JP2002528088A - Targeted gene modification by parvovirus vectors - Google Patents

Abstract

  (57) [Summary] The present invention provides a method for obtaining a target gene modification in a vertebrate cell using a parvovirus vector comprising an adenovirus associated virus (AAV). Parvovirus used in the method according to the invention. Vectors can target specific genetic modifications to preselected target loci in the cell genome by way of pairing.

Description

DETAILED DESCRIPTION OF THE INVENTION

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under Grant No. PO1HL53750 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION Technical Field The present invention relates to the field of targeted modification of cellular DNA in vertebrate cells by homologous pairing using parvovirus vectors, including adeno-associated virus (AAV) based vectors.

BACKGROUND [0003] Previously known methods for introducing limited mutations into mammalian chromosomes by gene targeting include transfection, electroporation or microinjection (Smithies et al. (1985) Nature 317: 230-23).
4; Thomas et al. (1986) Cell 44: 419-428). These methods produce homologous recombination events only in small fractions of the whole cell population, except for microinjection, in the order of 10 ^{-6 in} the case of mouse embryonic stem cells (Doetschman et al. (1987)
) Nature 330: 576-578; Thomas and Capecchi (1987) Cell 51: 503-512). Thus, the routine use of these methods requires pre-screening of transformed cells, which makes it difficult to apply the technology to normal cells and in vivo applications.

[0004] Attempts to use viral vector transduction to overcome these limitations and to accomplish chromosomal gene targeting experiments have been performed with retroviral and adenoviral vectors, but the results are: It was not significantly better than the results obtained by transfection that homologous recombination occurs in ^10-5 to ^10-6 cells (Ellis and Bernstein (1989
9) 1621-1627; Wang and Talor (1993) Mol. Cell. Biol.
3: 918-927).

[0005] Adeno-associated virus 2 (AAV) is a 4.7 kb single-stranded DNA virus developed as a transduction vector that can integrate into mammalian chromosomes (Muzyczka (199
2) Curr. Top. Microbiol. Immunol. 158: 97-129). Two-thirds of the integrated wild-type AAV provirus are found at a specific human chromosome 19 site 19q13-qter (Ko
tin et al. (1991) Genomics 10: 831-834; Kotin et al. (1990) Proc. Natl. A
cad. Sci. USA 87: 2211-2215; Samulski et al. (1991) EMBO J. 10: 3941-3950.
). The site-specific integration event is a heterologous recombination reaction thought to be mediated by the viral Rep protein (Giraud et al. (1995) J. Virol. 69: 691769).
24; Linden et al. (1996) Proc. Natl. Acad. Sci. USA 93: 7966-7972). This feature has been found to be useful in some applications, but the virus rep
AAV vectors with deletions in the gene have not been found to integrate at this same locus (Russell et al. (1994) Proc. Natl. Acad. Sci. USA 91 :: 8915-89).
19; Walsh et al. (1992) Proc. Natl. Acad. Sci. USA 89 :: 7257-7261). Southern analysis of the integration rep ^- AAV vector provirus suggests that the integration site is random (Lebkowski et al. (1988) Mol. Cell. Biol. 8: 3988-39).
96; McLaughlin et al. (1988) J. Virol. 62: 1963-1973; Russell et al. (1994
) Supra; Walsh et al. (1992) supra), and sequencing of the integration vector junction fragment confirms that integration occurs by heterologous recombination at various chromosomal sites.

[0006] Although the development of eukaryotic virus-based vector integration has enabled efficient transfer of genes into mammalian chromosomes, there are a number of situations where it is desirable to modify certain chromosomal sequences. I do. For example, rather than introducing a corrected version of the gene at a chromosomal location other than the original locus for the gene, a defective allele at the original locus may be corrected. This ability can eliminate unwanted chromosomal genotypes and avoid position effects on gene expression. The need for such an ability to modify pre-existing loci is particularly urgent in gene therapy, where mutant genes can have a dominant effect and tissue-specific regulation of expression is Often serious.

[0007] Therefore, there is a need for a method for obtaining specific genetic modifications at a selectable marker site in the genome of vertebrate cells at a high frequency. The present invention fulfills this and other needs. SUMMARY OF THE INVENTION The present invention provides a method for producing vertebrate cells having a modification at a preselected target locus. The method comprises the steps of: a) a targeting construct comprising a DNA sequence that is substantially identical to the target locus except that the modification has been introduced; and b) at least one
Contacting a cell with a recombinant parvovirus vector genome comprising all or part of one parvovirus ITR or functional equivalent. Upon entry of the vector into the cell, homologous pairing occurs between the targeting construct and the target locus, resulting in a modification being introduced at the target locus. Modifications can include one or more deletions, insertions, substitutions, or combinations thereof. The method comprises the steps of: Can be used to introduce Yet another target locus can be modified by transduction with a parvovirus vector having the appropriate targeting construct. More than one targeting construct may be included on each parvovirus vector.

[0008] Further, a DN that is substantially identical to the target locus except that a modification has been introduced
Contacting a cell with a parvovirus vector having a recombinant viral genome that includes a targeting construct comprising an A sequence, the specific gene at one or more preselected target loci introduced into the cell or ancestor of the cell Vertebrate cells containing the modifications are also provided by the invention. These cells are used in vitro, ex v
It can be cultured ivo or exist as part of an organism.

The present invention relates to a) a targeting construct comprising a DNA sequence that is substantially identical to the target locus, except that a modification has been introduced, and b) at least one parvovirus ITR or functional equivalent thereof. A method for introducing a modification of a target locus in a vertebrate cell is also provided by ex vivo contacting a cell with a recombinant parvovirus vector containing all or a portion of the target gene. The recombinant parvovirus vector is introduced into the cell, after which homologous pairing between the targeting construct and the target locus occurs, resulting in the modification being introduced into the cellular DNA of the target locus. The modified cells are then introduced into a vertebrate.

[0010] In another embodiment, the invention provides a method of producing a modification of a target locus in a cell in a vertebrate by administering the recombinant parvovirus vector to the vertebrate. The parvovirus vectors used in these methods include: a) a targeting construct comprising a DNA sequence that is substantially identical to the target locus except that the modification has been introduced; and b) at least one parvovirus ITR or its Includes all or some of the functional equivalents. The recombinant viral genome is introduced into the cell, after which homologous pairing between the targeting construct and the target locus occurs, resulting in the modification being introduced into the cellular DNA of the target locus.

[0011] The present invention also provides a method for producing an animal containing cells having the target locus modification. The method comprises the steps of: a) a targeting construct comprising a DNA sequence that is substantially identical to the target locus except that a modification has been introduced; and b) at least one
Introducing a recombinant parvovirus vector containing all or part of one parvovirus ITR or functional equivalent into cells into which the animal can be reconstituted. Homologous pairing between the targeting construct and the target locus occurs, resulting in modifications that have been introduced into the cellular DNA of the target locus. The cells and / or progeny of the cells are then developed into embryos, reaching the end of the month. The resulting animal can be a transgenic or chimeric animal, which is also part of the present invention.

In another embodiment, the method of the invention is used to obtain a modified nucleus for use in nuclear transfer. These methods involve using the gene targeting methods of the present invention to introduce desired modifications at target loci in the genome of the cell to serve as a nuclear donor. Nuclei from cells having the desired modifications are introduced into secondary cells from which the animal can be reconstituted. The cells are then developed into the embryo, reaching the end of the month. Furthermore, the resulting animals, which are transgenic or chimeric, are also provided by the present invention.

[0013] The invention also provides a method for introducing a recombination signal into the genome of a cell. These recombination signals, e.g., lox sites, are specific polynucleotide sequences (e.g.,
(Eg, a Cre polypeptide). In these embodiments, the targeting construct comprises a recombination signal flanked by polynucleotide sequences that are substantially identical to the target locus. Upon introduction of the targeting construct into the cell, homologous pairing occurs with respect to the target locus, resulting in a recombination signal being introduced at the target locus.

[0014] Methods for enhancing the efficiency of gene targeting are also provided by the present invention. In some embodiments, the recombinant parvovirus vector comprises a targeting enhancer. Enhancers can include, for example, modifications to the polynucleotide, such as addition products, pyrimidine dimers, deletions of sugars and / or bases, or other modifications of the DNA backbone. Targeting enhancers can also include polypeptides that can enhance gene targeting, such as recombinant polypeptides, DNA repair enzymes, and the like. These can be contained, for example, in virus particles.

[0015] Another method provided by the present invention for enhancing the efficiency of gene targeting involves treating target cells with an agent that enhances targeting efficiency. These agents include, for example, one or more cell cycle modulators, DNA repair modulators, DNA recombination modulators, modulators of chromatin packaging, inhibitors of apoptosis and DNA
And methylation inhibitors.

The invention also provides a method for determining the efficiency of parvovirus vector-mediated gene targeting. These methods involve providing a cell with an integrated retroviral provirus that includes a defective reporter gene. Reporter genes are defective in that they have a primary mutation that prevents expression of a reporter gene product with a detectable phenotype. The retroviral provirus serves as a target locus that is uniform in every cell. The recombinant parvovirus vector is then introduced into the cell. The recombinant parvovirus vector includes at least a polynucleotide subcell of the reporter gene, wherein the polynucleotide subsequence overlaps the location of the primary mutation, but does not include the primary mutation. Reporter gene subsequences present in parvovirus vectors may be due to secondary mutations that prevent expression of the reporter gene product with a detectable phenotype, or because the subsequence does not encode a full-length reporter gene product. Does not encode a functional reporter gene product. Homologous pairing occurs between the polynucleotide subsequence and the reporter gene, resulting in correction of the primary mutation and expression of the reporter gene. Next, the efficiency of gene targeting is determined by detecting the presence or absence of the reporter gene product.

[0017] Yet another embodiment of the invention provides a method for enriching for cells that have undergone gene targeting at a target locus. The method includes providing a) a reporter gene that includes a primary mutation that prevents expression of a reporter gene product having a detectable phenotype, and b) a cell having a target locus where modification is desired. The recombinant parvovirus vector is introduced into these cells with the following elements: a) a selection construct that includes the polynucleotide subsequence of the reporter gene, wherein the polynucleotide subsequence is the primary mutation But does not contain a primary mutation and includes a secondary mutation that prevents expression of a reporter gene product with a detectable phenotype, and b) the target except that a modification has been introduced. A targeting construct comprising a DNA sequence that is substantially identical to the locus. Next, cells in which the reporter gene product is expressed are identified. Cells expressing the reporter gene product include a population of cells in which homologous pairing has occurred between the polynucleotide subsequence and the reporter gene, resulting in correction of a primary mutation and expression of the reporter gene. This population of cells is then screened to identify those that have undergone homologous pairing between the targeting construct and the target locus, resulting in the modification being introduced into the target locus.

DETAILED DESCRIPTION OF THE INVENTION Definitions Unless defined otherwise, all technical and scientific terms used herein are
It has the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.

The term “cell line” as used herein refers to individual cells, harvested cells and cultures containing cells as long as they are obtained from the cells of the cell line to which they belong. A cell line is said to be "continuous", "immortal" or "stable" if its lower part is still viable for a long period of time, typically at least about 6 months.
For a cell line to be considered, the cells herein must be viable for at least about 50 passages. "Primary cells" or "normal cells"
In contrast, refers to cells that have not been able to grow in culture for long periods of time.

“Cis-active nucleic acid” refers to a nucleic acid subsequence that encodes or directs the biological activity of a nucleic acid sequence. For example, a cis-active nucleic acid contains the nucleic acid subsequences necessary for modification of the nucleic acid sequence in the host chromosome, and an origin of nucleic acid replication. The term "constitutive promoter" refers to a promoter that is active under most environmental and developmental conditions.

The term “equivalent conditions” refers to developmental, environmental, growth phases and other conditions that can affect the cell and the expression of a particular gene by the cell. For example, when the inducibility of gene expression by a hormone is studied, two cells are under equivalent conditions if the level of the hormone is approximately the same for each cell. Similarly, if the cell cycle specificity of gene expression is under study, the two cells are under the same conditions if they are at approximately the same stage of the cell cycle.

The term “exogenous” as used herein refers to a moiety added to a cell either directly or by expression from a gene that is not present in a wild-type cell. "
Included within this definition of "exogenous" are those portions that have been added to the parent or early ancestors of the cell and that are present in the cell as a result of being passaged from the parent cell.
As a control, "wild-type" refers to cells that do not contain an exogenous moiety. "Exogenous D
"NA" as used herein refers to one or more deletions, point mutations, as compared to a DNA sequence in a wild-type target cell, as well as a DNA sequence that is not present in the wild-type cell or viral genome. Includes DNA sequences having mutations and / or insertions, or mixtures thereof. The term "homologous pairing" as used herein refers to a possible pairing between two nucleic acid sequences or subsequences that are complementary or substantially complementary to each other. As described below, two sequences are substantially complementary to each other if one of the sequences is substantially identical to a nucleic acid that is complementary to the secondary sequence.

The term “host cell” or “target cell” refers to a cell transduced with a specialized vector. The cells are optionally selected from in vitro cells, eg, obtained from cell culture, ex vivo cells, eg, obtained from an organism, and in vivo cells, eg, cells within an organism. The term "identical", in the context of two nucleic acid or polypeptide sequences, refers to residues in two sequences that are identical when aligned for maximum similarity. Optimal alignments for comparison can be found, for example, in Smith and Waterman (1981) Adv. Appl.
Math. 2: 482, by the local homology algorithm, Needleman and Wunsch (1970) J. Mol. Bi
ol. 48: 443, by the homology alignment algorithm of Pearson and Lipman (1988) Proc.
Natl. Acad. Sci. USA 85: 2444 for a search for similarity by computerized implementation of these algorithms (Wisconsin Genetics Software Package, Genetics).
GAP, BESTFI at Computer Group, 575 Science Dr., Madison, WI
T, FASTA and TFASTA) or by inspection.

When two nucleic acid sequences are "substantially identical", the polypeptide encoded by the primary nucleic acid immunologically cross-reacts with the polypeptide encoded by the secondary nucleic acid. . Another meaning that two nucleic acid sequences are substantially identical is that the two molecules and / or their complementary strands hybridize to each other under stringent conditions.

The phrase “specifically hybridizes” refers to the binding of a molecule to only a particular nucleotide sequence under stringent conditions when the sequence is present in a complex mixture (eg, whole cell) DNA or RNA; Duplication, refers to hybridization. "Stringent conditions" refer to conditions under which a probe will hybridize to its target subsequence but will not hybridize to other sequences. Stringency conditions are sequence-dependent and will be different in different circumstances. The longer the sequence, the higher the specific hybridization temperature. In general, the stringent conditions are the heating melting point (T
m) about 5 ° C lower. Tm is the temperature at which 50% of the probes complementary to the target sequence hybridize with the target sequence at equilibrium (limited ionic strength, pH
(And under nucleic acid concentration) (Tm occupies 50% of the probe at equilibrium because the target sequence is generally redundant). Typically, the stringent conditions are p
H 7.0-8.3 and a salt concentration of less than about 1.0 M, typically about 0.01-1.0 M sodium ion (or other salt), and a temperature of at least about 30 for short probes (eg, 10-50 nucleotides). ° C, long probe (eg longer than 50 nucleotides)
Is at least about 60 ° C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.

An “inducible” promoter is a promoter that is under environmental or developmental regulation. The term "labeled nucleic acid probe" is used to indicate that the presence of the probe can be detected by detecting the presence of the label bound to the probe, such as by a linker or by an ionic, van der Waals or hydrogen "bond". Refers to a nucleic acid probe attached to a label.

The term “label” refers to a moiety that is detectable by spectroscopic, radiological, photochemical, biochemical, immunological or chemical means. For example, useful labels include ³² P, ³⁵ S, fluorescent dyes, high electron density reagents, enzymes (such as those commonly used in ELIS), biotin, dioxygenin, green fluorescent protein (G
FP), or haptens and proteins for which antisera or monoclonal antibodies are available.

The term “nucleic acid” refers to a single-stranded or double-stranded passage of a deoxyribonucleotide or ribonucleotide polymer, and unless otherwise limited, the known nature of a natural nucleotide that hybridizes to a nucleic acid in a manner similar to the natural nucleotide. Analogs. Unless otherwise specified, a particular nucleic acid sequence includes its complementary sequence. The term "operably linked" refers to an operable linkage between a nucleic acid expression control sequence (eg, an array of promoter or transcription factor binding sites) and a secondary nucleic acid sequence, wherein the expression control The sequence directs the transcription of the nucleic acid corresponding to the secondary sequence.

The term “recombinant parvovirus vector genome” refers to parvovirus DN
A refers to a vector genome derived from parvovirus which carries non-parvovirus DNA in addition to A. Recombinant vector genomes typically include at least one targeting construct. The term "replicating cells" refers to cells undergoing the cell cycle, including the S and M phases of DNA synthesis and mitosis.

The term “subsequence”, in the context of a particular nucleic acid sequence, refers to a region of a nucleic acid that is less than or equal to a particular nucleic acid. "Target locus" as used herein refers to the region of the cellular genome where genetic modification is desired. The target locus typically contains the special nucleotide to be modified, as well as additional nucleotides on one or both sides of the modification site.

