JP2002521004A - Interaction of human β-amidoid precursor protein (β-APP) with human LON protease-like protein (HsLON) - Google Patents

Abstract

SUMMARY OF THE INVENTION The present invention discloses the interaction between β-APP and HsLON and the formation of β-APP: HsLON complexes or their derivatives, fragments, analogs and homologs, which are modified. And identified using a modified yeast two-hybrid assay system. A methodology for screening the complex for efficacy in treating and / or preventing various diseases and disorders, particularly neurodegenerative diseases, cardiomyopathy, diabetes, hearing impairment, male infertility, mitochondrial DNA mutation-related diseases, etc. , Disclosed herein.

Description

DETAILED DESCRIPTION OF THE INVENTION

(Subsidy Aid) The present invention relates to the National Institute of Standard.
Grant No. 70NANB awarded by s and Technology
Made with US government assistance under 5H1066. Accordingly, the United States Government has certain rights in the invention.

FIELD OF THE INVENTION [0002] The present invention relates to a complex of β-APP and HsLON proteins. In addition, the present invention provides for the production of antibodies against the protein complexes described above, and, in particular,
It relates to its use in screening, diagnosis, prognosis and therapy.

BACKGROUND OF THE INVENTION 1. β-APP Human β-amyloid precursor (β-APP) protein is the subject of intense research because amyloid plaques containing fragments of the β-APP protein Show important pathophysiological features in the brain of patients with Alzheimer's disease (AD) (Glenner and Wong, 1984, Bio).
chem. Biophys. Res. Commun. 120: 885-890).
. The first mRNA for β-APP was cloned in 1988 (Ge
n Bank Deposit No. A02759; Mueller-Hill et al., 1988,
European Patent Publication EP 276723). This mRNA encodes 695 amino acids of a protein expressed in nerves. 714 of three other protein precursors
, 751 and 770 amino acids are also differential splicing (d
differential splicing (Kang and Muller-Hill, 1990, Biochem. Biophys. R).
es. Commun 166: 1192-1200).

[0004] A major focus of AD research has been the potential for abnormal processing of β-APP to produce products that collect in the brain and form harmful deposits. The major product in amyloid plaques is β-A4, a 39-42 residue fragment of β-APP that is located at the C-terminal third from the beginning of this precursor molecule (Kan
g et al., 1987, Nature 325: 733-736). This fragment is a product normally expressed in the human brain, while its accumulation is greatly enhanced in several disorders including AD and trisomy 21 (Suebe
rt et al., 1992, Nature 359: 325-327). Mutations in the β-APP gene appear to account for a small proportion of the cases of AD, and therefore, other factors involved in β-A4 folding, stability, or targeting (eg, processing enzymes, cofactors) Abnormalities also tend to cause accelerated accumulation and deposition of β-A4 (Seubert et al., 1993, Nature 3).
61: 260-263).

[0005] Apolipoprotein E (apoE) protein associates with β-A4. ApoE can function as a pathological molecular chaperone that binds soluble β-A4 and stabilizes abnormal β-pleated sheet formation and thus plaque formation (Wisnicwski et al.,
1992, Neurosci. Lett. 135: 235-238). Finally, the presenilin proteins PS-1 and PS-2 show an association with some cases of early-onset familial AD (Sherlington et al., 1995, Natu).
re 375: 754-760; Cruts et al., 1996, Hum. Mol. G
enet. 5: 1449-1455). The results of the above studies indicate that aberrant protein interactions or functions of β-A4, or other products of β-APP,
oning) may be the basis for some or all forms of AD pathology.

[0006] Mitochondrial dysfunction may also be involved in the pathology of AD. Mutations in codon 331 of the mitochondria-encoded subunit 2 of NADH dehydrogenase (complex 1 of the oxidative phosphorylated chain) have an AD patient of 10/19 and have amyotrophic lateral sclerosis (ALS) 2 / 6 patients (Lin
Et al., 1992, Biochem. Biophys. Res. Commun. 18
2: 238-246). Thus, mitochondrial damage is associated with neurodegenerative diseases. A unifying hypothesis regarding the pathology of AD has been formed around the central theme of increased oxidative damage to mitochondria, resulting in disrupted calcium homeostasis and neurodegeneration (Markesbury, 1997, Free Radic).
. Biol. Med. 23: 134-147; Meier-Ruge and Be
rtoni-Freddari, 1996, Rev. Neurosci. 7: 1
-19). Assembly of the mitochondrial inner membrane respiratory complex results from the addition of mitochondrial-encoded subunits around the core of the imported protein subunit (Hall and Hare, 1990, JB).
iol. Chem. 265: 16484-16490). When assembly is delayed, free mitochondrial encoded subunits are rapidly degraded in an oligomycin sensitive manner, thus mitochondrial biogenesis,
Thus, it is important for protection against neurodegenerative diseases and thus affects ATPase-dependent proteases (Meier-Ruge and Bertoni-Fre
ddari, 1996, Rev. Neurosci. 7: 1-19). Therefore,
Mitochondrial dysfunction and the protein components involved in them are associated with abnormal β-APP function in AD pathology.

(2. HsLON) Human Lon-protease-like (HsLON) protein (GenBank Accession No. X74215: Amerik et al., 1994, FEBS Lett. 340)
: 25-28) describe Lon, E, which is involved in the degradation of misfolded proteins.
. It is a homolog of E. coli protease. In yeast, the mitochondrial localized protease PIM1 is homologous to Lon and
M1 and HsLON function interchangeably in yeast to degrade misfolded proteins in the mitochondrial matrix (Suzu
ki et al., 1994, Science 264: 273-276; Teichma.
nn et al., 1996, J. Am. Biol. Chem. 271: 10137-10142
). Yeast expressing mutant PIM1 show abnormal construction of the mitochondrial inner membrane respiratory complex, become respiratory deficient, and ultimately their mitochondrial DNA
Suffers a loss of integrity. Like the yeast homolog, human LON (HsLON)
It is an ATPase-dependent protease that can function in mitochondrial biosynthesis and maintenance (Suzuki et al., 1997, Trends Biochem. S.
ci. 22: 118-123).

[0008] HsLON is involved in all aspects of mitochondrial maintenance and function. As such, it is a physiological process (mitochondrial biosynthesis, cell oxidizing capacity and energy metabolism, cell apoptosis, calcium homeostasis) and pathological processes (Alzheimer's disease (including, but not limited to)
AD), trisomy 21 dementia, amyotrophic lateral sclerosis (ALS) and other neurodegenerative disorders). Furthermore, mutations in mitochondrial DNA, which increase with both age and oxidative stress, are associated with a wide range of both sudden and hereditary clinical disorders (Odawara, 1996, New York).
Engl. J. Med. 334: 270-271; Hammans, 1994.
, Essays Biochem. 28: 99-112). In many but not all cases, these mutations are referred to as point mutations "hot sp
ot) ”(eg, C3254G or A3243T in the mitochondrial tRNA (Leu) gene). But most obstacles also
It is found with a more generalized mitochondrial DNA deletion (Rose, 199
8, Arch. Neurol. 55: 17-24).

[0009] Most of these disorders are caused by underlying mitochondrial dysfunction.
Including muscular disorders caused. Among them, MELAS syndrome (Mitochondori
al myopaty,Encephalomyopathy,Lactic A Cidosis andSstroke-like episodes; Sa
Itoh et al., 1998, Neurology, 50: 531-534), progressive.
External ophthalmoplegia (Melberg et al., 1998, Neurology, 50:29)
9-300), both autosomal and emergency chromosome cardiomyopathy (Takeda et al., 1).
996, Diabetes Res. Clin. Pract. 31 Suppl
. S123-126), and some forms of polymyalgia rheumatica (Re
ynier et al., 1994, Biochem. Biophys. Res. Comm
un. 205: 375-380). Many mitochondrial DNA mutations also
Associated with CNS degeneration, including: Parkinson's disease (Ozawa et al., 1991, B
iochem. Biophys. Res. Comm. 177: 518-525).
, Alzheimer's disease (including morphologically identified amyloid plaques (Kai
do et al., 1996, Acta Neuropath [Berlin] 92:31.
2-318)), and delayed encephalopathy (Johnston et al., 1995, An
n. Neurol. 37: 16-23). Therefore, mitochondrial DNA mutation,
Or mitochondrial dysfunction associated with aging, oxidative stress, etc.
There is evidence that the resulting mitochondrial dysfunction is associated with neurodegenerative diseases
I do.

[0010] Mitochondrial DNA mutations also the underlying diseases and disorders such as the following: MERRF Syndrome (M yoclonic E pilepsy with R a
gged R ed F ibers; Blumenthal et al, 1998, Neu
50: 524-525), multiple symmetric lipomatosis (Klopst
Ock et al., 1997, Mol. Cell. Biochem. 174: 271-2
75), Kearns-Sayre syndrome (pigmented retinal disorders, bilateral progressive ophthalmoplegia, and cardiac conduction deficiency; Z
oviani et al., 1988, Neurology 38: 1339-1346).
, Male infertility (St. John et al., 1997, Nat. Med. 3: 124-1).
25), sensorineural hearing impairment (Donovan et al., 1995, Ann. Otol. R.
hinol. Laryngol. 104: 786-792), maternal genetic hearing loss (S
ilvestri et al., 1994, Human Mutat. 3: 37-43),
And maternal genetic diabetes (Tsukada et al., 1997, Diabetes Me).
d. 14: 1032-1037).

In summary, besides its involvement in neurodegenerative diseases, HsLOS is also involved in cardiomyopathy, some forms of diabetes, hearing impairment, male infertility, and mitochondrial DN
It can be involved in a number of less common syndromes and disorders associated with the A mutation.

[0012] In conclusion, both β-APP and HsLON are involved in neurodegenerative processes and mitochondrial function. As such, each or both are pathological processes (including but not limited to mitochondrial biosynthesis, cell oxidizing capacity and energy metabolism, cell apoptosis, calcium homeostasis) and pathological processes (Alzheimer's disease (AD)) Neurodegenerative disorders such as trisomy 21 dementia, amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; hearing impairment; and male infertility; and numerous mitochondrial DNA mutations Including but not limited to less common syndromes and disorders)
Can be affected.

Although β-APP and HsLON have been described as participating in a similar process, the direct association or interaction of β-APP with HsLON has not been described prior to the present invention.

Citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.

SUMMARY OF THE INVENTION The present invention relates, in part, to β-amyloid precursor protein (β-APP) and Hs
Based on the discovery of a novel interaction with the LON protein,
The predominantly expressed 695 amino acid form of PP (the term β-APP in this application) or a portion of β-APP consisting of residues 597-638 (referred to herein as β-A4) , HsLON or the C-terminal 126 residues of HsLON.

[0016] The present invention relates to specific compositions containing and methods for the production of a protein complex of β-APP with a protein that interacts with (ie, binds to) β-APP. In particular, the present invention relates to complexes of HsLON, and derivatives, fragments and analogs thereof, with β-APP and derivatives, fragments, and analogs of β-APP (herein, β-APP and Hs
The complex of LON is named β-APP: HsLON). The present invention further provides:
interacts with β-APP and / or HsLON, or interacts with a derivative, fragment or analog of β-APP and / or HsLON;
The present invention relates to a method for screening for a protein.

[0017] Methods of producing the β-APP: HsLON complex, and derivatives and analogs of the complex and / or individual proteins are also provided, eg, by recombinant means. Pharmaceutical compositions are also provided.

[0018] The invention further relates to methods for modulating (ie, inhibiting or enhancing) the activity of a β-APP: HsLON complex. The protein components of the β-APP: HsLON complex are involved in physiological processes (including but not limited to mitochondrial biosynthesis, cell oxidizing capacity and energy metabolism, cell apoptosis, calcium homeostasis) and pathological processes (Alzheimer's disease) Associated with neurodegenerative disorders such as trisomy 21 dementia, Parkinson's disease, amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; hearing impairment; and male infertility; and mitochondrial DNA mutations Numerous uncommon syndromes and disorders). Therefore, the present invention relates to cell functions (in particular, β-APP
And / or derivatives of β-APP: HsLON complexes, and / or derivatives of β-APP: HsLON complexes, for the ability to alter associated cellular functions (supra) when HsLON is enumerated non-exclusively. And methods for screening analogs.

The present invention also relates to methods of treatment and prevention, as well as diagnostic, prognostic and screening methods, and compositions based on the β-APP: HsLON complex (and nucleic acids encoding the individual proteins involved in the complex). Therapeutic compounds of the invention include, but are not limited to, the β-APP: HsLON complex, and one or both members of the complex are derivatives, fragments, homologs or β-APP or HsLON of the complex. A complex that is an analog; an antibody to the same and a nucleic acid encoding the same; and an antisense nucleic acid to a nucleotide sequence that encodes a component of the complex. Diagnostic, prognostic and screening kits are also provided.

[0020] Also provided are animal models and methods for screening for modulators (ie, agonists and antagonists) of the activity of the β-APP: HsLON complex.

[0021] Also provided are methods of identifying molecules that inhibit or increase the formation of a β-APP: HsLON complex.

DETAILED DESCRIPTION OF THE INVENTION The present invention is based, in part, on the identification of proteins that interact with β-APP (SEQ ID NO: 2) using a modified form of the yeast matrix conjugation test. HsLO
At least amino acids 721 to 845 of N (SEQ ID NO: 4)
It was found to form a complex with at least amino acids 597-638 of β-APP (SEQ ID NO: 2) (the complex of β-APP with HsLON is referred to herein as “
β-APP: HsLON ”). The β-APP: HsLON complex is involved in modulating the functional activity of β-APP and its binding partner by interaction. Such functional activities include neurodegenerative disorders such as Alzheimer's disease, trisomy 21 dementia, Parkinson's disease, amyotrophic lateral sclerosis (AL
S))); cardiomyopathy; some forms of diabetes; deafness; and male infertility; and physiological processes including, but not limited to, a number of less common syndromes and disorders associated with mitochondrial DNA mutations. It is.

The present invention also relates to a method of screening for a protein that interacts with (eg, binds to) β-ATP. The present invention further provides a β-APP protein,
Or complexes of the derivatives, analogs or fragments thereof, especially with the HsLON protein, or derivatives, analogs or fragments thereof. In a preferred embodiment, such a conjugate comprises anti-β-APP, anti-HsL
Binds to ON and / or anti-β-APP: HsLON complex antibodies. In another particular embodiment of the invention, a complex of human β-APP with human HsLON is provided.

The present invention also provides a methodology for production and / or isolation of a β-APP: HsLON complex. In certain embodiments, the present invention relates to β-APP and Hs
Provided is a methodology for using recombinant DNA technology to express both LONs (or derivatives, fragments, or analogs of one or both members of the complex), wherein both binding partners comprise 1 Either are under the control of one heterologous promoter (ie, a promoter not naturally associated with the gene encoding that particular complex component), or each is under the control of a separate heterologous promoter.

Disclosed are methods of diagnosis, prognosis, and screening for diseases and disorders associated with abnormal levels of the β-APP: HsLON complex. The present invention also provides
A disease or disorder associated with an abnormal level of APP: HsLON complex or an abnormal level of activity of one or more of the components of the complex, the activity of β-APP: HsLON complex or β-APP: HsLON complex; Alternatively, modulators of formation (eg, antibodies that bind to β-APP: HsLON complex) or uncomplexed β-APP
Or a method for treating or preventing by administering a binding partner thereof or a derivative, fragment, analog, or homolog thereof. Preferably, said derivative, fragment, analog or homolog is (i) a portion of β-APP or HsLON that is directly involved in complex formation;
i) a mutant of β-APP or HsLON that modulates binding affinity; (iii)
A small molecule inhibitor or enhancer of complex formation; or (iv) any antibody that stabilizes or neutralizes the complex.

Methodology for assaying β-APP: HsLON complex for biological activity as a therapeutic or diagnostic agent, and for screening for β-APP: HsLON complex or modulators thereof (ie, agonists and antagonists) The methodology is also disclosed herein.

For clarity of the disclosure, but not for limitation, the detailed description of the present invention is divided into the following sections.

((1) β-APP protein, HsLON protein, and β-APP:
HsLON Complex) The present invention discloses a complex of β-APP with HsLON (β-APP: HsLON complex). In a preferred embodiment, the β-APP: HsLON complex is a complex of a human protein. The present invention also relates to (i) complexes of β-APP derivatives, fragments and analogs with HsLON; (ii) β-AP
Complexes of P with derivatives, fragments and analogs of HsLON and (iii) HsLO of derivatives, fragments and analogs of β-APP
A complex with N. As used herein, β-APP: HsL
Note that a fragment, derivative, or analog of an ON complex includes a complex in which one or both members of the complex are fragments, derivatives, or analogs of the wild-type β-APP or HsLON protein.

The derivatives, fragments and analogs provided herein are sufficient to allow specific hybridization in the case of nucleic acids, or for specific recognition of an epitope in the case of amino acids. It is defined as a sequence of at least six (contiguous) nucleic acids or at least four (contiguous) amino acids, each of sufficient length. A fragment is at most one nucleic acid or one amino acid shorter than the full-length wild-type sequence. Derivatives and analogs may be full-length or other than full-length if the derivatives or analogs contain nucleic acids or amino acids modified as described above. β-APP and HsLO
Derivatives or analogs of N may, in various embodiments, span the same size amino acid sequence, or be aligned using known computer homology programs (eg, Wisconsin GCG using default parameter settings).
Genetics Computer Group) software package)
At least about 30%, 50% when compared to aligned sequences made by
, 70%, 80%, or 90% identity (80-95% identity is preferred), including, but not limited to, molecules containing regions substantially homologous to β-APP or HsLON. . Alternatively, the comparison is that the encoding nucleic acid is a complement of the sequence encoding β-APP or HsLON under stringent conditions (preferred embodiment), moderately stringent, or low stringent conditions ( For example, an aligned sequence encoding a nucleic acid capable of hybridizing to the reverse complement). For example, Ausubel et al., CURRENT P
ROTOCOLS IN MOLECULAR BIOLOGY, John W
See iley & Sons, New York, NY, 1993, and supra.

