JP2002516109A - Mycobacterial N-acetyltransferase - Google Patents

Abstract

  (57) [Summary] Described are arylamine N-acetyltransferase proteins from Mycobacterium tuberculosis, along with related gene production and antibodies raised against the protein, and Mycobacterium smegmatis. And methods for detecting mycobacteria using such antibodies and mycobacterial strains expressing or lacking such proteins. Also described is a method of screening for compounds that are ligands of an arylamine N-acetyltransferase protein, such as substrates and inhibitors, obtained from mycobacteria. Such ligands, examples of which can be used in medicaments for the treatment of mycobacterial infections or in anti-mycobacterial formulations, and can be designed by using a three-dimensionally structured protein of the invention. Methods for identifying nucleic acid sequences related to putative enzymes useful for or as targets for anti-mycobacterial drugs are also described.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[Introduction]

Arylamine N-acetyltransferases (NAT) include arylamine N-acetylation, N- and O-acetylation of arylhydroxyamines, N-O transfer of acetyl groups from acetylhydroxylamine, and N-acetyl of aromatic hydrazines. (1, 2). These substrates include pharmaceuticals (eg, isoniazid, hydrazine) and oncogenes (eg, aminofluorene). NAT is found in a wide variety of organisms, and enzymes form a characteristic family of proteins based on sequence similarity. Enzymes obtained from bacteria build a subpopulation of NAT enzymes based on sequence comparisons. All of the enzymes use acetyl-CoA as a cofactor in the acetylation reaction, and the reaction mechanism is to transfer the acetyl group to the active site sulfhydryl group in the protein, followed by the transfer of the acetyl group from the acetylated intermediate. It is believed to include transferring to an aromatic amine or hydrazine substrate.

[0002] Studies of activity measurements have shown that N-acetyltransferase activity in bacteria, initially referred to as N-hydroxyarylamine O-acetyltransferase (NhoA transferase) activity, is restricted to Salmonella typhimurium. It was originally thought to be. There is an interest in the activity of this bacterium as NAT activity has been shown to be associated with the susceptibility of S. difficulium strains when used as an indicator of mutagenesis in the Ames test.

When aligned with a NAT from eukaryotes for maximum similarity, NAT from S. difficulium is localized in the eukaryotic NAT, which is presumed to be a random coil. The corresponding 20 amino acid gap is shown. According to the structure estimation, each of the eukaryotic NAT and S. difficulium NAT has a N
Preferentially from the beta sheet in the C-terminal half, while having a loop at the C-terminal side between the two regions in eukaryotes that are alpha-helical in the terminal region and lost in S. difficile NAT It is suggested to be composed. The N-terminal portion of human NAT has been shown to catalyze the formation of the first step of the reaction to produce an acetylase intermediate, but does not transfer the acetyl group to the arylamine substrate. From this information and the sequence comparisons related to substrate specificity, it is clear that the C-terminal region, and in particular the C-terminal 20 amino acids, plays an important role in controlling substrate specificity.

[0004] Isoniazid is used to treat tuberculosis (TB). M. The molecular mechanism that makes tuberculosis highly sensitive to isoniazid has provided powerful targets, one of which has been crystallized, but how it works is not yet well established. Isoniazid is disclosed in M.S. It has been proposed to interfere with the synthesis of mycolic acid, a characteristic component of the cell wall of mycobacteria, including tuberculosis. It was thought to be an oxidation product of the activator isoniazid, and isoniazid resistance was accompanied by a mutation in katG (catalase-peroxidase gene). Other loci were associated with isoniazid resistance. Ahpc (alkyl hydroperoxide reductase) expression is thought to interfere with the action of activated isoniazid. Enoyl A in long chain fatty acid synthesis
Another protein, InhA, which catalyzes the NADH-specific reduction of CP has been proposed as another target for isoniazid. The drug does not appear to be binding to the InhA protein. Isoniazid resistance can only be partially explained by a recently identified strong cause.

[0005] We have found that the enzyme arylamine N-acetyltransferase (NAT)
But M. It is proposed to have a role in regulating the activity of isoniazid in tuberculosis. NAT protein itself or M.E. Mutations affecting any of the expression of the NAT protein in tuberculosis may modify NAT activity in isoniazid resistant strains.