“Targeting construct” refers to a DNA molecule present in the recombinant parvovirus vector used in the methods of the invention, and one or more modifications that are introduced into the host genome at the target locus. Others include regions that are identical or substantially identical to regions of the target locus. The modification may be at either end of the targeting construct or may be internal to the targeting construct. The modification can be one or more deletions, point mutations and / or insertions or a combination thereof, as compared to the DNA in the wild-type target cell.

The term “transduction” refers to the transfer of genetic material by infection of a recipient cell with a recombinant viral vector. Cells that have received the recombinant parvovirus vector DNA, and thereby have been genetically modified, are referred to herein as "transduced cells", "trans Referred to as "transfected cells", "modified cells" or "recombinant cells".

The term “transgenic cell” refers to a cell that contains a special modification of the chromosome or other nucleic acid of the cell, wherein the special modification has been introduced into the cell or an ancestor of the cell. Such modifications may include one or more point mutations, deletions, insertions or combinations thereof. When referring to an animal, the term "transgenic" means that the animal contains cells that are transgenic. Animals consisting of both transgenic and non-transgenic cells are referred to herein as "chimeric" animals.

[0034] The term "vector" refers to an agent for transferring a nucleic acid (or nucleic acids) to a host cell. The vector includes a nucleic acid containing the nucleic acid fragment to be transmitted,
And optionally a viral capsid, or other material to facilitate entry of the nucleic acid into the host cell and / or replication of the vector in the host cell (eg, a reversal packaged within or as part of the capsid). Transcriptase or other enzymes).

The term “viral vector” refers to a vector that includes viral nucleic acids and may also include viral capsid and / or replication functions. DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention provides a method for producing vertebrate cells having a specific modification of a target locus. Genetically modified cells and animals produced using these methods are also provided. The method involves introducing into a cell a recombinant parvovirus vector capable of targeting genetic modification to a particular target locus by homologous pairing. The recombinant viral genome of the parvovirus vector used in the present method includes a targeting construct comprising a DNA sequence that is substantially identical to the target locus, except that the modification has been introduced. Upon introduction of the recombinant viral genome into a cell, homologous pairing occurs between the targeting construct and the target locus, resulting in the introduction of a special genetic modification at the target locus.

The method of the present invention allows for the precise modification of the genome of a cell. This avoids undesirable effects such as disruption of the desired gene due to insertion of an exogenous gene that can occur when other methods of modifying the genome are used. In addition, precise alterations of genes or regulatory regions that allow for correction of endogenous genes can be achieved without, for example, inserting corrected copies of the gene elsewhere in the genome. The method avoids the often observed "position effect" where the level of expression of the exogenous gene largely depends on the location in the genomic DNA of the cell where the exogenous gene becomes integrated. The method allows for the modification of genes that are too large to be introduced into cells by other methods. Rather than introducing a full copy of the gene containing the desired modification,
To modify only the desired portion of the gene, the methods of the invention can be used. The method of the invention uses a recombinant parvovirus vector to insert DNA containing the desired genetic modification into the vertebral cells to be modified. A general introduction to human parvovirus can be found, for example, in Pattison (1994) Principles and Practice of Clinical Vi
rology (Chapter 23) Zuckerman et al. eds, John Wiley & Sons Ltd. and Berns (1991) "Parvoviridae and their Replication," In Fundamental Viro
logy, Fields, Ed., Raven Press, New York, pp. 817-837, as well as in the references cited therein. The best characterized human parvovirus is B1
9 and AAV, both of which are used as a basis for transduction vectors, eg, for gene therapy. Other parvovirus vectors that can be used include the parvovirus vector LuIII (Maxwell et al. (1992).
3) Human Gene Ther. 4: 441-450) and mouse small virus (mvm) (Rus
sel et al. (1992) J. Virol. 66: 2821-2828).

In a preferred embodiment, the method uses a viral vector derived from an adeno-associated virus (AAV). AAV is a single-stranded replication defective DNA having a 4.7 Kb genome
It is a virus. Adeno-cooked rice viruses are easily obtained and their use as vectors for gene delivery is described, for example, in Muzyczka (1992) Curr. Top. Microbiol.
. Immunol. 158: 97-129, U.S. Patent No. 4,797,368 and PCT application WO 91/18088. Samulski (1993) Current Opinion in Genetic and Developme
nts 3: 74-80 and references cited therein provide a review of the AAV life cycle. For a general review of AAV and of the pathogenesis / function of adenovirus or herpes, see Bern and Bohensky (1987) Advances in Virus Research, Academic Pr.
ess., 32: 243-306. The genome of AAV is described in Srivastava et al. (198
3) J. Virol .. 45: 555-564. Carter et al. (U.S. Pat.
Describes a number of relevant planning considerations for constructing recombinant AAV vectors (see also Carter, WO 93/24641). Additional references describing AAV vectors include, for example, West et al. (1987) Virology 160: 38-47; Kotin (1994) Hu.
man Gene Therapy 5: 793-801; and Muzyczka (1994) J. Clin. Invest. 94: 135.
1 Construction of recombinant AAV vectors has also been described in a number of further publications, such as Lebkowski (US Pat. No. 5,173,414); Lebkowski et al. (1988) Mol. C.
ell. Biol. 8: 3988-3996; Tratschin et al. (1985) Mol. Cell. Biol. 5 (11):
3251-3260; Traschin et al. (1984) Mol. Cell. Biol. 4: 2072-2081; Hermonat
and Muzyczka (1984) Proc. Natl. Acad. Sci. USA, 81: 6466-6470; McLaughlin
et al. (1988) and Samulski et al. (1989) J. Virol. 63: 03822-3828. AAV is a defective human parvovirus, which means that the virus can replicate and produce virus particles only in cells that are also infected with helper virus. To obtain the integration of the AAV genome into mammalian cells,
Cells are infected with AAV in the absence of a helper virus.

The parvovirus genome has an inverted terminal repeat (ITR) at each end.
For use in the methods of the present invention, the recombinant parvovirus vector genome typically has all or part of at least one ITR, or a functional equivalent, which generally Required for parvovirus vectors,
Packaged in parvovirus particles. The functional equivalent of an ITR is typically an inverted repeat, which can form a hairpin structure. Both ITRs are often present in the recombinant parvovirus vector DNA used in the method. The viral genome can be used in single-stranded or double-stranded form.

[0039] The recombinant viral genome of the parvovirus vector used in the method for genetically modifying a vertebrate cell is, except for the desired modification, identical or substantially identical to the target locus where genetic modification is desired. A targeting construct that is The targeting construct generally has at least about 20 nucleotides, preferably at least about 100, more preferably about 1000-5000 nucleotides or more, that is identical or substantially identical to the nucleotide sequence of the corresponding region of the target locus. Including the above. "Substantially identical" means that this portion of the targeting construct is at least about 80%, more preferably at least about 90%, and most preferably at least about 99% identical to the corresponding region of the target locus. means.

[0040] The targeting construct also includes one or more genetic modifications introduced into the target locus. Modifications may include one or more insertions, deletions or point mutations, or a combination thereof, as compared to the DNA sequence of the target locus.
For example, to modify a target locus by introducing a point mutation, the targeting construct comprises a DNA sequence that is at least substantially identical to the target locus except for the specific point mutation introduced. Upon introduction of the recombinant viral genome into the cell, homologous pairing occurs between portions of the targeting construct that are substantially identical to the corresponding region of the target locus, followed by the introduced mutation present in the targeting construct. DNA sequence replaces the sequence at the target locus.

The targeting construct may have a genetic modification at the end or in a region of the targeting construct that is identical or substantially identical to the target locus. To delete a portion of the target locus, for example, the genetic modification is generally present in the targeting construct and flanks two regions that are substantially identical to the target locus. Homologous pairing between the two substantially identical regions and their corresponding regions in the target locus results in a portion of the sequence of the targeting construct, including the deletion, and becomes integrated at the target locus. Deletions can be targeted precisely at the desired location by this method. Similarly, genetic modifications involving site-specific insertion of a DNA sequence into a target locus can be achieved by targeting constructs having the DNA sequence flanked or flanked by regions substantially identical to the target locus. Can be achieved. Following homologous pairing between the targeting construct and the corresponding region of the target locus, integration of the inserted sequence into the target locus occurs.

[0042] The methods of the invention can be used to introduce modifications at more than one target locus. For example, to introduce one or more modifications to a secondary target locus in the cell genome, the cell is at least substantially identical to the secondary target locus except for the desired modification or modifications. It can be contacted with a parvovirus vector having the recombinant viral genome with the targeting construct. The targeting construct for the secondary target locus can be present in the same parvovirus vector as the targeting construct for the primary target locus, or can be present in the secondary parvovirus vector. If the primary and secondary targeting constructs are in different parvovirus vectors, the cells can be transduced with the vectors sequentially or simultaneously. To obtain modifications at more than two target loci, the method is simply repeated as desired.

[0043] Structural genes, regulatory regions and other sequences in the genome or other DNA of a vertebrate cell are susceptible to modification using the methods of the invention. “Structural gene” refers to the transcribed region of a gene, whether or not the gene is transcribed in a particular cell. For example, special changes in the structural gene that can alter the gene product of the gene or prevent the gene product from being expressed can be introduced. In this embodiment, the recombinant viral genome may include a targeting construct that is identical or substantially identical to the target locus, except for the special nucleotide changes introduced. Homologous pairing between the targeting construct and the target locus in the cellular DNA results in modifications present in the targeting construct that become incorporated into the target locus. For example, if the gene product is a polypeptide, to obtain a gene encoding a polypeptide having one or more special hemp substitutions, insertions or deletions compared to the polypeptide encoded by the native gene The method of the invention can be used. The method further comprises codons that, when present, identify amino acids that result in a polypeptide that is inactive or has less activity than desired.
Amino acids that restore normal activity on the polypeptide may be replaced by codons specifying the amino acids. Many genetic disorders characterized by one or more mutations that result in amino acid changes can be corrected using the methods of the present invention. As another example, the target region can be modified by substituting a codon that identifies the glycosylation site for a codon that encodes an amino acid that is not part of the glycosylation site, and vice versa. As yet another example, a protease cleavage site may be created or destroyed. Nonsense codons present in the target locus can be changed to sense codons, or if disruption of the polypeptide is desired, a nonsense mutation can be introduced into the target locus. By incorporating into the targeting construct exogenous DNA encoding a portion of the fusion protein that can be linked to the endogenous protein, a fusion protein is obtained. Exogenous DNA is introduced upon incorporation of the DNA sequence of the targeting construct into the cellular genome of the target locus.
Located in the proper reading frame for translation of the fusion protein.

Similarly, where the gene product is a nucleic acid, the method can be used for modification of the gene product. RNA genes that can be modified using the methods of the invention include those expressed therefrom, tRNA, ribosomal RNA, ribozymes, telomerase subunits, and the like. Alternatively, the method can be used to construct a gene whose end product is an endogenous nucleic acid linked to an exogenous nucleic acid. For example, exogenous DNA, which when transcribed produces a catalytic RNA, can be linked to an endogenous gene. The RNA transcribed from the fusion gene hybridizes to an endogenous nucleic acid that is substantially complementary to the endogenous portion of the fusion gene, after which a portion of the hybrid ribozyme expressed from the exogenous DNA becomes its normal The reaction can be catalyzed. Thus, the fusion gene obtained using the method of the present invention provides a means for targeting ribozymes.

[0045] The method of the present invention is also useful for substituting, deleting or inserting nucleotides that create regulatory regions involved in the expression of the gene. The change control area is, for example,
Gene expression can be altered by increasing or decreasing the expression level of the gene as compared to the expression level under equivalent conditions in unmodified cells. Modifications can cause, for example, expression of the gene under conditions where the gene is not typically expressed, or can prevent expression of genes that are normally expressed under certain circumstances. To insert a heterologous transcription control element at a certain position or to modify an endogenous control element, such as a promoter, enhancer, transcription termination signal, relative to the gene, which is appropriate to affect the expression of the gene. In addition, the method of the invention can be used. By replacing a constitutive promoter with an inducible promoter, expression of the gene may be correlated with the presence or absence of a particular environment or developmental stimulus. Similarly, R
Regions involved in post-transcriptional modifications such as NA splicing, polyadenylation, translation, as well as regions encoding amino acid sequences involved in post-translational modifications are inserted,
It can be deleted or modified. Examples of gene expression control elements that can be modified or replaced using the methods of the present invention include response elements, promoters, enhancers, locus control regions, binding sites for transcription factors and other proteins, other transcription initiation signals. , Transcription elongation signals, introns, RNA stability sequences, transcription termination signals, polyadenylation sites and splice sites. Gene expression can be regulated by using the methods of the present invention to introduce or destroy DNA methylation sites.

In one embodiment, the method of the invention is used to obtain selective expression of a nucleic acid in a cell. Selective expression of a nucleic acid is expressed in a desired cell type and / or under desired conditions (eg, upon induction), but substantially in an undesired cell type and / or under undesired conditions. Refers to the ability of a nucleic acid to not be expressed. Thus, the site and degree of expression of a particular nucleic acid sequence can be adjusted in a desired manner. This is achieved, for example, by introducing site-specific nucleotide substitutions, deletions or insertions to create nucleotides containing regulatory elements that are selectively expressed in the desired cell type and / or under the desired conditions. Is done. This may be by altering nucleotides already present in the target locus, by incorporating exogenous DNA containing sequences that function as all or part of a control element into the target locus, or a combination of these modifications Can be achieved by

For example, the method of the present invention provides a cis-protein that interacts with a transactivating or transrepressing compound (usually a protein that complexes with another substance) to stimulate or repress transcription, respectively. It can be used to introduce or destroy a response element that is a working nucleic acid sequence. Response elements that can be introduced or eliminated using the methods of the present invention include cell-selective response elements, hormone receptor response elements, carbohydrate response elements, antibiotic response elements, and the like. The cell sorting response element can be activated by a transactivation regulatory element that is selectively produced in the cell type (s). The selection of a cell-selective response element used in the present method depends on whether the cell whose expression is desired to produce a transactivator that acts on the response element or the cell whose expression is desired to be suppressed does so. For example, selective expression of genes in pancreatic acinar cells, lens tissue, B cells, hepatocytes, and HIV infected cells can be performed using the methods of the present invention to elastase I enhancers, γ-crystallin gene responsive elements, immunoglobulin heavy and // light chain enhancers, liver enhancers such as α-1 antitrypsin or serum albumin enhancer, chorionic gonadotropin α- or β-chain enhancer, interleukin-2 (IL-
2) Can be achieved by introducing an enhancer, an IL-2 receptor enhancer, or a human immunodeficiency virus (HIV) response element, such as a TAR site, respectively.

A hormone receptor responsive element that can be activated or inhibited when a hormone or its functional equivalent interacts with a cellular receptor for that hormone is introduced into a desired location using the methods of the present invention. obtain. The hormone-receptor complex is internalized into the cell, where it selectively interacts (directly or indirectly) with an appropriate hormone receptor responsive element, thereby making the element operable. Activate or suppress the expression of a gene linked to To obtain hormone responsive induction or suppression of expression, the invention is used to create a hormone responsive element upstream of the regulated gene. Gene expression is regulated by hormones in cells that express receptors for certain hormones.

[0049] Antibiotic response elements are modulated by the presence or absence of the antibiotic. For example, a tetracycline responsive device is responsive to tetracycline. Similarly, carbohydrate responsive elements are modulated by the presence or absence of certain carbohydrates or analogs thereof. Other response elements, as well as promoters, enhancers and other regulatory regions are well known to those skilled in the art. These can also be made and destroyed by the method of the present invention.

[0050] The method of the present invention can be used for DNA replication (eg, Kornberg and Baker, DNA Replicatio).
^{n, 2 nd Ed., WH} Freeman & Co., 1991), and matrix attachment region (
For example, Bode et al. (1996) Crit. Rev. Eukaryot. Gene. Expr. 6: 115-38;
nucleic acids involved in other cellular processes, such as ulikas (1993) J. Cell. Biochem. 52: 14-22), chromatin recombination hotspots (see, eg, Smith (1994) Exerientia 50: 234-41). It can also be used to modify a sequence.

The present invention also provides a method for introducing a recombination signal into a cell. In a preferred embodiment, special recombinases are available that can catalyze recombination with a recombination signal. To introduce a recombination signal into the cell genome, one or more recombination signals are included in the targeting construct, which also contains a sequence that is at least substantially identical to the target locus. Homologous pairing and subsequent gene repair result in the incorporation of the recombination signal (s) into the target locus.

[0052] One suitable recombination system is the Cre-lox system. In the Cre-lox system, the recombination site is
Called the "x site" and the recombinant enzyme is called "Cre". When the lox sites are in a parallel orientation (ie, in the same direction), Cre catalyzes the deletion of the polynucleotide sequence between the lox sites. If the lox site is in the opposite orientation, Cre recombinase will catalyze the inversion of the intervening polynucleotide sequence. Thus, for example, to introduce two lox sites into the target locus, oriented in opposite directions, and to obtain an inversion of the region between the lox sites by contacting the lox site with a Cre polypeptide. Can be used. For example, if two lox sites flank the promoter, expression of the gene may be turned off simply by controlling the presence or absence of the Cre polypeptide. Such sites are also useful for introducing DNA that also contains the recombination signal at the location of the recombination signal at the target locus. In some embodiments, the gene encoding the Cre polypeptide is under the control of a constitutive or inducible promoter.