Preferably, as disclosed by the present invention, one or both members of the complex are β, which are fragments, derivatives or analogs of the wild-type protein.
The -APP: HsLON complex is a functionally active β-APP: HsLON complex. In certain aspects, the native protein of β-APP and / or HsLON (or a homolog, fragment, derivative, or analog thereof) is
Insects (eg, flies), plants, or animals (eg, mice, rats, pigs, cows, dogs, monkeys, frogs), or, most preferably, humans. As used herein, the term “functionally active β-APP: HsLON”
A “complex” refers to one or more known functionalities of full-length β-APP (or a derivative, fragment, analog, or homolog thereof) complexed with full-length HsLON (or a derivative, fragment, analog, or homolog thereof). Control of cell cycle progression, cell differentiation and apoptosis, intracellular signaling, neurogenesis, response to viral infection, hyperproliferative disorders (eg, tumorigenesis and tumor transmission)
Degenerative disorders (including, for example, neurodegenerative disorders, autoimmune disorders, disorders associated with organ transplantation, inflammation, and / or allergic disorders, atherosclerosis, nephropathy, heart disease, muscular disease, and the like) ).

Certain embodiments of the present invention disclose a β-APP: HsLON complex consisting of fragments of one or both protein species of the complex. In a preferred embodiment, these aforementioned fragments are fragments of HsLON that have been identified as interacting with β-APP in the improved, modified yeast two-hybrid assay of the present invention (ie, those shown in FIG. 2). HsLON
Amino acids 721 to 845 (SEQ ID NO: 4)), but is not limited thereto. In addition, also disclosed herein are fragments (or proteins comprising the fragments) that can delete some or all of the above regions of any member of the complex, as well as nucleic acids encoding the above proteins.

[0032] Nucleic acid sequences encoding human β-APP and human HsLON are known (
GenBank accession number A02759 and GenBank, respectively
k accession number X74215), and in FIGS. 1 and 2 (SEQ ID NOS: 1 and 3, respectively). Nucleic acids can be prepared by any method known in the art (
For example, by PCR amplification using synthetic primers capable of hybridizing to the 3 'and 5' ends of the sequence, and / or cloning from a cDNA or genomic library using oligonucleotide sequences specific for a given gene sequence , Etc.).

[0034] Homologs (ie, nucleic acids encoding the aforementioned proteins from non-human species) or other related sequences (eg, paralogs) can also be obtained by methods well known in the art for nucleic acid hybridization and cloning. Can be obtained by low, moderate, or high stringency hybridization using all or a portion of a particular human sequence as a probe.

In a most preferred embodiment, there is provided a nucleic acid sequence capable of hybridizing under high stringency conditions to a nucleic acid sequence encoding β-APP and / or HsLON, or a derivative thereof (or the complementary strand described above). . By way of example, but not limitation, the procedure using such conditions of high stringency is as follows: Step 1: filter the DNA containing filter from 8 hours to overnight at 65 hours.
At 6 ° C., 6 × SSC, 50 mM Tris-HCl (pH 7.5), 1 mM ED
Pre-treat in a buffer consisting of TA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg / ml denatured salmon sperm DNA. Step 2: Filter the filters for 48 hours at 65 ° C. with the prehybridization mixture described above, including 100 μg / ml denatured salmon sperm DNA and 5-20 × 10 ⁶ c
pm ³² P-labeled probe). Step 3: Filter for 1 hour at 37 ° C., 2 × SSC, 0.01% PVP, 0.01% Fico
Wash in a solution containing II and 0.01% BSA. After this, 0.1 ×
Wash in SSC at 50 ° C. for 45 minutes. Step 4: Filter the autoradiograph. Other conditions of high stringency that can be used are well known in the art. For example, Ausubel et al. (Eds.) 1993, CURRENT PR
OTOCOLS IN MOLECULAR BIOLOGY, John Wi
Lee & Sons, NY and Kriegler, 1990, GENE T
RANSFER AND EXPRESSION, A LABORATORY
See MANUAL, Stockton Press, NY.

In a second embodiment, the nucleic acid sequence encoding β-APP and / or HsLON, or any derivative thereof (or the complementary strand as described above), can hybridize under moderate stringency conditions. A nucleic acid sequence is provided. By way of example, and not by way of limitation, a procedure using such conditions of moderate stringency is as follows: Step 1: filter containing DNA
Pre-treat for 5 hours at 55 ° C. in a solution containing 6 × SSC, 5 × Denhardt solution, 0.5% SDS, and 100 μg / ml denatured salmon sperm DNA.
Step 2: Filters are placed in the same solution (5-20 × 1) at 55 ° C. for 18-20 hours.
(Add ⁶ Cpm of ³² P-labeled probe). Step 3:
The filters are washed for 1 hour at 37 ° C. in a solution containing 2 × SSC and 0.1% SDS, and then washed in a solution containing 1 × SSC and 0.1% SDS.
Wash twice at 60 ° C. for 0 minutes. Step 4: Filters are blotted dry and autoradiographed. Other conditions of moderate stringency that can be used are well known in the art. For example, Ausubel et al.
993, CURRENT PROTOCOLS IN MOLECULAR B
IOLOGY, John Wiley & Sons, NY and Kriegl
er, 1990, GENE TRANSFER AND EXPRESSION
, A LABORATORY MANUAL, Stockton Press,
See NY.

In a third embodiment, a β-APP and / or HsLON nucleic acid sequence or a nucleic acid sequence encoding a β-APP and / or HsLON derivative (or the complementary strand described above) is hybridized under low stringency conditions. Are provided. For illustration but not limitation, a procedure using such conditions of low stringency is as follows (Shilo and Weinberg, 1
981, Proc. Natl. Acad. Sci. USA 78: 6789-6
792): Step 1: filter containing DNA for 6 hours
At 40 ° C., 35% formamide, 5 × SSC, 50 mM Tris-HCl (
pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1
Pre-treat in a solution containing% BSA and 500 μg / ml denatured salmon sperm DNA. Step 2: filters are placed in the same solution at 40 ° C. for 18-20 hours (
0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100μ
g / ml salmon sperm DNA, 10% (wt / vol) dextran sulfate, and 5-20 × 10 ⁶ cpm of ³² P-labeled probe). Step 3: filter for 1.5 hours at 55 ° C., 2 × SSC, 25 mM
Wash in a solution containing Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated for a further 1.5 hours at 60 ° C. Step 4: Filters are blotted dry and autoradiographed. If necessary, filters are washed a third time at 65-68 ° C and re-exposed to film. Other conditions of low stringency that can be used are well known in the art (eg, those utilized for cross-species hybridization). For example, Ausubel et al. (Eds.) 1993, CURRENT PROTOCOLS IN MOLECULAR.
BIOLOGY, John Wiley & Sons, NY and Krie
gler, 1990, GENE TRANSFER AND EXPRESSI
ON, A LABORATORY MANUAL, Stockton Pres
See s, NY.

The present invention also relates to nucleic acids that are capable of hybridizing to or complementary to the above-described sequences, and in particular, the present invention relates to nucleic acids capable of hybridizing to the above-described sequences having a reverse complement (ie, a nucleic acid) The reverse complement of the strand has a complementary sequence that runs in the opposite direction to the strand such that the reverse complement hybridizes with little or no mismatch to the nucleic acid strand). I do. In certain aspects, β-APP
And / or at least about 10, 25, 50, 100, or 200 nucleotides of the HsLON gene (SEQ ID NOs: 1 and 3, respectively), or a sequence that is complementary (particularly reverse complementary) to the entire coding region. Provided are nucleic acid molecules. Further provided are nucleic acid molecules encoding derivatives and analogs of β-APP and / or HsLON (supra), or antisense nucleic acids thereto (see, eg, supra).

In the nucleotide sequence encoding a polypeptide identified as a βAPP interactor by the modified yeast two-hybrid assay of the present invention,
Potential open reading frames are publicly available on NCBI BLAS
It can be identified using a T program ORF finder. Since all known protein translation products are at least 60 or longer amino acids (Cre
night, 1992, PROTEINS, 2nd edition, W.W. H. Freeman
And Co. , New York), only ORFs potentially encoding proteins of 60 or more amino acids are considered. The identification of the initiation methionine codon (ATG) and the translation stop codon (TGA, TAA, or TAG) defines the boundaries of the protein. Other potential proteins include any open reading frame extending to the 5 'end of the nucleotide sequence. In this case, the open reading frame predicts the C-terminal or core portion of the longer protein. Similarly, any open reading frame extending to the 3 'end of the nucleotide sequence predicts a longer N-terminal portion of the protein.

Recombinant Techniques for Obtaining Complexes or β-APP or HsLON β-APP and HsLON proteins, either alone or in a complex, are used in the art for protein purification and recombinant protein expression. Can be obtained by known methods. For recombinant expression of one or more proteins, a nucleic acid containing all or a portion of the nucleotide sequence encoding the protein is provided in a suitable expression vector (ie, for transcription and translation of the inserted protein coding sequence). (A vector containing the necessary elements). In a preferred embodiment, the regulatory element is heterologous (ie, not a native gene promoter). Alternatively, the necessary transcription and translation signals can also be provided by the natural promoter for the β-APP or any HsLON gene and / or their flanking regions.

Various host vector systems can be utilized to express the protein coding sequence. These include (i) mammalian cell lines infected with vaccinia virus, adenovirus, etc .; (ii) insect cell lines infected with baculovirus, etc .;
ii) yeast containing a yeast vector, or (iv) bacteriophage, DN
A, but includes, but is not limited to, bacteria transformed with plasmid DNA or cosmid DNA. Depending on the host vector system utilized, any one of a number of suitable transcription and translation elements may be used.

In a preferred embodiment, the β-APP: HsLON complex expresses the entire β-APP and HsLON coding sequences in the same cell, under the control of either the same promoter or two separate promoters. It is obtained by doing. In another embodiment, the derivative, fragment or homolog of β-APP and / or the derivative, fragment or homolog of HsLON is recombinantly expressed. Preferably, a derivative, fragment or homolog of the β-APP and / or HsLON protein forms a complex with a binding partner identified by a binding assay (eg, a modified yeast two-hybrid based assay), more preferably Are anti-β-APP, anti-HsLON, and / or
Alternatively, a complex is formed that binds to the anti-β-APP: HsLON complex antibody.

[0042] Any methodologies known in the prior art relating to the insertion of nucleic acid fragments into a vector can be used to construct an expression vector containing a chimeric gene containing appropriate transcription / translation control signals and protein coding sequences. Can be used. These methodologies include, but are not limited to, in vitro recombinant DNA and synthetic techniques, and in vivo recombinant techniques (eg, genetic recombination). β-APP
And the expression of the nucleic acid sequence, derivative, fragment, analog or homolog thereof encoding the HsLON protein is such that the gene or fragment thereof is expressed in a host that has been co-transformed with the recombinant DNA molecule of interest. It can be regulated by a second nucleic acid sequence. The expression of a particular protein is
(I) SV40 early promoter (eg, Bernoulist & Chambon)
, 1981, Nature 290: 304-310); (ii).
A promoter contained within the 3 'long repeat of Rous sarcoma virus (Yam
(see amoto et al., 1980, Cell 22: 787-797);
iii) Herpesvirus thymidine kinase promoter (eg, Wagne
r et al., 1981, Proc. Natl. Acad. Sci. USA 78:14
(Iv) regulatory sequences of the metallothionein gene (e.g., Br)
interter et al., 1982, Nature 296: 39-42).
(V) prokaryotic vectors such as the β-lactamase promoter (eg, V
illa-Kamaroff et al., 1978, Proc. Natl. Acad. S
ci. ScL USA 75: 3727-3731); (vi) the tac promoter (e.g., DeBoer et al., 1983, Proc. Natl. Acad).
. Sci. USA 80: 21-25) and any other promoter / enhancer known in the art, including but not limited to.

In addition, plant promoter / enhancer sequences in plant expression vectors, including, but not limited to, (i) nopaline synthase promoters (eg, Herrar-Estrella et al., 1984, Natu)
re 303: 209-213); (ii) the cauliflower mosaic virus 35 SRNA promoter (eg, Garder et al., 1981, Nu).
c. Acids Res. 9: 2871), and (iii) the promoter of the photosynthetic enzyme ribulose diphosphate carboxylase (eg, Herrera).
-See Estrella et al., 1984, Nature 310: 115-120).

Promoter / enhancer elements from yeast and other fungi (eg, Gal4 promoter, alcohol dehydrogenase promoter, phosphoglycerol kinase promoter, alkaline phosphatase promoter),
As well as promoter / enhancer elements from the transcriptional control regions of animals (eg, those that have tissue specificity and are used in transgenic animals) can be utilized in producing the proteins of the invention. Transcriptional regulatory sequences from animals include (i) insulin gene regulatory regions active in pancreatic β cells (see, eg, Hanahan et al., 1985, Nature 315: 115-122); (ii) active in lymphocytes Immunoglobulin gene regulatory region (
See, for example, Grosschedl et al., 1984, Cell 38: 647-658.
(Iii) albumin gene regulatory regions active in the liver (eg, Pinkert et al., 1987, Genes and Level. 1:
(Iv) myelin basic protein gene regulatory regions active in brain oligodendrocytes (eg, Readhead et al., 1987, Ce);
and (v) a conadotropin-releasing hormone gene regulatory region active in the hypothalamus (e.g., Mason et al., 1).
986, Science 234: 1372-1378), and the like.

In certain embodiments of the invention, a promoter operably linked to a nucleic acid sequence encoding β-APP and / or HsLON, or a fragment, derivative, or homolog thereof, one or more origins of replication, and A vector containing one or more selectable markers (eg, an antibiotic resistance gene) is used depending on the type. In a preferred embodiment, a vector is used that comprises a promoter operably linked to a nucleic acid sequence encoding both β-APP and HsLON, one or more origins of replication, and, optionally, one or more selectable markers. You.

In another embodiment, the expression vector contains the coding sequences for β-APP and HsLON (or portions thereof), either together or separately. The expression vector is prepared by combining the above gene sequence into three available pGEX vectors (glutathione S transferase expression vector; for example, Smith & John).
Son, 1988, Gene 7: 31-40).
Can be produced by subcloning into the I restriction site, thus:
Allows expression of the product in the correct reading frame.

Expression vectors containing the sequence of interest can be identified by three general approaches: (i) nucleic acid hybridization, (ii) the presence or absence of “marker” gene function, and / or (iii) Expression of inserted sequence. In a first approach, β-APP and HsLON can be detected by nucleic acid hybridization using a probe that includes a sequence homologous to and complementary to the inserted sequence of interest. In a second approach, a recombinant vector / host system can be identified and a particular “marker” function (eg, β-APP, HsLON, or β-AP) generated by insertion of the sequence of interest into the vector.
P: HsLON complex binding to antibodies specific, antibiotic resistance, occlusion formation in baculovirus, etc.). In a third approach, the recombinant expression vector is HsL
Can be identified by assaying for expression of β-APP simultaneously with expression of ON.

[0048] Once the recombinant β-APP and HsLON molecules have been identified and the complexes or isolated individual proteins, and the appropriate host system and growth conditions established, the recombinant expression vector Can be propagated and amplified in large quantities. As previously discussed, expression vectors or derivatives thereof that may be used include human or animal viruses (eg, vaccinia virus or adenovirus); insect viruses (eg, baculovirus); yeast vectors; bacteriophage vectors ( Phage); plasmid vectors, cosmid vectors, and the like.

A host cell strain may be chosen which modulates the expression of the inserted sequences of interest, or modifies or processes the expressed protein encoded by the sequence, in the specific fashion desired. In addition, expression from a particular promoter may be enhanced in the presence of a particular inducer in the selected host strain; thus, facilitating control of the expression of the engineered β-APP and / or HsLON. Furthermore, different host cells have characteristic and specific mechanisms for translation of the expressed protein, as well as for post-translational processing and modification (eg, glycosylation, phosphorylation, etc.). Thus, an appropriate cell line or host system can be chosen to ensure that the desired modification and processing of the foreign protein is achieved. For example, protein expression in a bacterial system can be used to produce a non-glycosylated core protein. On the other hand, expression in mammalian cells is
Ensure "natural" glycosylation of heterologous proteins.

In another embodiment, β-APP and / or HsLON (or a derivative, fragment, analog and homolog thereof) comprises a fusion protein or chimeric protein comprising a protein linked to a heterologous protein sequence of a different protein by a peptide bond. Can be expressed as a product of Such chimeric products can be produced by ligating together the appropriate nucleic acid sequences encoding the desired amino acids, which linkage maintains the proper coding frame and, consequently, by methods well known in the art. Express the chimeric product in a suitable host. Alternatively, such a chimeric product can be made by protein synthesis techniques (eg, by using a peptide synthesizer).

[0051] Certain embodiments of the present invention disclose chimeric proteins comprising fragments of β-APP and / or HsLON. In another particular embodiment, β-A
Contains the interacting domain of PP and HsLON (the domain involved in the direct formation of the β-APP: HsLON complex) and, optionally, links the two aforementioned proteins and binds β-APP and HsLON Fusion proteins having heterofunctional reagents (eg, peptide linkers) that act to promote domain interaction are provided. These fusion proteins can be used when stability of the interaction is desired, for example, in the production of antibodies specific for the β-APP: HsLON complex (ie, due to complex formation as an intramolecular reaction). Stability), which can be particularly useful.

