerequisite for the peptide extension to provide the required effect is, of course, that the glucoamylase variant containing the peptide extension can be expressed in a suitable host organism. The following general considerations may relate to the design of a suitable peptide extension.

Peptide extension length : A peptide extension containing a variable number of amino acid residues can provide the required effect, thereby providing the amino acid residues to be present in the peptide extension to be used according to the present invention. It has been found that it is not possible to specify the exact number of The upper limit for the number of amino acid residues is determined, inter alia, on the effect of the peptide extension on the expression, structure and / or activity of the resulting modified glucoamylase variant.

The peptide extension thereby comprises 1 to 100 amino acid residues, preferably 1 to 5 amino acid residues.
0 amino acid residues, more preferably 1-20, and even more preferably 1-10
It may include amino acid residues. Stability : The peptide extension preferably provides a glucoamylase variant with acceptable stability (eg, structural stability and / or expression stability).
Alternatively, it should be selected so as not to significantly reduce the structural stability of the glucoamylase variant. While it is not believed that many peptide extensions will confer any substantial structural instability to the resulting glucoamylase variant, it does, in certain instances and in certain parental glucoamylases, show structural stability. Can be provided to the modified glucoamylase enzyme by itself. For example, peptide extensions can increase the number of interactions and / or become covalently linked by adding a cysteine bridge from the N-terminal extension to the N-terminal residue, as discussed below.

Nature of the Amino Acid Residues of the Peptide Extension In order to obtain an improved interaction between the N-terminal residue and the N-terminal extension, the residues are preferably formed to form an α-helix. Should be from the lower priority residue, and should be used in the context of the present invention. This is theoretically explained by the fact that when the N-terminal α-helix becomes longer at the N-terminus, it protrudes from structures without contact with the N-terminal residue. Peptide extensions according to the invention include improved stability by improving contact of the N-terminal residue with the N-terminal extension. Within a given N-terminal extension, the major portion of the residues must be from the group of non-helical manufacturers. By using lower or equal residues having an α-helical propensity in the N-terminus of the helix, and / or in the middle of the helix, and / or in the C-terminal portion of the helix, the N-terminal residue and the N-terminal extension Improved contact between will be optimal. Residues having a lower propensity in the N-terminal portion of the α-helix are of particular interest because their extension is located in the N-terminal portion of the natural α-helix in glucoamylase. M (methionine), K (lysine), H (histidine), V (valine), I (isoleucine)
, Y (tyrosine), C (cysteine), F (phenylalanine), T (threonine), G (glycine), N (asparagine), P (proline), S (serine) and D (aspartic acid) Can be used in the present invention as a non-α-helix maker.

In the context of the present invention, “N-terminal residue” is a residue around the N-terminal residue, ie N
A residue that is in the sphere at 18, 12, and / or 8 ° from the center of the terminal residue and is not part of the N-terminal extension. More preferably, the extension is within 10 ° but C
Defined as residues having a positive number in accessibility using the onlinely accessible surface program (version October 1988), cited W. Kabsch and C. Sander, Biopolymers 22 (1983) pp. 2577-2637. The enzyme is on the surface.

A “non-helix maker” is herein referred to as (Proteins: Creighton T.
E. (1993)) as defined by table 6.5. Here, different tendencies are described for different amino acid residues. Alternatively, improved structural stability can be provided by the introduction of a cysteine bridge in the glucoamylase of the invention. For example, a cysteine bridge between the peptide extension and the mature portion of the glucoamylase forms a covalent bond with at least one of the amino acid residues of the peptide extension with a cysteine residue in the mature portion of the glucoamylase variant. If the cysteine residue is located such that it can be established, it can be established. Example 3 shows the positive effect of introducing a cysteine bridge. If a suitable cysteine is not present in the mature glucoamylase, it is convenient to insert the cysteine in a suitable position of the parent glucoamylase by substituting an amino acid of the parent glucoamylase which is not considered important for activity. Can be.

In general, the amino acid sequence of the peptide extension portion containing a cysteine residue in the present invention is represented by X—C— (X) _n (where X is independently one amino acid, preferably Of a helix maker, even more preferably those with short side chains).

Between the carboxy-terminal side of the Cys and the processed native N-terminus is greater than or equal to 5, preferably 5-100, and even more preferably 5
There are any number (n) of X residues, from 10 to even more preferably 5. Examples include: ACGPSTS (SEQ ID NO: 25) ACPGTST (SEQ ID NO: 26) ACGTGTS (SEQ ID NO: 27) ACGSTG (SEQ ID NO: 28) ACGPSTSG (SEQ ID NO: 29) ACPGTSTG (SEQ ID NO: 30) ) ACGTGTSS (SEQ ID NO: 31) ACTGSTGT (SEQ ID NO: 32) Native propeptide of glucoamylase (eg, A. niger G1 or G2)
AMG) is cleaved by a kex2-like protease (dibasic protease). Thus, the kex2 protease is a protease that can cleave a kex2 or kex2-like site. kex2 site (eg, Methods in Enz
ymology Vol 185, ed.D. Goeddel, Academic Press Inc. (1990), San Diego, C
A, "Gene Expression Technology") and kex2-like sites are dibasic recognition sites (ie, cleavage sites) found between the propeptide coding and mature regions of a particular protein.

By mutating this cleavage site, the N-terminal propeptide can be left completely. Example: NVIPPR (SEQ ID NO: 33) NPPIRP (SEQ ID NO: 34) NVIPRP (SEQ ID NO: 35) Another possibility is to delete the kex2-like protease coding gene in a host selected to express the glucoamylase gene. Or inactivation. This may also leave the N-terminal peptide extension completely.

Other genes encoding proteases involved in N-terminal processing, such as the tripeptidyl aminopeptidase coding gene, could also be deleted or inactivated in the host in question for expression. The N-terminal residue for the cysteine variant is located around the N-terminal residue, ie, within the sphere at 18, 12, and / or 8 ° from the center of the N-terminal residue, and is not part of the N-terminal extension. Defined as residue. In general, the amino acid sequence for an extension comprising a cysteine residue in the present invention is: xCxxxxxxxx, where x is independently a non-α helix maker as described above. One of them)
It can be shown.

[0027] In certain embodiments, the glucoamylase variant comprises a peptide extension capable of forming a covalent bond with the mature portion of the parent glucoamylase. In another specific embodiment, the glucoamylase variant comprises one or more cysteine residues of the peptide extension and a cysteine residue of the mature portion of the parent glucoamylase, such that the cysteine residues together form a cysteine bridge. including. In yet another specific embodiment, a cysteine residue in the mature portion of the parent glucoamylase is inserted or substituted for an amino acid residue of the parent glucoamylase. In a most preferred particular embodiment, an aspartic acid residue at a position corresponding to position 375, a glutamic acid residue at a position corresponding to position 299, a serine residue at a position corresponding to position 431, an alanine residue at a position corresponding to position 471. The alanine residue at the position corresponding to position 479, the threonine residue at the position corresponding to position 480, the proline residue at the position corresponding to position 481, or the serine residue at the position corresponding to position 8 are Aspergillus It is substituted with a cysteine residue in the amino acid sequence of Nigel G1 glucoamylase.

In particular, the peptide extension linked to the parent glucoamylase may advantageously be one of the following extensions: Asn-Val-Ile-Ser-Arg-Arg (NVISRR), Asn- Val-Ile-Pro-Lys-Arg (NVIPKR), Ala-Ser-Pro-Pro-Ser-Thr-Ser (ASPPSTS), Ala-Cys-Pro-Pro-Ser-Thr-Ser (ACPPSTS), Pro-Cys -Ser-Ala-Gly-Glu (PCSAGE), Pro-Leu-Ala-Leu-Ser-Asp (PLALSD), Leu-Gly-Val-Thr-Gly-Glu (LGVTGE), Ala-Gly-Pro-Leu- Pro-Ser-Glu (AGPLPSE), Leu-Gly-Pro-Asp (LGPD), Ile-Phe-Glu-Leu-Thr-Pro-Arg (IFELTPR), Ile-Ser-Asn (ISN), or Met-Asn (MN).

In the present context, tripeptidyl aminopeptidase (TPAP) is intended to indicate an aminopeptidase that cleaves a tripeptide from a peptide or protein sequence, such as a prohormone or an extended amino acid sequence found within a proenzyme. Tripeptidyl aminopeptidase (TPAP) has been found, in certain cases, to lead to reduced stability when cleaving tripeptide fragments from the unsubstituted N-terminus of peptides, oligonucleotides or proteins.
More specifically, N-terminal tripeptidyl aminopeptidase reduces the stability of the glucoamylase enzyme. Accordingly, the present invention also relates to a variant of the parent glucoamylase wherein the peptide extension is capable of preventing the cleavage of the glucoamylase enzyme tripeptidyl aminopeptidase (TPAP).