Lox511 (Hoess R. et al., Nucleic Acids Res. 14: 2287-2300 (1986)), lox511
x66, lox71, lox76, lox75, lox43, lox44 (Albert H. et al., Plant J.7 (4)
; 649-659 (1995)). This system employs various host cells, such as mammalian cells (US Pat. No. 4,959,317, Sauer, B. e.
Natl. Acad. Sci. USA 85: 5166-5170 (1988); Sauer, B. et al.
, Nucleic Acids Res. 17: 147-161 (1989)), brewer's yeast (Sauer, B., Mol).
Cell Biol. 7: 2087-2096 (1987)), as well as plants such as tobacco (Dale, E. e.).
t al., Gene 91: 79-85 (1990)) and Arabidopsis (Osborne, B. et al.,
Plant J. 7 (4): 687-701 (1995)). The use of the Cre-lox system in plants
It is also described in US Pat. No. 5,527695 and PCT application WO 93/0128.

[0054] Several other recombinant systems are also suitable for use in the present invention. Examples of these include, for example, the FLP / FRT system of yeast (Lyznik, LA et al., Nucleic Acids Re
s. 24 (19): 3784-9 (1996)), Gin recombinase of phage Mu (Crisona, NJ
et al., J. Mol. Biol. 243 (3): 437-57 (1994)), E. coli Pin recombinase (
See, for example, Kutsukake K. et al., Gene 34 (2-3): 343-50 (1985)), PinB, PinD and PinF from Shigella (Tominaga A et al., J. Bacteriol. 173 (13)). :Four
079-87 (1991)), and the R / RS system of the pSR1 plasmid (Araki, H. et al.,
J. Mol. Biol. 225 (1): 25-37 (1992)). Thus, recombinant enzyme systems are obtained from vast and still increasing sources.

[0055] Due to their use of parvovirus vectors to deliver recombinant viral genomes to cells, the methods of the invention are much more than previously possible with other methods of site-specific modification of DNA in vertebrate cells. Produce the desired specific genetic modification that occurs frequently. Using this method, a desired modification frequency of typically 0.01% or more is obtained. In fact, efficiencies greater than 0.1%, and even greater than 1%, are obtained using the method. The efficiency of genetic modification depends in part on the multiplicity of infection (MOI; defined herein as units of vector particles per cell) used for transduction, as well as the type of cells transduced. . In an exemplary embodiment, to transduce cells obtained from a continuous cell line, about 1 to 1
0 ¹² MOI is used. More preferably, the MOI is at least about 10 ⁴ , most preferably, the MOI used in the methods of the invention is at least about 10 ⁶ vector particles / cell.

The present invention is useful for introducing genetic modifications into any cell susceptible to transduction with a recombinant parvovirus vector. Such cells are obtained from a number of vertebrate species, for example, mammals, birds, reptiles, amphibians, fish, and the like. For example, cells from mammals such as humans, cows, pigs, goats, sheep, rodents, etc.
It can be modified using these methods. Cells that can be modified using the methods of the present invention include brain, muscle, liver, lung, bone marrow, heart, nerve, gastrointestinal, kidney, spleen, and the like. Germ cells, such as eggs, sperm, fertilized egg cells, embryonic stem cells, and other cells that can develop in an organism or part of an organism, such as an organ, can also undergo genetic modification using the present invention. For example, the present invention can be used to modify cells that are nuclear donors in nuclear transfer.

[0057] Both primary cells (also referred to herein as "normal cells") and cells obtained from the cell line are susceptible to modification using the methods of the invention. Primary cells are cells obtained directly from or present in an organism, and obtained from these sources and grown in culture, but in culture continuous (eg multiple generation) growth is not possible. Cells that are not possible. For example, primary fibroblasts are considered to be primary cells. The method is also useful for modifying the genome of cells obtained from continuous or immortal cell lines, such as tumor cells, as well as tumor cells obtained from an organism. Cells can be prepared in vitro, ex vivo using the methods and vectors of the invention.
Or it can be modified in vivo.

The method is useful for modifying the genome of vertebrate organelles, as well as the nuclear genome. For example, a target locus in the mitochondrial genome of a cell by including in the recombinant viral genome a targeting construct at least substantially identical to the target locus in the mitochondrial genome, except for the desired modification or modifications. The method of the present invention can be used to modify

A. Vector Preparation The practice of the present invention involves the construction of recombinant parvovirus vector genomes and, optionally, the packaging of these viral genomes into viral particles. Methods for achieving these goals are known in the art. A wide variety of cloning and in vitro amplification methods suitable for the construction of recombinant viral genomes are well known to those of skill in the art. Examples of these techniques and instructions that are sufficient to guide the technician through numerous cloning practices can be found in Berger and Kimmel, Guide to Molecular Clonin.
g Techniques, Methods in Enzymology 152 Academic Press, Inc., San Diego,
CA (Berger); Sambrook et al. (1989) Molecular Cloning-A Laboratory M
anual (2nd ed.) Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harb
or Press, NY, (Sambrook); Current Protocols in Molecular Biology, FM
Ausubel et al., Eds., Current Protocols, a joint venture between Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc., (1994 Suplement
) (Ausbel); US Patent No. 5,017,478 (Cashion et al.) And European Patent No. 0,246,86.
Found in No. 4 (Carr).

Examples of techniques sufficient to guide technicians by in vitro amplification methods are described in Berger, Samb
rook and Ausubel and Mullis et al. (US Pat. No. 4,683,202, 1987); PCR
Protocol A Guide to Methods and Applications (Innis et al. Eds, Acade
mic Press Inc. San Deigo, CA (1990)) (Innis); Amheim & Levinson (1990)
1st October) (C & EN 36-47); The Journal Of NIH Research (1991) 3: 81-94
Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173; Guatelli et al.
(1990) Proc. Natl. Acad. Sci. USA 87: 1874; Lomell et al. (1989) J. Clin.
Chem. 35: 1826; Landegren et al. (1988) Science 241: 1077-1080; Van Brun
t (1990) Biotechnology 8: 291-294; Wu and Wallace (1989) Gene 4, 560; and Barringer et al. (1990) Gene 89: 117. Oligonucleotide synthesis useful for cloning or amplifying nucleic acids is typically performed on a commercially available solid phase oligonucleotide synthesizer (Needham-Van Devanter et al. (1984) Nucl.
eic Acids Res. 12: 6159-6168) or Beaucage et al. (1981, Tetrahedron Let
ts. 22 (20); 1859-1862), chemically synthesized using the solid phase phosphoramidite triester method.

Typically, the viral genome is first constructed as a plasmid using standard cloning techniques. A targeting construct comprising at least one of the two inverted terminal repeats or their equivalent is inserted into a viral vector. In some embodiments, the viral vector DNA is packaged in virions for use to infect target cells. The viral vector to be packaged can contain the viral genomic DNA sequences necessary for replication and packaging of the recombinant viral genome into virions. However, in most embodiments, one or more replication and / or packaging polypeptides are provided by the producer cell line and / or a helper virus (eg, an adenovirus or a herpes virus). These helper functions include, for example, the Rep expression products required to replicate the AAV genome (eg, Muzycska, N. (1992) Current Topics in Microbiol. And Immun).
ol. 158: 97-129 and Kotin, RM (1994) Human Gene Therapy 5: 793-801). The pervirus 6 (HHV-6) rep gene from humans can serve as an alternative to the AAV rep gene (Thomson et al. (1994) Virology 204: 304-311). The cap region encoding the capsid proteins VP1, VP2 and VP3, or functional homologs thereof, are also typically provided by helper virus or producer cell lines (Id.).

The recombinant viral genome is propagated as a plasmid and packaged into virions by standard methods (eg, Muzyczka, supra; Russell et al. (1994).
Natl. Acad. Sci. USA 91: 8915-8919; Alexander et al. (1996) Human.
Gene Ther. 7: 841-850; Koeberl et al. (1997) Proc. Natl. Acad. Sci. USA 9
4: 1426-1431; Samulski et al. (1989) J. Virol. 63: 3822-3828; Tratschin et.
al. (1985) Mol. Cell. Biol. 5: 3251-3260; and Hermonat and Muzyczka (1
984) Proc. Natl. Acad. Sci. USA 81: 6466-6470).

[0063] The recombinant viral genome can be introduced into target cells by any of several methods. For example, as described above, the viral genome can be packaged into parvovirus virions, which can then be used to infect target cells. Alternatively, the recombinant viral genome can be introduced into the cell in an unpackaged form. For example,
Standard methods for introducing DNA into cells can be used to introduce the viral genome, for example, by microinjection, transfection, electroporation, lipofection, lipid encapsulation, biolistics, and the like. The recombinant viral genome can be incorporated into a virus other than parvovirus (eg, an inactivated adenovirus) or the target cell can be conjugated to a receptor and / or other moiety that has mechanisms for cellular uptake. (For example, Ga
o et al. (1993) Hum. Gene Ther. 4: 17-24). The recombinant virus genome
It can be introduced into the nucleus or cytoplasm of the target cell.

[0064] Methods for transfecting and expressing genes in vertebrate cells are known in the art. Transduction of cells with a viral vector can include, for example, incubating the vector with cells within the viral host range under the conditions and concentrations necessary to cause transduction (eg, Methods in Enzymology, vol.
.185, Academic Press, Inc., San Diego, CA (DV Goeddel, ed.) (1990) or M. Krieger, Gene Transfer and ExpressionA Laboratory Manual, Stockto
n Press, New York, NY and Muzyczka (1992) Curr. Top. Microbiol. Immunol
158: 97-129, as well as the references cited therein). Culture of cells, including cultured cells from cell lines and tissue samples, is well known in the art. Freshney (Cult
ure of Animal Cells, a Manual of Basic Technique, Third edition Wiley-Li
ss, New York (1994)) provides general guidelines for culturing cells.

[0065] The recombinant viral genome and / or other components of the recombinant viral vector can be manipulated to improve targeting efficiency. These targeting enhancers include, for example, addition products, pyrimidine dimers and / or cellular DNA synthesis, repair and / or recombination systems, and can include other DNA modifications that can be introduced into the viral genome. Such alterations can include modifications of nucleotides in the viral DNA, for example, elimination of one or more sugars, bases, and the like. For example, parvovirus vectors can be treated with DNA damage agents such as UV light, gamma irradiation, and alkylating agents. Modifications can be performed in vitro with the viral DNA, or during or after packaging of the viral DNA into virions.

Other targeting enhancers that may be included are recombinant proteins (eg, Pati et al. (1996) Molecular Biol. Of Cancer 1: 1; Sena a
nd Zarling (1996) Nature Genet. 3: 365; Revet et al. (1993) J. Mol. Biol.
232: 779-791; Kowalczkowski & Zarling in Gene Targeting (CRC 1995, Ch.7
)reference). The parvovirus vector nucleic acid can be associated with the recombinant protein prior to introduction into the cell, or the recombinant protein can be introduced into the cell separately from the parvovirus vector. In one preferred embodiment of the present invention,
The parvovirus vector is packaged in the presence of the recombinogenic protein such that the recombinogenic protein is packaged in the virus particle. The best characterized recombinant protein is recA from E. coli, Pharmacia
(Piscataway, NJ). In addition to wild-type proteins, a number of mutant recA-like proteins have been identified (eg, recA803). In addition, many organisms have recA-like recombinant enzymes (eg, Ogawa et al. (1993) Cold Sprin
g Harbor Symp. Quant. Biol. 18: 567-576; Johnson and Symington (1995) Mol.
Cell. Biol. 15: 4843-4850; Fugisawa et al. (1985) Nucl. Acids Res. 13: 7.
473; Hsieh et al. (1986) Cell 44: 885; Hsieh et al. (1989) J. Biol. Chem.
264: 5089; Fishel et al. (1988) Proc. Natl. Acad. Sci. USA 85: 3638; Cass
uto et al. (1987) Mol. Gen. Genet. 208: 10; Ganea et al. (1987) Mol. Cell
Biol. 7: 3124; Moore et al. (1990) J. Biol. Chem. 19: 11108; Keene et al.
. (1984) Nucl. Acids Res. 12: 3057; Kimiec (1984) Cold Spring Harbor Sym
p. Quant. Biol. 48: 675; Kimeic (1986) Cell 44: 545; Kolodner et al. (1987)
Natl. Acad. Sci. USA 84: 5560; Sugino et al. (1985) Proc. Natl.
cad. Sci. USA 85: 3683; Halbrook et al. (1989) J. Biol. Chem. 264: 21403; E
Isen et al. (1988) Proc. Natl. Acad. Sci. USA 85: 7481; McCrthy et al. (1
Natl. Acad. Sci. USA 85: 5854; Lowenhaupt et al. (1989) J. Bio.
l. Chem. 264: 20568). Examples of such recombinant enzyme proteins include, for example,
recA, recA803, uvsX (Roca (1990) Crit. Rev. Biochem. Molec. Biol. 25: 415)
), Sep1 (Kolodner et al. (1987) Proc. Natl. Acad. Sci. USA 84: 5560; Tis
hkoff et al., Mol. Cell. Biol. 11: 2953), RuvC (Dunderdale et al. (1991)
) Nature 354: 506), DST2, KEM1, XRN1 (Dykstra et al. (1991) Mol. Cell. B)
iol. 11: 2583), STPα / DST1 (Clark et al. (1991) Mol. Cell. Biol. 11: 2576).
Natl. Acad. Sci. USA 88: 9067), HPP-1 (Moore et al. (1991) Proc. Natl. Acad. Sci. USA 88: 9067), and other eukaryotic recombination enzymes (Bishop et al. (1992) Cell 69: 439; Shinohar).
a et al., Cell 69: 457) (PCT patent application PCT / US98 / 000852 (WO98)
/ 31837)).

The efficiency of gene targeting can be improved by the treatment of host cells, as well as by the introduction of a recombinant viral genome. For example, agents that affect the cell cycle can be administered to target cells. These agents include, for example, DNA synthesis inhibitors (eg, hydroxyurea, aphidicolin), microtubule inhibitors (eg, vincristine), and gene damaging agents (eg, radiation, alkylating agents). Other agents that can improve the efficiency of gene targeting include DNA repair, DNA
Those that affect recombination, DNA synthesis, protein synthesis, as well as the level of the receptor for AAV. Because low-condensed DNA appears to be more acceptable for gene targeting, agents that affect chromatin packaging, gene asymptomatic, DNA methylation, etc. are also of interest. These factors include:
Examples include topoisomerase inhibitors such as etoposide and camptothecin, and histone deacetylase inhibitors such as sodium lactate and trichostatin. Agents that inhibit apoptosis may also increase gene targeting due to their ability to reduce the tendency of high concentrations of AAV to induce apoptosis. Suitable factors for these applications are, for example, U.S. Pat.No. 5,604,090, R
ussell et al. (1995) Proc. Natl. Acad. Sci. USA 92: 5719; Chen et al. (199
7) Proc. Natl. Acad. Sci. USA 94: 5798; Alexander et al. (1994) J. Virol.
68: 8282: and Ferrari et al. (1995) J. Neurosci. 15: 2857-66, (1998) Mol.
Cell. Biol. 18: 6482-92, (1994) EMBO J. 13: 5922-8 (70: 3227).

A parvovirus vector can be targeted to a particular cell or tissue type through the use of virions, or can deliver a vehicle that displays a molecule that binds to a moiety that is specific for the desired target cell. . For example, antibodies that bind to a polypeptide found for a cancer cell can be displayed on a delivery vehicle. In some embodiments, a polynucleotide encoding a polypeptide capable of specifically binding to a target cell is incorporated into a gene encoding a parvovirus capsid protein. Upon packaging of the parvovirus vector genome, the modified capsid is displayed on the surface of the virion, thus allowing the virion to preferentially deliver the nucleic acid to the desired target cells. Modification of the parvovirus capsid protein for other purposes, and in vitro packaging using cells and modified capsid proteins useful for expressing the gene encoding the modified protein, are described in US Pat. No. 5,863,541 ( Issued January 26, 1999).

[0069] Gene targeting can also be improved by using only a single strand of either the + or-of the recombinant viral genome. For example, each has a + chain,
Alternatively, the use of a population of parvovirus vectors each carrying a-strand may increase the efficiency of gene targeting. Alternatively, a combination of + and-chains, each delivered by a different vector, may be used.

