JP2002526036A - Novel G protein-coupled receptor cDNA sequence - Google Patents

Abstract

  (57) [Summary] Provided is a cDNA encoding a novel human G protein-coupled receptor HG03, and a protein encoded by the cDNA. Methods for identifying agonists and antagonists of HG03 are also provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION [0001] The present invention relates to a novel human cDNA encoding a G protein-coupled receptor (GPCR) having homology to nucleotides and members of the receptor family for platelet activating factor; Proteins and methods for identifying selective agonists and antagonists.

BACKGROUND OF THE INVENTION G protein-coupled receptors (GPCRs) form a very large class of membrane receptors that relay information from the outside of cells to the inside. GPCRs function by interacting with a group of heterotrimeric proteins known as G proteins. Most GPC
R functions by a similar mechanism of action. After binding to the agonist, the GPCR catalyzes the dissociation of guanosine diphosphate (GDP) from the G protein α subunit. This binds guanosine triphosphate (GTP) to the α subunit and dissociates the α subunit from the β and γ subunits. This released α-subunit then interacts with other cellular components and, in the process, carries extracellular signals represented by the presence of the agonist. Sometimes it is the free β and γ subunits that carry this agonist signal.

[0003] GPCRs have common structural features. GPCRs have seven hydrophobic domains of about 20-30 amino acids in length, linked by a sequence of hydrophilic amino acids of various lengths. These seven hydrophobic domains are inserted into the plasma membrane, resulting in a protein with seven transmembrane domains, an extracellular amino terminus, and an intracellular carboxyl terminus (Strader et al., 1994, Ann. Rev. Biochem. 63: 101-132; Schertler et al.,
1993, Nature 362: 770-772l; Dohlman et al., 1991, Ann. Rev. Biochem. 60: 653-
688).

[0004] GPCRs are expressed in a wide variety of tissues and respond to a wide variety of ligands such as, for example, protein hormones, biological amines, peptides, lipid-derived messengers, and the like. Given their widespread expression and ligands, it is not surprising that GPCRs are involved in many pathological conditions. This has sparked great interest in the development of modulators of GPCR activity that can be used pharmacologically. For example, Table 1 of Stadel et al., 1997, Trends Pharmacol. Sci. 18: 430-437 shows that GPC
There are 37 different over-the-counter drugs that act on R. Thus, there is a great need to understand the function of GPCRs and to develop agents that can be used to modulate GPCR activity.

SUMMARY OF THE INVENTION [0005] The present invention is directed to novel human cDNAs encoding the G protein-coupled receptor HG03. The DNA encoding HG03 is substantially free of other nucleic acids and has the nucleotide sequence shown in SEQ ID NO: 1. The present invention also provides the HG03 protein encoded by this novel cDNA sequence. This HG03 protein is substantially free of other proteins and has the amino acid sequence shown in SEQ ID NO: 2. HG03 using recombinant system
Are also provided, as well as methods for identifying HG03 agonists and antagonists.

DETAILED DESCRIPTION OF THE INVENTION For the purposes of the present invention: The expression “substantially free of other proteins” means at least 90%, preferably 95%, more preferably 99%, and even more preferably Means 99.9% free of other proteins. Therefore, it is substantially free of other proteins
The HG03 protein preparation has less than 10%, preferably less than 5%, more preferably less than 1%, and even more preferably less than 0.1%, as a percentage of total protein.
Does not contain HG03 protein. Whether a particular HG03 protein preparation is substantially free of other proteins can be determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) in combination with appropriate detection methods (eg, silver staining or immunoblotting). Can be determined by conventional techniques for assessing protein purity.

The expression “substantially free of other nucleic acids” means at least 90%, preferably 95%
, More preferably 99%, and even more preferably 99.9% free of other nucleic acids. Thus, an HG03 DNA preparation substantially free of other nucleic acids, as a percentage of its total nucleic acids, is 10% or less, preferably 5% or less, more preferably 1% or less,
And even more preferably, no more than 0.1% contains non-HG03 nucleic acids. Specific HG03 DNA
Whether the preparation is substantially free of other nucleic acids can be determined by conventional techniques for assessing nucleic acid purity, such as agarose gel electrophoresis in combination with appropriate staining methods (eg, ethidium bromide staining), or by sequencing. Can be determined by

[0008] A "functional equivalent" refers to a naturally occurring receptor that differs in amino acid sequence from a naturally occurring G protein-coupled receptor by alternative splicing, deletion, mutation or addition. Refers to a receptor that retains at least 1%, preferably 10%, and more preferably 25% of the biological activity of A. Such a derivative will have a high degree of homology to the native GPCR. Genes and cDNAs encoding such derivatives can be detected by reduced stringency hybridization with the DNA sequence encoding the native GPCR. Nucleic acids encoding functional equivalents have at least about 50% homology at the nucleotide level with naturally occurring receptor nucleic acids.

[0009] polypeptide that for a polypeptide is the ligand, if they have a 5 times or less a K _d value of K _d values of the HG03 for the same ligand, HG03 and "substantially the same biological activity ].

“Conservative substitution of an amino acid” refers to the replacement of one amino acid residue with another chemically similar amino acid residue. Examples of such conservative substitutions include the substitution of one hydrophobic residue (isoleucine, leucine, valine or methionine) for another; another hydrophobic residue having the same charge as one polar residue. (Eg, replacement of lysine with arginine; replacement of aspartic acid with glutamic acid).