Method for Linking a Peptide Extension to a Parent Glucoamylase The variants of the invention can be obtained by adding (fusing or inserting) a synthetically produced peptide extension to the parent glucoamylase enzyme in question. But,
The glucoamylase variants of the present invention may be modified i) the nucleotide sequence, preferably the DNA sequence, encoding the parent glucoamylase to encode a required peptide extension applied to the N-terminus of the parent glucoamylase (eg, By inserting a nucleic acid (preferably DNA) sequence encoding a peptide extension at the relevant position in the nucleic acid (preferably DNA) sequence encoding glucoamylase), ii) the modified result obtained in a suitable expression system Preferably, the nucleic acid (preferably DNA) sequence is expressed, and iii) the resulting glucoamylase variant is recovered.

In the present context, the term “link” means that the extension is the N-terminus of the mature glucoamylase (
(For example, the last amino acid residue). Many glucoamylases are expressed as "preproglucoamylase", ie, a glucoamylase consisting of a mature glucoamylase, a secretory signal peptide (ie, a prepeptide) and a propeptide. The prepro-glucoamylase is processed intracellularly and secreted into the fermentation medium. From there, the mature glucoamylase can be isolated and / or purified. Addition of the peptide extension to the parent glucoamylase can be performed by ligating the nucleic acid sequence encoding the required peptide upstream (for the N-terminal peptide extension) to the DNA sequence encoding the parent glucoamylase. .

The insertion is such that the required glucoamylase variant (ie, having the required peptide extension) is expressed and secreted by the host cell after transcription, translation, and processing of the glucoamylase variant. Should be done. The term "processing" in this context means the removal of the pre- and pro-peptides (unless, of course, the pro-peptide is identical to the required peptide extension; this is dealt with further below).

In most cases, a DNA sequence encoding a peptide extension is inserted between the DNA sequence encoding the pro-peptide or pre-peptide (if no pro-sequence is present) and the DNA sequence encoding mature glucoamylase. This makes it possible to elongate the parent glucoamylase. Insertion / addition of a DNA sequence encoding a peptide extension can be performed by any standard technique known to one of skill in the art of molecular biology (eg, Sambrook et al., 1989). This includes, for example, the polymerase chain reaction (PCR) using specific primers described in U.S. Pat. No. 4,683,202 or RK Saiki et al. (1988), Science, 239, 487-491. Methods for providing expression and secretion of flanking DNA sequences will be described below. Care must be taken in selecting the correct expression system for producing the glucoamylase variants of the invention (especially when the modified DNA sequence is used for production), A glucoamylase variant according to the invention can be obtained by expressing a DNA sequence encoding the parent glucoamylase enzyme in an expression system which is unable to process the translated polypeptide in the usual manner, This produces a glucoamylase that contains some or all of the propeptide or a similar peptide sequence associated with the mature protein prior to its processing. In this case, the propeptide or similar peptide sequence constitutes the peptide extension. The propeptide or analogous peptide sequence may be heterologous or homologous to the parent glucoamylase and may be at the N-terminus of the parent glucoamylase. The production of glucoamylase variants according to the invention using this latter technique is described further below.

Thus, if a suitable stretch of an amino acid is already encoded in the prepro-form of the parent glucoamylase and this stretch of amino acid is cleaved in the processing of the glucoamylase by a given expression system, the peptide extension will This can be applied by changing the expression host system to a system in which processing of the stretch of amino acids does not occur. In such cases, the secretory signal pre-peptide is truncated during or after secretion, and the modified glucoamylase comprises the parent glucoamylase containing the pro-peptide or a portion thereof or a similar peptide sequence encoded by the corresponding DNA sequence. Ie, a glucoamylase with an extended N-terminus.

Yeast cells have found particular use for applying peptide extensions (in the form of a propeptide or a portion thereof) to a parent fungal glucoamylase enzyme, particularly an Aspergillus niger glucoamylase enzyme. In a highly preferred embodiment, the peptide extension is designed and applied by random mutagenesis according to the following principle: a) A DNA sequence encoding the parent glucoamylase having the peptide extension is
Subjected to localized random mutagenesis at the peptide extension or at the N-terminus of the parent glucoamylase; b) expressing the mutated DNA sequence obtained in step a) in a host cell; and c) comparing the parent glucoamylase enzyme Screening for host cells that express a mutant glucoamylase enzyme with improved ability.

With this approach, some very advantageous peptide adducts were formed. Localized random mutagenesis can be performed essentially as described in WO 95/22615. More specifically, mutagenesis is performed under conditions in which only one or more of the above-mentioned regions is subjected to mutagenesis. In particular, to mutagenize large peptide extensions, it may involve using PCR generated mutagenesis methods (eg as described in Deshler 1992 or Leung et al., 1989). Here, one or more suitable oligonucleotide probes adjacent to the region to be mutagenized are used. For shorter peptide extensions, it is more preferred to perform localized random mutagenesis by using a doped or spiked oligonucleotide. Doping or spiking may, for example, avoid codons for unwanted amino acid residues or introduce specific types of amino acid residues, such as positively charged or hydrophobic amino acid residues, at the required positions. Used to increase the

After mutagenesis, the mutated DNA is expressed by culturing a suitable host cell having the DNA sequence under conditions in which expression occurs. Host cells used for this purpose are those that have been transformed with the mutated DNA sequence, optionally present on a vector, or that have the DNA sequence encoding the parent enzyme during the mutagenesis treatment. obtain. Examples of suitable host cells are provided below, which are preferably host cells capable of secreting the mutated enzyme (which allows easy screening). Yeast cells, such as S. S. cerevisiae cells have been found to be suitable host cells.

[0038] The parent glucoamylase contemplated by the parent glucoamylase present invention, fungal glucoamylase, fungal glucoamylase particular can be obtained from Aspergillus strains, e.g. Aspergillus niger or Aspergillus awamori (Aspergillus a wamori) glucoamylase and There are variants or mutants thereof, homologous glucoamylases, and additional glucoamylases that are structurally and / or functionally similar to SEQ ID NO: 1. Of particular consideration are Boel et al. (1984), "Glucoamylases.
G1 and G2 from Aspergillus niger are synthesized from two different but
closely related mRNAs ", EMBO J. 3 (5), pp. 1097 to 1102, which are Aspergillus niger glucoamylases G1 and G2. G2 glucoamylase is disclosed in SEQ ID NO: 1.

Commercial Parent Glucoamylase Commercial parent glucoamylases include AMG from Novo Nordisk, and Genencor,
There are also glucoamylases from Inc USA and Gist-Brocades, Delft, The Netherlands. Parent homologous glucoamylase The homology of the parent glucoamylase indicates the derivation of the first sequence from the second sequence.
It is determined as the degree of similarity between two protein sequences. The homology is preferably
Computer programs known in the art, such as the GCG Program Package (Program Manual for the Wisconsin Package, Version 8, August 1994, Ge
(netics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711)
(Needleman, SB and Wunsch, CD, (1970), Journal of Molecular Biology,
48, pp. 443-453). The following settings for polypeptide sequence comparison: Using GAP with a GAP creation penalty of 3.0 and a GAP extension penalty of 0.1, the mature portion of the polypeptide encoded by the analogous DNA sequence of the invention is preferably At least 80%, at least 90%, more preferably at least 95%, more preferably at least 97%, and most preferably at least 99% with the mature portion of the amino acid sequence shown in SEQ ID NO: 1. Indicates the degree of identity.

In a preferred embodiment, the variants of the present invention are prepared using maltodextrin as a substrate at a temperature in the range of about 60-80 ° C., preferably 63-75 ° C., for 4 hours.
It has improved thermal stability at pH of -5, especially 4.2-4.7. In another preferred embodiment, the parent homologous glucoamylase comprises glucoamylase from a microorganism. In a more preferred embodiment, the microorganism comprises eubacteria, archaea, fungi, algae and protozoa, and in an even more preferred embodiment, the parent homologous glucoamylase is obtained from a filamentous fungus.

In a highly preferred embodiment, the parent glucoamylase is Aspergillus niger G1 glucoamylase (Boel et al. (1984), EMBO, J. 3 (5), p. 1097-
1102). The parent glucoamylase may be a truncated glucoamylase. Methods for preparing glucoamylase variants Several methods for introducing mutations into genes are known in the art.
After a brief discussion of cloning the glucoamylase coding DNA sequence, methods for creating mutations at specific sites within the glucoamylase coding sequence will be discussed.

Cloning of the DNA sequence encoding glucoamylase, cloning of the DNA sequence encoding α-amylase The DNA sequence encoding the parent glucoamylase can be produced by various methods known in the art to produce the glucoamylase in question. Can be isolated from any cell or microorganism. First, a genomic DNA and / or cDNA library should be created using chromosomal DNA or messenger RNA from the organism producing the glucoamylase to be studied. Then, if the amino acid sequence of the glucoamylase is known, a labeled oligonucleotide probe can be synthesized and used to identify a glucoamylase coding clone from a genomic library prepared from the organism in question. Alternatively, labeled oligonucleotide probes containing sequences homologous to another known glucoamylase gene may be used as probes to identify glucoamylase-encoding clones using low stringency hybridization and washing conditions. I can do it.

Yet another method for identifying glucoamylase coding clones is to insert a fragment of genomic DNA into an expression vector, such as a plasmid, transform the resulting genomic DNA library into glucoamylase negative bacteria, and It then involves plating the transformed bacteria on agar containing a substrate for glucoamylase (ie, maltose), thereby identifying a clone that expresses glucoamylase.