In certain embodiments of the invention, the nucleic acid encoding the protein, and β
Provided herein are proteins consisting of or comprising a fragment of β-APP or HsLON consisting of a minimum of six consecutive amino acid residues of APP and / or HsLON. In another embodiment, the protein fragment described above is at least 10, 20, β-APP or HsLON.
Consists of 30, 40, or 50 amino acid residues (and preferably no more than 35, 100, or 200 amino acid residues). β-APP and HsLON
In various embodiments, a derivative or analog of
-Substantially homologous to APP or HsLON (at least 30%, 4
0%, 50%, 60%, 70%, 80%, 90% or preferably 95% amino acid identity), including, but not limited to: (i)
(Ii) as compared to an aligned sequence, wherein the alignment is performed by a computer homology program known in the art; or (iii) ) The nucleic acid encoding β-AP under stringent (preferred), moderately stringent, or non-stringent (eg, see above) conditions.
When hybridizable to a sequence encoding P or HsLON.

[0053] β-APP and / or HsLON derivatives can be produced by modifying their sequence by substitutions, additions, or deletions that result in functionally equivalent molecules. In certain embodiments of the invention, the degeneracy of the nucleotide coding sequence allows the use of other DNA sequences that encode substantially the same amino acid sequence as the β-APP or HsLON gene. In another particular embodiment, one or more amino acid residues within the sequence of interest can be replaced by another amino acid of similar polarity and net charge, thus producing a silent alteration. Amino acid substitution variants that are conservative for an amino acid in the sequence may be selected from other members of the class to which the amino acid belongs. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Positively charged (basic) amino acids include arginine, lysine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

The derivatives and analogs of β-APP or HsLON of the present invention can be produced by various methodologies known in the art. For example, the cloned β
-The gene sequences of APP and HsLON can be modified by any of a number of methods known in the art. See, for example, Sambrook et al.
0, Molecular Cloning: A Laboratory Man
ual, 2nd edition (Cold Spring Harbor Laboratory)
y Press; Cold Spring Harbor, NY). These sequences can be digested at the appropriate site using restriction endonuclease (s), if desired, and then further enzymatically modified, and the resulting fragments isolated and in vitro Can be connected. Further, the nucleic acid encoding β-APP or HsLON may be (i) created variations in the coding region to facilitate further in vitro modification; (
ii) to create and / or destroy translation, initiation, and / or termination sequences; and / or (iii) to form new restriction endonuclease sites, or to replace pre-existing restriction endonuclease sites. To destroy
It can be mutated in vitro or in vivo. Any method for mutagenesis known in the art may be utilized, including chemical mutagenesis and site-directed mutagenesis in vitro (see, eg, Hutchinson et al., 1978, J. Biol.
Chem. 253: 6551-6558); TABJ ^™ linker (
Pharmacia), and other similar methodologies, including, but not limited to.

Isolation and Analysis of Gene Products or Complexes Once recombinant cells expressing β-APP and / or HsLON or a fragment, analog or derivative thereof have been identified, individual gene products or The complex can be isolated and analyzed. This includes assays based on the physical and / or functional properties of the protein or complex, including analysis by radiolabeling of the product followed by gel electrophoresis, immunoassays, crosslinking to marker-labeled products, etc. But not limited to). β-APP: H
The sLON complex can be isolated and purified by standard methods known in the art (either from natural sources or recombinant host cells expressing the protein / protein complex), including column chromatography. (Eg, ion exchange, affinity, gel exclusion, reversed phase, high pressure, protein high performance liquids, etc.), differential centrifugation, differential solubility, or similar methodologies used for protein purification. However, it is not limited to these. Alternatively, once, β-APP
Alternatively, once HsLON or a derivative thereof has been identified, the amino acid sequence of the protein can be deduced from the nucleic acid sequence of the chimeric gene that encoded it. Thus, proteins or derivatives thereof can be synthesized by standard chemical methodologies known in the art. See, e.g., Hunkapiller et al., 1984, N.
See atature 310: 105-111.

In certain embodiments, the β-APP: HsLON complexes (whether produced by recombinant DNA technology, chemical synthesis methods, or purified from natural sources) are used as their primary amino acids: Made from proteins, fragments, analogs and derivatives thereof, and proteins homologous thereto, comprising sequences substantially as shown in FIG. 1 (SEQ ID NO: 2) and FIG. 2 (SEQ ID NO: 4). .

(Manipulation of β-APP and / or HsLON Sequence) Manipulation of the β-APP and / or HsLON sequence can be performed at the protein level. Included within the scope of the invention are complexes of β-APP or HsLON fragments, differentially modified during or after translation (eg, glycosylation, acetylation, phosphorylation, amidation, Derivatives, fragments or analogs (by derivatization with known protecting / blocking groups, proteolytic cleavage, binding to antibody molecules or other cellular ligands, etc.). Obtained a large number of use any chemical modification methodologies known in the art, These include cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, specific chemical cleavage by NaBH _4, acetylation, formylation, oxidation , Reduction, metabolic synthesis in the presence of tunicamycin, and the like. In certain embodiments, the β-APP and / or HsLON sequences are modified to include a fluorescent label. In another specific embodiment, β-APP and / or HsLON are modified by incorporating a heterofunctional reagent. Here such heterofunctional reagents can be used to crosslink the membrane of the conjugate.

Chemical Synthesis Complexes of β-APP and / or HsLON analogs and derivatives can be chemically synthesized. For example, β-APP containing a desired domain or mediating a desired activity (eg, β-APP: HsLON complex formation) in vitro
And / or a peptide corresponding to a portion of HsLON can be synthesized by using a peptide synthesizer. If the natural product is suspected to be a mutant, or if the natural product is isolated from a new species, the amino acid sequence of β-APP and / or HsLON isolated from natural sources, and expressed in vitro These amino acid sequences, or the amino acid sequences of β-APP and / or HsLON isolated from expression vectors synthesized in vivo or in vitro, can be obtained from DNA sequence analysis or directly from the isolated protein. Can be determined by decision. The β-APP: HsLON complex can also be used to identify hydrophobic and hydrophilic regions of proteins, as described by hydrophilic analysis (see, eg, Hopp & Woods, 1981, Proc. Natl. Acad. Sci.
ScL USA 78: 3824-3828), thus assisting in the design of substrates for experimental procedures (eg, in binding experiments, antibody synthesis, etc.). Secondary structure analysis can also be performed to identify regions of β-APP and / or HsLON that take specific structural motifs. For example, Cho
u & Fasman, 1974, Biochem. 13: 222-223. Manipulation, translation, prediction of secondary structure, hydrophilicity and hydrophobicity profile, prediction and plotting of open reading frames,
As well as determination of sequence homology can be accomplished using computer software programs available in the art (eg, Wisconsin GCG using default parameter settings (Genetics Computer).
Group) software package). Other methods of structural analysis include X-ray crystallography (eg, Engstrom, 1974, Biochem. Exp. Bio.
l. 11: 7-13); mass spectrometry and gas chromatography (eg, M
ETHODS IN PROTEIN SCIENCE, 1997; Wil
eye and Sons, New York, NY). And computer modeling (eg Fletteric
k & Zoller ed., 1986, Computer Graphics and
Molecular Modeling, CURRENT COMMUNIC
ATTIONS IN MOLECULAR BIOLOGY, Cold Spr
ing Harbor Laboratory Press, Cold Spr
ing Harbor, NY) may also be used.

Methodology for Screening The present invention relates to the ability of β-APP, HsLON to modify and / or modulate cellular functions, particularly those associated with β-APP and / or HsLON.
Provided are methodologies for screening N and / or β-APP: HsLON complexes, and derivatives, fragments, and analogs thereof. These functions include controlling cell cycle progression; regulating transcription; controlling intracellular signaling; and pathological processes, and various other biological activities (eg,
Anti-β-APP antibody, anti-HsLON antibody, and / or anti-β-APP: HsLO
Binding to an N-complex antibody, etc.). Derivatives, fragments, or analogs possessing the desired immunogenicity and / or antigenicity can be used in immunoassays to detect β-APP, HsLON, and / or β-A
It can be used for immunization for inhibition such as the activity of the PP: HsLON complex.
For example, a derivative, fragment or analog that retains or deletes or inhibits a property of interest of interest (eg, involved in the β-APP: HsLON complex) may be such a property and its physiological correlates. Can be used as inducers or inhibitors, respectively. In certain embodiments, β-
Β-APP of a fragment of APP and / or a fragment of HsLON:
The HsLON complex is such that such a fragment is a given β-APP: HsLON
When contained within a complex, it can be bound by an anti-β-APP antibody and / or an anti-HsLON antibody or an antibody specific to the β-APP: HsLON complex.
Derivatives, fragments, and analogs of the β-APP: HsLON complex can be analyzed for the desired activity (s) by procedures known in the art.

((2) Production of Antibodies Against β-APP: HsLON Complex) As disclosed herein by the present invention, the β-APP: HsLON complex, or a derivative, fragment, analog, or derivative thereof. Homologs can be utilized as immunogens in the production of antibodies that immunospecifically bind these protein components. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, _Fab fragments, and _Fab expression libraries. In certain embodiments, human β-APP and human Hs
Disclosed are antibodies to a complex of LON. In another particular embodiment, the complex is formed from fragments of β-APP and HsLON; wherein these fragments comprise a protein domain that interacts with other members in the complex, and Used as an immunogen for production. Various procedures known in the art can be used for the production of polyclonal or monoclonal antibodies to the β-APP: HsLON complex, or a derivative, fragment, analog or homolog thereof.

For the production of polyclonal antibodies, various host animals use native β-APP:
It can be immunized by injection with the HsLON complex, or a synthetic variant thereof, or a derivative as described above (eg, cross-linked β-APP: HsLON). Various adjuvants can be used to increase the immunological response. And this includes:
Freund (complete and incomplete), inorganic salt gels (eg, aluminum hydroxide), surfactants (eg, lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, etc.), and human adjuvants (eg, Bacille) Calmette-Guerin and Corynebacterium parvum).

For the preparation of β-APP: HsLON complexes, or monoclonal antibodies directed to derivatives, fragments, analogs, or homologs thereof, any technique that provides for the production of antibody molecules by continuous cell line culture is available. Can be used. Such techniques include, but are not limited to, the hybridoma technology (Kohler & Milstein, 1975, Nature 256:
495-497); trioma technology; human B-cell hybridoma technology (Kozbor et al., 1983, Immunol. Today).
4:72) and EBs for producing human monoclonal antibodies
V hybridoma technology (Cole et al., 1985, Monoclonal Ant).
Ibodies and Cancer Therapy, Alan, R.A. Li
ss, Inc. , Pp. 77-96). Human monoclonal antibodies
Can be utilized in the practice of the present invention and by the use of human hybridomas (
Cote et al., 1983, Proc. Natl. Acad. Sci. USA 80
: 2026-2030) or by transforming human B cells with the Epstein-Barr virus in vitro (Cole et al., 198).
5. Monoclonal Antibodies and Cancer T
herapy (see Alan R. Liss, Inc., pp. 77-96).

According to the present invention, a single-chain antibody specific for the β-APP: HsLON complex
For production, the techniques may be adapted (eg, US Pat. No. 4,946,778).
checking). Further, F_abMethodology compatible for expression library construction
(Eg, Huse et al., 1989, Science 246: 1275-
1281), β-APP: HsLON, or a derivative or flag thereof.
Monochrome with the desired specificity for the target, analog or homolog
Null F_abIt may allow for rapid and efficient identification of fragments. Non-human antibodies are
It can be "humanized" by techniques well known in the art. For example, U.S. Patent No.
See 5,225,539. β-APP: HsLON complex
Antibody fragments, including diotypes, can be prepared by techniques known in the art.
Can be produced. This includes, but is not limited to: (i)
F produced by pepsin digestion of antibody molecules_{(ab ') 2}Fragment; (ii) F _{(ab ') 2} F produced by reducing the disulfide bridge of the fragment_ab Fragments; (iii) treatment of the antibody molecule with papain and a reducing agent.
F produced by_abFragment, and (iv) F_VFragment.

In one embodiment, methodologies for screening for antibodies possessing the desired specificity include enzyme linked immunosorbent assays (ELISAs) and other immunologically mediated techniques known in the art. But not limited thereto. In certain embodiments, the selection of an antibody that is specific for a particular domain of the β-APP: HsLON complex comprises selecting a β-APP possessing such a domain.
: Promoted by generation of hybridomas that bind to fragments of the HsLON complex. In another specific embodiment, a methodology for the selection of antibodies that specifically bind the β-APP: HsLON complex but do not specifically bind to individual proteins of the β-APP: HsLON complex (individually). Β-APP protein and H
Identified by selecting antibodies based on positive binding to the β-APP: HsLON complex, with concomitant loss of binding to the sLON protein, is within the scope of the invention. Accordingly, also provided herein are antibodies specific for a domain in the β-APP: HsLON complex, or a derivative, fragment, analog or homolog thereof.

The antibodies described above can be used in methods known in the art for localizing and / or quantifying β-APP: HsLON complexes (eg,
(Eg, for use in measuring protein levels in appropriate physiological samples, for use in diagnostic methods, for use in imaging proteins, etc.). In certain embodiments, the anti-β-APP antibody, anti-HsLON antibody and / or anti-β-APP: HsLON complex antibody, or a derivative, fragment, analog, or homolog thereof comprising a binding domain derived from the antibody is:
Pharmacologically active compound [hereinafter referred to as “therapeutic agent (Therapeutic)
s)].

((3) β-APP: HsLON in Diagnosis, Prognosis, and Screening
Use of the Complex The β-APP: HsLON complex can act as a “marker” for certain disease states, including disruption of physiological processes known to involve β-APP and HsLON. For example, BACKGROUND OF THE IN
See VENTION. Such functional activities include (1) Alzheimer's disease, trisomy 21 dementia, Parkinson's disease, amyotrophic lateral sclerosis (AL
(2) cardiomyopathy; (3) some forms of diabetes; (
4) hearing impairment; (5) and male infertility; and (6) many uncommon syndromes and disorders associated with mitochondrial DNA mutations,
It is not limited to these. Therefore, the β-APP: HsLON complex is expected to have diagnostic utility. Thus, the identification and classification of a particular group of patients with elevated or deficient β-APP: HsLON complexes may lead to a new taxonomic classification of the disease, thereby significantly improving diagnostic performance.

The level of β-APP: HsLON complex or β-APP protein and / or
Or detection of HsLON protein level, or β-APP: HsLON
Detection of the level of mRNA encoding a component of the complex can be utilized in the analysis of various diseases. And they provide important information in a variety of medical processes, including diagnosis, prognosis, identifying disease states, tracking disease course, tracking the effectiveness of administered therapeutics, tracking therapeutic response, and the like. Similarly, nucleic acid sequences (and sequences complementary thereto), and β-APP: HsLON complexes and / or
Alternatively, both antibodies specific for individual components capable of forming a β-APP: HsLON complex can be used in diagnosis.

The molecules described above are for detecting, prognosing, diagnosing or monitoring various conditions, diseases and disorders characterized by abnormal levels of β-APP: HsLON complex, or for monitoring the treatment thereof. In addition, it can be utilized in assays (eg, immunoassays). By "abnormal level" is meant an increase or decrease in the level in a sample relative to the level present in a similar sample from a non-diseased part of the body or from a subject without the disorder. The immunoassay described above allows a sample from a patient to be subjected to anti-β-A under conditions such that immunospecific binding can occur.
Contacting with a PP antibody, an anti-HsLON antibody, and / or an anti-β-APP: HsLON complex antibody, followed by detecting or measuring the amount of any immunospecific binding by the antibody. obtain. In certain embodiments, β-APP, HsLON, and / or β-APP: HsLO
Non-complexed β-APP: HsLON or complexed β-A can be used to treat tissue or serum samples from patients using antibodies specific for the N complex.
PP: can be analyzed for the presence of HsLON; where abnormal levels of β-AP
P, HsLON, and / or β-APP: HsLON complex are indicators of a disease state. Examples of immunoassays that can be used include Western blot, radioimmunoassay (RIA), and enzyme-linked immunosorbent assay (ELISA).
Using techniques such as "sandwich" immunoassays, immunoprecipitation assays, sedimentation reactions, gel diffusion sedimentation reactions, immunodiffusion assays, agglutination assays, complement binding assays, immunoradiometric assays, fluorescent immunoassays, and protein-A immunoassays , Competitive and non-competitive assay systems.

[0069] Nucleic acid species of the invention that encode related protein components of the β-APP: HsLON complex, as well as related nucleotide and subsequences, can also be used in hybridization assays. The nucleotide sequences of β-APP and HsLON, or a subsequence thereof comprising at least 6 nucleotides, can be used as a hybridization probe. Hybridization assays are for detecting, prognosing, diagnosing, or monitoring conditions, disorders, or disease states associated with abnormal levels of mRNA encoding a component of the β-APP: HsLON complex, as described above. Can be used for In certain embodiments of the invention, diseases and disorders involving or characterized by abnormal levels of the β-APP: HsLON complex, or a predisposition to develop such a disorder, may be associated with functional activity. Abnormal levels of β-APP: HsLON complex,
Alternatively, the diagnosis can be made by detecting an uncomplexed β-APP protein and / or HsLON protein, or a nucleic acid. The above-mentioned functional activities include, but are not limited to: (i) binding to interacting partners (eg, β-APP, HsLON), or (ii) β-APP, HsLON. Or R of β-APP and / or HsLON, which can result in altered expression or activity of the β-APP: HsLON complex.
Mutations in NA, DNA, or protein (eg, wild-type β-APP
And / or transposition, truncation to HsLON,
(A change in nucleotide or amino acid sequence).