One aspect of the present invention is the identification and cloning of a novel G protein-coupled receptor (GPCR), designated HG03, that is substantially free of proteins associated with the receptor.

[0012] Another aspect of the invention is a nucleic acid encoding an HG03 G protein-coupled receptor. These nucleic acids are substantially free of related nucleic acids. For cloning purposes, DNA is mostly a preferred nucleic acid.

The present invention provides a cDNA molecule having the nucleotide sequence shown in FIG. 1 as SEQ ID NO: 1 and substantially free of other nucleic acids. According to the analysis of FIGS. 3A-C, SEQ ID NO.
It was found that positions 346 and 1,419 contained an open reading frame. Accordingly, the present invention also provides a cDNA molecule comprising the nucleotide sequence of positions 346 to 1,419 of SEQ ID NO: 1 and substantially free of other nucleic acids. The present invention also provides a recombinant DNA molecule comprising the nucleotide sequence of positions 346 to 1,419 of SEQ ID NO: 1.

[0014] Sequence analysis of the open reading frame of the HG03 cDNA reveals that it encodes a protein of 358 amino acids. Based on the predicted amino acid sequence, HG03 is very likely to be a novel GPCR. Northern blot analysis showed that HG03 RNA was highly expressed in human prostate, placenta and trachea, with a major transcript of about 1.8 kb and a minor transcript of about 1.8 kb.
8.0 kb. HG03 was also expressed at a lower level in the thymus and testis as a transcript of approximately 1.8 kb. HG03 appears to be related to members of the receptor for nucleotides and platelet activating factors.

[0015] The novel DNA sequence of the present invention encoding HG03 may be wholly or partially
It can be combined with other DNA sequences (ie, DNA sequences that are not naturally associated with HG03) to form “recombinant DNA molecules” that include HG03. The novel DNA sequences of the present invention can be inserted into a vector containing a nucleic acid encoding a GPCR or a functional equivalent thereof. These vectors may consist of DNA or RNA; for cloning purposes, mostly DNA vectors are preferred. Typical vectors include plasmids, modified viruses, bacteriophages, and cosmids, yeast artificial chromosomes, and other forms of episomal or integrated DNA that can encode a GPCR. Determining the appropriate vector for a particular gene transfer or other use is well within the skill of the artisan.

A cDNA sequence that hybridizes to SEQ ID NO: 1 under stringent conditions is included in the present invention. A non-limiting example of a procedure using high stringency conditions is as follows. That is, pre-hybridization of the filter containing DNA was performed using 6X SSC, 5X Denhardt solution and 100 μg / ml denatured salmon sperm DN.
Perform in a buffer consisting of A for 2 hours to overnight at 65 ° C. Filter 10
Hybridize at 65 ° C. for 12 to 48 hours in a prehybridization mixture containing 0 μg / ml denatured salmon sperm DNA and 5-20 × 10 ⁶ cpm of ³² P-labeled probe. Washing of the filter is performed at 37 ° C. for 1 hour in a solution containing 2 × SSC, 0.1% SDS. Then, at 50 ° C in 0.1X SSC, 0.1% SDS before autoradiography.
Wash for 45 minutes.

Other procedures using high stringency conditions include hybridization steps performed in 5X SSC, 5X Denhardt's solution, 50% formamide at 42 ° C for 12 to 48 hours, or in 0.2X SSPE, 0.2% SDS And a washing step performed at 65 ° C. for 30 to 60 minutes.

[0018] The reagents described in the above procedure for performing high stringency hybridization are well known in the art. Details of the composition of these reagents can be found, for example, in Sambrook, Fritsch and Maniatis, 1989, Molecular Cloning: A Laborato
It can be found in the ry Manual, 2nd edition, Cold Spring Harbor Laboratory Press. In addition to the conditions described above, other high stringency conditions that can be used are well known in the art.

[0019] Another embodiment of the present invention includes host cells that have been genetically engineered to contain and / or express a DNA sequence encoding HG03. Such a recombinant host cell can be cultured under conditions suitable for producing HG03. HG03 can be expressed in recombinant host cells using an expression vector containing DNA encoding HG03. The recombinant host cell may be a prokaryotic cell or a eukaryotic cell,
Bacteria such as Escherichia coli; fungal cells such as yeast; mammalian cells including but not limited to cell lines of human, bovine, porcine, monkey and rodent origin; and cell lines derived from Drosophila and silkworm including but not limited to Insect cells; and the like. Cell lines derived from mammalian species that are suitable for recombinant expression of HG03 and are commercially available include, but are not limited to, L cell LM (TK ⁻ ) (ATCC CCL 1.3), L cell LM (ATCC CCL 1.2),
293 (ATCC CRL 1573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CCL 70)
CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 9)
2), NIH / 3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), B
SC-1 (ATCC CCL 26) and MRC-5 (ATCC CCL 171).

Human embryonic kidney (HEK 293) cells and Chinese hamster ovary (CHO) cells are HG03
Particularly suitable for protein expression. This is because these cells express a large number of G proteins. Thus, at least one of these G proteins can be functionally linked to a signal generated by the interaction of HG03 with its ligand, thereby transmitting this signal to downstream effectors and ultimately Is any component that can be assayed (eg, cAMP levels, reporter gene expression, inositol lipid hydrolysis, or intracellular Ca ²⁺ levels)
Would result in a measurable change in

[0021] Recombinant HG03 can be expressed in mammalian cells using various mammalian expression vectors. Suitable commercially available mammalian expression vectors include, but are not limited to, pCR2.1 (Invitrogen), pMClneo (Stratagene), pSG5 (Stratagene), pc
DNAI and pcDNAIamp, pcDNA3, pcDNA3.1, pCR3.1 (Invitrogen), EBO-pSV2-neo
(ATCC 37593), pBPV-1 (8-2) (ATCC 37110), pdBPV-MMTneo (342-12) (ATCC 372
24), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198) and pSV2-dhfr (ATCC 371)
46) is included. After expression in recombinant cells, HG03 can be purified by conventional techniques to a level substantially free of other proteins.