Alternatively, the DNA sequence encoding glucoamylase can be obtained using established standard methods, such as SLBeaucage and MHCaruthers (1981), Tetrahedron Letters.
22, p. 1859-1869, or the phosphoramidite method, or Matthes et al., (1984),
It can be prepared synthetically by the method described in EMBO J. 3, pages 801 to 805. In the phosphoramidite method, oligonucleotides are synthesized, for example, on an automated DNA synthesizer, purified, annealed, ligated, and cloned into a suitable vector. Finally, the DNA sequence may be a mixture of genomic and synthetic origin, a mixture of synthetic and cDNA sources, or a mixture of genomic and cDNA sources, which may be prepared according to standard techniques. Then, fragments corresponding to various parts of the whole DNA sequence)
Is prepared by linking The DNA sequence can be found, for example, in US 4,683.
, 202 or RK Saiki et al. (1988), Science 239, 1988, pp. 487-491, and can be prepared by a polymerase chain reaction using specific primers.

After incubation with or exposure to a mutagen, the mutated D
NA is expressed by culturing a suitable host cell having the DNA sequence under conditions in which expression occurs. Host cells used for this purpose are those that have been transformed with the mutated DNA sequence, optionally present on a vector, or that also carry the DNA sequence encoding the parent glucoamylase during the mutagenesis treatment. possible. Examples of suitable host cells are: Gram-positive bacteria, such as Bacil
rus subtilis, Bacillus licheniformis,
Bacillus lentus, Bacillus brevis, Baci
lulus stearothermophilus, Bacillus alk
alophilus, Bacillus amyloliquefaciens
, Bacillus coagulans, Bacillus circula
ns, Bacillus lautus, Bacillus megateri
um, Bacillus thuringiensis, Streptomyc
es lividans or Streptomyces murinus; and Gram-negative bacteria such as E. coli. coli. The mutated DNA sequence may further include a DNA sequence encoding a function that permits expression of the mutated DNA sequence.

Site-directed mutagenesis After isolating the glucoamylase coding DNA sequence and identifying the required site for mutation, the mutation can be introduced using synthetic oligonucleotides. These oligonucleotides contain the nucleotide sequence adjacent to the required mutation site. In a particular method, a single stranded gap in the DNA of the glucoamylase coding sequence is formed in a vector containing the glucoamylase gene. Next, the synthetic nucleotides with the required mutations are converted to single-stranded DNA
Annealed with the homologous part of Next, fill the remaining gap with DNA polymerase I
(Klenow fragment) and the construct is ligated using T4 ligase. One example of this method is described in Morinaga et al. (1984), Biotechnology 2, p 646-63.
It is described in 9. US 4,760,025 discloses the introduction of oligonucleotides encoding multiple mutations by making small changes in the cassette. However, even more types of mutations can be introduced at any one time by the method of Morinaga. This is because a large number of oligonucleotides of various lengths can be introduced.

Another method for introducing mutations into the glucoamylase coding DNA sequence is described in Nelson and Long (1989), Analytical Biochemistry 180, pp. 147-151. It involves a three-step generation of a PCR fragment containing the required mutation introduced by using a chemically synthesized DNA strand as one of the primers in a PCR reaction. From the PCR-generated fragment, the DNA fragment containing the mutation can be isolated by cleavage with restriction endonucleases and reinserted into the expression plasmid.

Further, Sierks. Et al., (1989) “Site-directed mutagenesis at the active
site Trp120 of Aspergillus awamori glucoamylase. "Protein Eng., 2, 621-62
5; Sierks et al., (1990), "Determination of Aspergillus awamori glucoamyl.
ase catalytic mechanism by site-directed mutagenesis at active site Asp1
76, Glu179, and Glu180 ". Protein Eng. Vol. 3, 193-198, also describes site-directed mutagenesis in Aspergillus glucoamylase.

Random Mutagenesis Random mutagenesis preferably involves localization or region-specific random mutagenesis within at least three parts, or the entire gene, of the gene translated into the amino acid sequence of interest. Done as either. DNA encoding the parent glucoamylase
Random mutagenesis of the sequence can be conveniently performed using any method known to those of skill in the art. In this regard, a further aspect of the present invention is a method for forming a variant of a parent glucoamylase, wherein the variant exhibits increased thermostability to its parent; Subject to random mutagenesis, (b) expressing the mutated DNA sequence obtained in step (a) in a host cell, and (c) having altered properties relative to the parent glucoamylase (ie, thermostable). Screening for host cells that express a glucoamylase variant having

Step (a) of the method of the present invention described above is preferably performed using a doped primer as described in the research examples of the present specification (described below).
For example, random mutagenesis can be performed by using a suitable physical or chemical mutagen, by using a suitable oligonucleotide, or by subjecting the DNA sequence to PCR-generated mutagenesis. Further, random mutagenesis can be performed by using any combination of these mutagens. The mutagenic agent is, for example, one that induces a transition, transversion, inversion, scrambling, deletion, and / or insertion. Examples of physical or chemical mutagens suitable for this purpose include ultraviolet (UV) irradiation, hydroxyamine, N-methyl-N'-nitro-N-nitrosoguanidine (NMMG)
, D-methylhydroxylamine, nitrous acid, ethyl methanesulfonate (EMS
), Sodium sulfite, formic acid, and nucleotide analogs. When using these agents, mutagenesis typically involves DNA encoding the parent enzyme to be mutagenized.
The sequence is performed by incubating the sequence in the presence of the selected mutagenesis under suitable conditions for mutagenesis to occur, and selecting for a mutant DNA having the required properties. If mutagenesis is performed by use of an oligonucleotide, the oligonucleotide may be doped or spiked with three non-parent nucleotides during synthesis of the oligonucleotide at a position that should not be changed. Doping or spiking can be performed such that codons for unwanted amino acids are avoided. Doped or spiked oligonucleotides are for example PCR, LC
The DNA encoding the glucoamylase enzyme can be incorporated by any published technique using R or any DNA polymerase and ligase that may be suitable. Preferably, the doping is performed using "constant random doping", in which the percentage of wild type and mutant at each position is predefined. In addition, doping is selective for the introduction of a particular nucleotide,
This is done for selectivity for the introduction of one or more specific amino acid residues. Doping can be performed, for example, to allow for the introduction of 90% wild-type and 10% mutations at each position. Further considerations in choosing a doping scheme are based on constraints on gene and protein structure. The doping scheme can be performed, inter alia, with a DOPE program that ensures that the introduction of stop codons is avoided. When using PCR-generated mutagenesis, the chemically treated or untreated gene encoding the parent glucoamylase has a nucleotide miss-
PCR is performed under conditions that increase incorporation (Peshler 1992
Leung et al., Technique, Vol. 1, 1989, pp. 11-15). Mutator strains of E. coli (Fowler et al., Molec. Gen. Genet., 133, 1947, pp. 179-191), Transforming S. cerebiae or any other microorganism, for example, a plasmid containing the parent glucosylate, into the mutator strain, growing a mutator strain having the plasmid, and isolating the mutant plasmid from the mutator strain. Can be used for random mutagenesis of DNA encoding glucoamylase. The mutated plasmid can then be transformed into an expression organism. The mutated plasmid can then be transformed into an expression organism. The DNA sequence to be mutagenized may conveniently be in a genomic or cDNA library prepared from an organism expressing the parent glucoamylase. Alternatively, the DNA sequence can itself be on a suitable vector, such as a plasmid or bacteriophage, which can be incubated with or exposed to a mutagen. The DNA to be mutagenized can also be present in the host cell by being integrated into the genome of the cell or by being present on a vector carried by the cell. Finally, the DNA to be mutagenized may be in an isolated form. It will be appreciated that the DNA sequence to be subjected to random mutagenesis is preferably a cDNA or genomic DNA sequence. In certain cases, it may be convenient to amplify the mutated DNA sequence before the expression step b) or the screening step c). Such amplification can be performed according to methods known in the art. The preferred method is
PCR generated amplification using oligonucleotide primers prepared based on the DNA or amino acid sequence of the parent enzyme. After incubation with or exposure to a mutagen, the mutated DNA is expressed by culturing a suitable host cell having the DNA sequence under conditions that allow expression. The host cells used for this purpose can be those that are transformed with the mutated DNA sequence, optionally on a vector, or that have the DNA sequence encoding the parent enzyme during the mutagenesis treatment. Examples of suitable host cells are: Gram-positive bacteria, such as Baci
lulus subtilis, Bacillus licheniformis
, Bacillus lentus, Bacillus brevis, Bac
illus stearothermophilus, Bacillus al
kalophilus, Bacillus amyloliquefacien
s, Bacillus coagulans, Bacillus circul
ans, Bacillus lautus, Bacillus metadata
ium, Bacillus thuringiensis, Streptomy
ces lividans or Streptomyces murinus; and Gram-negative bacteria such as E. coli. coli. The mutated DNA sequence further includes a DNA sequence encoding a function that permits expression of the mutated DNA sequence.