B. Identification of Cells with Genetic Modification Because specific genetic modifications occur frequently using the methods of the invention, sorting or screening for individual cells containing the desired modification is not necessary for many applications. If it is desirable to identify cells that have incorporated the desired genetic modification, techniques well known to those skilled in the art can be used. For example, PCR and related methods (eg, the ligase chain reaction) are routinely used to detect specific changes in nucleic acids (for a general description of the PCR method, see Innis (supra)). Hybridization assays under conditions of appropriate stringency are also suitable for detecting specific genetic modifications. A number of assay formats are suitable, including, for example, Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Bio
logyHybridization with Nucleic Acid Probes, Parts I and II, Elsevier, Ne
w York; and Choo (ed) (1994) Methods In Molecular Biology Volume 33-In
These include those discussed in the Situ Hybridization Protocols, Human Press Inc., New Jersey (see also other books in the Methods in Molecular Biology series). Various automated solid-phase detection techniques are also suitable. For example, very large scale immobilized polymer arrays (VSIPS) are used for the detection of specific mutations in nucleic acids (Tijssen (supra), Fodor et al. (1991) Science, 251: 767-777. And Sheldon et al. (1993) Clinical Chemistry 39 (4): 718-719).

[0071] These methods can be used to detect the specific genetic modification itself, or can be used to detect changes due to the modification. For example, hybridization or other methods can be used to detect the presence or absence of mRNA in cells having a modification in the promoter region. By other methods, changes in the phenotype of the cell may also be detected. For example, if a genetic modification of the polypeptide occurs, such as when the unmodified cell is expressed in the modified cell under conditions that do not express the polypeptide, or vice versa, antibodies to the polypeptide will detect expression. Can be used for If the modified cells are in a vertebrate,
Antibodies can be used, for example, to detect the presence or absence of a protein in the bloodstream or in other tissues. When the genetic modification changes the structure of the polypeptide, it recognizes the unmodified polypeptide, but does not recognize the modified polypeptide,
Or vice versa, antibodies are obtained. Methods for producing polyclonal and monoclonal antibodies are known to those of skill in the art, and a number of antibodies are available (eg,
Coligan (1991) Current Protocols in Immunology Wiley / Greene, NY; and H
arlow and Lane (1989) Antibodies: A Laboratory Manual, Cold Spring Harbo
r Press, NY; Stites et al. (eds.) Basic and Clinical Immunology (4th ed.
) Lange Medical Publications, Los Altos, CA, and references cited therein; Goding (1986) Monoclonal Antibodies: Principles and Practice (2d e).
d.) Academic Press, New York, NY; and Kohler and Milstein (1975) Nat
ure 256: 495-497). Other suitable techniques for preparing antibodies include selecting a library of recombinant antibodies in phage or a similar vector (
Huse et al. (1989) Science 246: 1275-1281 and Ward et al. (1989) Nature.
341: 544-546). Vaughan et al. (1996) Nature Biotechnology, 14: 309-31
4 describes a human antibody with subnanomolar affinity isolated from a large non-immunized phage display library. Chhabinath et al describe a knowledge-based automated approach for antibody structure modeling (1996, Nature Biotechnology 14:
323-328). Specific monoclonal and polyclonal antibodies, and antisera, usually bind their corresponding antibodies with a K _D of at least about 0.1 mM, more usually at least about 1 μM, preferably at least about 0.1 μM or better. . The enzymatic activity (or loss thereof) of the modified enzyme can also be detected.

In general, modified cells can also be identified by use of a selectable or screenable marker that is integrated into the cell genome. A selectable marker is a gene that encodes a protein necessary for the survival or growth of the cell, so that only host cells containing the marker can grow under selection conditions. For example, when the method of the present invention is used to introduce a genetic modification that places a gene required for cell growth under the control of an inducible promoter, by growing the cell under selection conditions that also induce expression of the gene. Cells that have incorporated the desired modification can be selected.
Typical selection genes provide (a) resistance to antibiotics or other toxic substances such as ganciclovir, neomycin, hygromycin, G418, methotrexate, etc., (b) complement auxotrophic deficiencies, or (c) complex It encodes a protein that supplies important nutrients that are not available from the medium. Selection of the appropriate selectable marker will depend on the host cell, and appropriate markers for different hosts are well known in the art. A screenable marker is a gene that encodes a protein whose activity is readily detected and that readily identifies cells that express such a marker. Such markers include, for example, β-galactosidase, β-glucuronidase and luciferase. Other markers include those identified by fluorescence activated cell sorting. For example,
Fluorescent proteins, such as green fluorescent protein (GFP), can be obtained using a fluorescence activated cell sorter (FACS) or HOOK sorting (available from Clontech).
Allows the isolation of cells expressing the protein. Alternatively, the marker may encode a polypeptide displayed on the cell surface and detectable by a fluorescently labeled antibody.

C. In Vitro Use The methods of the present invention are useful for constructing cells and cell lines useful for a number of purposes. Genetically modified cells can be used to produce the desired gene product at a higher level than would otherwise be produced by the cell, or the gene product could be derived from one that was otherwise produced Qualified. For example, a non-human cellular gene encoding a desired protein can be modified such that the amino acid sequence of the encoded protein corresponds to the sequence of the human form of the protein. Alternatively, the amino acid sequence can be altered, such as to make the protein more active, more stable, have a longer therapeutic half-life, have a different glycosylation pattern, and the like. The method can be used to introduce a signal sequence at the amino terminus of the protein, which can facilitate purification of the protein by allowing the cell to secrete proteins that are not normally secreted.

As another example, the methods of the invention can be used to modify cells to express, for example, a polypeptide involved in the degradation of toxic compounds. If desired, expression can be made inducible by the presence of a toxic compound. Such cells can be used to improve the viability of toxic wastewater as well as to clean up contaminated sites. Cells modified using the methods of the invention are also useful for studying the effects of particular mutations. For example, the expression of a particular gene may be disrupted to determine the effect of the mutation on the growth and / or development of the cell and its interaction with other cells. Genes suspected of being involved in diseases, such as tumorigenesis (eg, angiogenesis stimulators) and other diseases, can be disrupted to determine their effect on disease development. Alternatively, the expression of the disease-related gene can be activated and increased, and the effect assessed.

[0075] Cells that are modified to express a particular gene under certain conditions can be used to screen for compounds that can inhibit expression of the gene. For example,
Cells can be modified to place genes necessary for cell growth under the control of an inducible promoter. A test compound is added to the growth medium along with a moiety that induces gene expression. Cells do not grow in the presence of the test compound that inhibits the interaction between the inducing moiety and the inducible promoter. Therefore, these cells
A simple screening system for compounds that regulate gene expression is provided.

The present invention also provides libraries of targeted integrants. These libraries are particularly suitable for use in the screening assays described above, as well as for genetic analysis. Numerous other uses for the methods of the invention for introducing gene mutations will be apparent to those skilled in the art. D. Construction of Transgenic and Chimeric Animals The present invention also provides methods for producing transgenic and chimeric animals, and transgenic and chimeric animals produced using these methods. "
"Chimeric animals" include some cells that contain one or more genetic modifications introduced using this method, as well as other cells that do not contain the modifications. "
A "transgenic animal", in contrast, consists of cells that have all incorporated one or more specific modifications. The transgenic animal can transmit the modified target locus to its progeny, but the ability of the chimeric animal to transmit the modification depends on whether the modified target locus is present in the animal's germ cells. Modifications can include, for example, insertion, deletion or substitution of one or more nucleotides.

[0077] The methods of the present invention are useful for producing transgenic and chimeric animals of most vertebrate species. Such species include non-human mammals, e.g., rodents such as mice and rats, rabbits, sheep, e.g. sheep and goats, pigs, e.g., pigs, and cattle, e.g., cattle and wild cattle,
It is not limited to these. Methods for obtaining transgenic animals are described, for example, in Puhler
, A., Ed., Genetic Engineering of Animals, VCH Publ., 1993; Murphy and Ca
rter, Eds., Transgenesis Techniques: Principles and Protocols (Methods in
Molecular Biology, Vol. 18), 1993; and Pinkert, CA, Ed., Transgenic An
imal Technology: A Laboratory Handbook, Academic Press, 1994. Transgenic fish with specific genetic modifications can also be made using the methods of the invention (eg, for general methods of making transgenic fish, see
Iyengar et al. (1996) Transgenic Res. 5: 147-166).

One method of obtaining a transgenic or chimeric animal having a specific modification in its genome is to contact a fertilized egg cell with a parvovirus vector containing a targeting construct having the desired modification. For some animals, such as mice, fertilization is performed in vivo and fertilized eggs are surgically removed. In other animals, especially cattle, eggs are removed from live or slaughtered animals and
It is preferred to fertilize the eggs in vitro (see DeBoer et al., WO 91/08216). in vitro
Fertilization may cause the modification to be introduced into substantially synchronized cells. The fertilized eggs are then cultured in vitro until a pretransplanted embryo containing about 16-150 cells is obtained. Embryos at the 16-32 cell stage are described as morula. Pretransplanted embryos containing more than 32 cells are called blastulas. These embryos typically show blastocoel development at the 64-cell stage. Embryos of more than one cell can also be modified by introducing the recombinant parvovirus genome of the present invention. If desired, the presence of the desired modification in the embryonic cells can be detected by methods known to those skilled in the art. The method of culturing fertilized eggs in the pretransplantation stage is described in Gordon et al.
) Methods Enzymol. 101: 414; Hogan et al. Manipulation of the Mouse Embryo
: A Laboratory Manual, CSHLNY (1986) (mouse embryo); Hammer et al. (
1985) Nature 315: 680 (rabbit and pig embryos); Gandolfi et al. (1987) J. Re.
prod. Fert. 81: 23-28; Rexroad et al. (1988) J. Anim. Sci. 66: 947-953 (sheep embryo) and Eyestone et al. (1989) J. Reprod. Fert. 85: 715-. 720; Camous
et al. (1984) J. Reprod. Fert. 72: 779-785; and Heyman et al. (1987) T.
heriogenology 27: 5968 (bovine embryo). Sometimes, pre-transplanted embryos
They are stored frozen until transplantation. The pre-transplanted embryo is transferred to a suitable female to produce a transgenic or chimeric animal, depending on the stage of development when the transgene is integrated. Chimeric mammals are bred to produce true germline transgenic animals.

Alternatively, parvovirus can be used to introduce specific genetic modifications into embryonic stem cells (ES). These cells are obtained from pretransplanted embryos cultured in vitro (eg, Hooper, ML, Embryonal Stem Cells: Introducing Planned C).
hanges into the Animal Germline (Modern Genetics, v.1), Int'l. Pub. Dis
trib. Inc., 1993; Bradley et al. (1984) Nature 309: 255-258). The transformed ES cells are combined with blastocysts from a non-human animal. ES cells colonize the embryo and in some embryos produce the germline of the resulting chimeric animal (Jaen
isch, Science, 240: 1468-1474 (1988)). Alternatively, ES cells or somatic cells that can reconstitute an organism ("somatic cell repopulating cells") can be used as a source of nuclei for transplantation into enucleated fertilized eggs that give rise to transgenic animals ( See, for example, Wilmut et al. (1997) Nature 385: 810-813).

For the production of transgenic animals containing two or more modified target loci, a parvovirus vector containing two targeting constructs can be used, or more preferably, each with a different targeting Two different parvovirus vectors containing the construct are introduced simultaneously, using techniques similar to those for modifying a single target locus. Alternatively, each modification is first introduced into a separate animal and then merged into the same genome by breeding the animal. Alternatively, the first transgenic animal that includes one of the desired modifications is produced, and then the second modification is introduced into fertilized eggs or embryonic stem cells from that animal.

E. Ex Vivo Applications The methods of the invention are useful for ex vivo applications, where cells are removed from an organism, genetically modified using the method, and reintroduced into the organism. In some applications, a genetically modified cultured cell line is introduced into the organism. Genetically modified cells can be introduced into the same cell from which the cell was originally obtained, or introduced into a different organism of the same or a different species. Both ex vivo can be removed from animals using, for example, genetic disorders such as hemophilia and certain thalassemias, and the methods of the invention, modified using the methods of the invention, and reintroduced into the organism. Useful for treating other diseases characterized by a defect in the resulting cells. Cells include, for example, hematopoietic stem cells obtained from bone marrow or fetal placental blood,
It can be a T lymphocyte, B lymphocyte, monocyte, hepatocyte, myocyte, fibroblast, stromal cell, skin cell or stem cell. The cells can be cultured from a patient or stored in a cell bank (eg, a blood bank). These methods are useful for human therapy and also for veterinary purposes.

The modified cells are expressed in animals at a rate determined by the LD ₅₀ of the modified cell type and the side effects of the cell type at various concentrations when applied to most and overall healthy patients. Or administered to the patient. Administration can be made once or in several divided portions. Animal models and clinical protocols for ex vivo gene therapy are described in Hematopoietic cells (Blaese et al. (1995) Science 270: 475-480; Kohn et al. (1995) Nature Me
d. 1: 1017-1023), hepatocytes (Grossman et al. (1994) Nature Genet. 6: 335-341).
), Muscle cells (Bonham et al. (1996) Human Gene Ther. 7: 1423-1429), skin cells (Choate et al. (1996) Nature Med. 2: 1263-1267) and fibroblasts (Palm
er et al. (1989) Blood 73: 438-445).

F. In Vivo Therapy The methods of the present invention are useful for correcting genetic defects in vivo. Muscular dystrophy is just one example of a genetic disorder that is often the result of one or a few mutations that express abnormal polypeptides that cannot perform their functions properly. The exact mutations for many variants of these and other genetic disorders are known to those of skill in the art, as are methods for identifying undesirable genetic mutations. Examples include Charcot-Marie-Tooth disease, Coffin-Lowry syndrome, cystic fibrosis, fragile X syndrome, hemophilia, hereditary thrombotic predisposition (Factor V mutation) Huntington's disease, medium-chain acyl coenzyme dehydrogenase deficiency (Mc
ad), myotonic dystrophy, neurofibromatosis (nf1), sickle cell disease and globin chain mutation, spinal muscular atrophy, spinocerebellar ataxia, α and β thalassemia,
Von Hippel-Lindau disease and the like, but are not limited thereto. Genetic disorders include, for example, Shaw, DJ (Ed.), Molecular Genetics of Human Inherited.
Disease, John Wiley & Sons, 1995; Davies and Read, Molecular Basis of I
nherited Disease, 2 ^nd Edition, has been studied in the IRL Press, 1992. Human genetic disorders can be treated using the methods of the present invention, as in other vertebrates. Non-genetic diseases can also be treated by manipulating the gene. For example, a co-receptor for HIV can be modified such that the receptor can no longer bind to the HIV particles.

A parvovirus vector containing the recombinant parvovirus genome can be used in vivo.
Can be administered directly to an organism for modification of cells in the organism. Administration can be by any of the routes commonly used to introduce viral vectors into the final contact with blood or tissue cells. The viral vector used in the method of the present invention is
It is preferably administered in any suitable manner, together with a pharmaceutically acceptable carrier.
Suitable methods for the administration of such viral vectors to patients in the context of the present invention are available, and more than one route may be used to administer a particular viral vector, but One particular route often provides a more direct and more effective reaction than another.

The pharmaceutically acceptable carrier depends, in part, on the particular viral vector being administered.
As well as the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of the pharmaceutical compositions of the present invention. Formulations suitable for oral administration include (a) liquid solutions such as water, saline or PEG
An effective amount of vector dissolved in a diluent such as 400, (b) capsules, sachets or tablets each containing a predetermined amount of active ingredient as a liquid, solid, granule or gelatin, (c) in a suitable liquid And (d) a suitable emulsion. Tablet form comprises one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphate, corn starch, potato starch,
Tragacanth gum, microcrystalline cellulose, gum arabic, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid and other excipients, coloring agents, fillers, binders, diluents, buffers Humectants, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically acceptable carriers. Lozenge forms may contain the active ingredient in a flavoring agent, usually sucrose and acacia or tragacanth, and incense tablets are inert bases containing carriers known in the art, in addition to the viral vector, e.g., The active ingredient is included in gelatin and glycerin or sucrose and acacia emulsions, gels and the like.

[0086] Viral vectors, alone or in combination with other suitable components, can be made into aerosol formulations that can be administered by inhalation. The corresponding vector is suitably administered by this method, since the bronchial passageway is the usual route of selection for certain viruses. The aerosol formulation is loaded into a pressurized acceptable propellant such as dichlorodifluoromethane, propane, nitrogen and the like.

Suitable formulations for rectal administration include, for example, suppositories, which consist of an active viral vector with a suppository base. Suitable suppository bases include natural or synthetic triglycerides or paraffinic hydrocarbons. In addition, gelatin rectal capsules composed of a combination of a viral vector and a substrate such as liquid triglycerides, polyethylene glycol and paraffinic hydrocarbons can be used.

Formulations suitable for parenteral administration by, for example, intra-articular (intra-articular), intravenous, intramuscular, intradermal, intraperitoneal, intrathecal (in cerebrospinal fluid) and subcutaneous routes include antioxidants, Aqueous and non-aqueous, isotonic, sterile injectable solutions which may contain buffering agents, bacteriostatic agents, and solutes which render the formulation isotonic with the blood of the intended recipient, as well as suspending agents, solubilizing agents,
Aqueous and non-aqueous sterile suspensions, which can include thickeners, stabilizers and preservatives. The formulations are presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and in some embodiments, require only a sterile liquid carrier for injection, e.g., water, immediately before use. It can be stored under dry (lyophilized) conditions. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

The dosage administration to the patient, in the context of the present invention, should be sufficient to effect a beneficial therapeutic response in the patient over an extended period of time. The dose will be determined by the efficacy of the particular viral vector used, and the condition of the patient or animal, and the weight or surface area of the patient being treated. The dose size will be determined by the existence, nature and extent of any side effects associated with administration of a particular vector or modified cell type in a particular patient or animal.