Like many receptor proteins, altering a number of amino acids of HG03, particularly those not in the ligand binding domain, and yet retain substantially the same biological activity as the original receptor Is possible. Accordingly, the present invention encompasses modified HG03 polypeptides that have amino acid deletions, additions or substitutions, but still retain substantially the same biological activity as HG03. It is generally accepted that single amino acid substitutions do not usually alter the biological activity of the protein (eg, Molecu
lar Biology of the Gene, Watson et al., 1987, 4th edition, The Benjamin / Cummings P
ublishing Co., Inc., p. 226; and Cunningham and Wells, 1989, Scienc.
e 244: 1081-1085). Accordingly, the invention encompasses a polypeptide in which one amino acid has been substituted in SEQ ID NO: 2, wherein the polypeptide still retains substantially the same biological activity as HG03. The present invention also encompasses a polypeptide in which two or more amino acids have been substituted in SEQ ID NO: 2, wherein the polypeptide still retains substantially the same biological activity as HG03. In particular, the present invention includes embodiments wherein the above substitutions are conservative substitutions. In particular, the invention encompasses embodiments where the above substitutions are not present in the ligand binding domain of HG03.

The present invention also encompasses HG03 in the C-terminal truncated form, particularly truncated HG03, which contains the extracellular portion of the receptor but lacks the intracellular signal portion. Such truncated receptors are useful in various binding assays described herein for crystallization studies and structure-activity relationship studies.

Romano et al., 1996, J. Biol. Chem. 271: 28612-28616 showed that GPCRs that are homodimerized through intermolecular disulfide bonds are often found.
The position of the cysteine involved in the disulfide bond is the amino terminal 17 kD of the receptor.
Turned out to be present. Therefore, the present invention includes a dimer of HG03.

It has been found that it may be possible in some cases to suppress receptor function using a membrane spanning region of the receptor protein (Ng et al., 1996, B
iochem. Biophys. Res. Comm. 227: 200-204; Hebert et al., 1996, J. Biol. Chem.
271, 16384-16392; Lofts et al., Oncogene 8: 2813-2820). Therefore, the present invention
Provided are peptides derived from the seven transmembrane regions of G03, and their use to inhibit HG03 function. Such peptides can include all or part of the transmembrane domain of the receptor.

The present invention also includes the chimeric HG03 protein. Chimeric HG03 protein is
Consists of a contiguous polypeptide sequence of HG03 fused in reading frame to the polypeptide sequence of the non-HG03 protein. For example, the N-terminal domain and seven transmembrane domains of HG03 fused in reading frame to the C-terminus of the G protein comprise the chimeric HG
03 will be a protein.

The invention also encompasses HG03 proteins in the form of multimeric structures (eg, dimers). For other G protein-coupled receptors, such multimers are known (Hebert et al., 1996, J. Biol. Chem. 271, 16384-16392; Ng et al., 1996, Bioche
m. Biophys. Res. Comm. 227, 200-204; Romano et al., 1996, J. Biol. Chem. 271,
28612-28616).

[0028] The present invention also includes the HG03 protein in isolated form. "Isolated HG
The term "03 protein" means the HG03 protein isolated from a natural source. Use of the term "isolated" indicates that the HG03 protein has been separated from its normal cellular environment. Thus, the isolated HG03 protein can take the form of a cell-free solution. Alternatively, it can be placed in a cellular environment different from the cellular environment in which HG03 occurs naturally. The term "isolated" does not mean that the isolated HG03 is the only protein present, but rather non-amino acid substances (e.g., nucleic acids, lipids) that are naturally associated with the HG03 protein. , Carbohydrates). Therefore, bacteria, or in nature (ie, without human intervention) HG03
An HG03 protein expressed by recombinant means in a eukaryotic cell that does not express the protein is an "isolated HG03 protein."

The binding specificity of a compound exhibiting affinity for HG03 is determined by measuring the affinity of the compound for cloned recombinant cells expressing the receptor or membranes derived from those cells. Is done. Screening for a compound that binds to HG03 or inhibits the binding of HG03 to a cell or a membrane prepared from the cell of a radiolabeled known ligand of HG03 has a high affinity for HG03 An effective method for rapidly selecting a compound having The ligand need not be radiolabeled, but can be used to displace bound radiolabeled compounds, or as a non-isotopic compound that can be used as an activator in functional assays. There can be. The compounds identified by the above methods are believed to be agonists or antagonists of HG03, and they may be peptides, proteins or non-proteinaceous organic molecules.