Localized Random Mutagenesis Random mutagenesis can advantageously be localized to a portion of the parent glucoamylase in question. This may be advantageous, for example, if a particular region of the enzyme is particularly important for a given property of the enzyme, and if the modification is expected to result in a variant with improved properties. Such regions can usually be identified when the tertiary structure of the parent enzyme has been elucidated and linked to the function of the enzyme.

[0052] Localization or region-specific random mutagenesis is conveniently performed using the PCR-generated mutagenesis technique described above or any other suitable technique known in the art. Alternatively, a DNA sequence encoding a portion of the DNA sequence to be modified can be isolated, for example, by insertion into a suitable vector, and that portion subsequently can be isolated by use of any of the mutagenesis methods discussed above. Can be subjected to mutagenesis.

Expression of a Glucoamylase Variant According to the present invention, a DNA sequence encoding a variant produced by the methods described above, or by any other method known in the art, typically comprises It can be expressed in enzymatic form using an expression vector that contains regulatory sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and optionally a repressor gene or various activator genes.

Expression Vectors A recombinant expression vector having a DNA sequence encoding a glucoamylase variant of the present invention can be any vector that can be conveniently subjected to recombinant DNA procedures. Often, it will depend on the host cell to be introduced. The vector may be one which, when introduced into the host cell, is integrated into the host cell genome and replicated along with the chromosome (s) into which it has been integrated. An example of a suitable expression vector is pMT838.

[0055] Within the promoter vector, the DNA sequence should be operably linked to a suitable promoter sequence. The promoter can be any DNA sequence that exhibits transcriptional activity in the selected host cell, and can be obtained from a gene encoding a homologous or heterologous protein for the host cell.

DNA encoding the glucoamylase variant of the invention, especially in bacterial hosts
Examples of suitable promoters for directing the transcription of the sequence, the promoter of the lac operon of E. coli, Streptomyces coelicolor (Streptomyc es coelicolor) agarose gene dagA promoters, Bacillus licheniformis (Batillus licheniformis) α- amylase gene (amyL promoter of), Bacillus stearothermophilus (Batillus stearothermophilus) maltogenic promoter of amylase gene (amyM), Bacillus amyloliquefaciens (Batillus amyloliquefaciens) α- amylase (promoter of amyQ), Bacillus subtilis (Batillu s subti is) is a promoter such as xylA and xylB gene.
Examples of useful promoters for transcription in a fungal host are described in Derived from a gene encoding A. oryzae TAKA amylase; A TPI (triose phosphate isomerase) promoter from S. cerevisiae (Alber et al. (1982), J. Mol. Appl Genet 1, p 419-434);
Rhizomucor miehei asparatic proteinase, A. A. niger neutral α-amylase, A. niger Nigeric acid stable α-amylase, A. Nigel glucoamylase, Rhizomucor miehei lipase, Oryzae alkaline protease; Oryzae triose phosphate isomerase or A. It is obtained from Nigerans acetamidase.

Expression Vectors The expression vectors of the present invention may also include suitable transcription terminators and, in eukaryotes, a polyadenylation sequence operably linked to the DNA sequence encoding the α-amylase variant of the present invention. The termination and polyadenylation sequences are:
It can be obtained from the same source as the promoter.

The vector is a DN that allows the vector to replicate in the host cell in question.
It may further include an A sequence. Examples of such sequences are the plasmids pUC19, pAC
It is the origin of replication of YC177, pUB110, pE194, pAMB1 and pIJ702. Vectors contain a selectable marker, eg, a gene whose product complements the defect in the host cell, eg, B. Subtilis or B. It may also include the dal gene from licheniformis, or those that confer antibiotic resistance, such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. In addition, the vector may include an Aspergillus selectable marker, such as amdS, argB, niaD and sC, a marker that produces hygromycin resistance, or the selection may be, for example, WO 91/1724.
As described in 3, it can be performed by co-transformation.

To ligate the DNA constructs of the present invention, each encoding a glucoamylase variant, promoter, terminator and other factors, and to insert them into a suitable vector containing the information necessary for replication The procedures used are known to those skilled in the art (eg, Sambrook et al., Molecular Cloning: A Laboratory Manual , 2nd Ed.,
Cold Spring Harbor, 1989).

Host Cell A cell of the invention comprising any of the DNA constructs or expression vectors of the invention as defined above is advantageously used as a host cell in recombinant production of a glucoamylase variant of the invention. . The cell can be transformed with a DNA construct of the present invention encoding the variant, conveniently by integrating the DNA construct (in one or more copies) into the host chromosome. This integration is generally considered to be advantageous because its DNA sequence tends to be stably maintained in the cell. Integration of the DNA construct into the host chromosome can be performed according to conventional methods, for example, by homologous or heterologous recombination. Alternatively, the cells can be transformed with expression vectors as described above in connection with different types of host cells.

The cell of the invention may be a cell of a higher organism, for example a mammal or an insect,
Preferably, it is a microbial cell, such as a bacterial or fungal cell (including yeast). Examples of suitable bacteria are gram-positive bacteria, such as Bacillus subtil
is, Bacillus licheniformis, Bacillus l
entus, Bacillus brevis, Bacillus star
thermophilus, Bacillus alcoholophilus,
Bacillus amyloliquefaciens, Bacillus
coagulans, Bacillus circulans, Bacillu
s lautus, Bacillus megaterium, Bacillu
s thuringiensis or Streptomyces live
idans or Streptomyces murinus, or Gram-negative bacteria such as E. coli. coli. Bacterial transformation can be effected, for example, by protoplast transformation or by using competent cells in a manner known per se.

[0062] The yeast organism is preferably Saccharomyces or Schizo.
saccharomyces species, for example, Saccharomyces cer
evisiae. The host cell is a filamentous fungus, such as a strain belonging to the species Aspergillus, most preferably Aspergillus oryzae or Aspergillus.
us niger, or a strain of Fusarium, such as Fusarium o.
xysporium, Fusarium graminearum (Gribberella zeae in its complete state, previously known as Sphaeria zea)
e, Gibberella roseum and Gibberella rose
um f. sp. cerealis) or Fusarium su
Iphureum (Gibberella puricalis in its complete state)
, Fusarium trichothechoides, Fusarium
bacridioides, Fusarium sambucium, Fus
arium roseum, and Fusarium roseum var. g
rameriarum), Fusarium cerealis (Fus
synonymous with arium crokkwell) or Fusarium
venenatum strain.

[0063] In a preferred embodiment of the present invention, the host cell is a protease-deficient protease-deficient strain. This may be, for example, a protease-deficient strain Aspergillus oryzae JaL 125 in which the alkaline protease gene called "alp" has been deleted.
This strain is described in WO 97/35956 (Novo Nordisk).

Filamentous fungal cells can be transformed by methods involving protoplast formation and transformation of the protoplasts, followed by regeneration of the cell wall in a manner known per se. The use of Aspergillus as a host microorganism is described in EP 238 023
(Novo Nordisk A / S), the contents of which are incorporated herein by reference.

Method for Producing a Glucoamylase Variant of the Invention In yet a further aspect, the invention provides a method of producing a glucoamylase variant of the invention, wherein the host cell is prepared under conditions conducive to the production of the variant. Culturing and recovering the mutant from the cells and / or culture medium. The medium used to culture the cells may be any conventional medium suitable for growing the host cell in question and obtaining expression of a glucoamylase variant of the invention. Suitable media are available from commercial sources, or (eg, Americ
It can be prepared according to published methods (as described in the catalog of an Type Culture Collection).

The glucoamylase variant secreted from the host cell is conveniently isolated from the medium by centrifugation or filtration and separated from the medium by a salt such as ammonium sulfate, followed by ion exchange. It can be recovered from the culture medium by a known method including using a chromatography method such as chromatography, affinity chromatography and the like.

Starch Conversion The present invention provides a method for using the glucose variant of the present invention to produce glucose or the like from starch. In general, the method comprises partially hydrolyzing the precursor starch in the presence of α-amylase, and converting α- (1 → 4) and α- (1 → 6)
Further hydrolyzing the release of D-glucose from the non-reducing end of starch or related oligo- and polysaccharide molecules in the presence of glucoamylase by cleaving glucosidic bonds.

The partial hydrolysis of the precursor starch utilizing α-amylase is based on the internal α- (1
→ 4) Provide initial degradation of starch molecules by hydrolyzing bonds. In commercial applications, the first hydrolysis using α-amylase is performed at a temperature of about 105 ° C. Very high starch concentrations, usually 30% to 40% solids, are processed. The first hydrolysis is usually performed at this elevated temperature for 5 minutes. The partially hydrolyzed starch is then transferred to a second tank and incubated for about 1 hour at a temperature of 85 ° -90 ° C. to obtain a dextrose equivalent (DE) of 10-15. Can be.

The step of further hydrolyzing the release of D-glucose from the non-reducing end of the starch or related oligo- or polysaccharide molecule in the presence of glucoamylase is usually a separate step at low temperatures between 30 ° C. and 60 ° C. Done in the tank. Preferably, the temperature of the substrate solution is reduced to 55-60 ° C. The pH of the solution is from 6 to 6.5 to 3
It is dropped to the range of 5.5. Preferably, the pH of the solution is between 4 and 4.5. Glucoamylase is added to the solution and the reaction is allowed to proceed for 24-72 hours, preferably 36 hours.
~ 48 hours.