In determining the effective amount of a viral vector to be administered in the treatment or prevention of a particular disease, a physician or veterinarian will need to evaluate circulating plasma levels, vector toxicity, and disease progression. In the practice of the present invention, the parvovirus vector may be administered orally, topically, intramuscularly, intraperitoneally, intrathecally or intrathecally, for example, by aerosolization and inhalation, intravenous infusion. The preferred method of administration is often by intravenous or inhalation, but the parvovirus vector can be applied in a suitable vehicle for local and local treatment of the virus-mediated condition.

[0091] For administration, the parvovirus vectors and genetically modified cell types of the present invention, at various concentrations when the LD ₅₀ for parvovirus vectors, and applied to the majority of and overall healthy patients Administered to animals or patients at a rate determined by the side effects of the parvovirus vector or cell type. Administration can be made once or in several divided portions.

[0092] Protocols for in vivo gene therapy using adeno-associated virus vectors include brain (Alexander et al. (1996) Human Gene Ther. 7: 841-850), liver (Ko
eberl et al. (1997) Proc. Natl. Acad. Sci. USA 94: 1426-1431), embryo (Flott
e et al. (1993) Proc. Natl. Acad. Sci. USA 90: 10613-10617) and muscle (
Xiao et al. (1996) J. Virol. 70: 8098-8108). These methods can be adapted to other target organs by those skilled in the art.

G. Assay System for Gene Targeting Efficiency The present invention also provides methods for determining the efficiency of parvovirus-mediated gene targeting. The invention encompasses using a retroviral vector to introduce into a target cell a mutant reporter gene that is subsequently corrected by gene targeting. Use of Retroviral Vectors to Introduce Corrected Genes Sub-H has significant advantages over conventionally used assay systems. By introducing the mutant reporter gene into a retroviral vector that becomes integrated into the target cell genome, the reporter gene becomes integrated into the cell genome in a well-characterized chromosomal region (integration Provirus).
Because of this homogeneity of the region surrounding the reporter gene, the efficiency of gene targeting between a wide variety of cell types, including primary cells, can be compared. In addition, retroviral vector provirus can be introduced into cells as a single copy target by infecting cells at a low multiplicity of infection. Yet another advantage is that polyclonal populations of cells containing the target locus at the site of integration of thousands of different retroviral vectors can be used in the assay, thus accounting for variations in the rate of gene targeting due to position effects.

The reporter gene introduced into the target cells using the retroviral vector is defective in that no detectable and / or selectable gene product of the reporter gene is expressed and no correction by gene targeting is observed. Sex. For example, a reporter gene can be defective by a mutation in the coding region or in a promoter or other sequence that controls expression of the reporter gene. In a preferred embodiment of the invention, the retroviral vector contains a selectable marker in addition to the defective reporter gene. Therefore,
One can sort for cells containing the integrated retroviral provirus. These cells are then used in a gene targeting assay.

[0095] Reporter genes suitable for use in the assays of the present invention are known to those of skill in the art.
Typically, the reporter gene encodes a polypeptide that is directly detectable, eg, a fluorescent polypeptide or a polypeptide that is readily detectable using a detection agent. For example, a reporter gene, when present, may encode an enzyme that converts a substrate into a readily detectable form. Alternatively, the reporter gene product may be detected by a detectable agent that binds to the reporter gene product, eg, a labeled antibody. Suitable reporter genes include β-glucuronidase from E. coli (
GUS, uidA), β-galactosidase, luciferase from firefly (LUC
), And green fluorescent protein (GFP) from jellyfish (eg, Chalfie)
et al. (1994) Science 263: 802-805; Crameri et al. (1996) Nature Biotechn.
ol. 14: 315-319; Chalfie et al. (1995) Photochem. Photobiol. 62: 651-656;
Olson et al. (1995) J. Cell. Biol. 130: 639-650), as well as related antigens, some of which are commercially available, but not limited to. In some embodiments, the reporter gene encodes a polypeptide that is expressed on the surface of a cell. The cells can then be identified and enriched for successfully gene-targeted, for example, by flow cytometry-based cell sorting.

The reporter gene can also be a selectable marker that allows for the selection of modified cells that have undergone the desired gene targeting event. These genes are gene products required for the survival or growth of transformed host cells grown in the selection medium,
For example, it can encode a protein. Host cells that do not express the gene product of the selection gene do not survive in the medium. Typical selection genes encode proteins that confer resistance to antibiotics or other toxins, such as ampicillin, neomycin, kanamycin, chloramphenicol or tetracycline. Examples of suitable coding sequences for selectable markers include the following: the neo gene encoding the enzyme neomycin phosphotransferase that confers resistance to the antibiotics kanamycin, neomycin and G418 (Beck et al. (1982) Gene 19:
327); a hyg gene that encodes the enzyme hygromycin phosphotransferase and confers resistance to the antibiotic hygromycin (Gritz and Davies (1983) Gen.
e 25: 179). Alternatively, the selectable marker may encode a protein that complements an auxotrophic defect or supplies a key nutrient that is not available from a complex medium. Numerous selectable markers are known to those skilled in the art, for example, Sambrook et al. (Supra).
It is described in.

The assay involves introducing a recombinant parvovirus vector containing a reporter gene that is defective by a mutation different from that of the retroviral provirus into cells containing the integrated retroviral provirus and an associated defective reporter gene. It is executed by doing. A defective reporter gene present in a parvovirus vector can be, for example, a full-length reporter containing a mutation that prevents expression of an active reporter gene product (eg, a mutation in a promoter, coding region, or other region that affects gene expression). It can be a gene. Alternatively, the parvovirus vector may include only reporter gene subsequences present in the retroviral provirus. In either case, the reporter gene present in the parvovirus vector overlaps the mutated region of the defective reporter gene in the retroviral provirus. The parvovirus vector reporter gene is mutated at a different location than the provirus reporter gene, so that the reporter gene product is produced only by cells in which homologous pairing and gene repair have occurred between the two defective reporter genes.

Next, the efficiency of gene targeting is established by determining the percentage of cells expressing the reporter gene product. In yet another embodiment, the invention provides a method for enriching for cells in which gene targeting has occurred. These methods are based on the finding that cells that undergo gene targeting at one locus are susceptible to targeting at a second locus. Thus, two targeting constructs are coupled to the cells. One targeting construct, when corrected, can correct a defective reporter gene that produces an easily detectable reporter gene product. The other targeting construct is directed to the gene. The two targeting constructs can be on the same parvovirus vector, but more usually each is contained on a separate parvovirus vector. After introduction of the targeting construct into the cells, the cells are first screened or sorted to identify those that express the reporter gene product. The resulting enriched cell population is then screened to identify cells in which the gene has been successfully gene-targeted.

The method of enrichment for a target cell is useful for a number of applications. For example, germ cells, eggs, or other cells from which the transgenic organism can be reconstructed, can be enriched for cells that have undergone gene targeting. With these cell initiatives,
Screened to identify those containing the desired alteration in the target locus. Cells that have undergone the desired gene targeting event are then used to produce transgenic and / or chimeric animals.

EXAMPLES The following examples are presented to illustrate, but not limit, the invention. Experimental Method A. Cell culture HeLa (Scherer et al. (1953) J. Exp. Med. 97: 695-709), HT-10
80 (Rasheed et al. (1974) Cancer 33: 1027-33) and 293 (Graham et a
l. (1977) J. Gen. Virol. 36: 59-74) Cells were heat-inactivated (30 min at 56 ° C) fetal calf serum (HyClone, Logan, UT), 1.25 μg / ml amphotericin, 100 U /
The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing ml of penicillin and 100 μg / ml of streptomycin at 37 ° C. in a 10% CO ₂ atmosphere. HT
-1080 cells were added to HAT medium (13.61) before their use in transduction experiments.
(DMEM containing μg / ml hypoxanthine, 0.176 μg / ml aminopterin and 3.875 μg / ml thymidine) to minimize the number of HPRT ^- cells in the population.

SV40 origin and promoter, mutant neo gene and p15A
HeL using the BamHI fragment containing the origin (identical fragment present in pASNO39, see FIG. 1A and below), and the BstYI fragment of pLHL containing the Moloney murine leukemia virus long terminal repeat promoter and the hygromycin resistance gene.
HSNO39 cells were generated by co-transfection of a cells. 0.2
Transfected cells were sorted by growing in mg / ml hygromycin (Calbiochem, San Diego, CA). HSNO39 from single hygromycin resistant colonies
Cells were obtained and showed by Southern analysis that they contained three copies of the neo gene / cell. HSNO39 cells were cultured in medium containing 0.2 mg / ml hygromycin before use in transduction experiments.

B. Plasmid Plasmid pAAA / Ad (Samulski et al. (1989) J. Virol. 63: 3822-8)
, PACYC184 (Chang et al. (1978) J. Bacteriol. 134: 1141-56), p.
Bluescript (Stratagene, La Jolla, CA), psub201 (Samuls
ki et al. (1987) J. Virol. 61: 3096-101), pSV2neo (Southern and Berg)
(1982) J. Mol. Appl. Genet. 1: 327-41) and pTR (Ryan et al. (1996)).
J. Virol. 70: 1542-53). pLHL is available from AD Miller (Fred Hu
(Tchinson Cancer Research Center, Seatle, WA). pRe
pCap2 contains the XbaI fragment of psub201 containing the AAV2rep and cap genes at the XbaI site of pBluescript. BstB downstream of the neo gene
PACYC1 in I site (end-filled with Klenow fragment of DNA polymerase I)
PASVori2 by inserting the BamHI-Esp31 neo fragment of pSV2neo containing the EspI-BstI 1071 origin fragment from 84 into the Bg / II site of the AAV vector backbone of pTR after binding the BamHI linker to the pSV2neo Esp31 site. It was constructed. Using this same neo fragment, an HSNO39 cell line was constructed. pASNO39 is identical to pASNori2 except for the SalI linker (5-CGGTCGACCG) in the end-filled EagI site. pASNO648 has pAS except for end-filled and religated CspI sites.
Same as the Nori2 site. pAHPe2 / 3 contains the human HPRT locus from bp 14,057 to 17,809 (GenBank HUMHPRTB) at the BglII site of pTR, as determined by DNA sequencing. pAHPe2 / 3X is identical to pAHPe2 / 3 except for the end-filled and religated XhoI sites. HPRT sequences in both orientations with respect to the pTR backbone were obtained, and no difference was observed in the gene correction rates of the corresponding vectors. The human HPRT sequence was from the Huλ3 lambda phage described above (Patel et al. (1986) Mol. Cell. Biol. 6: 393-403).

C. Vector Production AAV vector stocks were prepared as follows. 293 cells were plated in 24 dishes (10 cm) at a density of 4 × 10 ⁶ cells / dish. The following day, each dish was infected with 5.6 x 10 ⁷ plaque forming units of adenovirus type 5 (ATCC VR-5),
Two hours later, they were co-transfected with 4 μg of vector plasmid and 16 μg of helper plasmid by the calcium phosphate method (Sambrook, supra). 3
After a day, cells and media are harvested, freeze-thawed three times, clarified by centrifugation at 5800 × g (5500 rpm) in a Sorvall HS4 rotor at 4 ° C. for 30 minutes, 68 units / ml.
Using Micrococcus nuclease (Pharmacia, Piscataway, NJ) for 1 hour at 37 ° C., treating with 50 ng / ml trypsin at 37 ° C. for 30 minutes, and 4 hours at 4 ° C. at 27,000 rpm in a Beckman SW28 rotor. , And centrifuged through 40% sucrose in phosphate buffered saline. The pellet was resuspended in 8 ml of a 0.51 g / ml solution of CsCl and centrifuged at 35,000 rpm at 4 ° C. in a Beckman SW41 rotor for 20 hours. AAV
The area of the gradient containing virions was collected and a 50,000 molecular weight cut-off membrane (Spectrum
, Houston, TX), and concentrated by centrifugation in Centricon 100 filters (Amicon, Inc., Beverly, MA). The vector plasmids used were pASNori2 and AAV-SNO648 for AAV-SNori.
PASNO648, AAV-SNO39 has pASNO39, AAV-HP
pAHPe2 / 3 for e2 / 3 and pAHPe2 for AAV-HPe2 / 3X
/ 3X. The helper plasmid used was pAAV / Ad (Samulskie
(1989) supra) or pRepCap2, which produced equivalent stock titers.

The titer of each stock vector was determined by Southern blot on alkaline gel as follows. Mix 10 μl of the stock dilution with 2 μl of 10% SDS and add
Heated for 1.2 min and electrophoresed through a 1.2% alkaline agarose gel (Sambrook
, Supra), blotted on Hybon-N membranes (Amersham, Buckinghamshire, England) and probed for vector sequence. Molecular Dynamics PhosphorImager
Using 400S (Sunnyvale, CA) to determine the amount of full-length linear vector DNA present in each sample by comparison to a standard present on the same gel,
The number of vector genomes per ml of stock was calculated. 10 μl using the same assay
The vector particles on CsCl were located by electrophoresis of each of the gradient fractions. The number of intact vector genomes per ml of stock was the value used for the number of vector particles, which was typically> 10 ¹¹ / ml.

D. DNA techniques New England BioLabs (Bevely, MA), Boehringer Mannheim (Indianapolis, MA)
The enzyme was obtained from IN) or Stratagene (La Jolla, CA) and the reaction was performed using the manufacturer's recommended conditions. Plasmid construction, DNA purification, Southern blot analysis and bacterial culture were performed by standard techniques (Sambrook et al., Supra). Plasmids were prepared using Qiagen columns (Chatsworth, CA). Die-terminator cycle sequencing was performed using the ABI PRISM sequencing kit (Perkin Elmer, Foster City, CA) and applied to Applied Biosystems Inc. sequencer (Foster).
City, CA). Oligonucleotides are available from Cruachem, Inc. (Dulles, VA)
It was from.

Transformation of the integrated neo gene with HSNO3 by digesting high molecular weight genomic DNA with calf intestinal phosphatase to prevent ligation of free ends in the sample.
Nine cells were removed, heat-inactivated, extracted with phenol and chloroform, and precipitated with ethanol. The resuspended DNA was digested with BamHI, extracted with phenol and chloroform, and precipitated with ethanol. The resulting DNA
Fragments were resuspended, cyclized overnight at 14 ° C. with T4 DNA ligase, and transferred to E. coli by electroporation or high efficiency chemical transformation. Bacterial colonies were selected by growth on kanamycin plates.

The bp39 and bp648 mutations in the corrected neo gene recovered as a bacterial plasmid
Was performed using primers 9606D (dATGGCTTTCTTGCCGCCA), respectively.
(SEQ ID NO: 1) and 9607A (dATACGCTTGATCCGGCTAC) (SEQ ID NO: 2)
It was carried out. A previously published method (Rossiter et al. (1991) “Detection of de
letions and point mutations. "In PCR. A practical approach, M.J.McPherso
n et al., eds. (Oxford, England: IRL Press), pp. 67-83)
From the high molecular weight genomic DNA, the HPRT exon 3 sequence was amplified as follows.
. 2.1 picomoles of 5 primers (dCCTTATGAAACATGAGGGCAAAGG) (SEQ ID NO: 3) and
And 3 primers (TGTGACACAGGCAGACTGTGGATC) (SEQ ID NO: 4), 6 mM MgSO _Four , 1.25 mM of each deoxynucleoside triphosphate and 0.4 units of VentD
20 μl of the reaction containing NA polymerase (New England Biolabs, Beverly, MA)
A 100 ng genomic DNA PCR in an equivalent volume was performed. PTC-200 thermocycle
(MJ Research, Watertown, MA) and denaturation at 94 ° C for 4.5 minutes
30 times at 94 ° C. for 30 seconds, 61 ° C. for 50 seconds and 72 ° C. for 2 minutes, then 5 minutes at 72 ° C.
Final polymerization for minutes. Add 6 μl of the product further in the 100 μl volume 20 times under the same conditions.
With QIAquick kit (Qiagen, Chia) according to the manufacturer's protocol.
atsworth, CA) and purify 75 ng of the purified product.
Used for DNA sequencing with the marker dACCTACTGTTGCCACTA (SEQ ID NO: 5)
.

E. Gene targeting assay On day 1, 96 (Nunc, Naperville, IL) or 48 (Costar, Cambridge, MA)
Standard transduction experiments were performed by plating 5 × 10 ³ or 1 × 10 ⁴ HSNO39 cells / well in well plates or 2 × 10 ⁴ HT-1080 cells in 48 well plates, respectively. On day 2, the medium was changed and the vector stock (prepared in DMEM) was added to the wells. The MOI was calculated and one cell doubling after the original plate was prepared was assumed. On day 3, each well was treated with trypsin and cells were plated in 10 cm dishes. At day 4, the assay was different for each cell line.