Thus, the invention encompasses assays for identifying agonists and antagonists of HG03. Other similar methods of identifying agonists and antagonists of the receptor are well known in the art and may be applied to identify agonists and antagonists of HG03. For example, Cascieri et al., 1992, Molec. Pharmac.
ol. 41: 1096-1099 describes a method for identifying substances that inhibit agonist binding to the rat neurokinin receptor and are therefore potential agonists or antagonists of the neurokinin receptor. This method involves transfecting COS cells with an expression vector containing a rat neurokinin receptor, growing the transfected cells for a time sufficient to express the neurokinin receptor, and then transfecting the transfected cells. Harvested cells and resuspend the cells in an assay buffer containing a radiolabeled known agonist of the neurokinin receptor, in the presence or absence of a test substance, and then the neurokinin Measuring the binding between a known radiolabeled agonist of the receptor and the neurokinin receptor. If the amount of binding of the known agonist in the presence of the test substance is less than in the absence of the test substance, the test substance is considered to be a potential agonist or antagonist of the neurokinin receptor.

Accordingly, the present invention is a method of determining whether a substance is a potential agonist or antagonist of HG03, comprising: (a) transfecting a cell with an expression vector encoding HG03; (b) Growing the transfected cells for a time sufficient for HG03 to be expressed; (c) collecting the transfected cells and labeling the cells in the presence and absence of the substance with HG03. Resuspending in the presence of the known agonist; and (d) measuring the binding of the labeled agonist to HG03, wherein in the presence of the substance in the absence of the substance When the binding amount of the known agonist is smaller than that of the known agonist, the substance is considered to be a potential agonist or antagonist of HG03. The law provides.

In a modification of the above method, step (b) is modified so that cells are stably transfected with an expression vector containing HG03. In another variation of the above method, step (c) involves binding the cells to a substratum (eg, a tissue culture plate) and collecting and resuspending the cells, rather than collecting and resuspending the cells. Modified to contact the agonist and the substance with the cell.

The conditions for carrying out step (c) of the above method are those typically used in the art for studying protein-ligand interactions, such as physiological pH;
Salt conditions as represented by commonly used buffers such as, or in tissue culture media; temperatures from about 4 ° C. to about 55 ° C .;

[0034] In certain embodiments of the above method, the cells are eukaryotic cells. In another embodiment, the cells are mammalian cells. In other embodiments, the cells are L-cell LM (TK ⁻ ) (ATCC CCL 1.3), L-cell LM (ATCC CCL 1.2), 293 (ATCC CRL 1573).
, Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (
ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH / 3T3 (ATCC C
RL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26)
Or MRC-5 (ATCC CCL 171).

The present invention also provides a method for determining whether a substance is capable of binding to HG03, ie, whether it is a potential agonist or antagonist of HG03, comprising: (a) determining the expression of HG03 in the cell; (B) exposing the test cells to the substance; (c) measuring the amount of binding of the substance to HG03; and (d) determining the amount of HG03 bound to the test cell. Comparing the amount of binding between the substance and HG03 in the test cells with the amount of binding between the substance and control cells that have not been transfected with HG03; If the test cell is larger than when used, the substance is capable of binding to HG03. Then, it can be determined whether the substance is in fact an agonist or antagonist by using a functional assay, such as one involving the use of a promiscuous G protein as described below.

The conditions for performing step (b) of the above method are those typically used in the art for studying protein-ligand interactions, such as physiological pH;
Or salt conditions as represented in tissue culture media; temperatures from about 4 ° C. to about 55 ° C .; and the like.

The above assays can be performed with cells transiently or stably transfected with HG03. Transfection shall include any method known in the art for introducing HG03 into a test cell.
For example, transfection includes transfection mediated by calcium phosphate or calcium chloride, lipofection, infection with a retroviral construct containing HG03, and electroporation.

When measuring the binding between the substance or agonist and HG03, such binding can be measured by using a labeled substance or agonist. The agent or agonist can be labeled by any conventional method known in the art, for example, radioactively, fluorescently, or enzymatically.

In certain embodiments of the above method, HG03 has the amino acid sequence set forth in SEQ ID NO: 2.

The above methods can be modified to prepare a membrane from the test cells and expose the membrane to the substance, rather than exposing the test cells to the substance. Such modifications utilizing membranes rather than cells are well known in the art and are described, for example, in Hess et al., 1992.
, Biochem. Biophys. Res. Comm. 184: 260-268.

Accordingly, the present invention is a method for determining whether a substance is capable of binding to HG03, comprising: (a) transfecting a cell with an expression vector that directs the expression of HG03 in said cell; (B) preparing a membrane containing HG03 from the test cells, and exposing a membrane from the test cells to the substance; (c) combining the substance with HG03 in the membrane from the test cells. And (d) comparing the amount of binding between the substance and HG03 in a membrane derived from the test cell with the amount of binding between the substance and a membrane derived from control cells not transfected with HG03. HG03 has the amino acid sequence shown in SEQ ID NO: 2; and the amount of binding between the substance and HG03 in a membrane derived from the test cell is higher than that between the substance and the membrane derived from the control cell. If greater than the binding amount, the substance binds to HG03 And it is Rukoto,
The method is provided.

The present invention provides a method for determining whether a substance is capable of binding to HG03, comprising: (a) transfecting a test cell with an expression vector that directs the expression of HG03 in the cell; Providing; (b) exposing said test cells to a ligand of HG03 under conditions wherein the ligand binds to HG03 in said test cells; (c) exposing said cells to HG03 after or simultaneously with step (b) above. (D) measuring the amount of binding of the ligand to HG03 in the presence and absence of the substance; and (e) in the presence and in the presence of the substance. Comparing the amount of binding between the ligand and HG03 in the absence of the substance, wherein a decrease in the amount of binding between the ligand and HG03 in the presence of the substance indicates that the substance can bind to HG03; HG03 Having the amino acid sequence shown in sequence number 2, provides a method, characterized in that.