[0070] By using the thermostable glucoamylase variants of the present invention, the saccharification process
It can be performed at higher temperatures than traditional batch saccharification processes. According to the invention, the saccharification can be carried out at a temperature in the range from 60 to more than 80C, preferably from 63 to 75C. This applies both for traditional batch processes (described above) and for continuous saccharification processes.

In practice, continuous saccharification, including one or more membrane separation steps, ie, a filtration step, may be performed to maintain a reasonably high flow over the membrane or to minimize microbial contamination. Must be carried out at a temperature above ° C. Therefore, the thermostable variants of the present invention are capable of performing large membrane continuous saccharification processes at reasonable prices and / or with low enzyme protein dosages and / or acceptable times for industrial saccharification processes. Provide gender. According to the present invention, the saccharification time can be further shortened.

The activity of a glucoamylase variant (eg, an AMG variant) of the present invention is generally
A temperature of 60C to 80C substantially higher than the traditionally used temperature of 30C to 60C. Therefore, by increasing the temperature at which glucoamylase functions, the saccharification process can be performed in a shorter time. Further, by improving the thermal stability, T _1/2 (half-time as defined in the "Materials and Methods" section) is improved. As the thermostability of the glucoamylase variants of the present invention is improved, it is necessary to add small amounts of glucoamylase to replace glucoamylase that is inactivated during the saccharification process. According to the present invention, more glucoamylase is maintained active during the saccharification process. In addition, the risk of microbial contamination is reduced when performing the saccharification process at temperatures above 63 ° C.

Examples of saccharifications in which the glucoamylase variants of the present invention can be used include JP
3-224493; JP 1-191693; JP 62-272987; and EP 452,238. The glucoamylase variant of the present invention can be used in the method of the present invention in combination with an enzyme that hydrolyzes only an α- (1 → 6) glucoside bond in a molecule having at least four glucosyl residues. Advantageously, the glucoamylase of the invention can be used in combination with a pullulanase or an isoamylase. The use of isoamylase and pullulanase for debranching, the molecular properties of the enzyme, and the potential use of the enzyme with glucoamylase are described by GMA van Beynum et al., Starch C.
onversion Technology, Marcel Dekker, New York, 1985, 101-142.

In a further aspect, the invention relates to the use of a glucoamylase variant according to the invention in a starch conversion process. Further, the glucoamylase variants of the present invention can be used in a continuous starch conversion process that includes a continuous saccharification step. The mutant glucoamylase of the present invention can also be used in an immobilized form. It is often and advantageously used for producing specialty syrups, for example maltose syrup, and also for oligosaccharide raffinate streams combined with fructose syrup production.

The glucoamylases of the invention can also be used in a method for producing ethanol for fuels or beverages, or a fermentation process for producing organic compounds such as citric acid, ascorbic acid, lysine, glutamic acid. Can be used for Finally, the present invention also relates to a method for improving the thermostability of a parent glucoamylase by forming an extension at the N-terminus. In important embodiments, the extension comprises a peptide extension.

Materials and Methods Materials: Enzymes : AMG G1: Boel et al. (1984), EMBO J. 3 available from Novo Nordisk.
(5), Aspergillus niger glucoamylase disclosed in 1097 to 1102. AM
GG2: Truncated Aspergillus niger glucoamylase G1 host cell shown in SEQ ID NO: 1, available from Novo Nordisk: Orizae JaL 125: A. Using the Oryzae pyrG gene, (G. May, “Applied Molecular Genetics of Filamentous Fungi” (1992)
Eds. JRKinghorn and G. Turner; Blackie Academic and Professi
onal) (deleted by one-step gene replacement) (Murakami K et al.
1991), Agric. Biol. Chem. 55, p. 2807-2811), Institute for Fermention, Osaka;
Aspergillus oryzae IFO 4177 available from Juso Hammachi 2-Chome Yodogawa-ku, Osaka, Japan. Strain JaL 125 is WO 97/3595
6 (Novo Nordisk).

Microorganism : Strain: Saccharomyces cerevisiae YNG318: MATαLeu2-Δ2 ura3-52 his4-539 pep4-Δ1 [cir +] Plasmid : pLaC103: Plasmid encoding truncated Aspergillus niger glucoamylase. G2. pJSO026: (S. cerevisiae expression plasmid) (JSOkkels, (1996) "A URA3-promoter deletion in a pYES vecto)
r increases the expression level of a fungal lipase in Saccharomyces cer
evisiae. Recombinant DNA Biotechnology III ”, The Integration of Biologi
cal and Engineering Sciences, vol. 782, the Annals of the New York Academ
y of Sciences). More specifically, the expression plasmid pJSO26 contains pYES2
. 0 inducible GAL1-promoter, constitutively expressed TPI (triose phosphate isomerase) -promoter from Saccharomyces cerevisiae (Albert and Karwasaki, (1982), J. Mol. Appl. Genet., 1, 419). ~ 434)
And deleting the part of the URA3 promoter,
. Obtained from 0.

Method: The transformed DNA fragment of Saccharomyces cerevisiae YNG318 and the opened vector were mixed and transformed into yeast Saccharomyces cerevisiae YNG318 by standard methods. Measurement of AGU activity 1 Novo amyloglucosidase units (AGU) were defined as the amount of enzyme that hydrolyzes 1 micromole of maltose per minute under the following standard conditions: Substrate Maltose Temperature 25 ° C pH 4 0.3 (acetate buffer) Reaction time 30 minutes Detailed description of analytical method (AF22) is available upon request.

Transformation of Aspergillus oryzae (General Procedure) 100 mL of YPD (Sherman et al. (1981), Methods in Yeast Genetics, Cold
Spring Harbor Laboratory). Oryzae spores were inoculated and incubated with shaking for 24 hours. The mycelium was collected by filtration through miracloth and washed with MgSO ₄ of 0.6M of 200 mL. 15 mycelium
mL of _{1.2M MgSO 4, 10mM NaH 2 PO} 4, was suspended in pH 5.8.
The suspension was cooled on ice and 1 mL of buffer containing 120 mg of Novozym ^™ 234 was added. After 5 minutes, 1 mL of 12 mg / mL BSA (Sigma type)
H25) and incubated at 37 ° C. for 1.5-2.5 hours with gentle agitation until many protoplasts were visible in the sample viewed under the microscope.
Continued.

The suspension was filtered through Miracloth, and the filtrate was transferred to a sterilization tube and 5 mL
0.6 M sorbitol, 100 mM Tris-HCl, pH 7.0.
Centrifugation was performed at 1000 g for 15 minutes to collect protoplasts from the top of the MgSO ₄ cushion. Two volumes of STC (1.2 M sorbitol, 10 mM Tris
-HCl, pH 7.5, 10 mM CaCl ₂ ) was added to the protoplast suspension and the mixture was centrifuged at 1000 g for 5 minutes. Put the protoplast pellet in 3
Resuspended in mL STC and pelleted again. This was repeated. Finally, the protoplasts were resuspended in 0.2-1 mL of STC.

100 μL of the protoplast suspension was combined with 5-25 μg of p3SR2 (Hynes et al.,
Mol. And Cel. Biol., Vol. 3, No. 8, 1430-1439, Aug. 1983. Plasmid containing the Nidurans amdS gene) in 10 μL of STC. The mixture was left at room temperature for 25 minutes. 0.2 mL of 60% PEG 400
0 (BDH 29576), 10 mM CaCl ₂ and 10 mM Tris-HCl
, PH 7.5, mixed carefully (twice), and finally 0.85 mL of the same solution was added and mixed carefully. The mixture was left at room temperature for 25 minutes, 2,500 g
For 15 minutes, and the pellet was resuspended in 2 mL of 1.2 M sorbitol. After one further settling, the protoplasts were transferred to a minimal plate containing 1.0 M sucrose, pH 7.0, 10 mM acetamide as a nitrogen source and 20 mM CsCl to inhibit background growth (Cove, (1966), Biochem. Biop
hys. Acta 113, 51-56). After incubation for 4-7 days at 37 ° C., the spores were removed, suspended in sterile water and spread on single colonies. This procedure was repeated, and spores of a single colony after the second re-isolation were stored as a given transformant.

Fed-Batch Fermentation Fed-batch fermentation is performed in a medium containing maltodextrin as a carbon source, urea as a nitrogen source, and yeast extract. Fed-batch fermentation is a problem for A.
The shake flask culture of the Oryzae host cells is performed by inoculating a medium containing 3.5% carbon source and 0.5% nitrogen source. After 24 hours of incubation at 34 ° C. at pH 5.0, a continuous supply of additional carbon and nitrogen sources is started. The carbon source is maintained as a limiting factor to ensure that oxygen is present in excess. The fed-batch culture can be continued for 4 days, after which it can be harvested by centrifugation, ultrafiltration, clear filtration and germ filtration. Further purification can be performed by anion exchange chromatography methods known in the art.