[0070] Methodologies well known in the art (eg, immunoassays, nucleic acid hybridization assays, assays for biological activity, and the like) can be used to affect a particular disease or disorder, or such a disease or disorder. In a sample from a patient who has a predisposition to develop a disease, as compared to a level in a sample from a subject who does not have or is not predisposed to such a disease or disorder. In addition, one can determine whether one or more particular β-APP: HsLON complexes are present or absent at either elevated or reduced levels. In addition, β-APP for uncomplexed components (ie, β-APP and / or HsLON) in the complex of interest:
The ratio of the HsLON complex is such that a sample from a patient suffering from or predisposed to develop a particular disease or disorder has such a disease or disorder. These assays can be utilized to determine whether they have been increased or decreased as compared to a ratio in a sample from a subject that does not have or is not predisposed to them.

Thus, in certain embodiments of the present invention, one or more modified levels of β-APP: HsL are provided by quantitatively establishing the following modified levels:
Diseases and conditions involving the ON complex may be diagnosed, or their possible presence screened, or a predisposition to develop such diseases and conditions may be detected: (i) one or more Β-APP: HsLON complex;
(Ii) mRNA encoding both protein members of the complex; (ii)
i) complex functional activity, or (iv) mutations in β-APP or HsLON that enhance / inhibit or stabilize / stabilize β-APP: HsLON complex formation (eg, wild-type β-APP Or transposition in a nucleic acid, truncation in a gene or protein, change in nucleotide or amino acid sequence relative to HsLON).

In the practice of the present invention, the use of detection techniques (particularly those involving antibodies to the β-APP: HsLON complex) may involve the use of uncomplexed or complexed proteins of interest ( For example, β-APP and / or HsL
Methods for detecting specific cells expressing ON) are provided. Using such assays, specific cell types can be quantitatively characterized, where β-APP: H is obtained by techniques well known in the art (eg, fluorescence-activated cell sorting).
One or more specific components of the sLON complex are expressed, and the presence of uncomplexed or complexed proteins may correlate with cell viability. For the purpose of characterizing and / or isolating the β-APP: HsLON complex, the β-APP: HsLON complex is expressed in an in vitro cell culture model expressing a specific β-APP: HsLON complex, or a derivative thereof. Methodologies for detecting the body are also embodied herein. These detection techniques include, but are not limited to: prokaryotes (eg, D
avey & Kell, 1996, Microbiol. Rev .. 60: 641-
696); primary cultures and tissue specimens from eukaryotes, including mammalian species such as humans (eg, Steele et al., 1996, Clin. Obste).
t. Gynecol. 39: 801-813), and continuous cell culture (see, eg, Orfao & Ruiz-Arguelles, 1996, Cl.
in. Biochem. 29: 5-9).

The present invention further provides an anti-β-APP antibody, an anti-HsLON antibody, and / or an anti-β
-Provide a kit for diagnostic use consisting of an APP: HsLON complex antibody, and optionally one or more containers containing a labeled binding partner for these antibodies. The label incorporated into the anti-β-APP: HsLON conjugate antibody may include, but is not limited to, a chemiluminescent, enzymatic, fluorescent, colorimetric, or radioactive moiety. In another specific embodiment, β-
Contains modified or unmodified nucleic acids encoding or complementary to APP, HsLON, and / or β-APP: HsLON complexes, and optionally, a labeled binding partner for these nucleic acids. Kits for diagnostic use consisting of one or more containers are also provided. In an alternative specific embodiment, the kit comprises a polymerase chain reaction (PCR);
nis et al., 1990, PCR PROTOCOLS, Academic Pre.
ss, Inc. , San Diego, CA), ligase chain reaction, cyclic probe reaction.
For example, or an oligonucleotide primer pair (e.g., each being 6-30 nucleotides in length) that can act as an amplification primer for other methods known in the art, can be included in one or more containers. The kit may also optionally include a predetermined amount of purified β-APP, HsLON, or β-APP: HsLO for use as a diagnostic, reference, or control in the assays described above.
It may further comprise N complexes, or their nucleic acids.

(4) β-APP and HsLON Protein and β-APP: HsLO
The present invention provides methods for treating or preventing various diseases and disorders by the administration of biologically active therapeutic compounds (hereinafter “therapeutic agents”). provide.
Such "therapeutic agents" include, but are not limited to: (
i) β-APP, HsLON, and β-APP: HsLON complexes, and their derivatives, fragments, analogs, and homologs; (ii) antibodies to the aforementioned proteins and their protein complexes; (iii) β-APP and And / or nucleic acids encoding HsLON, and derivatives, fragments, analogs and homologs thereof; (iv) antisense nucleic acids against sequences encoding β-APP and HsLON proteins; and (v) β-APP: H
The sLON complex and its modulators (ie, inhibitors, agonists and antagonists).

As discussed above, β-APP and its binding partner HsLON are significantly associated with disorders, including but not limited to: Alzheimer's disease, trisomy 21 dementia, Parkinson Disease, neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; deafness; and male infertility; and a number of less common No syndromes and disorders. A wide range of cellular diseases include β-APP:
Modulates (ie, antagonizes or enhances) HsLON complex activity or formation
It is treated or prevented by administration of a therapeutic agent.

An abnormal level of β-APP: HsLON complex, or an activity level, or a disease or disorder associated with an abnormal level of β-APP is β-APP: HsLON
It can be treated by administration of a therapeutic agent that modulates complex formation or activity. In certain embodiments, the activity or level of β-APP is modulated by administration of HsLON. In another specific embodiment, the activity or level of HsLON is
It is regulated by administration of β-APP.

Disorders Associated with Increased β-APP and β-APP: HsLON Complex Levels Increased β-APP: HsLON levels or biological activity (relative to a subject not suffering from the above disease or disorder) Diseases and disorders characterized by can be treated with therapeutic agents that antagonize (ie, reduce or inhibit) β-APP: HsLON complex formation or activity. β-APP: HsLO
Therapeutic agents that antagonize N complex formation or activity can be administered in a therapeutic or prophylactic manner. Therapeutic agents that may be utilized include, but are not limited to, β-APP or HsLON, or an analog, derivative, fragment or homolog thereof; (ii) anti-β-APP, anti-HsLON, and / or anti-β. -APP: HsLON complex antibody; (iii) nucleic acid encoding β-APP or HsLON; (iv) β-APP and HsLON antisense nucleic acid and “dysfunctional” (ie, β-APP coding sequence and HsLON coding Heterologous (due to non-β-APP and / or non-HsLON) insertions within the sequence)
Co-administration of β-APP and / or HsLON nucleic acids is utilized to “knock out” endogenous β-APP and / or HsLON function by homologous recombination (eg, Capecchi, 1989. Science 244: 1).
288-129). In a further embodiment of the present invention, a first H that retains greater affinity for β-APP than a first wild-type HslON.
A variant or derivative of sLON is administered to bind a second to bind to β-APP.
Of HsLON, thereby reducing the level of the complex between β-APP and a second HsLON.

Increased levels of β-APP: HsLON complex can be obtained by obtaining a patient tissue sample (eg, from biopsy tissue) by quantifying protein and / or RNA, and expressing β-APP: It can be readily detected by assaying the HsLON complex (or β-APP and HsLON mRNA) for RNA or protein levels, structure and / or activity in vitro. Methods well known in the art include, but are not limited to:
immunoassay to detect β-APP: HslON complex (eg, by Western blot analysis, immunoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis; immunocytochemistry, etc.), and / or β-A
Hybridization assays to detect co-expression of PP and HsLON mRNA (eg, Northern assay, dot blot, in situ hybridization, etc.).

Reduction of β-APP and β-APP: HsLON Complex Expression Certain embodiments of the present invention provide for β-APP: HsLON complex expression (ie, by targeting mRNA that expresses a protein moiety). , The expression of two protein components of a complex and / or the formation of a complex). RNA therapeutics fall into three classes: (i) antisense species; (ii) ribozymes, or (iii) RNA aptamers.
. For example, Good et al., 1997, Gene Therapy 4: 45-54.
checking ... Antisense oligonucleotides are the most widely used and are discussed below. Ribozyme therapy involves administering (ie, inducing expression) a small RNA molecule that has the enzymatic ability to cleave, bind, or inactivate a particular RNA to reduce or eliminate expression of a particular protein. For example,
Grassi and Marini, 1996, Ann. Med. 28: 499-
See 510. In the present invention, the design of “hairpin” and / or “hammerhead” RNA ribozymes is based on specific mRNA (eg, β-APP mRN).
It is necessary to specifically target A). RNA aptamers are RNA ligands that are specific for proteins (eg, Tat and Rev RNA) (eg, Good et al., 1997, Gene Therapy 4: 45-5).
4), which specifically inhibit its translation.

In a preferred embodiment of the invention, the activity or level of β-APP is Hs
It can be reduced by the administration of LON, a nucleic acid encoding HsLON, or an antibody that immunospecifically binds to HsLON (or a derivative or fragment of an antibody bearing the binding domain thereof). Similarly, the level or activity of HsLON is
-APP, a nucleic acid encoding β-APP, or an antibody that immunospecifically binds to β-APP (or a derivative or fragment of an antibody bearing the binding domain thereof). In another embodiment of the present invention, β-APP
Alternatively, diseases or disorders associated with increased levels of HsLON are β-APP: H
When sLON complex formation acts to reduce or inactivate β-APP or certain HsLONs via β-APP: HsLON complex formation, β-AP
It can be treated or prevented by administration of a therapeutic agent that increases P: HsLON complex formation. Such a disease or disorder may be treated or prevented by:
i) One member of the β-APP: HsLON complex (β-APP: HsLON
Administration (including variants of one or both proteins) that retains increased affinity for other members of the complex (to result in increased complex formation), or
ii) administration of antibodies or other molecules that result in stabilization of the β-APP: HsLON complex, and the like.

(5) Determining the Biological Effect of a Therapeutic Agent In a preferred embodiment of the present invention, appropriate in vitro or in vivo assays are utilized to determine the effect of a particular therapeutic agent and its administration on the affected tissue. A determination is made as to whether the indicator is for a treatment.

In various specific embodiments, in vitro assays are performed using cells representative of the type involved in the disorder of the patient, such that a given therapeutic agent exerts a desired effect on this cell type. It can be determined whether to do so. Compounds for use in therapy may be tested prior to testing a human subject in a suitable animal model system, including but not limited to rats, mice, chickens, cows, monkeys, rabbits, etc. . Similarly, for in vivo testing, any animal model system known in the art can be used prior to administration to a human subject.

Neurodegenerative Disorders β-APP and its binding partner HsLON are associated with neurodegenerative diseases. Therefore, the therapeutic agent of the present invention, particularly, but not exclusively, β-APP: HsL
Those that modulate (or recruit) ON complex activity may be effective in treating or preventing a neurodegenerative disease. Β-APP: HsL involved in neurodegenerative disorders
Therapeutic agents of the invention that modulate ON complex activity can be assayed for efficacy in treating or preventing such neurodegenerative diseases and disorders by any method known in the art. Such assays include in vitro assays for controlled inhibition of cell maturation or apoptosis, or in vivo assays using animal models of neurodegenerative diseases or disorders, or any of the assays described below. Potentially effective therapeutic agents, for example, but not limited to, promote regulated cell maturation and prevent cell apoptosis in culture or reduce neurodegeneration in animal models as compared to controls.

[0084] Once a neurodegenerative disease or disorder has been shown to embrace treatment by modulating β-APP: HsLON complex activity, the neurodegenerative disease or disorder comprises:
Administration of a therapeutic agent that modulates β-APP: HsLON complex formation or activity (β-A
PP: HsLON complexed or uncomplexed binding partner (eg, β-
APP and / or HsLON). Such diseases include all degenerative disorders associated with aging, especially osteoarthritis and neurodegenerative disorders.

Hypertrophic Cardiomyopathy HsLON has been implicated in several disorders and syndromes that share the common characteristics of hypertrophic cardiomyopathy. Therefore, the therapeutic agent of the present invention, in particular, β-APP: HsLO
Those that modulate (or supply) N-complex activity or formation are effective in treating or preventing hypertrophic cardiomyopathy and related diseases or disorders. Therapeutic agents of the present invention (particularly those that modulate the level or activity of the β-APP; HsLON complex) can be prepared by any method known in the art, including those described below. It can be assayed for efficiency in treating or preventing diseases and disorders.

Thus, once a hypertrophic cardiomyopathy-related disease or disorder has been shown to embrace treatment by modulation of β-APP: HsLON complex activity or formation, the disease or disorder is associated with a β-APP: HsLON complex. It can be treated or prevented by administration of a therapeutic agent that modulates body activity or formation, including providing a β-APP: HsLON complex, or individual uncomplexed β-APP and / or HsLON protein.

Diabetes HsLON has been implicated in the development of maternally inherited diabetes. Thus, a therapeutic agent of the invention, particularly, but not limited to, that modulates (or alters or supplies) β-APP: HsLON complex activity may be effective in treating or preventing a neurodegenerative disease. . Therapeutic agents of the invention that modulate β-APP: HsLON complex activity involved in diabetes can be assayed for efficacy in treating or preventing such diseases and disorders by any method known in the art. . Such assays include in vitro assays or in vivo assays using animal models of diabetes, or any of the assays described below. Potentially effective therapeutic agents, for example, but not limited to, reduce diabetes in animal models as compared to controls.

Once diabetes has been shown to embrace treatment by modulating β-APP: HsLON complex activity, the disease or disorder is indicated by administration of a therapeutic agent that modulates β-APP: HsLON complex formation or activity. (Including providing a β-APP: HsLON complex or an uncomplexed binding partner (eg, β-APP and / or HsLON)).

Hearing Loss HsLON is associated with both sensorineural and maternally inherited hearing loss. Accordingly, therapeutic agents of the invention, particularly, but not limited to, those that modulate (or supply) β-APP: HsLON complex activity, are effective in treating or preventing sensorineural hearing loss or maternally inherited hearing loss. Can be Therapeutic agents of the present invention that modulate β-APP: HsLON complex activity involved in sensorineural hearing loss or maternally inherited hearing loss treat or prevent such diseases and disorders by any method known in the art. Can be assayed for efficiency. Such assays include in vitro assays or in vivo assays using animal models of sensorineural or maternally inherited hearing loss, or any of the assays described below. Potentially effective therapeutic agents reduce, for example, but not limited to, sensorineural or maternally inherited hearing loss in an animal model as compared to a control.

Once the sensorineural or maternally inherited hearing loss has been shown to embrace treatment by modulating β-APP: HsLON complex activity, the disease or disorder is characterized by β-APP: HsLON complex activity.
-APP: Administration of a therapeutic agent that modulates HsLON complex formation or activity (β-AP
P: can be treated or prevented by an HsLON complex or uncomplexed binding partner, including, for example, providing β-APP and / or HsLON.

Male Infertility HsLON has been linked to the development of male infertility. Therefore, the therapeutic agent of the present invention,
In particular, but not limited to, modulating (or supplying) β-APP: HsLON complex activity
What can be effective in treating or preventing male infertility. The therapeutic agent of the present invention that regulates β-APP: HsLON complex activity involved in male infertility,
Any method known in the art can be assayed for efficiency in treating or preventing such diseases and disorders. Such assays include in vitro assays or in vivo assays using animal models of male infertility,
Alternatively, any of the assays described below. Potentially effective therapeutic agents, for example, but not limited to, reduce male infertility in animal models as compared to controls.

[0092] Once male infertility has been shown to embrace treatment by modulating β-APP: HsLON complex activity, the disease or disorder may be a therapeutic agent that modulates β-APP: HsLON complex formation or activity. (Eg, β-APP: HsLON complex or uncomplexed binding partner (eg, β-APP and / or HsLON).
), Comprising providing).

(Disease Associated with Mitochondrial DNA Mutation) HsLON is associated with a number of diseases or disorders associated with mitochondrial DNA mutation. Accordingly, the therapeutic agents of the present invention, in particular, but not exclusively, β-APP: H
Those that modulate (or provide) sLON complex activity may be effective in treating or preventing a disease or disorder associated with mitochondrial DNA mutations. Β-APP: HsL involved in diseases or disorders associated with mitochondrial DNA mutations
Therapeutic agents of the invention that modulate ON complex activity can be assayed for efficacy in treating or preventing such diseases and disorders by any method known in the art. Such assays include in vitro assays or in vivo assays using animal models of diseases or disorders associated with mitochondrial DNA mutations, or any of the assays described below. Potentially effective therapeutic agents reduce, for example, without limitation, diseases or disorders associated with mitochondrial DNA mutations in animal models as compared to controls.

Once the disease or disorder associated with mitochondrial DNA mutations is β-APP: H
When indicated to be amenable to treatment by modulating sLON complex activity, the disease or disorder is indicated by administration of a therapeutic agent that modulates β-APP: HsLON complex formation or activity (β-APP: HsLON complex or uncomplexed). It can be treated or prevented by an incorporation binding partner (including, for example, providing β-APP and / or HsLON).

(6) Gene Therapy In certain embodiments of the invention, for gene therapy, β-APP and / or
Alternatively, a nucleic acid containing a sequence encoding HsLON or a functional derivative thereof is administered to regulate the function of the β-APP: HsLON complex. In a more particular embodiment, the nucleic acid (s) encoding both β-APP and HsLON, or a functional derivative thereof, can be administered for gene therapy. Gene therapy refers to therapy performed by the administration of a particular nucleic acid to a subject. In this embodiment of the invention, the nucleic acid produces its encoded protein,
-Works by exerting a therapeutic effect by regulating the function of the APP: HsLON complex. Any method for gene therapy available in the art can be used in the practice of the present invention. See, for example, Goldspiel et al., 1993, C.
lin. Pharm. 12: 488-505.