The present invention provides a method for determining whether a substance is capable of binding to HG03, comprising: (a) transfecting a test cell with an expression vector that directs the expression of HG03 in the cell; (B) preparing a membrane containing HG03 from the test cells, and wherein the ligand is HG in the membrane;
Exposing the membrane to the ligand of HG03 under conditions that bind to 03; (c) exposing the membrane from the test cells to the substance after or simultaneously with step (b) above; Measuring the amount of binding between the ligand and HG03 in the membrane in the presence and absence of the substance; and (e) the binding between the ligand and HG03 in the membrane in the presence and absence of the substance. Comparing the amount of binding, wherein a decrease in the amount of binding of the ligand to HG03 in the membrane in the presence of the substance indicates that the substance is capable of binding to HG03; Has the amino acid sequence set forth in SEQ ID NO: 2.

As a further modification of the above method, RNA encoding HG03 may be transformed into a HG03-containing plasmid using an HG03-containing plasmid under the control of the bacteriophage T7 promoter.
Prepared by in vitro transcription and used to effect expression of HG03 in oocytes
RNA can be microinjected into Xenopus oocytes. Next, the substance is tested for binding to HG03 expressed in the oocyte. Alternatively, rather than detecting binding, the effect of the substance on the electrophysiological properties of the oocyte can be measured.

The present invention encompasses assays for determining the ability to stimulate or counteract a functional response mediated by HG03 to identify agonists and antagonists of HG03. HG03 belongs to a group of proteins known as G-protein coupled receptors (GPCRs). After binding the ligand, the GPCR transmits a signal to the other side of the cell membrane. The ligand-coupled GPCR interacts with the heterotrimeric G protein, dissociating the Gα subunit of the G protein from the Gβ and Gγ subunits. This Gα subunit can then go on to activate various second messenger systems.

In general, certain GPCRs bind only to certain types of G proteins. Therefore, to observe a functional response from a GPCR, one must ensure that the appropriate G protein is present in the system containing the GPCR. However, "promiscuous"
G proteins have also been found to be present. These miscellaneous G proteins bind to virtually any GPCR and consequently transmit a functional signal from the GPCR. Offermanns and Simon, 1995, J. Biol. Chem. 270: 15175, 15180
See (Offermanns). Offermanns described a system in which cells were transfected with an expression vector resulting in the expression of one of a number of GPCRs, as well as one of the miscellaneous G proteins, Gα15 or Gα16.
When an agonist of the GPCR is added to the transfected cells, the GPCR can be activated to activate the β isoform of phospholipase C via Gα15 or Gα16, increasing the level of inositol phosphate in the cells. Brought.

Thus, by utilizing these miscellaneous G proteins as in Offermanns, even if the G protein to which HG03 binds in vivo is not known, HG0
Three functional assays can be designed. One possibility is to create a fusion or chimeric protein composed of the extracellular and transmembrane portions of HG03 fused to a miscellaneous G protein. Such fusion proteins are expected to transmit a signal after binding of the ligand to the HG03 portion of the fusion protein. Accordingly, the present invention is a method of identifying an antagonist of HG03,
(A) preparing cells expressing a chimeric HG03 protein fused to a miscellaneous G protein at the C-terminus; (b) exposing the cells to an agonist of HG03; (c) after step (b) above Or at the same time, exposing the cells to a substance suspected of being an antagonist of HG03; and (d) measuring inositol phosphate levels in the cells; If the inositol phosphate level in the cell is reduced in the presence of the substance compared to the inositol phosphate level in the cell in the method, the decrease is indicative of the substance being an antagonist of HG03. I will provide a.

The miscellaneous G proteins associated with HG03 can also be used to identify agonists of HG03. The method comprises: (a) providing cells that express both HG03 and a miscellaneous G protein; (b) exposing the cells to a substance suspected of being an agonist of HG03; and (c) Measuring the level of inositol phosphate in the cell in the presence of the substance compared to the level of inositol phosphate in the cell in the absence of the substance suspected of being an agonist. If is increased, it is assumed that the increase indicates that the substance is an agonist of HG03.

[0049] Inositol phosphate levels can be measured by monitoring calcium mobilization. Intracellular calcium mobilization is usually assayed using whole cells under a microscope using a fluorescent dye or using a cell suspension by luminescence using an aequorin assay.

[0050] In certain embodiments of the above method, the cells are eukaryotic cells. In another embodiment, the cells are mammalian cells. In other embodiments, the cells are L-cell LM (TK ⁻ ) (ATCC CCL 1.3), L-cell LM (ATCC CCL 1.2), 293 (ATCC CRL 1573).
, Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (
ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH / 3T3 (ATCC C
RL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26)
Or MRC-5 (ATCC CCL 171).

In certain embodiments of the above method, the cells are HG03 and miscellaneous G in the cells.
Transfected with an expression vector that directs the expression of the protein.

The conditions for performing step (b) of the above method are those commonly used in the art for studying protein-ligand interactions, eg, physiological pH; commonly used, such as PBS. Salt conditions as represented by the buffer being used, or as in tissue culture media; temperatures from about 4 ° C. to about 55 ° C .;

In certain embodiments of the above method, the miscellaneous G protein is Gα15 or Gα15.
It is selected from the group consisting of α16. Expression vectors containing Gα15 or Gα16 are known in the art. For example, Offermanns; Buhl et al., 1993, FEBS Lett. 3
23: 132-134; Amatruda et al., 1993, J. Biol. Chem. 268: 10139-10144.