Purification The culture broth was filtered, and ammonium sulfate (AMS) was added to 1.7M.
Add to the concentration of AMS and adjust the pH to pH5. The precipitated material was removed by centrifugation and the solution containing glucoamylase activity was applied to a Toyo Pearl Butyl column previously equilibrated with 1.7 M AMS, 20 mM sodium acetate, pH5. Unbound material was washed off with equilibration buffer. Bound protein was eluted with 10 mM sodium acetate, pH 4.5 using a linear gradient of 1.7-0 M AMS over 10 column volumes. Glucoamylase-containing fractions were collected and dialyzed against 20 mM sodium acetate, pH 4.5.

Determination of the Thermal Stability of the Variants of the Invention The thermal stability of the variants of the invention is tested using the following method: 950 microliters of 50 mM sodium acetate buffer (pH 4.3) (NaOAc) 5 minutes, 7
Incubate at 0 ° C. Enzyme in 50 microliter buffer (4 AGU /
mL). 2 × 40 microliter samples are taken at 0, 5, 20 and / or 40 minutes each and cooled on ice. The activity measured before incubation (AGU / mL) (0 min) is used as a standard (100%). The percentage reduction is calculated as a function of the incubation time.

T _1/2 (half-life) of glucoamylase T1 / ₂ is determined by converting the glucoamylase of interest (0.18-0.36 AG / g DS) to a pH of 4.5 at the temperature of interest (eg 70 ° C.). By incubating in 30% 10DE maltodextrin. Samples were collected at set time intervals and further incubated for 24 hours at 50 ° C. to ensure that all substrate was hydrolyzed. Because maltodextrin can affect the activity assay. Incubation at 50 ° C. for 24 hours will not significantly reduce enzyme activity. After incubation, the samples were cooled and the residual enzyme activity was measured by the pNPG method (described below).

[0086] Residual glucoamylase activity (%) was measured at different times. T _1/2 was the time until relative activity was reduced to 50%. Residual enzyme activity (pNPG method) pNPG reagent: 0.2 g of pNPG (p-nitrophenylglucopyranoside) was dissolved in 0.1 M acetate buffer to make 100 mL.

Boric acid solution: Dissolve 3.8 g of Na ₂ B ₄ O ₇ .10H ₂ O in Milli-Q water and add
mL. AMG standard: aqueous solution containing a known amount of enzyme equivalent to 0.04 AGU / mL.

The samples could be diluted before analysis (1: 1 to 1: 2 with water). The following solutions were prepared: HS: 0.5 mL sample + 1 mL AMG standard + 3 mL pNPG reagent H: 0.5 mL sample + 1 mL water + 3 mL pNPG reagent B: 0.5 mL sample + 1 mL AMG standard + 3 mL boric acid solution HS and H at 50.degree. Into a water bath. After 2 hours, 3 mL of boric acid solution was added to each vial. B was placed at room temperature and after 2 hours 3 mL of pNPG reagent was added. The optical density of all three solutions was measured at 400 nm and their activities were calculated: Activity = 2 * AGU _st * (HB) / (HS-H) where HS, H and B were analyzed OD of the solution, AGU _st is the AM used
Activity of G standard.

Concentration of pAMGY The pAMGY vector was prepared as follows: the lipase gene in pJSO026 was replaced with the AMG gene, which was forwarded using the template plasmid pLAC103 containing the AMG gene; FG2: 5'-CAT CCC CAG GAT CCT TA
C TCA GCA ATG-3 'and reverse primer: RG2: 5'-CTC AAA CGA CTC ACC AGC
Amplified with CTC TAG AGT-3 '. Plasmid pJSO026 at 37 ° C for 2 hours, X
Digestion with baI and SmaI, the PCR amplicon was blunt-ended with Klenow fragment, and then digested with XbaI. The vector fragment and PCR amplicon were serially transformed into E. coli by electrotransformation. The resulting vector is designated pAMGY.

The expression plasmid pJSO37 is available from WO 97/04079 and WO 97/07.
205. It contains the pYES2.0 inducible GAL1-promoter, a TPI (triose phosphate isomerase) -promoter (Albert and Karwasaki, (1982) which is constitutively expressed from Saccharomyces cerevisiae.
, J. Mol. Appl Genet., 1, 419-434) and delete the portion of the URA3 promoter from pYES2.0.

Preparation of pLaC103 A. The Nigel AMGII cDNA clone (Boel et al. (1984), supra) was cloned from AMG GII S. Used as a source for the production of pLaC103 for cerevisiae expression. Fabrication is performed in several steps outlined below.

PT7-212 (EP 37856 / US Pat. No. 5,162,498) was converted to Xba
Cleavage with I and blunt ends with Klenow DNA polymerase and dNTPs. Ec
After cleavage with oRI, the resulting vector fragment was purified from agarose gel electrophoresis and ligated to the 2.05 kb EcoRI-EcoRV fragment of pBoe153, which resulted in the EcoRV end of the AMG coding fragment in plasmid pG2x. Reshape the XbaI site.

To remove the DNA upstream of the AMG cds and provide a suitable restriction endonuclease recognition site for the AMG coding DNA, the following construct was made: p
The 53 930 bp EcoRI-PstI fragment was isolated, subjected to AluI cleavage, and the resulting 771 bp Alu-PstI fragment was blunt-ended EcoR.
Ligation to pBR322 with an I site (described above) and cleavage with PstI. In the resulting plasmid pBR-AMG ', an EcoRI site was added to the AMG cds
Reconstituted just 34 bp from the start codon.

From pBR-AMG ', a 775 bp EcoRI-PstI fragment was isolated and ligated to the 1151 bp PstI-XbaI fragment from pGZx in a ligation reaction involving the XbaI-EcoRI vector fragment of pT7-212. The resulting plasmid pT7GII was transformed with Bam in the presence of alkaline phosphatase.
HI cleavage followed by partial SphI cleavage after inactivation of the phosphatase. From this reaction, S. aureus linked to AMG II cds was used. C. A 2489 bp SphI-BamHI fragment containing the TPI promoter was obtained.

This fragment was combined with the 1052 bp BamHI fragment of pT7GII together with pMT743 (EP 37856) obtained from SphI-BamHI digestion.
/ US Pat. No. 5,162,498). Screening for thermostable glucoamylase variants The library is screened with the thermostable filter assay described below.

Filter Assay for Thermal Stability The yeast library was filtered for at least 72 hours at 30 ° C. on a SC ura agar plate containing 100 μg / mL ampicillin on a cellulose acetate filter (OE
67, Schleicher & Schuell, Dassel, Germany). The colonies are screened with nitrocellulose filters (Protran-Ba 85, Schleicher & Schuell, Das
sel, Germany) and incubate at room temperature for 1 hour. The colonies are washed from the Protran filter with tap water. Each filter is specifically marked with a needle before incubation so that the positive mutants on the filter can be localized after screening. P with linked variants
Transfer the rotran filter to a container containing 0.1 M NaAc, pH 4.5,
Incubate for 15 minutes at 55-75 ° C. Store cellulose acetate filters on SC ura-agar plates at room temperature until use. After incubation, the remaining activity was determined by 5% maltose, 1% agarose, 50 mM NaAc.
, PH 4.5. The assay plate with the Protran filter is marked like a cellulose acetate filter and incubated at 50 ° C. for 2 hours. After removing the Protran filters, the assay plates are stained with Glucose GOD perid (Boehringer Mannheim GmbH, Germany). Mutants with residual activity are detected on the assay plate as dark green spots on a white background. The modified mutant is localized on the storage plate. The modified mutant is rescreened under the same conditions as the first screen.

General Method for Random Mutagenesis by Using the DOPE Program Random mutagenesis can be performed using the following steps: 1. Select the area in question for the modification in the parent enzyme; 2. determining the mutated and non-mutated sites within the selected region; 3. For example, determine the type of mutation to be made with respect to the required stability and / or ability of the mutant to be made; 4. Select structurally reasonable mutations; 5. adjust the residues selected by step 3 for step 4; 6. Analyze the nucleotide distribution using a suitable doping algorithm; If necessary, the required residues may be adjusted to the genetic code feasibility, eg, to avoid the introduction of stop codons, for example, taking into account constraints arising from the genetic code; Will not be used in practice and will need to be adapted. 8. 8. Make primers; 9. Perform random mutagenesis by using the primer; The resulting glucoamylase variants are selected by screening for the required altered properties.

Doping Algorithms Suitable doping algorithms for use in step 6 are known in the art.
One such algorithm is described by Tomandl, D et al., 1997, Journal of Computer-Ai.
ded Molecular Design 11: 29-38. Another algorithm is DOPE
(Jensen, LJ, Andersen, KV, Svendsen, A, and Kretzschmar, T (1998) Nucle
ic Acids Research 26: 697-702).

EXAMPLES Example 1 Generation of a Glucoamylase with an N-Terminal Extension Random mutagenesis (possibly inserting 1-7 extra amino acids after KexII site and before mature protein) Nucleotides AM11-18 and primer AM1
8 with 5 '(4244: 5'-TCA AGA ATA GTT CAA ACA AGA AGA-3') and 3 '
The overlap extension method (Horton et al. Gene Gene) was used with two primers corresponding to a sequence of about 75 bp outside the coding region at both ends (KB14: 5'-CTT TTC GGT TAG AGC GGA TG-3 '). , 77 (1989), pp. 61-68).