In a preferred embodiment, the therapeutic agent is β-APP and / or HsLON
Nucleic acid, which is part of an expression vector that expresses both of the aforementioned proteins or fragments or chimeric proteins thereof in a suitable host. In certain embodiments, such nucleic acids are operably linked to the β-APP and HsLON coding regions or, less preferably, two separately to separate β-APP and HsLON coding regions. Have a promoter.
The promoter can be inducible or constitutive, and, if desired, tissue-specific. In another specific embodiment, β-APP and HsLON
Nucleic acid molecules are used in which the coding sequence (and any other desired sequences) flank the region that promotes homologous recombination at the desired site in the genome, and β-APP and HsLON
Provides intrachromosomal expression of a nucleic acid. For example, Koller and Smithes
, 1989, Proc. Natl. Acad. Sci. USA 86: 8932.
See -8935.

Delivery of a therapeutic agent nucleic acid to a patient can be direct (ie, the patient is directly exposed to the nucleic acid or a nucleic acid-containing vector) or indirect (ie, the cells are first transformed in vitro with the nucleic acid and in vitro). , And then implanted in the patient). These two approaches are known, respectively, as in vivo or ex vivo gene therapy. In certain embodiments of the invention, the nucleic acid is directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of a number of methods known in the art, including but not limited to: constructing the nucleic acid as part of a suitable nucleic acid expression vector, and In a manner that is internal (eg, by a defective or attenuated retrovirus or other viral vector (US Pat. No. 4,980,286).
Administration of this nucleic acid; direct injection of naked DNA;
Particulate bombardment (eg, “Gene Gun®”; Bio)
coating the nucleic acid with a lipid; using an associated cell surface receptor / transfection agent;
Encapsulating in liposomes, microparticles, or microcapsules;
Administering to a peptide known to link in and enter the nucleus; or ligands that link the nucleic acid to make it susceptible to receptor-mediated endocytosis (eg, Wu and Wu, 1987). , J. Biol
. Chem. 262: 4429-4432), which can be used to "target" a cell type that specifically expresses the receptor of interest.

In another particular embodiment of the invention, the nucleic acid comprises a fusogenic viral peptide whose ligand is designed to disrupt endosomes.
A ligand complex can be produced, allowing the nucleic acid to avoid subsequent lysosomal degradation. In yet another specific embodiment, the nucleic acids can be targeted in vivo for cell-specific endocytosis and expression by targeting specific receptors. For example, PCT Publication WO92 / 06180; WO93
/ 14188 and WO93 / 20221. Alternatively, the nucleic acid can be introduced and integrated intracellularly into the host cell genome for expression by homologous recombination. See, for example, Zijlstra et al., 1989, Nature.
e 342: 435-438.

In yet another specific embodiment, a viral vector containing β-APP and / or HsLON nucleic acid is utilized. For example, retroviral vectors can be used (eg, Miller et al., 1993, Meth. Enzymol).
. 217: 581-599). This vector has been modified to delete retrovirus-specific sequences that are not necessary for packaging of the viral genome, with subsequent integration into host cell DNA. The β-APP nucleic acid and / or HsLON nucleic acid (preferably both) can be cloned into a vector that facilitates delivery of the gene to the patient. See, for example, Boesen et al., 1994.
Biotherapy 6: 291-302; Kiem et al., 1994, Blo.
od 83: 1467-1473. In addition, adenovirus can be used as an essentially effective "vehicle" for delivery of genes to the respiratory epithelium. Other targets for adenovirus-based delivery systems include the liver, central nervous system,
Endothelial cells, and muscle. Adenoviruses also possess the advantageous ability to infect non-dividing cells. For a review, see, for example, Kozarsky and Wil.
son, 1993, Curr. Opin. Gen. Developer. 3: 499
See -503. Adenovirus-associated virus (AAV) has also been proposed for use in gene therapy. See, for example, Walsh et al., 1993, P.
rc. Soc. Exp. Biol. Med. 204: 289-300.

A further approach to gene therapy in the practice of the present invention involves transferring genes to cells in in vivo tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, viral infection, and the like. Generally, the transfer methodology involves the simultaneous transfer of a selectable marker to the cells. The cells are then subjected to selective pressure (eg, antibiotic resistance).
To facilitate isolation of cells utilizing (and expressing) the transferred gene. These cells are then delivered to the patient. In certain embodiments, prior to in vivo administration of the resulting recombinant cells, the nucleic acid is introduced into the cells by any method known in the art, including, but not limited to, the following: Not: transfection, electroporation,
Microinjection, infection with a virus or bacteriophage vector containing the nucleic acid sequence of interest, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, and A similar methodology to ensure that development and physiological functions are not destroyed by the transfer. For example, Loeffler and Behr
1993. Meth. Enzymol. 217: 599-618. The technique chosen should provide for stable transfer of the nucleic acid into the cell, so that the nucleic acid should be expressible by the cell. Preferably, the transferred nucleic acid is heritable and expressible by cell progeny.

In a preferred embodiment of the present invention, the resulting recombinant cells can be delivered to a patient by various methods known in the art, including but not limited to: epithelium Injection of cells (eg, subcutaneous), application of recombinant skin cells as a skin graft to a patient, and intravenous injection of recombinant blood cells (eg, hematopoietic stem or precursor cells). The total amount of cells envisioned for use depends on the desired effect, patient condition, etc., and can be determined by one skilled in the art.

Cells into which nucleic acids can be introduced for gene therapy purposes include any desired available cell type and can be heterologous, heterologous genotype, syngeneic, or endogenous. . Cell types include, without limitation, epithelial cells, endothelial cells, keratinocytes, fibroblasts, myocytes, hepatocytes and blood cells, or various stem or progenitor cells, particularly embryonic cardiomyocytes, liver stem cells (International Patent Publication WO 94 / 08598),
Neural stem cells (Stemple and Anderson, 1992, Cell 7
1: 973-985), including hematopoietic stem or progenitor cells (eg, as obtained from bone marrow), umbilical cord blood, peripheral blood, embryonic liver, and the like. In a preferred embodiment, the cells utilized for gene therapy are autologous to the patient.

[0103] In a specific embodiment where the recombinant cells are used for gene therapy, stem or progenitor cells that can be isolated and maintained in vitro may be utilized. Such stem cells include, but are not limited to, hematopoietic stem cells (HSC), epithelial tissue stem cells, and neural stem cells (eg, Temple & Anderson, 1992. Cell 71:
973-985). With respect to HSC, the isolation, propagation,
And any technique that provides for in vitro maintenance can be used in the detailed embodiments of the invention. As discussed above, preferably the HS used in gene therapy
C may be autologous to the patient. When used, preferably non-autonomous HS
C is utilized in combination with a method to suppress additional host / patient transplantation immune responses. See, for example, Kodo et al., 1984. J. Clin. Invest. 73:13
See 77-1384. In another preferred embodiment of the invention, the HSC is
Prior to administration to a patient, it can be highly enriched (or produced in a substantially pure form) by any technique known in the art. For example, Witlock & Wit
te, 1982. Proc. Natl. Acad. Sci. USA 79:36
See 08-3612.

(7) Use of Antisense Oligonucleotides In a specific embodiment of the present invention, β-APP, HsLON, and / or β-
APP: HsLON complex formation and function can be inhibited by the use of antisense nucleic acids against β-APP or HsLON, or most preferably, β-APP and HsLON. Further, the present invention provides a method for preparing β-APP and / or HsL
Disclosed are the therapeutic or prophylactic uses of nucleic acids (at least 6 nucleotides in length) that are antisense to genomic sequences (genes) or cDNAs encoding ON, or portions thereof. Such antisense nucleic acids include β-APP, HsL
It has utility as a therapeutic agent that inhibits ON and / or β-APP: HsLON complex formation or activity, and can be utilized in a therapeutic or prophylactic manner.

Another detailed embodiment of the present invention is a prokaryotic cell or a prokaryotic cell, such as providing a cell with a therapeutically effective amount of an antisense nucleic acid of β-APP and / or HsLON, or a derivative thereof. Disclosed are methodologies for inhibiting expression of β-APP and HsLON nucleic acid sequences in eukaryotic cells.

An antisense nucleic acid of the invention can be an oligonucleotide that can either be administered directly to a cell or produced in vivo by transcription of a heterologous introduced sequence. Further, the antisense nucleic acid can be complementary to either the coding (ie, exonic) and / or non-coding (ie, intronic) regions of β-APP or HsLON mRNA. β-APP and HsLON antisense nucleic acids are at least 6 nucleotides in length;
Preferably, the oligonucleotide has a length in the range of 6 to 200 nucleotides. In particular embodiments, the antisense oligonucleotide is at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides, or at least 200 nucleotides. The antisense oligonucleotide can be DNA or RNA (or a chimeric mixture, derivative or variant thereof), can be either single-stranded or double-stranded, and modified with a base, sugar or phosphate backbone moiety Can be done.

In addition, the antisense oligonucleotide may include moieties that facilitate the transport of the oligonucleotide across cell membranes, such as peptides, other related functional groups such as hybridization-triggered cross-linking agents, hybridization-triggered cleavage agents, and the like. . See, for example, Letsinger et al., 1989. Proc. Natl. Aca
d. U. S. A. 86: 6553-6556; PCT Publication No. WO88 / 098
See FIG. In a specific embodiment, the β-APP and HsLON antisense oligonucleotides comprise a catalytic RNA or ribozyme. For example, Sa
rver et al., 1990. Science 247: 1222-1225.

The antisense oligonucleotides of the invention can be synthesized by standard methodology known in the art including, but not limited to: (i) Automated phosphorothioate-mediated oligonucleotide synthesis (Stein et al., 1988. Nuc). .Ac
ids Res. 16: 3209) or (ii) methylphosphonate oligonucleotides prepared by use of controlled pore glass polymer supports (eg, Sarin et al., 1988. Proc. Natl. Acad. Sci. US)
. A. 85: 7448-7451).

In an alternative embodiment, β-APP and HsLON antisense nucleic acids are produced intracellularly by transcription of a foreign sequence. For example, vectors that include a promoter operably linked to the reverse complement of the desired gene, and the like, can be transcribed in vivo (when taken up by cells) and, thus, produce antisense nucleic acid (RNA) species.
The aforementioned vector can either remain episomal or become capable of becoming integrated into the chromosome as long as it can be transcribed to produce the desired antisense RNA. The origin of the vector utilized may be from bacteria, viruses, yeast or other sources known in the art utilized for replication and expression in mammalian cells. β-APP and HsLON antisense RN
Expression of the sequence encoding A can be driven by any promoter known in the art to function in mammalian, preferably human cells. Such promoters may be inducible or constitutive and include, but are not limited to: (i) the SV40 early promoter region; (ii) the promoter contained in the 3 'terminal long terminal repeat of Rous sarcoma virus (RSV); (Iii) a herpesvirus thymidine kinase promoter and (iv) a metallothionein gene regulatory sequence.

The β-APP and HsLON antisense nucleic acids include β-APP, HsLON,
And / or may be used prophylactically or therapeutically in the treatment or prevention of disorders of the cell type that express (or preferably overexpress) the β-APP: HsLON complex. Cell types that express or overexpress β-APP and HsLON RNA include, without limitation, hybridization with β-APP and HsLON-specific nucleic acids (eg, Northern hybridization, dot blot hybridization, in situ hybridization). It can be identified by various methods known in the art, or by observing the ability of RNA from specific cell types to be translated in vitro into β-APP and / or HsLON by immunohistochemistry. In a preferred aspect, primary tissue from a patient can be assayed for β-APP and / or HsLON expression prior to actual treatment, for example, by immunocytochemistry or in situ hybridization.

An effective amount of β-APP and HsLO contained in a pharmaceutically acceptable carrier
Pharmaceutical compositions of the invention comprising N antisense nucleic acids comprise β-APP: HsLON
The complex, or the individual components of the complex, can be administered to a patient having a disease or disorder of the type involving altered expression of RNA or protein. The amount of β-APP and / or HsLON antisense nucleic acid that is effective in treating a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. Where possible, it is desirable to measure antisense cytotoxicity in in vitro systems and in useful animal models prior to testing and use in humans. In a specific embodiment, a pharmaceutical composition comprising β-APP and an HsLON antisense nucleic acid can be administered by liposomes, microparticles, or microcapsules and the like. See, eg, supra, and Leonetti et al.
0. Proc. Nalt. Acad. Sci. U. S. A. 87: 2448-2
See 451.

(8) β-APP: HsLON Complex Assay The functional activity of the β-APP: HsLON complex (derivatives, fragments, analogs and homologs thereof) is assayed by a number of methods known in the art. obtain. For example, β-APP: β-APP complex activity (eg, anti-β-APP: Hs
Putative modulators (e.g., inhibitors, agonists and antagonists) of LON complex antibodies, and [beta] -APP or HsLON antisense nucleic acids, are described for their ability to modulate [beta] -APP: HsLON complex formation and / or activity. Can be assayed.

Immunoassays In a specific embodiment, an immunoassay-based methodology is provided wherein (i) binding to the wild-type β-APP: HsLON complex or HsLON,
Or compete for (ii) binding to an anti-β-APP: HsLON complex antibody. These immunoassays include, but are not limited to, radioimmunoassays, enzyme-linked immunosorbent assays (ELISAs), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (eg, Colloidal gold,
Enzyme or radioisotope labeling), complement fixation assay, western blot, northwestern blot, sedimentation reaction, agglutination assay (eg, gel agglutination assay, hemagglutination assay), immunofluorescence assay, protein A assay and immunoelectrophoresis Includes competitive and non-competitive assay systems utilizing techniques such as assays. In one particular embodiment, antibody binding is detected directly by assaying for a label on the primary antibody. In another specific embodiment, binding of the primary antibody is confirmed by detection of a secondary antibody (or reagent) that is specific for the primary antibody. In a further embodiment, the secondary antibody is labeled.

Gene Expression Assay Expression of the β-APP or HsLON gene (from both endogenous genes and from the incorporated recombinant DNA) is unrestricted, Southern hybridization, Northern hybridization, restriction endonuclease. Nuclease mapping,
DNA sequence analysis and Southern hybridization or RNase using probes specific for the β-APP or HsLON gene in various cell types
Polymerase chain reaction amplification (PCR) with protection (eg, CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY 1997
, John Wiley and Sons, New York, NY).

In one particular embodiment of the invention, Southern hybridization is used to determine β-APP and / or HsLON for physiological or pathological conditions.
The genetic linkage of the genetic mutation can be detected. Many cell types at various stages of development have their expression of β-APP and HsLON, especially β-A in the same cell.
Co-expression of PP and HsLON). The strategy of hybridization conditions for Northern or Southern blot analysis can be manipulated to ensure detection of nucleic acids with the desired degree of relevance to the specific probe used. See, for example, above. Modifications of these aforementioned methods, well known in the art, and other methods may be utilized in the practice of the present invention.

Binding Assays Derivatives, fragments, analogs and homologs of HsLON include, but are not limited to: (i) a modified yeast two-hybrid assay system; (ii) β-A in a complex.
Analysis by immunoprecipitation with antibodies binding to PP followed by size fractionation of immunoprecipitated proteins (eg, by denaturing or non-denaturing polyacrylamide gel electrophoresis); (iii) Western analysis; (v) non-denaturing gel electrophoresis Assay for binding to β-APP by any method known in the art, including and the like.
Alternatively, the foregoing technique may be modified to allow for a reverse analysis, whereby the β-A
The PP component binds to HsLON.

Assays for Biological Activity A detailed embodiment of the present invention provides a methodology for screening derivatives, fragments, analogs or homologs of β-APP for biological activity, which comprises Contacting said derivative, fragment, analog or homolog of APP with HsLON, and detecting the formation of a complex between said derivative, fragment, analog or homolog and HsLON; Detection of formation involves indicating that the β-APP derivative, fragment, analog or homologue possesses biological (eg, binding) activity. Similarly, a further embodiment discloses a methodology for screening derivatives, fragments, analogs or homologs of HsLON for biological activity, wherein the derivatives, fragments, analogs or homologs of the above proteins are identified as β-A
Contacting with PP; and detecting the formation of a complex between this derivative, fragment, analog or homolog of HsLON and β-APP,
Here, detecting the formation of the complex involves indicating that the HsLON derivative, fragment, analog, or homolog possesses biological activity.

Related Treatment Assays Neurodegeneration Similarly, once a neurodegenerative disease or disorder embraces treatment by modulating β-APP, HsLON, and / or β-APP: HsLON complex activity or formation. Indicated that the disease or disorder comprises providing β-APP, HsLON, and / or β-APP: HsLON complex.
: Treated or prevented by administration of a “therapeutic agent” that modulates HsLON complex activity or formation. In a specific embodiment, β-APP, HsLON, and / or β-APP: HsLON complex is administered to treat or prevent a neurodegenerative disease or disorder. β-APP is involved in the development and regression of all organs, including the central nervous system. Casaccia-Bonnefil et al., 1997.
Genes and Dev. 11: 2335-2346. Therefore, β-AP
P: HsLON complex or derivative, homologue, analog or fragment thereof, nucleic acid molecule encoding β-APP or HsLON, anti-β-APP: HsL
ON complex antibodies, and β-APP, HsLON, and / or β-APP:
Other modulators of HsLON complex activity or formation can be tested for activity in treating or preventing a neurodegenerative disease in in vitro and in vivo assays.