The assays described above can be readily modified to form a method for identifying antagonists of HG03. Such methods are also part of the present invention, comprising: (a) providing cells that express both HG03 and a miscellaneous G protein; (b) exposing the cells to a substance that is an agonist of HG03; c) after or simultaneously with step (b) above, exposing the cells to a substance suspected of being an antagonist of HG03; and (d) measuring inositol phosphate levels in the cells; Comprising, when the inositol phosphate level in the cell is reduced in the presence of the suspected antagonist, as compared to the inositol phosphate level in the cell in the absence of the suspected antagonist; Let the decrease indicate that the substance is an antagonist of HG03.

In certain embodiments of the above method, the cells are eukaryotic cells. In another embodiment, the cells are mammalian cells. In other embodiments, the cells are L-cell LM (TK ⁻ ) (ATCC CCL 1.3), L-cell LM (ATCC CCL 1.2), 293 (ATCC CRL 1573).
, Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (
ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH / 3T3 (ATCC C
RL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26)
Or MRC-5 (ATCC CCL 171).

The conditions under which steps (b) and (c) of the above method are performed are those conventionally used in the art for studying protein-ligand interactions, such as physiological pH;
Salt conditions as represented by commonly used buffers such as PBS or in tissue culture media; temperatures from about 4 ° C to about 55 ° C; and the like.

In certain embodiments of the above method, the cells are HG03 and miscellaneous G in the cells.
Transfected with an expression vector that directs the expression of the protein.

In certain embodiments of the above method, the miscellaneous G protein is Gα15 or Gα15.
It is selected from the group consisting of α16.

In a particular embodiment of the above method, HG03 has the amino acid sequence set forth in SEQ ID NO: 2.

Another embodiment of the present invention is a method for expressing HG03 using a recombinant system, a method for identifying agonists and antagonists of HG03, and a method for counter screening.

When screening compounds to identify potential pharmaceuticals that interact specifically with the target receptor, it is important that the identified compound be as specific as possible to the target receptor. Confirmation is required. This requires that compounds be screened against as wide a range of receptors as possible, similar to the target receptor. Thus, in order to identify compounds that are potential pharmaceuticals that interact with receptor A, the compound interacts with receptor A (“plus target”) to form the desired pharmacology via receptor A Not only does it need to be confirmed that a chemical effect occurs, but also that the compound does not interact with receptors B, C, D, etc. ("minus target"). In general, it is important for screening programs to have as many negative targets as possible (Hodgson, 1992, Bio / Technology 10: 973-9).
80, p. 980). The HG03 protein and the DNA encoding the HG03 protein are:
It has use as a "minus target" in screening designs to identify compounds that specifically interact with other G protein-coupled receptors.

The present invention also encompasses antibodies to the HG03 protein. Such antibodies can be polyclonal or monoclonal. The antibody of the present invention
The whole HG03 protein or a suitable carrier (eg, serum albumin or keyhole limpet hemocyanin) is bound to a suitable antigenic fragment of the protein and produced by methods well known in the art. Methods for identifying suitable antigenic fragments of a protein are known in the art. For example, Hopp and Woods, 1
Natl. Acad. Sci. USA 78: 3824-3828; and Jameson and Wolf, 1
988, CABIOS (Computer Applications in the Biosciences) 4: 181-186.

To produce a polyclonal antibody, the HG03 protein or an antigenic fragment thereof conjugated to a suitable carrier can be prepared using a suitable non-human host animal, such as a rabbit,
Sheep, goats, rats, mice, etc. are injected periodically. The animals are bled periodically and the sera obtained are tested for the presence of antibodies to the injected antigen. The injection can be intramuscular injection, intraperitoneal injection, subcutaneous injection, etc., and can be used together with an adjuvant.

To produce a monoclonal antibody, the HG03 protein or an antigenic fragment thereof conjugated to a suitable carrier is injected into a suitable non-human host animal as described for the production of polyclonal antibodies. In the case of a monoclonal antibody, the animal is generally a mouse. Next, Kohler and Milstein, 1975, Nature 256: 495
The animal's spleen cells are often immortalized by fusing with myeloma cells, as described in -497. For a more detailed description of monoclonal antibody production, see Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold.
See Spring Harbor Laboratory Press, 1988.

It is possible to introduce HG03 polypeptide into cells of the target organ using gene therapy. The nucleotide encoding the HG03 polypeptide can be ligated to a viral vector that infects recipient cells and mediates the introduction of the nucleotide. Suitable viral vectors include retroviruses, adenoviruses,
Vectors based on adeno-associated virus, herpes virus, vaccinia virus, and poliovirus are included. Alternatively, HG03 polypeptide-encoding nucleotides are introduced into target cells for gene therapy by non-viral techniques including receptor-mediated targeting using ligand-nucleotide conjugates, lipofection, membrane fusion, or direct microinjection. can do. These methods and variants thereof are suitable for ex vivo and in vivo gene therapy. Gene therapy using HG03 polypeptides would be particularly useful for treating diseases where increasing HG03 activity would be beneficial.

The following non-limiting examples are provided to better illustrate the invention.