The following PCR reactions were performed: PCR reaction 1: 4244 as 5 ′ primer and AM1 as 3 ′ primer
8. PCR reaction 2: AM11 as 5 'primer and KB1 as 3' primer
4 (7 extra aa). PCR reaction 3: AM12 as 5 'primer and KB1 as 3' primer
4 (6 extra aa). PCR reaction 4: AM13 as 5 ′ primer and KB1 as 3 ′ primer
4 (5 extra aa). PCR reaction 5: AM14 as 5 'primer and KB1 as 3' primer
4 (4 extra aa). PCR reaction 6: AM15 as 5 'primer and KB1 as 3' primer
4 (3 extra aa). PCR reaction 7: AM16 as 5 'primer and KB1 as 3' primer
4 (2 extra aa). PCR reaction 8: AM17 as 5 'primer and KB1 as 3' primer
4 (one extra aa).

Template in the first reaction: pAMGY. Template in reactions 2-8: pAMGY or modified mutant cloned into the same vector. PCR reactions 9-15: The DNA from PCR reaction 1 together with any DNA from PCR reactions 2-8, 4244 as 5 'primer and KB1 as 3' primer
4 was used for the PCR reaction. These final PCR fragments contain the restriction enzymes SmaI (or BamHI) and X (to remove the coding region and at the same time create an overlap of about 75 bp at each end to allow recombination).
Along with pJSO026 cut with baI, it was used for in vivo recombination in yeast.

AM11: 5′-GCA AAT GTG ATT TCC AAG CGC NNS NNS NNS NNS NNS NNS NNS
GCG ACC TTG GAT TCA TGG TTG AGC-3 ′ (SEQ ID NO: 2) AM12: 5′-GCA AAT GTG ATT TCC AAG CGC NNS NNS NNS NNS NNS NNS GCG
ACC TTG GAT TCA TGG TTG AGC-3 '(SEQ ID NO: 3) AM13: 5'-GCA AAT GTG ATT TCC AAG CGC NNS NNS NNS NNS NNS GCG ACC
TTG GAT TCA TGG TTG AGC-3 '(SEQ ID NO: 4) AM14: 5'-GCA AAT GTG ATT TCC AAG CGC NNS NNS NNS NNS GCG ACC TTG
GAT TCA TGG TTG AGC-3 '(SEQ ID NO: 5) AM15: 5'-GCA AAT GTG ATT TCC AAG CGC NNS NNS NNS GCG ACC TTG GAT
TCA TGG TTG AGC-3 '(SEQ ID NO: 6) AM16: 5'-GCA AAT GTG ATT TCC AAG CGC NNS NNS GCG ACC TTG GAT TCA
TGG TTG AGC-3 '(SEQ ID NO: 7) AM17: 5'-GCA AAT GTG ATT TCC AAG CGC NNS GCG ACC TTG GAT TCA TGG
TTG AGC-3 '(SEQ ID NO: 8) AM18: 5'-GCG CTT GGA AAT CAC ATT TGC-3' (SEQ ID NO: 9) 4244: 5'-TCA AGA ATA GTT CAA ACA AGA AGA-3 '(sequence No. 10) KB14: 5'-CTT TTC GGT TAG AGC GGA TG-3 '(SEQ ID NO: 11) Example 2 Introduction of N-terminal extension by changing KexII recognition site Can be introduced by removing or changing the KexII recognition site before the above. The extension of 6 amino acids can then be introduced as a prosequence of 6 amino acids. In the yeast, KR is Kex
Optimal recognition site for II. Changes to RR will reduce the percentage of molecules cleaved (Bevan, A, Brenner, C and Fuller, RS, 1998, PNAS 95 (
18): 10384-10389). Alternatively, the introduction of P before the KR will reduce the percentage of molecules cleaved.

The prosequence was changed from NVISKR to NVISRR or NVIPKR to about 5
AMG molecules with 0% extension NVISRR or NVIPKR and 50% of normal processed mature AMG molecules were provided. Example 3 Generation of a Glucoamylase (AMG2) Mutant Containing a Cysteine Bridge The glucoamylase variant of the present invention contains the following mutations: A479C, T480
C, P481C, A471C, S431C, S8C, E299C or D375C
And the peptide extensions ACSPPTS and ASPPSTS. The parent glucoamylase (AMG2) contains the following mutations: A479C, T480C, P481C, A4
71C, S431C, S8C, E299C or D375C.

The cysteine bridge was made as follows. For the production of a mutant of the site-directed mutagenesis AMG G2 enzyme (SEQ ID NO: 11),
The nameleon double-stranded site-directed mutagenesis kit was used according to the manufacturer's instructions.

The gene encoding the AMG G2 enzyme in question is the plasmid pIVI9
Cleavage with amHI / XhoI (cut out coprinusper oxidase gene) and pLaC103 (containing G2 cDNA) as template and primer 139123 (CGCACGAGATCTGCAATGTCGTTCCGATCTCTA) (SEQ ID NO:
12) and 139124 (CAGCCGGTCGACTCACAGTGACATACCAGAGCG) (SEQ ID NO:
13) is located on pENI1542 prepared by cloning into AMG G2 containing the PCR fragment (cut with BglII / SalI) made using This was confirmed by DNA sequencing to be a mutant. According to the manufacturer's instructions, the ScaI site of the ampicillin gene of pNEI1542 was changed to a MluI site by using the following primers: 7258: 5'pgaat
ga ctt ggt tga cgc gtc acc agt cac 3 ′ (SEQ ID NO: 14) (this allows Sc found in the ampicillin resistance gene to be used to cleave at the MluI site)
aI site is changed). The pENI1542 vector containing the AMG gene in question was then ligated with DNA polymerase and oligos 7285 (SEQ ID NO: 14) and 214.
Used as template for 01 (SEQ ID NO: 15). Primer no.2
1401 (SEQ ID NO: 15) was used as a selection primer. 21401: 5 '
p gg gga tca tga tag gac tag cca tat taa tga agg gca tat acc acg cct tgg
acc tgc gtt ata gcc 3 '(SEQ ID NO: 15) The introduction of a cysteine residue is introduced into the AMG gene in question by the addition of a suitable oligo containing the required mutation as follows.

Mutagenesis oligo: ACSPPTS 137767 (SEQ ID NO: 16) (5′P-GTGATTTCCAGCGGTGCCCGCCGTCCACGTCCGCGACCTTGGATTCATGG 3 ′) ASPPSTS 137766 (SEQ ID NO: 17) (5′P-GTGATTTCCAGCGGTCCCCGCCGTCCACGTCCGCGCCGGATTATT) 5'P-GTAGCATTGTATGTGCCGTGAAGAC 3 ') S431C 146826 (SEQ ID NO: 19) (5'P-ACCGTCGTAACTGCGTCGTGCCCCTGC 3') E299C 146828 (SEQ ID NO: 20) (5'P-GTCTCAGTGACAGCTGCGCTGTTGCGGTG 3 ') A479C (5'P-CCACTACGACGTGCACCCCCACTGG 3 ') T480C 146830 (SEQ ID NO: 22) (5'P-CTACGACGGCTTGCCCCACTGGATCC 3') P481C 146831 (SEQ ID NO: 23) (5'P-CGACGGCTACCTGCACTGGATCCGGC 3 ') S8C14 4) (5'P-TGGATTCATGGTTGTGTAACGAAGCGACC 3 ') Mutant ACCPPSTS, D375C ACPPSTS, S431C ACPPSTS, E299C ACPPSTS, A479C ACPPSTS, T480C ACPPSTS, P481C CPSPSCTSC8P8C4PSCPSCTSPSCTSPSCTSPSCTSPSCTSPSCTSPSCTSPSCTSPS8C8PSCTSPSCTSC8S Confirm. The plasmid was transformed into A. cerevisiae using the method described above in the "Materials and Methods" section. Oryzae was transformed. The mutant was fermented and purified as described above in the "Materials and Methods" section.

The screening library can be screened in the thermostable filter assay described in the "Materials and Methods" section above. Example 4 Glucoamylase mutant thermostability activity with increased thermostability was measured at pH 4.5, 70, as described in the Methods section above.
Measured in ° C.

[0108]

[Table 1]

The results show that according to the present invention, the thermostability can be increased by linking an extension to the N-terminal of the glucoamylase enzyme. Example 5 The thermostability activity of the modified mutant expressed in the glucoamylase mutant yeast with increased thermostability was determined at pH 4.5, 68 ° C., as described in the Methods section above. Measured above.

[0110]

[Table 2]

Example 6 Glucoamylase Variants with Increased Thermostability The thermostable activity of the modified mutant expressed in nigels was measured on crude samples at pH 4.5 and 70 ° C. as described in the Methods section above.

[0112]

[Table 3]

N-terminal analysis of mutant ACSPPSTS + E299C showed the absence of free or oxidized cysteine at the N-terminal of this mutant, indicating that -SS between the N-terminal cysteine and the cysteine at position 299. -Indicates that a bond has been formed.