In one embodiment, the “therapeutic agent” of the invention comprises a cultured cell that is indicative of a neurodegenerative disease in vitro for its activity in treating or preventing a neurodegenerative disease,
Contacting with said "treatment" and comparing the level of said indicator in cells so contacted with said "therapeutic agent" with the level of said indicator in cells not so contacted. Thus, now lower levels in the contacted cells can be assayed by a step indicating that the "therapeutic agent" has activity in treating or preventing a neurodegenerative disease. Detailed examples of such cultured models of neurodegenerative diseases include, but are not limited to, cultured rat endothelial cells from diseased and unaffected individuals (Maneiro et al., 1997, Methods Find.
. Exp. Clin. Pharmacol. 19: 5-12); P19 mouse embryonic carcinoma cells (Hung et al., 1992, Proc. Natl. Acad. Sci. U.
SA 89: 9439-9443); and dissociated cell culture of cholinergic neurons from the basal nucleus of Meinert (Nakajima et al., 1985, Proc. N).
alt. Acad. Sci. ScL USA 82: 6325-6329).

In another embodiment, the “therapeutic agent” of the invention is characterized by its activity in treating or preventing a neurodegenerative disease, wherein the “therapeutic agent” is administered to a test animal susceptible to developing symptoms of the neurodegenerative disease. Administering, and after the administration of the "therapeutic agent", measuring a change in the condition, wherein the decrease in severity of the condition of the neurodegenerative disease, or Prevention can be assayed by showing that the "therapeutic agent" has activity in treating or preventing the disease state. Such test animals can be any one of many animal models known in the art for neurodegenerative diseases. These models, including models for Alzheimer's disease and trisomy 21 mental retardation, accurately mimic natural human neurodegenerative diseases. Farine, 1997, Toxicol. 119
: 29-35. Examples of detailed models include, but are not limited to, partial trisomy 16 mice (Holzman et al., 1996, Proc. Natl. Acad. Sci.
USA 93: 13333-13338); bilateral nuclear basal large cell injured rats (P
opovic et al., 1996, Int. J. Neurosci. 86: 281-2
99); Aged rats (Muir, 1997, Pharmacol. Bioche).
m. Behav. 56: 687-696); PDAPP transgenic mouse model of Alzheimer's disease (Johnson-Wood et al., 1997, Pro.
c. Natl. Acad. Sci. ScL USA 94: 1550-1555); and experimental autoimmune dementia (Oron et al., 1997, J. Neural Trans).
m. Addendum 49: 77-84).

Cardiomyopathy In a specific embodiment of the invention, the β-APP: HsLON complex is administered to treat or prevent a disease or disorder, including cardiomyopathy. HsLON has been linked to several disorders and syndromes that share common features of hypertrophic cardiomyopathy.
Thus, a β-APP: HsLON complex, or a derivative, homolog, analog or fragment thereof, a nucleic acid encoding the β-APP and HsLON protein, an anti-β-APP: HsLON antibody, and a β-APP: HsLON complex activity or Other modulators of formation can be tested for activity in treating or preventing a disease or disorder, including cardiomyopathy, in in vitro and in vivo assays.

In one embodiment, the “therapeutic agents” of the invention include, but are not limited to, neonates that show an indication of cardiomyopathy in vitro (Wall et al., 1996, Eur. J. Pharma.
col. 306: 165-174) or adults (Hain and Schaper).
, 1996, Curr. Opin. Cardiol. 11: 293-301) and cultured autoreactive T-cell myocarditis in autoimmune myocarditis (Perez-Leiros et al., 1997, Neroimmunomod).
contacting cultured cells (e.g., ul. 4: 91-97) with the "therapeutic agent" and the level of the indicator in cells contacted with the "therapeutic agent", Comparing the level of the indicator in the cell, wherein the lower level in the contacted cells indicates that the "therapeutic agent" has activity in treating or preventing cardiomyopathy. Can be assayed.

In another embodiment, the “therapeutic agent” of the invention is administered to a test animal exhibiting symptoms of cardiomyopathy for activity in treating or preventing cardiomyopathy; And measuring a change in the symptoms of the cardiomyopathy after administration of the “therapeutic agent”, wherein the reduction in the severity of the symptoms or prevention of the symptoms of cardiomyopathy is determined by treating the “therapeutic agent”. Can be assayed by a step that indicates that it has activity in treating or preventing this cardiomyopathy. Such a test animal can be any one of a number of animal models known in the art for cardiomyopathy. These models include, but are not limited to, models of mice lacking aryl hydrocarbon receptors (Fernandez-Salguero et al., 1997, Vet. Pa.
thol. 34: 605-614), experimental autoimmune myocarditis in mice (P
erez-Leiros et al., 1997, Neuroimmunmodulat.
ion 4: 91-97), transgenic mice overexpressing tropomodulin (Sussman et al., 1998, J. Clin. Invest. 101).
: 51-61), guinea pigs immunized with adenine nucleotide transporter I (Dorner et al., 1997, Mol. Cell. Biochem. 174).
: 261-269), MLP-deficient mice (Arber et al., 1997, Cell
88: 393-403), and adenine nucleotide translocator I.
Type-knockout mice (Graham et al., 1997, Nat. Genet. 1
6: 226-234). The relationship of cardiomyopathy to heart disease in general in these models is described in Christensen et al., 1997, Am. J. Physio
l. 272: H2513-H2524.

Diabetes In yet another embodiment of the present invention, the β-APP: HsLON complex is administered to a subject to treat or prevent diabetes in the subject. HsLON is
It is involved in the development of maternally inherited diabetes. Therefore, β-APP: HsLO
N complex or its or a derivative thereof, homolog, analog or fragment, nucleic acid molecule encoding β-APP and HsLON protein, anti-β-APP
: HsLON antibodies, and other modulators of β-APP: HsLON complex activity or formation may be tested for activity in treating or preventing diabetes in in vitro and in vivo assays.

In one embodiment, the “therapeutic agent” of the present invention comprises the steps of contacting a cultured cell exhibiting an indicator of diabetes in vitro with the “therapeutic agent” and in the cells contacted with the “therapeutic agent”. Comparing the level of the indicator with the level of the indicator in cells that have not so contacted, wherein the lower level in the contacted cells indicates that the "therapeutic agent" has diabetes or its It can be assayed by a step showing that it has activity in treating or preventing sequelae. Detailed examples of such cultured models of diabetes include, but are not limited to, cultured rat endothelial cells from diseased and unaffected individuals (Bazan et al., 1997, Therapy 5).
2: 447-451), cultured antigen-specific lymphocytes from TCR-HA transgenic mice (Sarughan et al., 1998, EMBO J. 17:
71-80), DAP. 3Ag7 transfected mouse fibroblast cell line (Nab
Avieh et al., 1998, J. Am. Autoimmun. 11: 63-71), and leukocyte cell isolates from affected and unaffected human individuals (Elhard et al., 199).
7, Q. J. M. 90: 461-464).

In another embodiment, the “therapeutic agent” of the invention is administered to a test animal exhibiting symptoms of diabetes for the activity in treating or preventing cardiomyopathy; and Measuring the change in the symptoms of the diabetes after administration of the "therapeutic agent", wherein the reduction in the severity of the symptoms, or prevention of diabetes, It can be assayed by a step showing that it has activity in treating or preventing. Such test animals can be any one of a number of animal models known in the art for diabetes, including, but not limited to, diabetic non-obese diabetic mice (Delovitch and Singh, 1
997 Immunity 7: 727-738), TCR-HA transgenic mice (Saroukhan et al., 1998, EMBO J. 17: 71-8).
0), IL-2 expressing transgenic mice (Elliot and Flave)
11, 1994. Int. Immunol. 6: 1629-1637), and NOS2-expressing transgenic mice (Takamura et al., 1998, J. Am.
Biol. Chem. 273: 2493-2496).

Hearing Loss In another specific embodiment of the invention, a β-APP: HsLON complex is administered to treat or prevent hearing loss. HsLON is used for hearing loss.
oss) and maternally inherited deafness. Thus, a β-APP: HsLON complex or a derivative or homologue, analog or fragment thereof, a nucleic acid molecule encoding β-APP and HsLON protein, an anti-β-APP: HsLON antibody, and a β-APP: Hs
Other modulators of LON complex activity or formation can be tested for activity in treating or preventing hearing loss in in vitro and in vivo assays.

In one embodiment, the “therapeutic agent” of the invention comprises the steps of contacting a cultured cell exhibiting an indicator of reduced function in vitro with the “therapeutic agent”, and the “therapeutic agent”.
Comparing the level of the indicator in cells that have been contacted with the level of the indicator in cells that have not so contacted, wherein the lower level in the contacted cells is the "therapeutic agent". "Has activity in treating or preventing hearing loss. Detailed examples of such cultured models of hearing loss include, without limitation, cultured sensory epithelia from the mammalian inner ear (
See Holley and Lawlor, 1997, Audiol. Neurooto
l. 2: 25-35), cultured auditory cortical neurons (Copal and Gr)
oss, 1996, Acta Otolaryngol (Stockh) 116
: 690-696), and cultured spiral ganglion neurons (Marzel
la et al., 1997, Neuroreport 8: 1641-1644).

In another embodiment, the therapeutic agent of the invention comprises administering the therapeutic agent to a test animal that has been previously treated to develop hearing loss and measuring a change in the hearing loss after administration of the therapeutic agent. May be assayed for activity in treating or preventing hearing loss, wherein reducing or preventing the severity of the symptoms of hearing loss indicates that the therapeutic agent has activity in treating or preventing hearing loss. Such test animals can be any of the many animal models known in the field of hearing loss. These models include mice (Steel and Brown, 1994, Trends Ge
net. 10: 428-435) and human (Hughes, 1997, Aud).
iol. Neurotol. 2: 3-11) Gene model of hearing loss, aminoglycoside ototoxicity in cats (Leake et al., 1997, Hear. Res. 113).
117-132), and Dalmatians congenital deafness (Nipar
Ko and Finger, 1997, Otolaryngol. Head Ne
ck Surg. 117: 229-235), but is not limited thereto.

Male Infertility In yet another specific embodiment of the present invention, the β-APP: HsLON complex is administered to treat or prevent male infertility. HsLON has been implicated in the development of male infertility. Thus, β-APP: HsLON complexes or their derivatives, homologs, analogs or fragments, β-APP and HsLO
Nucleic acid encoding N protein, anti-β-APP: HsLON antibody, and β-A
Other modulators of PP: HsLON complex activity or formation can be tested for activity in treating or preventing male infertility in in vitro and in vivo assays.

[0131] In one embodiment, the therapeutic agent of the invention comprises contacting the therapeutic agent with a cultured cell exhibiting an indicator of male infertility in vitro, and measuring the level of the indicator in the cells contacted with the therapeutic agent. By comparing the level of this indicator of cells that have not been contacted in this way, they can be assayed for activity in treating or preventing male infertility, wherein the lower level of the contacted cells is Indicate that the therapeutic agent has activity in treating or preventing male infertility. Specific examples of such cultured models for male infertility include spermatogenic cell cultures from affected and unaffected individuals (Blanchard et al., 1991, M.P.
ol. Reprod. Dev. 30: 275-282), cultured Leydig cells and macrophages from a rat study (Dirami et al., 1991, J.
. Endocrinol. 130: 357-365), as well as cultured mammalian Sertoli cells (Syed et al., 1997, J. Androl. 18: 2).
64-273), but not limited thereto.

In another embodiment, a therapeutic agent of the invention comprises administering a therapeutic agent to a test animal with infertility and measuring male infertility by measuring a change in male infertility symptoms following administration of the therapeutic agent. Can be assayed for activity in treating or preventing,
Here, reducing the severity of symptoms of male infertility or preventing symptoms indicates that the therapeutic agent has activity in treating or preventing male infertility. Such test animals are:
It can be any of a number of animals known in the art of male infertility, including t
Haplotype expressing mice (Olds-Clarke, 1997, Rev.
Reprod. 2: 157-164), a testis transplant model of syngeneic neonates (J
Ohnson et al., 1997, Concept. Fertil. Sex 2
5: 549-555), Sertoli cell depleted rats (Orth et al., 1998).
Endocrinology 122: 787-794), old male brown-
Norway rats (Wang et al., 1993, Endocrinology 1)
33: 2733-2781) and hybrid infertile mouse Forejt, 19
96, Trends Genet. 12: 412-417), but is not limited thereto. The applicability of these animal models to future human therapeutics is described in Lamb and Niederberger, 1994, Urol. C
lin. North Am. 21: 377-387.

Disorders Associated with Mitochondrial DNA Mutation In certain embodiments of the invention, the β-APP: HsLON complex is administered to treat or prevent a disease or disorder associated with a mitochondrial DNA mutation. H
sLON has been implicated in many mitochondrial DNA mutation-related diseases or disorders. Furthermore, the association between neurodegeneration and mitochondrial dysfunction indicates that β-AP
P is also associated with mitochondrial disease. Therefore, β-APP: HsLON
Complex, nucleic acid encoding β-APP and HsLON protein, anti-β-AP
The P: HsLON antibody, and other modulators of β-APP: HsLON complex activity or formation, or derivatives, fragments, analogs or homologs thereof, inhibit diseases or disorders associated with mitochondrial DNA mutations in in vitro and in vivo assays. It can be tested for activity in treating or preventing.

In one embodiment, the therapeutic agent of the present invention comprises contacting the therapeutic agent in vitro with a cultured cell that is indicative of a disease or disorder associated with mitochondrial DNA mutation, and contacting the cell with the therapeutic agent. By comparing the level of this indicator to the level of this indicator in cells that have not so contacted, mitochondrial DNA
The assay may be assayed for activity in treating or preventing a disease or disorder associated with the mutation, wherein the lower level of the contacted cells indicates that the therapeutic agent has been treated or treated in a disease or disorder associated with a mitochondrial DNA mutation. It has activity in prevention. Particular examples of such cultured models for diseases or disorders associated with mitochondrial DNA mutations include cultured myotubes from muscles of individuals who do not and do not have mitochondrial myopathy (Colombet et al. 1996, Mol.Gen.Genet.253.
183-188), cultured human dermal fibroblasts (van de Corp.) from humans who do not have and have a disease associated with mtDNA deletion.
ut et al., 1997, J. Am. Histochem. Cytochem. 45: 55-
61), and cultured cell lines containing various mtDNA mutations (Spelbri
nk et al., 1997, Curr. Genet. 32: 115-124), but is not limited thereto.

In another embodiment, the therapeutic agent of the invention comprises mitochondrial DN by administering the therapeutic agent to a test animal having a condition associated with a mitochondrial DNA mutation.
A mutation can be assayed for activity in treating or preventing a disease or disorder associated with the A mutation, and measuring a change in the condition after administration of the therapeutic agent, wherein the change in the condition of the disease or disorder associated with the mitochondrial DNA mutation is A reduction in severity or prevention of symptoms indicates that the therapeutic agent is active in treating or preventing a disease or disorder associated with mitochondrial DNA mutation. Such test animals are:
It can be any of a number of animal models known in the art for diseases or disorders associated with mitochondrial DNA mutations. These models include liver, heart, and brain tissue from adult and aged rats (Gadaleta et al., 1992, Mu
t. Res. 275: 181-193), skeletal muscle tissue from adult and aged rhesus monkeys (Lee et al., 1993, J. Gerontol. 48: B201-B2).
05), as well as primate foreign body mitochondria (xenomitochondri)
al) Cyblit (Kenyon and Moraes, 1997, Pro.N.
atl. Acad. Sci. USA 94: 9131-9135), but are not limited thereto.

(Modulation of β-APP: HsLON complex activity) The present invention relates to the administration of a binding partner of a protein (or a derivative, fragment, analog or homolog thereof) capable of participating in the β-APP: HsLON complex. Doing so provides a methodology for modulating the level or activity of that protein moiety. β-APP (and its derivatives, fragments, analogs and homologs) can be combined with β-APP protein or β-APP.
An animal that contacts a cell with a nucleic acid encoding an antibody that immunospecifically binds APP or β-APP (or a derivative, fragment, analog, or homolog thereof containing an antibody binding domain), or that expresses the HsLON gene By measuring changes in HsLON levels or activity.
Can be assayed for its ability to modulate the activity or level of Hs
This change in LON level or activity indicates that the β-APP has the ability to regulate HsLON level or activity. In another embodiment, HsLONs (and their derivatives, fragments, analogs, and homologs) can be assayed for their ability to modulate β-APP activity or levels in a similar manner.

Protein-Protein Interaction Assay The present invention discloses a methodology for assaying and screening for derivatives, fragments, analogs and homologs of HsLON for binding to β-APP. Derivatives, fragments, analogs and homologs of HsLON that interact with β-APP have been developed using the yeast two-hybrid assay system (eg, Fie
lds and Song, 1989, Nature 340: 245-246) or; preferably, modifications and improvements thereof (Nandabalan).
Et al., U.S. Patent Application Serial No. 08 / 663,824 (June 14, 1996).
No. 08 / 874,825, filed June 13, 1997, which are incorporated herein by reference in their entirety. Can be done.

The identification of interacting proteins by the improved yeast two-hybrid system is based on the reporter gene (hereinafter “Reporter Gene”).
) Is based on transcription that depends on the reconstitution of the transcriptional regulator by the interaction of two proteins, each fused to half of the transcriptional regulator. Bait β-APP (or derivatives, fragments, analogs or homologs) and prey proteins (proteins that are tested for their ability to interact with bait proteins) bind to the DNA binding domain and to regulate transcription. Each domain is expressed as a fusion protein or vice versa. In certain embodiments of the invention, the play population is HsLON
One or more nucleic acids (eg, by site-directed mutagenesis,
Or as produced by another method that produces mutations in the nucleotide sequence). A prey population is a protein encoded by DNA (eg, cDNA, genomic DNA or synthetically generated DNA), and the DN derived from either a particular gene of choice or a cDNA library.
A is obtained from the cell type of interest. For example, this population contains cD from mammalian RNA.
It can be expressed from a chimeric gene containing cDNA sequences from an uncharacterized sample of the population of NA. In another specific embodiment, a recombinant biological library expressing random peptides can be used as a source of prey nucleic acids.