For neo gene correction experiments, 90%, 9.5% and 0.5% cells from each well were plated in different dishes. On day 4, G418 (1 mg / ml active compound) was added to 9
Sorting was continued for 10-12 days, with additional additions of 0% and 9.5%, changing the medium every 3-4 days. G418 was not added to the 0.5% dishes, which served as a control for the total number of colony forming units (CFU) from each original well. Colonies present in each dish were counted after staining with Coomassie Brilliant Blue G. The neo gene correction rate was calculated as the value of G418 resistant CFU / total CFU for each original well.

For HPRT experiments, all cells from each well were plated in 10 cm dishes on day 3 and then cultured without sorting for 10-14 days to determine the existing HPR in HPRT cells.
The T protein was eliminated. After culturing for 10 to 14 days, no significant difference was found in the HPRT mutation rate. The medium was changed every 3-4 days, and if the dishes became too dense, the cells were treated with trypsin and the dilutions were placed in new dishes. After this phenotypic expression period, 10 ⁵ , 10 ⁴ and 10 ² cells from each culture were plated in new 10 cm dishes and the next day,
6TG the (5 [mu] g / ml) were added to 10 ⁵ and 10 ⁴ cells dish. Since used to calculate the plate efficiency, 6TG selection was not applied to the 10 ² cells dishes. Cells were cultured for an additional 10 days, stained with Coomassie Brilliant Blue G, and viable colonies counted. After correction for plating efficiency, the percentage of 6TG resistant CFU was determined.

Example 1 Correction of Mutant Neo Gene Using Adeno-Associated Virus Vector This example demonstrates that an adeno-associated virus (AAV) -based vector can efficiently target specific chromosomal target sequences in human cells. Prove that it can be modified. The selectable neomycin phosphotransferase gene (neo) was used as a marker to test gene correction by transduction. The vector constructed for these experiments was the AAV shuttle vector AAV-SNori (FIG. 1A).
Based on the neo gene under the control of both the bacterial Tn5 promoter and the SV40 early promoter, as well as p1 which supports stable replication in E. coli.
Contains the 5A plasmid origin of replication (Cozzarelli et al. (1968) Proc. Natl. A
cad. Sci. USA 60: 992-999). The AAV 2 terminal repeat flanks these internal sequences and contains the cis-acting sequences necessary for vector genome replication and packaging (McLaughlin et al. (1988) J. Virol. 62: 1963-1973; Samulski). et a
l. above). Mammalian cells transduced by AAV-SNori are resistant to G415, and the uptake provirus can be recovered as a bacterial plasmid expressing kanamycin resistance. Mutations were introduced into the AVV-SNori vector at bp39 (14 nucleotide insertion) and bp648 (3 nucleotide insertion) (bp1 is the translation initiation codon) of the neo gene, resulting in vectors AAV-SNO39 and AAV-SNO64.
8 was generated. Both mutations disrupt neo gene function, but genetic correction between the two mutant genes can regenerate the functional gene and confer G418 resistance.

Gene correction with AAV vectors was tested using HeLa cells as a model human system. Cotransfection of this fragment with a hygromycin selectable marker generated a HeLa cell line containing an integrated copy of the internal portion of the AAV-SNO39 genome (lacking terminal repeats) (see Experimental Procedures). Several hygromycin resistant clones were isolated and the mutant neo was analyzed by Southern analysis.
Screened for the presence of the gene cassette. One cell line, designated HSNO39, was thought to contain 3 intact copies / cell of the neo cassette integrated at different locations and was selected for further experiments.

A. neo Gene Correction Frequency HSNO39 cells were infected with AAV-SNO648 vector stock, treated with trypsin, plated the next day with different dilutions, and 2 days after infection,
Sorted in G418. The dilutions were grown without sorting to determine the total number of colony forming units in the sample. Correction of the mutant chromosomal neo gene by incorporating the vector genome was measured as the fraction of colonies resistant to G418. As shown in Table 1, about 0.1% H after infection with AAV-SNO648.
SNO39 cells were resistant to G418. This represents a minimal neo gene correction rate, as some cells may contain asymptomatic genes at inappropriate expression levels. A
Infection of HeLa cells with AV-SNO648 did not produce G418 resistant colonies, demonstrating that reversion of the bp648 mutation in the vector did not occur at a detectable rate. Similarly, G418 resistant colonies were not detected in uninfected or AAV-SNO39 infected HSNO39 cells, indicating that chromosome bp39
Indicates that no reversion of the mutation occurred. After transduction with an AAV-SNori vector containing a functional neo gene and being able to integrate at random chromosomal locations by non-homologous recombination, approximately 0.6% of HeLa cells were resistant to G418. Therefore, neo
The rate of gene correction was about one-fifth of the rate of random vector uptake of similar vectors.

[0114]

[Table 1]

B. Chromosomal neo gene structure Several G418 resistant colonies obtained by infecting HSNO39 cells with AAV-SNO648 were isolated, expanded to approximately 2 x 10 ⁷ cells, and analyzed by Southern blot. Genome D from parental HSNO39 cells after digestion with BamHI
NA contained three major neo-hybridization bands of 2.7, 5.0 and> 20 kb, representing three integrated copies of the neo gene cassette (FIG. 1B). 2.7
The HSNO39 strain was generated by co-transfection using a kb BamHI neo fragment. A blurred 8.0 kb band was also observed at less than 1 / cell, but this was due to HS
It is likely due to a methyl or mutation at one of the BamHI sites in a subset of stalk-sewn O39 cells. 11 HSNO39 / AAV-SNO648 G418
Four of the resistant clones (1, 2, 9, and 10) contained the same three major bands as the parent strain, but without additional fragments. The 8.0 kb band for clones 4 and 5 represents a smeared band of the same size in the parent strain. For four of the clones,
A new band was observed, suggesting that random vector uptake also occurred in a subset of cells exposed to the vector. The three clones did not have the bands present in the parent strain (3, 4 and 7), which was due to the modification of the BamHI site rather than rearrangement since no new bands were observed in these clones. Can be explained. The homology between the vector and the chromosomal neo cassette extended to the BamHI site, and such modification of the chromosomal sequence at this site by vector DNA did not destroy that site. These results indicate that the majority of the isolated G418 resistant clones had at least one corrected neglected without additional rearrangement due to vector incorporation.
o Demonstrates that the gene was included.

C. Sequence of the corrected neo gene To assess the fidelity of the gene correction process, several corrected neo genes in bacterial plasmids were recovered and the relevant regions were sequenced. The neo gene cassette and the AAV-SNO648 vector present in HSNO39 cells can replicate and confer kanamycin resistance in E. coli (FIG. 1A), which allows recovery of the corrected neo gene as a bacterial plasmid. G418 resistant HS shown in FIG. 1B
Chromosomal DNA from the NO39 / AAV-SNO648 clone was digested with BamHI, circularized with DNA ligase and transferred into bacteria, which were then screened for kanamycin resistance. As shown in Table 2, the corrected neo gene was recovered as a bacterial plasmid from the 7/11 clone. More persistent attempts to recover plasmids from the remaining four clones have been successful. Plasmids isolated from these bacteria were
Only those with unique sites digested with mHI were considered correct. 2.7 kb
Plasmids were recovered from each of the seven clones and, by restriction digestion, the cyclized BamHI fragment was considered identical to that used to produce HSNO39 except for the absence of the bp39 mutation. A secondary 20 kb plasmid was also recovered from clone 11, but
This appeared to correspond to the high molecular weight band observed on the Southern blot. Clearly, at least two neo genes present in this cell line were corrected.
The recovered plasmid contained the wild type neo gene based on digestion with BsiEI, which could identify bp39 and bp648 mutations (see FIG. 1A).

[0117]

[Table 2]

The regions around the bp39 and bp648 mutations of each recovered plasmid were sequenced. Sequences greater than 200 bp were obtained from each region, but in all cases the sequences corresponded exactly to the sequence of the wild type neo gene. Thus, the gene correction step resulted in the precise deletion of the 14 nucleotide insertion present in the chromosomal bp39 mutation, without additional genetic changes, and without the insertion of the bp648 mutation present in the vector. However, because our assay required the presence of a functional neo gene, any additional mutations created during the targeting event that disrupted neo gene function were excluded from our analysis.

Example 2 Modification of Human HPRT Gene by AAV Vector Human Hypoxanthine Phosphoribosyltransferase Locus (HPRT)
AAV vector gene correction was also examined. HPRT gene, HPRT ^-
Since cells can be sorted by growth in the presence of 6-thioguanine (6TG),
Often used to check for mutations, such mutagenesis at a single copy X-linked locus can be measured in diploid male cells. This cell line has a pseudodiploid male karyotype (Rasheed et al. (1974) Cancer 33: 1027-1033) and is conventionally used for HPRT gene targeting experiments (Pikaart et a.
l. (1992) Mol. Cell. Biol. 12: 5785-92; Zheng et al. (1991) Proc. Natl. A
cad. Sci. USZ 88: 8067-71), HT-1080 human fibrosarcoma cells were used to examine gene targeting at the HPRT gene.

AAV containing a region of the human HPRT locus encompassing exons 2 and 3
Using the vector, specific mutations were introduced into the HPRT gene of HT-1080 cells (FIG. 2A). The AAV-HPe2 / 3 vector contains the wild-type genomic sequence, while the AAV-HPe2 / 3X vector contains a four nucleotide insertion in exon 3, which creates an open reading frame in the HPRT coding sequence. HT-108
0 cells were infected with both vectors and cells were cultured for a period of time without sorting to allow for elimination of pre-existing HPRT protein (see Experimental Procedures) before being sorted for 6TG resistance. As shown in FIG. 3, about 1/2000 HT-1080 cells infected with the mutant AAV-HPe2 / 3X vector were 6TG resistant. this is,
HT-1080 cells are not uniformly diploid and cannot contain additional X chromosomes (Ra
sheed et al., supra), and thus represents the minimum HPRT gene modification frequency. AAV-HPe2
The / 3X vector targeting frequency was approximately 30 times the background mutation rate. Infection with the wild-type vector did not result in a higher HPRT mutation rate than background.

[0121] Southern analysis of several 6TG resistant clones isolated after infection with AAV-HPe2 / 3X confirmed that a vector mutation was introduced at the chromosomal HERT locus. FIG. 2B shows the results of digestion with HindIII, which cuts outside the vector sequence and produces a 6.8 kb chromosomal fragment containing exons 2 and 3 in HT-1080 cells. This band is unchanged in all of the clones analyzed, which demonstrates the absence of large rearrangements in this region. Five strains contained additional bands, likely due to random vector incorporation. Further digestion with PvuI resulted in 10/13 clones
It contained a 2.2 kb band predicted from the migration of the I site insertion mutation (FIG. 2C). To date, 24 individual 6TG resistant HT-108 infected with AAV-HPe2 / 3X.
Of the 0 clones analyzed, 18 had the expected PvuI site insertion as determined by Southern analysis. The polymerase chain reaction (PCR) was used to amplify exon 3 from genomic DNA of six of these clones, and the PCR products were sequenced (see Experimental Procedures). At least 330 bp
Suspected sequence was obtained from each clone and encompassed all of exon 3.
In all cases, except for the predicted four nucleotide insertion in exon 3, the entire sequence was identical to the published HPRT sequence. Clones without additional vector integration events were sequenced to avoid amplification of unlinked vectors. Parent H
Sequences from the T-1080 cell line did not contain this insertion mutation.

Example 3 Effect of Vector Administration on Gene Correction The mutant neo gene in HSNO39 cells was transformed using a series of
Corrected with AAV-SNO648 vector. FIG. 4 shows the results of some experiments plotted as percent of infected vector genome / cell versus cells with the corrected neo gene. Gene correction rates increased from about 0.001 to greater than 0.1% with increasing vector dose of 40-2 x 10 ⁶ vector particles / cell. These results
This suggests that the gene correction response is limited by the number of vector molecules that enter the cell.

Example 4 Comparison of Transduction and Transfection Gene Correction Rates HSNO39 cells transduced with AAV-SNO648 vector stock,
Alternatively, the neo gene correction rates in HSNO39 cells transfected with plasmid pASNO648 containing the entire AAV-SNO648 genome were compared (
(Fig. 5). Transduction rates are at least as high as those obtained by transfection.
It was 400 times. PASNO39 containing the same mutation as the HSNO39 cell line
Further transfection experiments with the plasmid showed similar results to pASNO648, suggesting that the rate of gene correction of pASNO648 was actually due to mutation reversion rather than homologous pairing. Therefore, the homologous pairing rate by transduction is 40% as obtained by transfection.
It was much larger than 0 times. One possible explanation for this difference is that plasmid uptake occurs only in a small portion of transfected cells, while the vector genome appears to invade all cells. The stable transfection efficiency of HSNO39 cells, as determined by transfection with pASNori2, was about 7%, which is identical to pASNO648 except that it contains a functional neo gene. Perhaps even higher percentages of cells were transiently transfected. A conservative assumption was made that 7% of the transfected cells contained a functional plasmid molecule and that all of the G418 resistant colonies obtained by transfecting pASNO648 were due to homologous pairing. Even after
In transduced cells, it is more than 30 times that observed in a subpopulation of cells incorporating plasmid DNA (1.7 x ^10-3 vs 5.7 x ^10-5 ).

Example 5 Modification of HPRT Gene in Normal Human Fibroblasts A standard transduction experiment was performed by plating 5 × 10 ⁴ normal human fibroblasts / well in a 24-well plate. On day 2, the medium was changed and the vector stock (AAV-HPe2 / 3 or AAV-HPe2 / 3X, DMEM
Was prepared) was added to the wells. On day 3, each well was treated with trypsin and cells were plated in 10 cm dishes. On day 4, all cells from each well were cultured, but were not sorted for 12-14 days to remove existing HPRT protein in HPRT cells. The medium was changed every 3-4 days, and when the cell density became too high, the cells were treated with trypsin and the dilution was placed in a new dish. After this phenotypic expression period, 10 ⁵ , 10 ⁴ and 10 ² cells of each culture were plated in fresh 10 cm dishes and the next day 6TG (10 Tg / ml) was added to the 10 ⁵ and 10 ⁴ cell dishes. Since used to calculate the plate efficiency, 6TG selection was not applied to the 10 ² cells dishes. Cells were cultured for an additional 10 days, stained with Coomassie Brilliant Blue G, and viable colonies counted. After correction for plating efficiency, the percentage of 6TG resistant CFU was determined. Four different normal fibroblast cell lines were examined. MHF1, MH
F2 and MHF3 were from normal males and FHF1 was from normal females.

As shown in FIG. 6, modification of the HPRT gene was proportional to the number of infected virus genomes / cell. The modification was introduced into the HPRT gene of all four fibroblast cell lines (FIG. 7). Summary of Examples 1-5 These examples demonstrate that adeno-associated virus (AAV) based vectors efficiently and specifically modify vertebrate chromosome target sequences. Both the integrated neomycin phosphotransferase gene and the normal X-linked hypoxanthine phos-overflow transferase gene were targeted by the AAV vector. Site-specific genetic modifications can be introduced into normal primary cells, with> 0.1% of the total cell population being introduced and at a significantly higher rate than achieved by transfection. DNA sequencing demonstrated high fidelity of the process, with the majority of modified cells containing no other detectable genetic alterations. These results indicate that the parvovirus vector is capable of transfecting genomic DN in a wide variety of
It suggests that it is useful for introducing specific genetic changes into A.

Example 6 Assay System for Determining Gene Targeting Efficiency This example describes a system for determining gene targeting efficiency. This system uses a bicistronic retroviral vector to introduce a target locus into cells. The strategy used is illustrated in FIG.

A. Correction of Alkaline Phosphatase Gene In this experiment, a human placental alkaline phosphatase (AP) reporter gene was used. The LAPSN retroviral vector is a murine leukemia virus (MLV)
) Containing the AP gene under the control of the LTR and the neomycin resistance gene (neo) under the control of the internal SV40 early promoter (Miller et al. (1994) Proc. Na).
tl. Acad. Sci. USA 91: 78-82). This vector is replaced by nucleotide 3 of the AP reading frame.
Engineered with a 4 bp deletion at 75 to create the vector LAP375 (△ 4) SN, or engineered with a 2 bp deletion at nucleotide 961 to create the vector LAP961 (△ 2) SN. (FIG. 8). Retroviral vector stocks were prepared by transient transfection of PG13 cells using pseudotyped vector particles in the gibbon ape leukemia virus (GALV) envelope (Miller et al. (1991) J. Virol. 65: 2220-). 2224) This pseudotype allows for efficient infection of human cells. Normal primary human fibroblasts were isolated from LAP375 (# 4) SN /
Transduced with PG13 and selected in G418. Polyclonal populations from more than 5,000 individual transduced cells were obtained, each of which probably contained a different single copy integration site at the retroviral target locus.

An AAV vector AAV-5′APBss containing the 5 ′ portion of the AP gene was prepared (2486 bp BssHII restriction fragment from pLAPSN; see FIG. 9). LAP37
5 (△ 4) SN-containing fibroblast population was transformed with an MO of 1,200 vector particles / cell.
The AAV-5'APBss vector was infected with I and cells were cultured and stained for AP expression at different times after infection.