Example 1 Cloning and Sequencing of HG03 The full length coding sequence of HG03 was isolated from the prostate cDNA library by multiple rounds of RCCA. The HG03 gene was originally called AOMF15, but was later named HG03. The primer pair F216 + R369 was first used to probe the 1-2.5 KB and 2.5 KB prostate cDNA libraries. Positive pools were identified and these pools were then subjected to nested insert-vector PCR using the following combinations of primers. That is, for the first round PCR reaction, F216 + 543R, F216 + 873F and R369 + 54
3R, R369 + 873F; F325 + 578R and R280 + 383F for nested second round PCR reactions
It is. The list of primers used for the isolation of HG03 is as follows: AOMF15.F216 CCAGGCAAACATTACACGCA (SEQ ID NO: 4) AOMF15.F325 GAATTCTGCACAAGTGATACGGTA (SEQ ID NO: 5) AOMF15.R280 CAGGCTTTTAGATGAATCTGCA (SEQ ID NO: 6) AOMF15.R369 AGGTCAGGTG No. 7) HG03.37R GCGTGTCAGGAAACACTTGG (SEQ ID NO: 8) HG03 FL243F AAAGAAATCAAACCAGGAATAACC (SEQ ID NO: 9) HG03 FL1429R CTTTGTACATATCGATTCCAACACAC (SEQ ID NO: 10) PBS.873F CCCAGGCTTTACACTTTATGCTTCC (SEQ ID NO: 11) PBS.543R GGGGATGTGCTGCAAGGCGA (SEQ ID NO: 12) Performed under the conditions suggested by The resulting PCR fragments were sequenced and assembled. The complete sequence was obtained by primer walking with primers 37R and 1118R.

The analysis and sequencing reaction of this “RACE” PCR resulted in the assembly of a continuous fragment of 1478 base pairs. This sequence contains an open reading frame consisting of 358 amino acids. The full length coding sequence of HG03 was amplified using primers FL-243F and FL-1429R, and plasmid vector pCR2.1 (TA
Invitrogen, Carlsbad, CA). Determining the appropriate vector for a particular gene transfer or other purpose is well within the skill of the art.

Example 2 Tissue Distribution of HG03 RNA Transcript The approximately 1.8 kb fragment containing HG03 was randomly labeled with ³² P-dCTP using the Megaprime DNA Labeling System (Amersham), and was subjected to Human MTN Blot (Clontech Catalog No. 77
60-1, Clontech, Palo Alto, CA, USA). The MTN blot was hybridized overnight at 65 ° C. in Expresshyb (Clontech) containing 2 × 10 ⁶ cpm / ml HG03 probe to 65 ° C. to a final stringency of 0.1 × SSC / 0.5% SDS.
And then exposed to X-ray film by autoradiography. FIG. 4 shows the results.

The present invention is not limited in scope by the specific embodiments described herein. Indeed, various modifications other than those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.

Various publications are cited herein. The disclosures of which are incorporated herein by reference in their entirety.

[Brief description of the drawings]

FIG. 1 shows the complete cDNA sequence of HG03 (SEQ ID NO: 1).

FIG. 2 shows the complete amino acid sequence of HG03 (SEQ ID NO: 2).

FIG. 3A-C shows translation of the HG03 open reading frame. The nucleotide sequence shown in the figure is SEQ ID NO: 1. The amino acid sequence shown in the figure is SEQ ID NO: 2.

FIG. 4 shows the results of Northern blot analysis of HG03 mRNA expression in various human tissues.

FIG. 5 shows the matching between the amino acid sequence of HG03 and the amino acid sequence of human platelet activating factor receptor (SEQ ID NO: 3).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification code FI Theme coat ゛ (Reference) C07K 16/28 C12N 1/19 4C084 C12N 1/15 1/21 4C087 1/19 C12P 21/02 C 4H045 1 / 21 C12Q 1/02 5/10 G01N 33/15 Z C12P 21/02 33/50 Z C12Q 1/02 33/566 G01N 33/15 C12N 15/00 ZNAA 33/50 5/00 A 33/566 A61K 37 / 02 (72) Inventor McDonald, Terrence, P. United States 07065 Lowway, East Lincoln Ave, New Jersey 126 (72) Inventor Wan, Louisin United States 07065 New Jersey, Lowway, East Lincoln Ave 126 F-term (reference) 2G045 AA40 FB03 4B024 AA01 AA11 BA63 CA04 DA02 EA02 GA11 HA11 4B063 QA20 QQ08 QQ61 QX02 4B064 AG20 CA10 CA19 CC24 DA13 4B065 AA90X AA93Y AB01 BA02 CA24 CA46 4C084 AA01 AA06 AA07 AA13 BA01 BA02 BA22 CA53 NA14 4C087 BC83 CA12 NA14 4H040 AA70 AA FAA

Claims (20)