The present invention discloses a method for screening for inhibitors of HsLON. Briefly, protein-protein interaction assays can be performed as previously described herein, except that they are performed in the presence of one or more candidate molecules. The resulting change in the level of Reporter Gene activity relative to the level present when one or more candidate molecules are absent indicates that the candidate molecules affect the interacting pair. In a preferred embodiment, inhibition of protein interaction is defined as, for example, when non-attenuated protein interaction causes activation of the URA3 gene and the yeast dies in a medium containing the chemical 5-fluoroorotic acid. Necessary for cells to survive. For example, Ro
thstein, 1983. Meth. Enzymol. 101: 167-18
See 0.

Generally, proteins comprising bait and prey populations are provided as fusion (chimeric) proteins, preferably by recombinant expression of a chimeric coding sequence comprising each protein contiguous to a preselected sequence. For one population, the preselected sequence is a DNA-binding domain, which can be any DNA-binding domain, so long as it specifically recognizes the DNA sequence in a promoter (eg, a transcriptional activator or inhibitor). For other populations, the preselected sequence is an activator or inhibitor domain of a transcriptional activator or inhibitor, respectively. The regulatory domain alone (not as a fusion to the protein sequence) and the DNA-binding domain alone (not as a fusion to the protein sequence) preferably do not detectably interact to avoid false positives in the assay. The assay system further includes a reporter gene operably linked to a promoter that includes a binding site for the DNA-binding domain of the transcription activator (or inhibitor). Thus, in the practice of the present invention, the binding of the β-APP fusion protein to the prey fusion protein is
Leads to the reconstitution of the transcriptional activator (or inhibitor), which
The expression of ter Gene is changed simultaneously.

[0141] In certain embodiments, the present invention discloses a methodology for detecting one or more protein-protein interactions comprising the following steps: (i) a first mating type yeast cell; Recombinantly expressing β-APP (or a derivative, fragment, analog or homolog thereof) in a population and having a first fusion protein comprising a β-APP sequence and a DNA binding domain, wherein: The first population of yeast cells includes a first nucleotide sequence operably linked to a promoter, which is "driven" by one or more DNA binding sites recognized by the DNA binding domain. As a result, the interaction between the first fusion protein and the second fusion protein (including the transcription activation domain) is
(Ii) negatively selecting to eliminate these yeast cells in said first population, wherein said increased transcription of said first nucleotide sequence results in increased transcription of said nucleotide sequence. Occurs in the absence of the second fusion protein; (iii) providing a plurality of the second fusion proteins in a second population of yeast cells of a second mating type different from the first mating type. Wherein the second fusion protein comprises a derivative, fragment, analog or homolog sequence of HsLON, and an activation domain of a transcriptional activator, wherein the activation domain is (Iv) crossing a first population of said yeast cells with a second population of said yeast cells, wherein said step is the same in each of said second fusion proteins; And forming a third population of oocytes, wherein the third population of the diploid yeast cells, is recognized by the DNA binding domain D
A second nucleotide sequence operably linked to a promoter that is “driven” by the NA binding site such that the interaction of the first and second fusion proteins results in increased transcription of the second nucleotide sequence. And wherein the first and second nucleotide sequences can be the same or different; and (v) detecting the increased transcription of the first and / or second nucleotide sequences, thereby Detecting an interaction between the fusion protein and a second fusion protein.

In a preferred embodiment, the bait (β-APP sequence) and prey (library of chimeric genes) are combined by mating the two yeast strains on solid medium for about 6-8 hours. In a less preferred embodiment, the crossing is performed in a liquid medium. The resulting diploid contains both types of chimeric genes (ie, DNA
Binding domain fusion and activation domain fusion). After an interaction population has been obtained, DNA sequences encoding pairs of interaction proteins are isolated by a method in which either a DNA binding domain hybrid or an activation domain hybrid is amplified in a separate reaction. Preferably, the amplification utilizes a pair of oligonucleotide primers specific for either the DNA binding domain hybrid or the activation domain hybrid, the polymerase chain reaction (PC
R; for example, Innis et al., 1990. PCR PROTOCOLS, Acad
emic Press, Inc. , San Diego, CA). The PCR amplification reaction also involves pooling cells expressing interacting protein pairs,
Preferably, it can be performed on a pooled array of interactants. Other amplification methods known in the art may also be used, including, but not limited to, ligase chain reaction, QB-replicase, and the like. For example, Kricka et al., 1995
. MOLECULAR PROBING, BLOTTING, AND SEQU
ENCING, Academic Press, New York, NY. checking ...

In a further embodiment of the present invention, the plasmid encoding the DNA binding domain hybrid and the activation domain hybrid protein can also be isolated and cloned by any method well known in the art. When a shuttle vector (eg, yeast to E. coli) is used to express the fusion protein, for example, but not limited to, the gene can be used to transform yeast DNA into E. coli. E. coli and can be substantially recovered by recovering the plasmid from the bacteria. See, for example, Hoffman et al., 1987, Gene 57: 267-272.
checking ...

Pharmaceutical Compositions The present invention provides methods of treatment and prevention by administering to a subject a pharmaceutically effective amount of a therapeutic agent of the present invention. In a preferred embodiment, the therapeutic is substantially pure and the subject is a mammal, most preferably a human.

[0145] Formulations and methods of administration that can be used when the therapeutic agent contains a nucleic acid are described above. A variety of delivery systems are known and can be used to administer the therapeutics of the invention, including but not limited to: (i) encapsulation in liposomes, microparticles, microcapsules; (Ii) a recombinant cell capable of expressing a therapeutic agent; (iii) receptor-mediated endocytosis (eg, Wu and W
u, 1987. J. Biol. Chem. 262: 4429-4432); (iv) Construction of therapeutic nucleic acids as part of a retrovirus or other vector.

[0146] Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural and oral routes. The therapeutics of the invention may be administered by any convenient route (eg, by injection or bolus injection), by absorption through epithelial or mucosal skin (eg, oral mucosa, rectal and intestinal mucosa, etc.). Can be administered with other biologically active agents. Administration can be systemic or local. In addition, it may be advantageous to administer the therapeutic agent to the central nervous system by any suitable route, including intraventricular and intrathecal injection. Intraventricular injection may be facilitated by an intraventricular catheter mounted in a reservoir (eg, an Ommaya reservoir). Pulmonary administration can also be employed by use of a respiratory or nebulizer, as well as by formulation with an aerosol. It may also be desirable to administer the therapeutic locally to the area in need of treatment. This can be accomplished, for example, but not limited to, using intraoperative local injections, topical applications, injections, the use of catheters, the use of suppositories, or implantation. In certain embodiments, administration may be by direct injection into the site of the malignancy or neoplasia or pre-neoplastic tissue (or the former site).

[0147] In another embodiment of the present invention, the therapeutic agent may be delivered in the form of vesicles, especially liposomes. See, for example, Langer, 1990. Science 249: 152
See 7-1533. In yet another embodiment, the therapeutic agent can be delivered in a controlled release system, including, but not limited to: a delivery pump (eg, Saudek et al., 1989. New Engl. JM).
ed. 321: 574) and semi-permeable polymer materials (eg, H
Oward et al., 1989. J. Neuroswg. 71: 105)
. In addition, controlled release systems can be placed in close proximity to the therapeutic target (eg, the brain) and thus require only a small systemic dose rate. For example, Good
son. In: MEDICAL APPLICATIONS OF CONTR
OLLED RELEASE. CRC Press, Bocca Raton,
See FL (1984).

In certain embodiments, where the therapeutic agent is a nucleic acid that encodes a protein, the therapeutic agent nucleic acid is constructed by constructing the protein as part of a suitable nucleic acid expression vector and administering the nucleic acid intracellularly. (Eg, retroviral vectors, direct injection, use of microparticle bombardment, contact with lipids or cell surface receptors or transfection agents, or administration of transfection agents conjugated to a homeobox-like peptide known to enter the nucleus. (See, eg, Joliot et al., 1991. Proc. Nat.
l. Acad. Sci. USA 88: 1864-1868), and the like, to enhance expression of the nucleic acid-encoded protein in vivo. Alternatively, the nucleic acid therapeutic is introduced intracellularly and the host cell DN for expression.
A can be incorporated, for example, by homologous recombination.

[0149] The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of a therapeutic, and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable” is recognized by a United States or state government agency or by the U.S.A. S. Meaning is described for use in mammals, more preferably humans, in the Pharmacopoeia or other accepted pharmacopeias. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered and includes, but is not limited to, sterile liquids such as water and oils.

The amount of a therapeutic agent of the invention effective for the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by one skilled in the art by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the overall severity of the disease or disorder, and must be decided according to the practitioner and each patient's circumstances. However, suitable dosage ranges for intravenous administration of the therapeutic agents herein are generally about 20-500 micrograms (μg) of active compound per kilogram (kg) of body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 picogram (pg) / kg body weight to 1 milligram (mg) / kg body weight. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems. Suppositories generally contain active ingredient in the range of 0.5% to 10% by weight; oral formulations preferably contain 10% to 95% active ingredient.

The invention also provides a pharmaceutical pack or kit comprising one or more components of a pharmaceutical composition and one or more containers filled with a therapeutic agent of the invention. Precautions in the form prescribed by governmental agencies that regulate the manufacture, use or sale of pharmaceutical or biological products may, where appropriate, relate to such container (s), which may be relevant to human administration Indicates the approval of a manufacturing, use or sales organization for

Specific Examples Example 1: Identification and Specificity of β-APP: HsLON Interactions A modified and improved yeast two-hybrid system is used to identify protein interactions for the neuronal protein product β-APP. Was used to identify
Yeast is eukaryotic, so any intermolecular protein interactions detected in this system are likely to occur under the physiological conditions found in mammalian cells (
Chien et al., 1991, Proc. Natl. Acad. Sci. USA 8
8: 9578-9581). An expression vector was constructed to encode the two-hybrid protein. One hybrid consists of the DNA binding domain of the yeast transcriptional activator Gal4 fused to a predetermined "bait" polypeptide. The other hybrid is a "play" encoded by a mammalian cDNA library.
Consists of a Gal4 activator domain fused to a polypeptide sequence. In the "reverse" screen, the bait is fused to the activation domain and the prey is
Fuse with the binding domain, otherwise the assay is performed similarly. In a matrix-mating assay, β-APP, HsLON and other proteins were inserted into complementary (a and α) mating types of yeast using methods known in the art. Crosses were made so that both vector constructs were expressed in the same yeast cell and thus an interaction occurred. Interactions between the domains are cis-
This results in transcriptional activation of the reporter gene containing the binding element. The indicator protein, a reporter gene encoding β-galactosidase, and metabolic markers for uracil and histidine auxotrophy were included in a specific manner in one of the yeast strains used for mating. Thus, the yeast
Selected for successful crosses, expression of both fusion constructs and expression of β-APP interacting protein, and interaction of both fusion proteins.

The HsLON cDNA was converted to 3.5 × 10 ⁶ independent isolates of commercial fetal brain cD.
NA Library (Clontech # HL4029AH, Palo Alto
, CA). This library contains pACT2 (a yeast G cloning vector containing the LEU2 gene for selection of yeast deficient during leucine biosynthesis).
the al4 activation domain) were directionally cloned, synthesized from Xho1-dT ₁₅ primed fetal brain mRNA (from 5 fetuses male / female 19-22 weeks).

The interaction of the prey cDNA product was determined by using 18 bait
) Tested against an array of proteins. One of these proteins is encoded by the β-APP gene sequence from nucleotides 1935 to 2060, which encodes β-APP ₆₉₅ residues 597-638 and the 42 residue peptide β-A4 (
42). The bait fragment is transferred to Clontech pA
From the CT2 library (Clontech, Palo Alto, CA), the forward primer 5'GATGCAGAATTCCGACATGACTCAG3 '
(SEQ ID NO: 5) and reverse primer 5′ATGGTGGGCGGGTGTT
Amplified by standard techniques using the polymerase chain reaction using GTCATAGCG 3 '(SEQ ID NO: 6). This fragment was cloned into the SfiI site of the vector pAS-SfiI, which was constructed by introducing an SfiI-containing polylinker into the vector pAS2-1 (Clontech, Palo Alto, CA). This vector is a yeast DNA binding domain cloning vector containing the TRPI gene for selection in yeast strains deficient in tryptophan biosynthesis. The bait sequence was confirmed by nucleic acid sequencing to confirm that the PCR amplification had reproduced an exact copy of the β-APP sequence (FIG. 1, SEQ ID NO: 1). This test determined, as expected, that the bait sequence encoded the same interaction domain as the human β-A4 peptide of 42 amino acids.

Example 2: Test for specificity of β-APP: HsLON interaction β-APP was transformed with lithium acetate / polyethylene glycol (Ito et al.,
1983, J.A. Bacteriol. 153: 163-168), the yeast strain N106 '(zygous a, ura3, his3, ade2, trp1, leu2).
, Gal4, gal80, cyh ', Lys2 :: GALI _UAS- HIS3 _TATA
-HIS3, ura3 :: GALI _UAS -GAL _TATA -lacZ), but the HsLON coding sequence was transformed into the yeast strain YULH (conjugated alpha, ura3,
his3, lys2, trp1, leu2, gal4, gal80, GALI-
URA3). The two transformed populations are then combined using standard methods in the art (Sherman et al., Eds. 1991, GETTING STA).
RTED WITH YEAST, Volume 194, Acadimitic Press,
(New York). Briefly, cells were grown on media from mid- to late-log phase and selected for the presence of the appropriate plasmid. The two conjugates, alpha and a, were then diluted in YAPD medium, filtered through a nitrocellulose filter, and incubated at 30 ° C. for 6-8 hours. These cells are then selected for expression of the desired diploid, a yeast having a reporter gene for β-galactosidase, uracil auxotrophy, and histidine auxotrophy, and bait and prey-encoding vectors. To a different medium. The conjugation products were adenine and lysine (to select for successful conjugation), leucine and tryptophan (to select for expression of the genes encoded by both plasmids), and uracil and histidine (to determine protein interactions). SC (synthetic complete) lacking (to select) (Sambro
Ok et al., 1989, A Laboratory Manual, Second Edition, Col.
d Spring Harbor Press. (New York) medium. This medium is referred to herein as the SCS medium relative to the SC selective medium.

Selected clones were tested for β-galactosidase expression to confirm β-APP: HsLON complex formation. Filter-lift (fi
l-lift) β-galactosidase assay was performed according to Breeden and Nasmyth, 1985, Cold Spring Harbor Quant.
t. Biol. 50: 643-650 with modifications. Colony S
Patched on CS plates, grown overnight, and plated on nitrocellulose filters in replica fashion. This filter was then combined with Breeden and Nasmyth, 1985, Cold Spring Harbor Qu.
ant. Biol. Assay for β-galactosidase activity by 50: 643-650. Positive colonies became clear blue.

To test for the specificity of the β-APP: HsLON interaction, two general tests were first performed. First, YULH cells expressing HsLON were created, plated on SC-Ura plates, grown for 1-2 days, and tested for growth. No growth is seen for HsLON, which is not a “self-activating” protein, ie, HsLON is
It was determined that it required an interaction with the second protein domain. Secondly,
The plasmid containing the β-APP insert was transformed into strain N106 ′ (conjugated alpha) and using yeast strain YULH (conjugated a) expressing either CDK2, HsLON, or other specific proteins. And joined. Promiscuous binder,
That is, insertion products that can bind to many other proteins in a non-specific manner are non-C
Interacts non-specifically with the DK2 domain and is discarded as a non-specific interactor. As shown in FIG. 3, the intersection of the column of β-APP and the row of HsLON is
Indicate proliferation (box A) (ie positive interaction). In contrast, the intersection of the β-APP column with the row for P1-P5 and the intersection of the HsLON row with the column for B1-B6 indicate no proliferation, ie, no protein interaction. These data demonstrate the specificity of the β-APP: HsLON interaction.

The present invention is not limited in scope by the specific embodiments described herein.
Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. This modification is intended to be within the scope of the appended claims.

Various publications are cited herein, the disclosures of which are incorporated by reference in their entirety.

Equivalents The foregoing detailed description of certain embodiments of the invention has described unique compositions and methods of use for β-APP, HsLON, and the β-APP: HsLON complex. That should be clear. Certain embodiments are described herein.
Although disclosed in detail, this is done by way of example only, and is not intended to be limiting on the appended claims. In particular,
It is contemplated by the inventors that various substitutions, modifications and improvements can be made to the present invention without departing from the spirit and scope of the invention as defined by the claims. For example, β-APP, HsLON and β-APP:
The selection of disease states for which the HsLON complex provides utility through diagnosis, screening, treatment of various diseases and disorders is a matter of routine for those skilled in the art, with an understanding of the embodiments described herein. it is conceivable that.

[Brief description of the drawings]

FIG. 1 is the nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of β-APP (GenBank Accession No. A02759). The coding sequence starting at base 1935 (amino acid 597) marked by arrow A and ending at base 2060 (amino acid 638) marked by arrow B was used as bait in the assay described above.

FIG. 2 is the nucleotide sequence (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of human HsLON (GenBank Accession No. X74215). The 5 ′ start site of the identified prey sequence is at base 2 marked by arrow A.
194 (amino acid 721).