As shown in FIG. 10, the number of AP ⁺ cell foci increased during the culture period, with only large AP ⁺ foci appearing later than expected. The number of small foci (possibly reflecting recent gene targeting events) 1-2 AP ⁺ also increased over time, suggesting that gene correction continues to occur throughout the entire culture period. This is not surprising since the AAV vector genome persists in human fibroblasts as episomal molecules for several days (Russell et al. (1994) Proc. Natl. Acad. Sci. USA 91: 8915-8919).
. AP ⁺ cells were not observed in cells that did not contain the retroviral target or in cells that did not receive the AAV vector. These controls prevent reversion as a source of AP positivity. The absolute number of gene targeting events is equivalent to M
OI, similar to that obtained in HPRT targeting experiments using normal human fibroblasts (Russell and Hirata (1998) Nat. Genet. 18: 325-330), which was relatively low in this experiment. . Thus, these results can be used in normal human cells as a convenient assay for measuring gene correction with AAV vectors.

B. Correction and removal of neo gene In this experiment, we tested gene correction with a mutant neo gene in normal human cells. Using the retroviral vector MLV-LHSNO39, the mutant neo
The gene was introduced into normal human fibroblasts. MLV-LHSNO39 has a functional hygromycin resistance gene and neo having an insertion mutation at bp39 of the coding sequence.
The gene was contained. The vector also contained a p15A bacterial plasmid origin of replication and a prokaryotic promoter controlling the neo gene, which allowed the recovery of the corrected provirus as a bacterial plasmid conferring resistance to kanamycin or neomycin.

Using MLV-LHSNO39, normal human fibroblasts were transduced and hygromycin-resistant cells were selected. Next, these cells are treated with the neo gene coding sequence b
MLV-LH, except that it was mutated at p648 and no mutation was found at bp39.
AAV vector AAV-S having about 2.7 kb sequence identity with SNO39 vector
Transduction was performed using NO648 (FIG. 11). Both neo mutations disrupted neo function, where G418 resistant cells had to undergo a gene targeting event.

After infection with the AAV-SNO648 vector, about 1 in 1000 normal human fibroblasts containing the LHSNO39 target provirus became G418 resistant. This gene correction rate is the same as that of H containing the same neo mutation in Example 1 described above.
Similar to that observed for eLa cells. Several G418-resistant colonies were isolated and expanded to about 10 ⁶ to 10 ⁷ cells for DNA analysis (Table 3). Genomic DNA from each clone was digested with EcoRI, which once digested the LHSNO39 target in the hygromycin resistance gene outside of the region homologous to the AAV-SNO648 vector (Figure 11). The genomic DNA fragments containing the corrected neo extend downstream of the next EcoRI in the flanking chromosomal DNA, so that they are the entire region homologous to the AAV-SNO648 vector, and the immediate region of the region homologous to AAV-SNO648. g outer region, as well as the junction between the retroviral provirus and the chromosomal DNA. These fragments were circularized with DNA ligase and recovered in bacteria as plasmids conferring kanamycin or neomycin resistance. Table 3 summarizes the restriction digests and sequence analysis to date for these recovered plasmids.

[0133]

[Table 3]

Of the 12 individual G418 resistant fibroblast clones, 10 contained a corrected neo target, which could be easily recovered as a bacterial plasmid. Although there was some variability in the efficiency of plasmid removal, this was probably related to differences in flanking chromosomal DNA. In each case, a different plasmid was recovered, confirming that the retroviral vector provirus integrated at a different chromosomal location than expected. These excised plasmids were digested with a panel of enzymes intended to determine what large rearrangements were occurring during the targeting step, especially at the left and right homologous ends, where the sequence of the AAV targeting vector was retrograde. Branches off the sequence of the viral target. Based on restriction analysis, one of the 10 recovery targets was left homologous and rearranged, and all 10 right homologous ends were considered intact. Sequencing confirmed that nine of the ten plasmids removed had no modification at the left homologous end. clone#
Sequencing of the plasmid from 1 resulted in rearrangement, which was partially due to A
This was due to the insertion of 14 additional heterologous nucleotides from the AV vector.

These removal experiments and sequence analysis of HPRT gene targeting (Example 2) are high fidelity steps in which AAV-mediated gene correction usually consists of precise replacement of sequences at the intended modification site. Prove that. Furthermore, this step does not usually introduce secondary mutations or rearrangements, even at homologous ends. In the case of conventional gene targeting experiments based on electroporation, several tests (but Thomas et al. (1992) Mol. Cell. Biol. 12: 2919-2923; Zheng et.
Natl. Acad. Sci. USA 88: 8067-8071), but secondary mutations can occur at targeted loci (Brinster et al. (1989) Proc.
tl. Acad. Sci. USA 86: 7087-7091; Thomas and Capecchi (1986) Nature 324: 3.
4-38), especially rearrangements at the homologous end (Doetschman et al. (1988) Proc. Natl
Acad. Sci. USA 85: 8583-8587; Hasty et al. (1991) Mol. Cell. Biol. 11: 4.
509-4517), and it was important to determine the fidelity of the AAV-mediated response. It should be noted that we have not observed doubling at the AAV targeting locus, often caused by conventional gene targeting methods using insertion vectors.

[0136] These neo removal experiments demonstrate some heavy oil points. Because the tested fibroblast population contains a large number of individual target loci at random chromosomal locations,
It is believed that AAV-mediated gene correction is not limited to a particular locus (provided that
(Excluding potential preferential sites for retroviral integration). The fact that the method is a high fidelity gene correction event is crucial for using the method for therapeutic purposes. In addition, this demonstration using the neo target can confidently elucidate data using other retroviral targets, such as the AP gene (described above), which is more difficult to sequence. These studies also demonstrate the experimental potential of a retroviral targeted correction system, particularly where the targeted locus can be routinely recovered from normal human cells and analyzed as a bacterial plasmid. Thus, these experiments not only demonstrate fidelity, but also require a wide variety of cell types and sequences that require sequence analysis of the targeted locus to mask that mutations were introduced during gene correction. It can be easily adapted to culture conditions.

C. An important feature of the retroviral targeted gene correction system described herein is that
Its ability to be used on different cell types. This makes it possible to compare the various mutations in the gene that may be important for gene targeting and the gene targeting rates at the same locus with the same vector in the cell line. Because both the target and the retroviral vector used to introduce the AAV targeting vector have a broad host range, a large number of mutant cell lines can be tested. In particular, a related set of cells are primary human fibroblasts with mutations in genes involved in DNA repair and / or recombination, because these same genes play important roles in gene targeting. . Many types of these cells are available from the Coriell Institute for Medical Research (Camden NJ).

In this example, four different primary human fibroblast cultures were used. These fibroblasts are normal male (MHF2) or xeroderma pigmentosum (XP) complementary group A (
XPA1) or C (XPC1) and Bloom syndrome (BS1). Both diseases are associated with defects in DNA repair, XP patients show increased sensitivity to ultraviolet light, and Bloom syndrome patients have hypermutation.

To measure the gene correction rate, alkaline phosphatase (A
P) A gene targeting system was used. For all four fibroblast types,
Retroviral vector LAP375 containing mutant AP gene (# 4)
Transduction was performed with SN to select a polyclonal G418 resistant population, which consisted of more than 5,000 individual proviral integration events. These transduced fibroblasts were then infected with the AAV-5'APBss targeting vector, cultured for 8 days, and stained for AP expression. The gene correction rate was calculated as AP ⁺ number of foci / 10 ⁵ infected cells. No AP ⁺ foci were observed in cultures that did not receive the vector or in cultures that did not contain the retroviral vector target, confirming that AP expression was due to AAV-mediated gene correction. As shown in FIG. 12, XP fibroblast X was compared with normal human fibroblast MHF2.
Almost no difference was observed in the gene targeting rate between PA1 and XPC1. However, Bloom's Syndrome Fibroblast BS1 has an approximately 5-fold gene correction rate for both retroviral targets. Cells from patients with Bloom's syndrome are known to show an increased rate of daughter dye exchange (Chaganti et al. (197
4) Proc. Natl. Acad. Sci. USA 71: 4508-4512), thus suggesting that gene targeting and daughter thread exchange involve a similar mechanism.

These experiments demonstrate that the retroviral targeted correction assay can be used on different cell lines, including primary fibroblast cultures. A system for HT-1080 human fibrosarcoma cells and HeLa cells was also used, indicating that the method is applicable to a wide variety of cell types. Example 7 In Vivo Correction of Chromosomal Genes This example describes a method for performing in vivo gene correction using the gene targeting method of the present invention. One is endogenous β-glucuronidase gene (β-gus)
Two murine models were used, which had the same mutation and the other had an engineered mutation in the β-galactosidase (β-gal) transgene.

A. β-gus Gene In Vivo Correction A murine model of mucopolysaccharidosis type VII (MPSVII) was generated by a single base pair deletion in the β-gus gene (Sands and Birkenmeier (1993) Proc. N).
atl. Acad. Sci. USA 90: 6567-6571). Mouse ^homozygotes for the MPS VII mutant gus ^mps develop lysosomal storage diseases with characteristics similar to human MPS VII or Sly syndrome, such as reduced lifespan, skeletal abnormalities, and accumulation of glycosaminoglycans in various tissues. These mice are used for the following reasons:
It is an ideal model for studying in vivo gene targeting. First, both wild-type and mutant genomic loci have been cloned and sequenced (Gallagher et al. (1987) Genomics 1: 145-152; Sands and B
urkenmeier, above). Second, histochemical staining (similar to staining for β-gal) can be used to easily distinguish gus ⁺ cells from gus ^mps in tissue culture and tissue sections from several organs. Third, biochemical assays for β-glucuronidase are available (Gallagher (1992)). PCR assays have been developed that distinguish mutants from wild-type alleles (Wolfe and Sands (1996) Murine mu
copolysaccharidosis type VII: a model system for somatic gene therapy of
the central mervous system.In Protocols for gene transfer in neuroscie
nce: towards gene therapy of neurological disorders, PRLowenstein and W
Enquist, eds.,; John Wiley and Sons, Ltd.). Transformed fibroblast cell lines from gus ^mps heterozygotes and homozygotes can be used for in vitro studies. Furthermore, the mutation is a small (1 bp) deletion that can be easily corrected by the AAV vector.

A mouse β-gus genomic locus and the structure of an AAV vector suitable for use in this experiment are shown in FIG. The AAV vector contains about 4 kb of genomic DNA, including exon 10. The AAV-Gus10w5 vector is made from wild-type DNA, while the control vector AAV-Gus10mps contains a 1 bp deletion in exon 10 involved in MPS VII.

In initial experiments, MAV was infected by infection with the AAV-Gus 10 wt vector.
The gus ^mps mutation is corrected in transformed fibroblasts from PSVII mice and then stained for β-gus expression. Cells infected with the AAV-Gus 10 mps vector serve as controls. When gene correction has occurred, β-gus expression is observed only in cells infected with the wild-type vector. This experiment is expected to provide a reasonable prediction that part of the cultured mouse cells will work well in vivo, as they are generally more difficult to transduce with AAV vectors than in vivo mouse cells.

Next, heterozygous breeding and homozygous gus ^mps mice obtained by PCR for the gus ^mps allele (Wolfe and Sands, supra) in vi
A vo experiment was performed. Liver was used as the target tissue because β-gus was expressed at high levels. (Koeberl et al. (1997) Proc. Natl. Acad. Sci. USA 94: 1426-1
431; Snyder et al. (1997) Nat. Genet. 16: 270-276). By intravenous or intrahepatic injection, they were fed a 10 ¹⁰ 10 ¹¹ vector particles in 8-10 week old mice. Conventional gene loading studies have shown that both types of injections efficiently deliver vector particles to the liver (Koeberl et al. Supra).

At different time points after infection (about 2 weeks, 2 months and / or at death), β-gus
Mice were analyzed for genetic correction. Based on the AP gene targeting with the AAV vector (Figure 10) and the time course of a conventional gene addition experiment (Snyder et al. Supra) using the AAV vector to deliver the gene to mouse desiccation,
It takes days or weeks to reach the maximum gene correction level. In the latter case,
Assess the persistence of gene expression from the corrected allele.

Analysis of the injected mice involved staining the tissue sections for β-gus expression, measuring β-glucuronidase activity in tissue homogenates, and isolating DNA from tissue samples for Southern analysis and PCR. Become. As an organization to be inspected,
Includes liver, spleen, kidney, lung and brain. Individual gus ⁺ cells should be clearly visible in the stained section, which will give a gene correction rate based on an estimate of the total cell number in the section or visualized field. Close examination of the stained sections may also allow identification of which types of cells express β-gus. This histochemical analysis
Predicted to be the most sensitive test for genetic correction, the ability to detect genetic correction rates is well below 1%. Based on the in vitro gene targeting rate, the in vivo gene targeting rate is expected to be 0.1-1.0%. AAV-
Comparison of sections from mice injected with Gus 10 wt and the control vector AAV-Gus 10 mps demonstrates that the β-gus expression observed is due to specific correction of the gus ^mps 1 bp deletion mutation. Measurement of β-glucuronidase levels in the tissue homogenate is also performed to help determine the rate of gene correction.

If the gene correction rate is close to 10%, the wild-type allele will be digested by NlaIV, but the mutant allele will not be digested, so it would be possible to identify the corrected chromosomal gene directly on a Southern blot. . If the genetic correction rate is lower,
Southern analysis of genomic DNA samples can be performed (using restriction enzymes and / or probes from AAV terminal repeats) to identify random integration vector proviruses that may be present in addition to the targeting locus.

[0148] PCR analysis can also be used to identify corrected alleles. For example, FIG.
Exon 10 can be amplified using primers at the positions shown in FIG. These PCR products are produced only from the genomic β-gus locus and should not be produced from random integration vectors. It should be possible to digest the product with NlaIV and then discriminate between mutant and corrective genes and detect relatively small fractions of wild-type, corrective alleles.

A similar gene correction experiment is also performed on neonatal animals by injecting the vector into the superficial temporal vein (Sands et al. (1993) Lab. Invest. 68: 676-686).
This approach has proven very well in gene transfer experiments with AAV vectors and allows vector delivery at the point where more cell growth occurs. In addition, any therapeutic effects that may be due to genetic correction must appear before permanent damage occurs in the elderly animal. Compared to uncorrected gus ^mps littermates,
The development of the animals can be followed and microscopic techniques can be used to determine that reduction in the expanded lysosomes has occurred (Wolfe and Sands, supra).

B. Transgenic mouse model for β-Gal transduced gene in vivo correction is also developed for in vivo gene correction experiments. This model, lac in lactose-containing medium ^- to based on beta-gal shuttle transduction gene as a bacterial plasmid capable of growing the bacteria may retrieve from mammalian cells. Transgenic mice containing a mutated version of the β-gal shuttle transgene are infected with an AAV targeting vector capable of correcting the β-gal mutation, and cells carrying the corrected transgene are transformed into β-gus Detection is performed by histochemical staining of tissue sections as in the experiments described above for gene correction. The main advantage of the β-gal system is that the corrected gene is taken up into bacteria, providing an individual estimate of the correction rate and allowing sequence analysis of the targeted gene. Furthermore, by selecting mice with the desired transgene expression profile, gene correction experiments can be performed on a variety of different organs. The approach is similar to other transgenic animal models screening for mutagenesis with the β-gal transgene, except in this case a test for genetic correction (Gossen et al. (1994) Mutat. Res. 307: 451-459).

FIG. 14 shows the constructs (in a linear form) that can be used in these experiments. pCn
ZSNO contains the nuclear localized β-gal gene under the control of the strong cytomegalovirus (CMV) promoter, the neo gene under the control of the SV40 early promoter and p
Contains the 15A plasmid origin. The SV-neo-p15A portion of the plasmid
This is the same shuttle vector cassette used in Example 6, which replicates in E. coli and confers kanamycin resistance. The β-gal gene also contains a bacterial lac operator and promoter (“lac” in FIG. 14), which regulates transcription in E. coli and allows for a blue / white screen for corrected alleles, lac ⁻ Another prokaryotic selectable marker is provided that confers lactose-dependent growth on bacteria. HeLa cells transfected with pCnZSNO form G418-resistant colonies with blue nuclei when stained for β-gal expression. Bacterial colonies can be selected for pCnZSNO by growing in media containing kanamycin or lactose as the sole sugar source.

The plasmid pCnZSNO can be further modified to contain additional marker genes that help identify transfected cells that express the β-gal transgene. As mutations are introduced into β-gal for genetic correction experiments, additional markers for identification are needed. For example, the internal ribosome entry V (controlled by the same promoter as β-gal but from encephalomyocarditis virus)
A reporter gene that initiates translation from the IRES) can be inserted downstream. Plasmids with green fluorescent protein (GFP) and / or alkaline phosphatase (AP) can be constructed, for example, as shown in FIG.