[0006]

The present invention has determined that arylamine N-acetyltransferase (NAT) proteins are present in certain species of mycobacteria. They believe that certain species of mycobacteria, and the NAT protein of drug-resistant mycobacterial strains, contribute to inactivation by acetylation of several anti-mycobacterial agents. The inventors isolated genes encoding such enzymes, the recombinant enzymes produced by these genes, and the genes encoding antibodies raised against these recombinant enzymes and their component peptides. did. The use of these antibodies and enzymes will enable the discovery of new anti-mycobacterial compounds. In addition, the inventors have engineered both mycobacterial strains that express foreign NAT enzymes and strains that lack NAT function, and have developed model substrates for NAT enzymes that limit mycobacterial growth.

In one aspect, the invention relates to a Mycobacterium sp. Having a sequence fragment of FIG. 1 or a peptide fragment larger than 5 and preferably 10 amino acid residues adjacent thereto.
Provided is a tuberculosis arylamine N-acetyltransferase protein. The Mycobacterium tuberculosis arylamine N-acetyltransferase protein or peptide fragment thereof may exhibit a sequence modified from that shown in FIG. 1 such that the amino acid at position 207 is arginine instead of glycine. .

[0008] Further provided is a Mycobacterium having the amino acid sequence of FIG. 2, or a peptide fragment that is larger than its 5 adjacent amino acid residues, preferably larger than its 10 adjacent amino acid residues.・ Arylamine N of smegmatis
-An acetyltransferase protein.

The present invention relates to Mycobacterium tuberculosis or Mycobacterium
Also provided is a protein or fragment or polypeptide thereof comprising a mimetope of an epitope of a smegmatis arylamine N-acetyltransferase protein or fragment thereof.

[0010] The protein of the present invention and fragments and polypeptides thereof are characterized by arylamine N
-Recovered from cells of an organism expressing the acetyltransferase gene,
Alternatively, in an appropriate expression system and host, the arylamine N-
It can be generated by expression of the acetyltransferase gene or coding sequence, or obtained by de novo synthesis or a combination thereof, by techniques well known in the art of recombinant DNA technology. The proteins, fragments and polypeptides of the invention comprise a naturally occurring NL-α-amino acid and comprise D or L
-May also include one or more unnatural α-amino acids having a configuration.

[0011] Further contemplated by the invention are variants of the above proteins and fragments, eg, which exhibit at least 80% sequence identity with variants of the above proteins or fragments, eg, in one or more arrangements, wherein Variants that show conservative substitutions of one residue for those, and long proteins and peptides, including characteristic proteins or fragments as defined herein, wherein the long proteins or peptides have been obtained artificially.

Further provided is a Mycobacterium smegmatis arylamine N-acetyltransferase gene having the sequence of FIG. 2, or an oligonucleotide larger than eight, preferably at least 20, nucleotide residues adjacent thereto. It is a fragment.

[0013] The gene or oligonucleotide fragment may differ from the sequence of the arylamine N-acetyltransferase gene or oligonucleotide fragment due to alternative codon usage, and / or in a conservative or otherwise manner, select an amino acid sequence. Alternatively, it may have a sequence encoding a mimetope. Single-stranded DNA can be a transcribed strand or a non-transcribed (complementary) strand. The nucleic acid corresponding to the arylamine N-acetyltransferase gene or oligonucleotide fragment can be present in a vector such as a plasmid or cosmid or bacterial genomic nucleic acid, for example, a cloning or expression vector. RNAs of the invention include raw and processed transcripts of DNA, messenger RNA (mRNA) containing an arylamine N-acetyltransferase gene, and antisense containing sequences complementary to the arylamine N-acetyltransferase gene. RNA.

[0014] Nucleic acids encoding mycobacterial arylamine N-acetyltransferases are useful for the polymerase chain reaction (PCR) performed to ascertain the infectivity of certain strains of Mycobacterium to anti-mycobacterial agents. Considered a primer. If nucleotide differences in the NAT gene or the control region of the NAT gene are present between isoniazid resistant and sensitive strains, PCR methods, including the use of fluorescent primers for rapid screening, and restriction fragment length polymorphism (RFLP) The analysis can be used on tuberculosis (TB) isolates to drive the correct course of treatment.