[Sequence list]

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/15 C12N 9/34 4H045 9/34 C12P 19/14 C12P 19/14 C13K 1/00 C13K 1 / 00 (C12N 1/15 // (C12N 1/15 C12R 1:69) C12R 1:69) (C12N 1/15 (C12N 1/15 C12R 1: 685) C12R 1: 685) (C12N 9/34 (C12N 9/34 C12R 1:69) C12R 1:69) (C12N 9/34 (C12N 9/34 C12R 1: 685) C12R 1: 685) C12N 15/00 ZNAA (81) Designated countries EP (AT, BE, CH) , CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA) GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY) , KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE , DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ , TM, TR, TT, TZ, UA, UG, UZ, VN, YU, ZA, ZW Isen, Kirsten Denmark-2880 Bagsba Elt, Novo Are, Novo Nordisk Aktiselskub (72) Inventor Bin, Jesper Denmark, Daek-2880 Bagsba Elt, Novo Are, Novo Nordisk Aktiselskub (72) Inventor Pedersen, Henrik, Denmark-2880, Bagusbaerto, Novo Are, Novo Nordisk Actiesel Scab F-term (reference) 4B024 AA03 AA05 BA13 CA06 DA11 EA04 FA20 GA11 GA19 HA01 HA14 4B041 LD08 LE10 LH04 LK44 LP25 4B050 CC LL02 LL05 4B064 AF02 AF04 AF14 CA22 CB07 CD19 DA10 4B065 AA62X AA62Y AA63Y AB01 AC14 BA02 CA27 CA41 4H045 AA10 AA30 BA13 BA14 BA41 CA15 DA89 EA01 FA74 GA21

Claims (38)

[Claims] 1. A mutant of a parent glucoamylase having a peptide extension at the N-terminus. 2. The mutant according to claim 1, wherein the peptide extension is linked to the N-terminus. 3. The peptide extension according to claim 1, wherein the peptide extension contains a cysteine residue.
The mutant according to item 1. 4. The method according to claim 1, wherein the peptide extension has a general formula: X—C— (X) _n (wherein X independently represents one amino acid). Mutant. 5. The mutant according to claim 4, wherein X is a non-α-helix maker. 6. The method according to claim 6, wherein the peptide extension comprises M, K, H, V, I, Y, C, F,
The variant according to claim 5, comprising a non-helix maker selected from the group consisting of T, G, N, P, S or D residues. 7. The length of the peptide extension comprises 1 to 100 amino acid residues, preferably 1 to 50 amino acid residues, more preferably 1 to 20, even more preferably 1 to 10 amino acid residues. Item 7. The mutant according to any one of Items 1 to 5. 8. The mutant according to claim 1, wherein the peptide extension part is capable of forming a covalent bond with the mature part of the parent glucoamylase. 9. The method of claim 9, wherein the cysteine residues together form a cysteine bridge.
The mutant according to any one of claims 1 to 8, wherein the variant comprises one or more cysteine residues in the peptide extension and a cysteine residue in the mature part of the parent glucoamylase. 10. The mutant according to any one of claims 1 to 9, wherein said peptide extension portion can prevent cleavage of said glucoamylase enzyme by tripeptidyl aminopeptidase. 11. The mutant according to claim 1, wherein the parent homologous glucoamylase comprises a glucoamylase from a microorganism. 12. The mutant according to claim 11, wherein said microorganisms include eubacteria, archaebacteria, fungi, algae and protozoa. 13. The mutant according to claim 12, wherein the parent homologous glucoamylase is obtained from a filamentous fungus. 14. The mutant according to any one of claims 1 to 13, wherein the parent homologous glucoamylase is Aspergillus niger G1 or G2 glucoamylase. 15. The peptide extension part comprises the following peptide extension: Asn-Val-Ile-Ser-Arg-Arg (NVISRR), Asn-Val-Ile-Pro-Lys-Arg (NVIPKR), Ala-Ser- Pro-Pro-Ser-Thr-Ser (ASPPSTS), Ala-Cys-Pro-Pro-Ser-Thr-Ser (ACPPSTS), Pro-Cys-Ser-Ala-Gly-Glu (PCSAGE), Pro-Leu-Ala -Leu-Ser-Asp (PLALSD), Leu-Gly-Val-Thr-Gly-Glu (LGVTGE), Ala-Gly-Pro-Leu-Pro-Ser-Glu (AGPLPSE), Leu-Gly-Pro-Asp ( LGPD), Ile-Phe-Glu-Leu-Thr-Pro-Arg (IFELTPR), Ile-Ser-Asn (ISN), or Met-Asn (MN). A mutant according to any of the above. 16. The mutant according to claim 3, wherein a cysteine residue in the mature portion of the parent glucoamylase is inserted or substituted for an amino acid residue of the parent glucoamylase. . 17. An aspartic acid residue at a position corresponding to position 375, position 2
A glutamic acid residue at a position corresponding to position 99; a serine residue at a position corresponding to position 431; an alanine residue at a position corresponding to position 471; an alanine residue at a position corresponding to position 479; A threonine residue, a proline residue at a position corresponding to position 481, or a serine residue at a position corresponding to position 8, is replaced with a cysteine residue in the amino acid sequence of Aspergillus niger G1 glucoamylase. The mutant according to any one of claims 1 to 16. 18. The variant according to claim 1, wherein the variant has improved thermostability compared to the parent glucoamylase. 19. A DNA sequence encoding the glucoamylase variant according to any one of claims 1 to 18. A DNA construct comprising a DNA sequence encoding the glucoamylase variant according to any one of claims 1 to 18. 21. A recombinant expression vector having the DNA construct according to claim 20. 22. A cell transformed with the DNA construct of claim 11 or the vector of claim 21. 23. The cell of claim 22, which is a microorganism, such as a bacterium or a fungus. 24. protease-deficient Aspergillus oryzae (Asper gillus oryzae) or Aspergillus niger (Aspergil lus niger) a cell according to claim 23. 25. A method for converting starch or a partially hydrolyzed starch to a syrup comprising dextrose, comprising the steps of:
A method comprising saccharifying in the presence of a glucoamylase variant according to any of claims 1 to 18. 26. The method of claim 25, wherein the glucoamylase variant is used in a method for producing ethanol for a fuel or beverage. 27. The method according to claim 25, wherein the glucoamylase variant is used in a method for producing a beverage. 28. The method according to claim 25, wherein the glucoamylase variant is used in a fermentation process to produce an organic compound, such as citric acid, ascorbic acid, lysine, glutamic acid. 29. A method for improving the thermostability of a parent glucoamylase by making an extension at the N-terminus. 30. The method of claim 29, wherein said extension comprises a peptide extension. 31. The method wherein the peptide extension comprises a non-helix maker, eg, M
, K, H, V, I, Y, C, F, T, G, N, P, S or D residues.
The method according to 0. 32. The length of the peptide extension portion is from 1 to 100 amino acid residues,
32. The method according to any of claims 29 to 31, comprising preferably 1 to 50 amino acid residues, more preferably 1 to 20, even more preferably 1 to 10 amino acid residues. 33. The method according to any of claims 29 to 32, wherein the peptide extension is capable of forming a covalent bond with the mature portion of the parent glucoamylase. 34. The peptide of any one of claims 29 to 33, comprising a cysteine residue in the peptide extension and a cysteine residue in the mature portion of the parent glucoamylase such that the cysteine residues together form a cysteine bridge. The method described in. 35. The peptide extension part comprising the following peptide extension: Asn-Val-Ile-Ser-Arg-Arg (NVISRR), Asn-Val-Ile-Pro-Lys-Arg (NVIPKR), Ala-Ser- Pro-Pro-Ser-Thr-Ser (ASPPSTS), Ala-Cys-Pro-Pro-Ser-Thr-Ser (ACPPSTS), Pro-Cys-Ser-Ala-Gly-Glu (PCSAGE), Pro-Leu-Ala -Leu-Ser-Asp (PLALSD), Leu-Gly-Val-Thr-Gly-Glu (LGVTGE), Ala-Gly-Pro-Leu-Pro-Ser-Glu (AGPLPSE), Leu-Gly-Pro-Asp ( LGPD), Ile-Phe-Glu-Leu-Thr-Pro-Arg (IFELTPR), Ile-Ser-Asn (ISN), or Met-Asn (MN). . 36. The method according to any one of claims 29 to 35, wherein a cysteine residue in the mature portion of the parent glucoamylase is inserted or substituted for an amino acid residue of the parent glucoamylase. 37. An aspartic acid residue at a position corresponding to position 375, position 2
A glutamic acid residue at a position corresponding to position 99; a serine residue at a position corresponding to position 431; an alanine residue at a position corresponding to position 471; an alanine residue at a position corresponding to position 479; A threonine residue, a proline residue at a position corresponding to position 481, or a serine residue at a position corresponding to position 8, is replaced with a cysteine residue in the amino acid sequence of Aspergillus niger G1 glucoamylase. A method according to any of claims 29 to 35. 38. The method according to any one of claims 29 to 36, wherein said peptide extension portion can prevent cleavage of said glucoamylase enzyme by tripeptidyl aminopeptidase.