[Claims] 1. A recombinant DNA molecule encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. 2. The DNA molecule according to claim 1, comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and positions 346 to 1,419 of SEQ ID NO: 1. 3. A DNA molecule that hybridizes to the DNA of claim 1 under stringent conditions. An expression vector comprising the DNA according to claim 1. A recombinant host cell comprising the DNA of claim 1. 6. An HG03 protein having the amino acid sequence shown in SEQ ID NO: 2 and substantially free from other proteins. 7. The HG03 protein according to claim 6, comprising one amino acid substitution. 8. The method of claim 8, wherein the substitution is a conservative substitution.
The HG03 protein according to claim 7. 9. The HG03 protein of claim 6, comprising two or more amino acid substitutions and having substantially the same biological activity as HG03. 10. A method for determining whether a substance can bind to HG03, comprising: (a) preparing a test cell by transfecting the cell with an expression vector that directs the expression of HG03 in the cell. (B) exposing the test cells to the substance; (c) measuring the amount of binding of the substance to HG03; and (d) determining the amount of binding of the substance to HG03 in the test cell by the substance. HG03 has the amino acid sequence shown in SEQ ID NO: 2; and the binding of the substance to HG03 in the test cells. If the amount is greater than the amount of the substance bound to the control cells, the substance is capable of binding to HG03. 11. A method for determining whether a substance can bind to HG03, comprising: (a) preparing a test cell by transfecting the cell with an expression vector that directs the expression of HG03 in the cell. (B) preparing a membrane containing HG03 from the test cells, and exposing a membrane derived from the test cells to the substance; (c) binding amount of the substance to HG03 in the membrane derived from the test cells; And (d) comparing the amount of binding between the substance and HG03 in the membrane derived from the test cells with the amount of binding between the substance and membranes derived from control cells not transfected with HG03. HG03 has the amino acid sequence shown in SEQ ID NO: 2; and the amount of binding between the substance and HG03 in a membrane from the test cell is smaller than the amount of binding between the substance and the membrane from the control cell. If the substance is also large, it can bind to HG03 That,
The method characterized by the above-mentioned. 12. A method for determining whether a substance can bind to HG03, comprising: (a) preparing a test cell by transfecting the cell with an expression vector that directs the expression of HG03 in the cell. (B) exposing the test cells to a ligand for HG03 under conditions in which the ligand binds to HG03 in the test cells; (c) binding the cells to HG03 after or simultaneously with step (b) above. (D) measuring the amount of binding of the ligand to HG03 in the presence and absence of the substance; and (e) in the presence and absence of the substance Comparing the amount of binding between the ligand and HG03 below, wherein a decrease in the amount of binding between the ligand and HG03 in the presence of the substance indicates that the substance can bind to HG03; HG03 is the sequence number Method characterized having an amino acid sequence, that shown. 13. A method for determining whether a substance can bind to HG03, comprising: (a) preparing a test cell by transfecting the cell with an expression vector that directs the expression of HG03 in the cell. (B) preparing a membrane containing HG03 from the test cells, and wherein the ligand is HG in the membrane;
Exposing the membrane to the ligand of HG03 under conditions that bind to 03; (c) exposing the membrane from the test cells to the substance after or simultaneously with step (b) above; Measuring the amount of binding between the ligand and HG03 in the membrane in the presence and absence of the substance; and (e) the binding between the ligand and HG03 in the membrane in the presence and absence of the substance. Comparing the amount of binding, wherein a decrease in the amount of binding between the ligand and HG03 in the membrane in the presence of the substance indicates that the substance is capable of binding to HG03; The method having the amino acid sequence shown in SEQ ID NO: 2. 14. A method for determining whether a substance is a potential agonist or antagonist of HG03, comprising: (a) transfecting a cell with an expression vector containing HG03; (b) said transfection. (C) harvesting the transfected cells and in the presence and absence of the substance in an assay buffer containing a labeled, known HG03 agonist. Resuspending the cells in the presence; and (d) measuring the binding of the labeled known agonist to HG03, wherein the amount of binding of the labeled known agonist is determined in the presence of the substance. Is less than a potential agonist or antagonist of HG03 when compared to the absence of the substance; Having the amino acid sequence shown. 15. A method for identifying an agonist of HG03, comprising: (a) providing a cell that expresses both HG03 and a promiscuous G protein; (b) determining whether the cell is an agonist of HG03. Exposing the substance to a suspected substance; and (c) measuring the level of inositol phosphate in the cell, the substance being compared to the level of inositol phosphate in the cell in the absence of the substance. If the level of inositol phosphate in the cell is increased in the presence of HG03, the increase is indicative that the substance is an agonist of HG03; and HG03 has the amino acid sequence set forth in SEQ ID NO: 2. Said method. 16. A method for identifying an antagonist of HG03, comprising: (a) providing a cell that expresses both HG03 and a miscellaneous G protein; (b) exposing the cell to an agonist of HG03; Exposing said cells to a substance suspected of being an antagonist of HG03 after or simultaneously with said step (b); and (d) measuring inositol phosphate levels in said cells. When the level of inositol phosphate in the cell is reduced in the presence of the substance compared to the level of inositol phosphate in the cell in the absence of the substance, the decrease is caused by the antagonist of HG03 And HG03 has the amino acid sequence set forth in SEQ ID NO: 2. 17. A method for identifying an antagonist of HG03, comprising: (a) providing a cell that expresses a chimeric HG03 protein fused to a miscellaneous G protein at the C-terminus; (C) exposing the cells to a substance suspected of being an antagonist of HG03 after or simultaneously with step (b) above; and (d) inositol phosphate levels in the cells Measuring the level of inositol phosphate in the cell in the presence of the substance as compared to the level of inositol phosphate in the cell in the absence of the substance. Indicates that the substance is an antagonist of HG03; and the HG03 protein has the amino acid sequence set forth in SEQ ID NO: 2. 18. An antibody that specifically binds to HG03, wherein HG03 is SEQ ID NO: 2.
The antibody having the amino acid sequence shown in Claim 1. 19. A method for expressing a truncated HG03 protein, comprising: (a) transfecting a host cell with an expression vector encoding an HG03 protein having a truncated amino terminus; Transfect the cells obtained in step (a) with the truncated HG
Culturing under conditions under which the 03 protein is expressed. 20. The method of claim 19, wherein said truncated HG03 protein is a chimeric HG03 protein.