Furthermore, contemplated by the present invention are variants of the above genes, or fragments having at least 80% sequence identity to the above genes and fragments; and long fragments comprising a characteristic gene or fragment as defined herein. The polynucleotide is a long polynucleotide as described above obtained by recombinant nucleic acid technology.

[0016] Further provided is encoding a hybrid protein comprising one or more genes or proteins of the invention, eg, an amino acid sequence found in two or more arylamine N-acetyltransferase proteins. Mycobacterial strains that have been transformed with one or more synthetic DNA constructs. Further provided is a mycobacterial strain transformed with a synthetic DNA construct that disrupts endogenous arylamine N-acetyltransferase activity.

In another aspect, the invention has been made to a Mycobacterium tuberculosis arylamine N-acetyltransferase protein having the sequence of FIG. 1, or a fragment larger than five of its adjacent amino acid residues. Provide an antibody. If at position 207 the amino acid is arginine instead of glycine, the arylamine N-acetyltransferase of Mycobacterium tuberculosis.
Antibodies raised against the protein or its peptide fragments also form part of the invention.

Further provided is an antibody raised against a Mycobacterium smegmatis arylamine N-acetyltransferase protein having the sequence of FIG. 2, or a fragment larger than the adjacent 5 amino acid residues thereof. .

Further provided is an antibody raised against a Salmonella typhimurium arylamine N-acetyltransferase protein having a sequence greater than the sequence of FIG. 3, or five of its adjacent amino acid residues.

The antibody provided by the present invention is a protein comprising the mimetope of an epitope of an arylamine N-acetyltransferase protein of Mycobacterium tuberculosis, Mycobacterium smegmatis or Salmonella typhimurium or a fragment thereof, or a protein thereof. This could be for fragments or polypeptides.

Expression and preferably secretion of chemically derived and recombinant fragments of such antibodies, and cells such as eukaryotic cells, for example, hybridomas, and antibodies and fragments thereof against such proteins or fragments Antibodies to such proteins and fragments, as well as fragments of such antibodies, including prokaryotic recombinant cells capable of transforming, the antibody fragments comprising at least one antigen-binding site, are described by the present invention. Form part of

Antibodies can be obtained by immunization of a suitable host animal and recovery of the antibody, by culture of antibody-producing cells obtained from the appropriately immunized host animal, or by the appropriate arylamine N-acetyltransferase protein, fragment, Or a polypeptide,
Alternatively, it can be obtained by in vitro stimulation of B cells using an arylamine N-acetyltransferase mimetope protein, fragment or polypeptide and culturing the cells. Such cells can be immortalized, if necessary, for example, by fusion with a melanoma cell. Antibodies can also be produced by "phage-display" techniques known in the art. Antibody fragments can be obtained by well-known chemical and biotechnological methods. All these techniques are well known to practitioners in biotechnology.

Further provided by the invention is a sample, eg, a biological sample,
For example, the use of the antibodies described herein to detect mycobacteria in those obtained from infected individuals. Further provided is provided a biological sample that has been treated to allow for the release of cytoplasmic components of mycobacteria present in the sample, wherein the treated sample is reacted against a mycobacterial arylamine N-acetyltransferase. Contacting the resulting one or more antibodies,
And a method for detecting mycobacteria in a sample, eg, a biological sample, comprising determining the binding of the antibody to one or more cytoplasmic components of the sample. The sample may be treated by sonication to release cytoplasmic components.

In another aspect, the invention relates to contacting one or more N-acetyltransferase proteins with one or more compounds to be screened for binding and detecting said binding. Provides a method of screening for a compound that binds to a mycobacterial N-acetyltransferase protein. Such compounds are produced by combinatorial or rational design methods as known in the art.

One such method provided provides for immobilizing one or more test compounds on a solid support and contacting an aliquot of N-acetyltransferase protein with the immobilized test compound. And removing unbound protein from the solid support and detecting the bound protein. The N-acetyltransferase protein used in the method is Mycobacterium tuberculosis,
It can be an arylamine N-acetyltransferase obtained from Mycobacterium smegmatis or Salmonella typhimurium, or a fragment thereof, or an N-acetyltransferase protein or fragment thereof obtained from a eukaryotic cell including human. If non-mycobacterial NAT proteins are used in the compound screen, the compounds can optionally be screened using mycobacterial NAT.