The pCnZGSNO and pCnZAPSNO plasmids are first tested in cultured cells. Mutations that disrupt protein function are engineered in the plasmid β-gal gene. HeLa cells are transfected with these mutated plasmids and stable integrants are selected in G418. Individual G418 resistant colonies are selected and examined for GFP or AP expression by visualization under fluorescent or histochemical staining. Colonies expressing GFP or AP are then screened for gene co-reactivity with an AAV vector containing the wild-type portion of β-gal (FIG. 14). Some of the β-gal contained in the vector contains functional β
-Does not encode the gal protein. Identify the corrected gene by staining HeLa cells for β-gal expression (similar to the AP gene correction assay described above), and by removing the plasmid and screening bacterial colonies for β-gal expression. .

Plasmid removal experiments are similar to those described above, in which the integrated transgene outside the required genetic elements is digested with restriction enzymes, the bacteria are electroporated, and then selected for kanamycin resistance (neo removal). And growing on lactose-containing medium (removal of β-gal). In the case of neo extraction experiment, Xp-
Colonies can be grown on gal plates and the percentage of recovered plasmids with the corrected transgene determined by blue / white colony screening. These in vitro experiments demonstrate that all brush-like constructs for gene correction work properly.

Next, transgenic animals are generated by prokaryotic injection of the appropriate pCnZGSNO or pCnZAPSNO construct. Pups are screened for the presence of the transgene by assaying for GFP expression under fluorescence or AP expression by histochemical staining of tail or toe sections. Pu expressing transgene
p can be analyzed by Southern blot to determine the structure of the transgene. These founders are bred and their progeny are screened to determine which organs and tissues express the GFP or AP reporter gene. Perhaps,
Mutant β-gal transcripts, because they are controlled by the same promoter,
It appears that they are highly expressed even in these same tissues. The goal is to identify animals that express high levels of GFP or AP in a wide variety of tissues. Such animals are a versatile model for studying in vivo gene correction.

Once suitable transgenic mice have been identified, they are used for in vivo gene correction experiments. The AAV vector used contains a wild-type β-gal sequence or a version of β-gal with the same mutations present in the transgenic animal. Only wild-type vectors should produce genetic correction.
As in the previous experiments, intravenous or intrahepatic injection gave 10 ¹⁰
1010 ¹¹ AAV vector particles were inoculated. These injections are expected to deliver the vector primarily to the liver (Koeberl et al. Supra). AAV vectors have been found to efficiently transduce skeletal muscle in gene addition experiments (Fisher e
t. al. (1997) Nat. Med. 3: 306-312; Xiao et al. (1996) J. Virol. 70: 8098-8.
108), and because this technique can be easily performed, intramuscular injection is also preferred in these transgenic animals. In addition, intravenous injections can be performed on newborn animals as described above.

Animals are sacrificed at different time points after injection (about 2 weeks, 2 months and 12 months or at death from other causes) and analyzed by several methods. First, tissue sections are histochemically stained for nuclear β-gus expression to determine the rate of gene correction in the relevant organ. Second, D, including Southern blot and plasmid removal in bacteria.
Perform NA analysis. Southern analysis determines the overall structure of the target locus and is useful for identifying occurring, eg, possible, random integration events. Plasmid removal is performed by selecting for the neo or β-gal gene, and the recovered plasmids are sequenced to determine that gene correction has occurred as expected and to assess the fidelity of the reaction. Gene correction rates are also measured by blue / white staining of colonies for β-gal expression in plasmids recovered by neo gene selection.

The embodiments described herein are for illustration only, and various modifications and alterations in this regard are suggested to those skilled in the art and are within the spirit and scope of the present application. It is understood that they fall within the scope of the appended claims. All publications, patents and patent applications cited herein are hereby incorporated by reference.

[Brief description of the drawings]

FIG. 1A shows the adeno-cooked rice virus vector AAV-SNo described in Example 1.
It is a figure of ri. This vector contains two AAV terminal repeats (TR), a bacterial gene encoding neomycin phosphotransferase (neo) under the control of the SV40 early promoter and a bacterial Tn5 promoter, a p15A plasmid origin of replication and a eukaryotic polyadenylation site. Bp39 and b of the neo gene respectively
Vectors AAV-SNO39 and AAV-SNO6 containing mutations in p648
48 is also shown.

FIG. 1B shows G418 resistant HeLa modified as described in Example 1.
It is an autoradiogram showing the result of Southern blot analysis of BamHI-digested genomic DNA from a cell clone. The lane with the heading “HeLa” is the unmodified HeL
a shows the hybridization of the neo gene probe with genomic DNA from cells, and the lane heading “HSNO39” shows the lane with HSNO39 containing three copies of the plasmid containing the internal portion of AA non-SNO39. Probe hybridization is shown, lanes 1-11 show probe hybridization with 11 different clones obtained by modifying HSNO39 cells with parvovirus vector AAV-SNO648.

FIG. 2A is a diagram of the human HPRT locus and the AAV vectors HPe2 / 3 and HPe2 / 3X used to modify the human HPRT locus. In addition to the indicator part of the HPRT gene, these vectors described in Example 2 contain two AAV terminal repeats (TR) and four Alu repeats called O, P, Q and R.

FIGS. 2B and 2C are autoradiograms of HT-1080 monofilament sarcoma cell genomic DNA digested with HindIII (FIG. 2B) or HindIII + PvuI (FIG. 2C). The lane under the heading "HT1080" shows the hybridization of the probe shown in FIG. 2A with genomic DNA from unmodified HT1080 cells, and lanes 1 to 13 were transduced with the AAV vector AAV-HPe2 / 3X. 6
Shown is the hybridization of this probe with genomic DNA from 13 different clones rendered TG resistant.

FIGS. 2B and 2C are autoradiograms of HT-1080 monofilament sarcoma cell genomic DNA digested with HindIII (FIG. 2B) or HindIII + PvuI (FIG. 2C). The lane under the heading "HT1080" shows the hybridization of the probe shown in FIG. 2A with genomic DNA from unmodified HT1080 cells, and lanes 1 to 13 were transduced with the AAV vector AAV-HPe2 / 3X. 6
Shown is the hybridization of this probe with genomic DNA from 13 different clones rendered TG resistant.

FIG. 3 shows AAV vectors AAV-HPe2 / 3 and AAV-HPe2 / 3X.
Shows the results of the experiment described in Example 2 used to modify the HPRT locus in HT-1080 cells. The percentage of 6TG-resistant cells obtained is indicated.

FIG. 4 shows that the defective neo gene present in HeLa cells is AAV vector AAV-
FIG. 9 shows the results of analysis of the effect of the multiplicity of infection on the frequency of correction by SNO648. This experiment is described in Example 3.

FIG. 5 shows a comparison of the frequency of neo gene correction in HSNO39 cells obtained using transduction versus transfection as described in Example 4. Transduction is performed with the AAV vector AAV-SNO648, while transfection is performed with plasmids pASNO648 (containing the entire AAV-SNO648 genome), pASNO39 (containing a mutation at base pair 39 of the neo gene).
And pASNori2 (without neo mutation).

FIG. 6 shows the fractionation of normal human fibroblasts having a modified HPRT gene after transduction with the AAV vector AAV-HPe2 / 3 as described in Example 5. The fraction of HPRT-modified cells is plotted against the number of infected AAV genomes per cell.

FIG. 7 shows four different normal human fibroblast cultures transduced with AAV-HPe2 / 3 (wild-type HPRT gene) or AAV-HPe2 / 3X (introducing a frameshift mutation in the HPRT gene). 3 shows the results of the experiment performed. HPR
The percentage of T gene modification is indicated.

FIG. 8 is a schematic diagram of gene targeting at a retroviral vector target locus.

FIG. 9 shows the vector used for gene targeting studies by repair of the alkaline phosphatase gene. Two retroviral vectors (
MLV-LAPSN) is shown. Vector LAP375 # 4 has a 4 bp deletion at nucleotide 375 of the AP reading frame, while vector LAP96 # 2 has a two base pair deletion at nucleotide 961. If any of these vectors
It is introduced into a host cell as a target locus for gene targeting.
AAV vector used for gene targeting (AAV-5'AP
Bss) contains part of the AP gene.

FIG. 10 shows the time course of gene targeting using the AP vector system.

FIG. 11 shows retroviral and AAV vectors suitable for use in testing the ability to correct the neo gene by gene targeting.
Retroviral vector MLV-L introduced into host cells as target locus
HSNO39 has a neomycin resistance gene containing an insertion mutation at bp39 of the neo gene. The AAV vector AAV-SNO648 contains a neo gene with an insertion mutation at bp 648 of the neo gene.

FIG. 12 shows normal (MHF2) and mutant fibroblasts (xeroderma pigmentosum complementation groups A (XPA1) and C (XPC1) and Bloom syndrome (BS1)).
5 shows the results of an experiment in which a mutant AP gene was corrected by gene targeting in Example 1.

FIG. 13 shows the mouse β-glucuronidase genomic locus and AA used in experiments to correct mutations in the genomic β-glucuronidase locus.
1 shows the structure of a V vector.

FIG. 14 shows β-galactosidase transgenes introduced into transgenic animal cells (pCnZSNO, pCnZGSNO (green fluorescent protein reporter gene) and pCnZAPSNO (alkaline phosphatase reporter gene)). An AAV vector containing a portion of the β-gal coding sequence is also shown.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) // A61K 35/76 C12N 5/00 B (81) Designated countries AE, AL, AM, AT, AU, AZ , BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO , NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, UZ, VN, U, ZA, ZW (72) inventor Hirata, Rory cable. United States, Washington 98102, Seattle, Twelve Avenue 603, Apartment Sea F-term (reference) 4B024 AA10 AA11 AA20 DA02 EA02 FA11 GA11 HA17 4B063 QA01 QA13 QA18 QQ02 QQ42 QQ53 QR08 QR55 QR62 QR80 QS25 QS34 4B0AA90A90A CA46 4C084 AA13 MA13 MA52 MA56 MA66 4C087 AA01 BC83 MA13 MA52 MA56 MA66

Claims (26)

[Claims] 1. A method for producing a vertebrate cell having a modification in a preselected target locus, comprising the steps of: a) ligating a DNA sequence that is substantially identical to the target locus except that the modification has been introduced. A targeting construct comprising: b) introducing a recombinant parvovirus vector genome comprising all or a portion of at least one parvovirus ITR or functional equivalent into a vertebrate cell, comprising: The recombinant parvovirus vector genome is introduced into vertebrate cells by a method selected from the group consisting of injection, transfection, electroporation, lipofection, lipid encapsulation, and biolistics, and the targeting construct is linked to the target locus. Homologous pairing occurs between the target The method involves causing modification which has been introduced into the child seat. 2. The method of claim 1, wherein the nucleus is removed from the vertebrate cell and the organism is transplanted into cells that can be reconstituted upon transplantation of the nucleus. 3. The method of claim 2, wherein the cells are selected from the group consisting of embryonic stem cells, sperm cells, eggs, fertilized eggs, and somatic repopulation cells. 4. A method of producing a non-human animal comprising cells having a modification of the target locus, comprising: a) DNA substantially identical to the target locus except that the modification has been introduced. Introducing into a vertebrate cell a targeting construct comprising the sequence, and b) a recombinant parvovirus vector genome comprising all or part of at least one parvovirus ITR or functional equivalent,
In this case, a homologous pairing between the targeting construct and the target locus occurs,
Producing a modification that has been introduced at the target locus, introducing nuclei from the cells into secondary cells from which the animal can be reconstituted, and allowing the cells to develop into an embryo. 5. The method of claim 4, wherein the animal is a transgenic animal. 6. The method according to claim 4, wherein the animal is a chimeric animal. 7. A method of producing a vertebrate cell having a modification at a preselected target locus, comprising: a) a DNA sequence substantially identical to the target locus except that the modification has been introduced. Introducing into the vertebrate cell a recombinant parvovirus vector genome comprising b) all or part of at least one parvovirus ITR or functional equivalent, and c) a targeting enhancer comprising:
In this case, a homologous pairing between the targeting construct and the target locus occurs,
Producing a modification that has been introduced at the target locus. 8. The method of claim 7, wherein the targeting enhancer is selected from the group consisting of an addition product, a pyrimidine dimer and a modified nucleotide or a modified DNA backbone. 9. The method of claim 7, wherein the recombinant parvovirus vector genome is associated with a DNA recombinant polypeptide or a DNA repair polypeptide. 10. The recombinant polypeptide comprising RecA, a RecA homolog and R
10. The method of claim 9, wherein the method is selected from the group consisting of ecA-related proteins. 11. A method for producing a vertebrate cell having a modification at a preselected target locus, comprising: a) a DNA sequence substantially identical to the target locus except that the modification has been introduced. A targeting construct comprising: b) introducing a recombinant parvovirus vector genome comprising all or a portion of at least one parvovirus ITR or functional equivalent into a vertebrate cell, comprising: The total member of the population of the recombinant parvovirus vector genome administered to the is a + line of the recombinant parvovirus genome, or the total member of the population is a-line, and between the targeting construct and the target locus A method comprising causing homologous pairing to result in a modification being introduced at the target locus. 12. A method for producing a vertebrate cell having a modification in a preselected target locus, comprising: a) a DNA sequence substantially identical to the target locus except that the modification is introduced. A targeting construct comprising: b) introducing a recombinant parvovirus vector genome comprising all or a portion of at least one parvovirus ITR or functional equivalent into a vertebrate cell, comprising: Is treated with an agent that increases targeting efficiency, resulting in homologous pairing between the targeting construct and the target locus, resulting in a modification being introduced at the target locus. 13. Agents that increase targeting efficiency include: cell cycle modulators, DNA repair modulators, DNA recombination modulators, modulators of chromatin packaging, inhibitors of apoptosis and D
13. The method of claim 12, wherein the method is selected from the group consisting of NA methylation inhibitors. 14. A method of producing a vertebrate cell having a recombination signal at a preselected target locus, comprising: a) substantially identical to the target locus except for the presence of the recombination signal in the targeting construct. And b) introducing into a vertebrate cell a recombinant parvovirus vector genome comprising all or part of at least one parvovirus ITR or functional equivalent. A method comprising: causing a homologous pairing between a targeting construct and a target locus to produce a recombination signal that has been introduced at the target locus. 15. The method of claim 14, wherein the recombination site is a lox site. 16. A method for determining the efficacy of parvovirus vector-mediated gene targeting, comprising: a reporter gene comprising a primary mutation that prevents expression of a reporter gene product having a detectable phenotype. Providing a retroviral provirus and introducing a recombinant parvovirus vector genome containing the polynucleotide subsequence of the reporter gene into the cell, wherein the polynucleotide subsequence overlaps with the location of the primary mutation But does not contain a primary mutation and includes a secondary mutation that prevents expression of a reporter gene product having a detectable phenotype, in which case a homologous pair between the polynucleotide subsequence and the reporter gene Conjugation occurs to correct primary mutations and reporter gene expression Flip and method comprises detecting the presence or absence of the reporter gene product. 17. The method of claim 16, wherein the secondary mutation is one or more mutations selected from the group consisting of deletion, nonsense mutation, missense mutation and insertion. 18. The method of claim 16, wherein the retroviral provirus comprises a selectable marker in addition to the reporter gene. 19. The vector genome includes a selectable marker.
The method of any one of the preceding claims, further comprising selecting the cells for expression of a selectable marker. 20. The method of claim 16, wherein said reporter gene product is selected from the group consisting of alkaline phosphatase, green fluorescent protein and β-galactosidase. 21. A method for enriching cells that have undergone gene targeting at a target locus, comprising: 1) a reporter gene comprising a primary mutation that prevents expression of a reporter gene product having a detectable phenotype. And 2) providing a cell having the target locus for which modification is desired, comprising: a) a selection construct comprising a polynucleotide subsequence of the reporter gene, wherein the polynucleotide subsequence is a primary mutation But does not contain a primary mutation and includes a secondary mutation that prevents expression of a reporter gene product having a detectable phenotype, and b) the target except that a modification has been introduced. A recombinant parvovirus vector comprising a targeting construct comprising a DNA sequence substantially identical to the locus -The reporter gene product is introduced into the cell in order to introduce the genome into the cell and cause a homologous pairing between the polynucleotide subsequence and the reporter gene to correct the primary mutation and to obtain a population of cells that have expressed the reporter gene. Identify cells that are expressed and screen a population of cells to identify those that have undergone a homologous pairing between the targeting construct and the target locus resulting in the modification being introduced into the target locus A method comprising the steps of: 22. The method of claim 21, wherein the cell is a cell from which an organism can be reconstituted. 23. The method of claim 21, wherein the nucleus is removed from the vertebrate cells and the organism is transplanted into cells that can be reconstituted upon transplantation of the nucleus. 24. The method of claim 23, wherein the cells are selected from the group consisting of embryonic stem cells, sperm cells, eggs, fertilized eggs and somatic repopulation cells. 25. The method of claim 21, wherein the selection construct and the targeting construct are on different parvovirus vector genomes. 26. A method for enrichment for cells in which gene targeting at the target locus has occurred, comprising the steps of: a) substantially the same as the target locus except that the following modifications are introduced into the cells: Introducing a recombinant parvovirus vector genome that includes a DNA sequence that is identical, and b) a targeting construct that includes a selectable marker, and homologous pairing between the targeting construct and the target locus occurs to produce a target gene. Growing the cells under sorting conditions to enrich for cells that have undergone the modification introduced into the locus.