FIG. 3 is a demonstration of the specificity of the β-APP: HsLON interaction. Positive interactions for bait and prey proteins are indicated as "+" in the box (forming an interaction between a particular bait protein and prey protein), and lack of interaction is indicated by "-". . Intersection of the β-APP column with the HsLON row indicates proliferation (box A) (ie, positive interaction). In contrast,
Interaction of β-APP column with rows for P1-5, and HsLON rows and B
Interactions with the columns for 1-B6 indicate non-proliferation (ie, no protein interaction). These data demonstrate the specificity of the β-APP: HsLON interaction.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 3/10 A61P 15/00 4H045 9/00 25/00 15/00 43/00 25/00 111 43 / 00 C07K 14/47 ZNA 111 16/18 C07K 14/47 ZNA 19/00 16/18 C12N 1/15 19/00 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 C12N 15/00 A 5/10 A61K 37/02 C12P 21/02 C12N 5/00 A (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE , IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP ( GH, GM, KE, LS, MW, S D, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG , BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD , SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Jan, Meijia United States Connecticut 06333, East Lime, Catbird Lane 6 (72) Inventor Schulz, Bi St. Peter United States Connecticut 06443, Madison, Old Farms Road 21F Term (Reference) 4B024 AA01 AA11 CA04 CA09 DA12 EA04 GA11 HA01 HA12 4B064 AG01 CA06 CA19 CC24 DA01 DA13 4B065 AA93Y 4C084 AA02 AA06 AA13 ZA01 ZA35 CA31 MAA ZA341 ZA361 ZA811 ZC351 4C085 AA13 AA16 BB11 CC04 DD22 DD23 EE01 EE06 FF24 GG01 4H045 AA10 AA11 AA20 AA30 BA10 BA41 CA45 DA83 EA21 EA26 EA50 FA74

Claims (64)

[Claims] 1. A purified complex of β-APP and HsLON. 2. The purified conjugate according to claim 1, wherein said protein is a human protein. 3. A complex of β-APP derivative and HsLON, a complex of β-APP and HsLON derivative, and a complex of β-APP derivative and HsLON derivative. A purified complex, wherein the β-A
A purified complex, wherein a derivative of PP is capable of forming a complex with wild-type HsLON, and wherein the derivative of HsLON is capable of forming a complex with wild-type β-APP. 4. The purified conjugate of claim 3, wherein said β-APP or HsLON derivative is fluorescently labeled. 5. A β-APP of at least 6 amino acids fused via a covalent bond to a fragment of HsLON of at least 6 amino acids
A chimeric protein comprising a fragment of 6. The chimeric protein according to claim 5, wherein the β-AP
The chimeric protein, wherein the fragment of P is a fragment capable of binding to HsLON, and the fragment of HsLON is a fragment capable of binding to β-APP. 7. The chimeric protein of claim 6, wherein the fragment of β-APP and the fragment of HsLON form a β-APP: HsLON complex. 8. An antibody that immunospecifically binds to the complex or the antibody fragment or derivative containing the antibody binding domain according to claim 1. 9. The antibody of claim 8, wherein the antibody does not immunospecifically bind to β-APP or HsLON that is not part of a β-APP: HsLON complex. 10. A nucleotide sequence encoding β-APP and HsLO
An isolated nucleic acid or combination of isolated nucleic acids comprising a nucleotide sequence encoding N. 11. The isolated nucleic acid according to claim 10, which is a nucleic acid vector, or a combination of isolated nucleic acids. 12. The isolated nucleic acid or isolated nucleic acid combination of claim 11, wherein said β-APP coding sequence and HsLON coding sequence are operably linked to a promoter. 13. An isolated nucleic acid comprising a nucleotide sequence encoding the chimeric protein of claim 7. 14. A cell comprising the nucleic acid of claim 10, wherein the nucleic acid is recombinant. 15. A cell comprising the nucleic acid of claim 12, wherein the nucleic acid is recombinant. 16. A recombinant cell comprising the nucleic acid according to claim 15, wherein the nucleic acid is recombinant. 17. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the conjugate of claim 1, and a pharmaceutically acceptable carrier. 18. The pharmaceutical composition according to claim 17, wherein said protein is a human protein. 19. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the conjugate of claim 3, and a pharmaceutically acceptable carrier. 20. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the chimeric protein of claim 5, and a pharmaceutically acceptable carrier. 21. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the chimeric protein of claim 6, and a pharmaceutically acceptable carrier. 22. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the antibody or antibody fragment or derivative comprising the antibody binding domain of claim 8, and a pharmaceutically acceptable carrier. 23. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the antibody or antibody fragment or derivative comprising the antibody binding domain of claim 9, and a pharmaceutically acceptable carrier. 24. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of a nucleic acid or combination of nucleic acids of claim 10 and a pharmaceutically acceptable carrier. 25. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the isolated nucleic acid of claim 13, and a pharmaceutically acceptable carrier. 26. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the recombinant cell of claim 14, and a pharmaceutically acceptable carrier. 27. A pharmaceutical composition comprising a therapeutically or prophylactically effective amount of the protein of claim 15, and a pharmaceutically acceptable carrier. 28. A method for producing a complex of β-APP and HsLON, the method comprising growing a recombinant cell containing the nucleic acid according to claim 10 and encoding the encoded β-APP and HsLON. A method comprising the steps of expressing the HsLON protein and binding to each other, and collecting the expressed complex of β-APP and HsLON. 29. An abnormal level of β-APP and HsLON in a subject
A method for diagnosing or screening for the presence of a disease or disorder characterized by a complex with or a predisposition to produce them, the method comprising the steps of: R encoding HsLON
Measuring the level of NA or the functional activity of the complex, wherein the complex is found in a similar sample without the disease or disorder or a predisposition to develop the disease or disorder; R encoding the β-APP and HsLON
Increasing or decreasing the level of the complex, the RNA encoding the β-APP and HsLON, or the level of functional activity of the complex in the sample, as compared to the level of NA, or the functional activity of the complex. Indicates the presence of the disease or disorder or a predisposition to cause them. 30. A complex of β-APP and HsLON, an antibody against the complex, a nucleic acid probe capable of hybridizing to β-APP RNA and HsLON RNA, or amplification of at least a part of β-APP gene and HsLON gene A kit comprising a substance selected from the group consisting of a pair of nucleic acid primers capable of priming in one or more containers. 31. An abnormal level of β-APP and HsLON in a subject
A method of treating or preventing a disease or disorder comprising a complex with a subject, the method comprising providing a subject in whom such treatment or prevention is desired with a therapeutically effective amount of a molecule that alters the function of the complex. Administering one or more. 32. The method of claim 31, wherein said disease or disorder includes reduced levels of said complex, and said molecule (s) is β-A
Promotes the function of the complex of PP and HsLON, and β-APP and HsLON
A complex with β-APP, wherein the complex is more stable and active than the wild-type complex
Or analog of a complex of HsLON and HsLON; nucleic acid encoding β-APP and HsLON protein; and derivatives or analogs of β-APP and HsLON forming a complex that is more stable and active than the wild-type complex A method selected from the group consisting of nucleic acids encoding 33. The method of claim 31, wherein said disease or disorder comprises increased levels of said complex, and said molecule (s) inhibits the function of said complex, and Selected from the group consisting of an antibody to the complex or a fragment or derivative thereof comprising a binding region thereof; β-APP and HsLON antisense nucleic acids; and a nucleic acid comprising at least a part of the β-APP and HsLON genes. The heterologous nucleotide sequence is inserted such that the heterologous nucleotide sequence inactivates at least a portion of the biological activity of the β-APP and HsLON genes, wherein the β-APP and HsLON gene portions are Flanking the heterologous sequence to promote homologous recombination with the APP and HsLON genes That, way. 34. A method of treating or preventing a disease or disorder comprising abnormal levels of HsLON in a subject, said method altering the function of HsLON in a subject in whom such treatment or prevention is desired. Administering a therapeutically effective amount of the molecule. 35. The method of claim 34, wherein said disease or disorder comprises reduced levels of HsLON, and said molecule promotes the function of HsLON, and binds said HsLON protein; β-APP. Hs active in
A derivative or analog of LON; a nucleic acid encoding HsLON;
A method selected from the group consisting of nucleic acids encoding a derivative or analog of HsLON that is active in binding PP. 36. The method of claim 34, wherein said disease or disorder comprises increased levels of HsLON and said molecule inhibits the function of HsLON and comprises an anti-HsLON antibody or binding region thereof. A fragment or derivative thereof; an antisense nucleic acid of HsLON; and a nucleic acid comprising at least a portion of an HsLON gene, wherein the heterologous nucleotide sequence is an organism of the HsLON gene wherein the heterologous nucleotide sequence is at least a portion thereof The HsLON gene portion is flanked by the heterologous sequence to promote homologous recombination with the genomic HsLON gene. 37. A method of treating or preventing a disease or disorder comprising abnormal levels of β-APP in a subject, the method comprising: administering to a subject in whom such treatment or prevention is desired, β-APP. Administering a therapeutically effective amount of a molecule that alters the function of a. 38. The method of claim 37, wherein said disease or disorder comprises reduced levels of β-APP, and wherein said molecule promotes β-APP function and said β-APP protein. Β- active in binding HsLON;
Derivatives or analogs of APP; nucleic acids encoding β-APP; and HsL
A method selected from the group consisting of nucleic acids encoding derivatives or analogs of β-APP that are active in binding ON. 39. The method of claim 37, wherein said disease or disorder comprises increased levels of β-APP, and wherein said molecule inhibits β-APP function and an anti-β-APP antibody. Or a fragment or derivative thereof comprising the binding region thereof; an antisense nucleic acid of β-APP; and a nucleic acid comprising at least a portion of the β-APP gene, wherein the heterologous nucleotide sequence in the gene comprises the heterologous nucleotide sequence. Has been inserted to inactivate at least a portion of the biological activity of the β-APP gene, wherein the β-APP gene portion comprises
Flanking said heterologous sequence to promote homologous recombination at the genomic β-APP gene. 40. A method for screening a purified complex of β-APP and HsLON or a derivative of the complex, or a modulator of the activity of the complex, for activity in treating or preventing a neurodegenerative disease. So, the method is
Contacting a cultured cell exhibiting an indicator of a neurodegenerative disease in vitro with the complex, derivative or modifier, and contacting the level of the indicator in cells contacted with the complex, derivative or modifier. Comparing the level of the indicator in untouched cells, wherein the lower level in the contacted cells is such that the conjugate, derivative or modulator treats or prevents a neurodegenerative disease. A method of showing activity. 41. A β-protein for activity in treating or preventing cardiomyopathy.
A method for screening a purified complex of APP and HsLON or a derivative of the complex, or a modulator of the activity of the complex, comprising the steps of: Contacting the complex, derivative or modifier with the indicator, and comparing the level of the indicator in cells contacted with the complex, derivative or modifier with the level of the indicator in cells not contacted. A method wherein the lower level in the contacted cells indicates that the complex, derivative or modulator has activity in treating or preventing cardiomyopathy. 42. A beta-protein for activity in treating or preventing diabetes.
A method for screening a purified complex of APP and HsLON or a derivative of the complex, or a modulator of the activity of the complex, comprising the steps of: Contacting with the derivative or modifier, and comparing the level of the indicator in cells contacted with the complex, derivative or modifier with the level of the indicator in cells not contacted. Wherein the lower level in the contacted cells indicates that the complex, derivative or modulator has activity in treating or preventing diabetes. 43. The use of β for activity in treating or preventing hearing impairment.
A method of screening for a purified complex of APP and HsLON or a derivative of the complex, or a modulator of the activity of the complex, comprising the steps of: Contacting the complex, derivative or modifier, and comparing the level of the indicator in cells contacted with the complex, derivative or modifier to the level of the indicator in cells not contacted. Wherein the lower level in the contacted cells indicates that the complex, derivative or modulator has activity in treating or preventing hearing impairment. 44. For activity in treating or preventing male infertility,
A method for screening a purified complex of β-APP and HsLON or a derivative of the complex, or a modulator of the activity of the complex, comprising the steps of: Contacting said complex, derivative or modifier, and comparing the level of said indicator in cells contacted with said complex, derivative or modifier with the level of said indicator in cells not contacted Wherein the lower level in the contacted cells indicates that the complex, derivative or modulator has activity in treating or preventing male infertility. 45. Screening for a purified complex of β-APP and HsLON or a derivative of the complex, or a modulator of the activity of the complex, for activity in treating or preventing a DNA mutation-related disorder of mitochondria. Contacting a cultured cell showing an indicator of a mitochondrial DNA mutation-related disease in vitro with the complex, derivative or modifier, and contacting the complex, derivative or modifier with in vitro. The level of the indicator in the contacted cells;
Comparing the level of the indicator in a cell that has not been contacted, wherein the lower level in the contacted cell indicates that the complex, derivative or modulator has a mitochondrial DNA mutation-related disorder. A method showing activity in treating or preventing. 46. A method of screening for a molecule that directly or indirectly regulates the formation of a complex between β-APP and HsLON, the method comprising detecting the molecule under conditions that lead to the formation of the complex. Measuring the level of the complex formed from the β-APP and HsLON proteins in the presence of, and comparing the level of the complex with the level of the complex formed in the absence of the molecule A method wherein the lower or higher level of the complex in the presence of the molecule indicates that the molecule modulates the formation of the complex. 47. Both the endogenous β-APP gene and the endogenous HsLON gene have been deleted or inactivated by homologous recombination or insertion mutation of the animal or its ancestor. Recombinant non-human animal. 48. A recombinant non-human animal comprising both a β-APP gene and a HsLON gene, wherein the β-APP gene is under the control of a promoter that is not a native β-APP gene promoter, and The HsLON gene is under the control of a promoter that is not the native HsLON gene promoter;
Recombinant non-human animal. 49. A recombinant non-human animal comprising a transgene comprising a nucleic acid sequence encoding the chimeric protein according to claim 7. 50. An HsLON protein or a nucleic acid encoding the protein, an antibody that immunospecifically binds to the protein, or an antibody binding domain of the antibody, which is obtained by contacting the animal with a cell or expressing the β-APP gene. Modulate the activity or level of β-APP by administering a fragment or derivative of said antibody, including. 51. An animal which is brought into contact with cells or expresses a gene encoding the protein, to a β-APP, a nucleic acid encoding β-APP, or an antibody immunospecifically binding to β-APP. A method of modulating the activity or level of HsLON by administering a fragment or derivative of the antibody comprising the binding domain of the antibody. 52. β-A by contacting a cell or by administering a molecule that modulates the formation of said complex to an animal that expresses and forms said complex.
A method of modulating the activity or level of a complex between PP and HsLON. 53. β-APP or HsLON or β-APP and HsL
A method for identifying a molecule that modulates the activity of a complex with ON, the method comprising:
Contacting β-APP with one or more candidate molecules in the presence of LON, and measuring the amount of complex formed between β-APP and HsLON,
Here, an increase or decrease in the amount of the complex formed, as compared to the amount formed in the absence of the candidate molecule, is due to the fact that the molecule is associated with β-APP or HsLON or a complex of β-APP and HsLON. A modulating activity. 54. The method of claim 53, wherein said contacting is performed by administering said candidate molecule to a recombinant non-human animal of claim 49. 55. The method of claim 55, wherein said contacting is performed in vitro and β-APP, Hs
55. The method of claim 54, wherein LON and said candidate molecule are purified. 56. A method of screening for a derivative or analog of β-APP for biological activity, comprising: contacting said β-APP derivative or analog with HsLON; Detecting the formation of a complex between the derivative or analog of APP and HsLON, wherein detecting the formation of the complex means that the derivative or analog of β-APP has a biological activity The method. 57. A method of screening for a derivative or analog of HsLON for biological activity, comprising contacting the derivative or analog of HsLON with β-APP, and the derivative of HsLON. Or detecting the formation of a complex between the analog and β-APP, wherein detecting the formation of the complex indicates that the derivative or analog of HsLON has biological activity. Indicate the method. 58. An abnormal level of β-APP and HsLON in a subject
Monitoring the efficacy of the treatment of the disease or disorder, characterized by a complex with β-A, in a sample derived from the subject.
Measuring the level of functional activity of RNA encoding the PP and HsLON, or the complex, wherein the sample is taken from the subject after administration of the treatment, and (a) administering the treatment. Comparing said level of a sample previously taken from said subject or (b) a standard level associated with a pretreatment stage of said disease or disorder, wherein said complex in said sample taken prior to administration of said treatment Body, the β-APP
And the complex encoding the β-APP and HsLON in a sample taken after administration of the treatment, as compared to RNA encoding HsLON, or the level of functional activity of the complex or the standard level. A method wherein a change or no change in the level of RNA, or the functional activity of the complex, indicates whether the administration is effective in treating the disease or disorder. 59. A method for treating or preventing neurodegeneration in a subject, the method comprising providing a therapeutically effective amount of a complex of β-APP and HsLON to a subject in whom such treatment or prevention is desired. Administering a molecule that modulates function. 60. A method for treating or preventing cardiomyopathy in a subject, the method comprising providing a therapeutically effective amount of β to a subject in whom such treatment or prevention is desired.
-Administering a molecule that modulates the function of the complex between APP and HsLON,
Method. 61. A method of treating or preventing diabetes in a subject, the method comprising providing a therapeutically effective amount of β to a subject in whom such treatment or prevention is desired.
-Administering a molecule that modulates the function of the complex between APP and HsLON,
Method. 62. A method of treating or preventing hearing impairment in a subject, the method comprising providing a subject in whom such treatment or prevention is desired with a therapeutically effective amount of a complex of β-APP and HsLON. Administering a molecule that modulates function. 63. A method of treating or preventing male infertility or a related disorder in a subject, the method comprising providing a subject in whom such treatment or prevention is desired with a therapeutically effective amount of β-APP and HsLON. Administering a molecule that modulates the function of the complex with the method. 64. A method of treating or preventing a mitochondrial DNA mutation-related disease in a subject, comprising: treating a subject in whom such treatment or prevention is desired with a therapeutically effective amount of β-APP and HsLON. Administering a molecule that modulates the function of the conjugate.