If the screened compound is known to bind to mycobacterial N-acetyltransferase, it is continuously tested for binding to human NAT1 or NAT2 or other eukaryotic NAT, eg, bovine or badger. Can. This immobilizes one or more screened compounds that bind to mycobacterial N-acetyltransferase on a solid support; an aliquot of human N-acetyltransferase protein is
Contacting the immobilized test compound; removing unbound protein from the solid support;
This can be by detecting the binding protein. In this particular method, detection of the binding protein can be by antibodies raised against the entire molecule, fragment, or polypeptide, including the mimetope of an epitope of human NAT protein.

[0027] If human NAT protein is not used in the screening method, detection of the binding protein in such a method can be performed using arylamines obtained from Mycobacterium tuberculosis, Mycobacterium smegmatis, or Salmonella typhimurium. • By antibodies raised against whole molecules, fragments, or polypeptides containing the mimetope of the epitope for N-acetyltransferase. Other methods of protein detection known in the art are envisaged, for example, the use of antibody fragments containing at least one epitope binding site, and other ELISA and fluorescence techniques.

In a preferred method, the compound to be screened is a substrate that is a substrate for NAT or a compound that modulates the enzymatic activity of NAT, such as an inhibitor, eg, aroma by a mycobacterial N-acetyltransferase protein. And those which are NAT ligands defined to include inhibitors of acetylation of family amines and hydrazine. More preferably, such compounds inhibit arylamine acetylation by the mycobacterial N-acetyltransferase protein. Most preferably, such compounds are ligands for the mycobacterial, but not the mammalian, N-acetyltransferase protein.

In another aspect, the present invention provides for the growth of Mycobacterium by contacting the Mycobacterium with a compound that is a ligand for an arylamine N-acetyltransferase protein expressed by the Mycobacterium. Provide a way to control. The ligand can be a substrate or inhibitor of an arylamine N-acetyltransferase. Methods for controlling the growth of mycobacteria include aromatic amines or hydrazines and arylamines expressed by the mycobacterium for the aromatic amines or hydrazines.
Contacting the Mycobacterium with a compound capable of reducing the activity of an acetyltransferase protein, such as a NAT ligand. Although other pathogenic mycobacterial species are envisaged, the preferred method according to the present invention is a Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium bovis or Mycobacterium abum.
rium avum). The aromatic amine or hydrazine and the inhibitor compound can be used separately or simultaneously for Mycobacterium.

The present invention, in another aspect, provides the use of a compound that is a NAT ligand in the manufacture of a medicament for the treatment of a mycobacterial infection. The ligand can be a substrate or inhibitor of mycobacterial arylamine N-acetyltransferase. The inhibitor can reduce the activity of the mycobacterial arylamine N-acetyltransferase protein against a second compound, which is an aromatic amine or hydrazine, and it can also be incorporated into a pharmaceutical.

Also provided is an anti-mycobacterial formulation comprising an effective concentration of a compound that is a ligand for a mycobacterial arylamine N-acetyltransferase protein. The ligand can be a substrate or inhibitor of mycobacterial arylamine N-acetyltransferase. An anti-mycobacterial formulation would be expected to have an effective concentration of an anti-mycobacterial aromatic amine or hydrazine and an effective concentration of an effective concentration capable of reducing the activity of the mycobacterial arylamine N-acetyltransferase protein. It is a mixture with a compound. A preferred anti-mycobacterial hydrazine is isoniazid, although other compounds such as ethionamide, dapsone or p-aminosalicylate are contemplated.

Further contemplated by the present invention are compounds that modulate the expression of NAT. Such compounds are screened using the antibodies and / or gene sequences of the present invention by methods known in the art to expose one or more NAT gene expressions by exposing the target Mycobacterium to a candidate molecule. Product levels can be monitored. Such compounds may be used in the manufacture of a medicament for the treatment of a mycobacterial infection, or may be included in an effective concentration in an anti-mycobacterial formulation.

Multiple isoforms of NAT have been found in many eukaryotes, including humans, chickens and mice. In humans, there are two isoforms, NAT1 and NAT2, which are 87% homologous in amino acid sequence, but show different tissue distribution and substrate specificity. NAT1 is widely distributed and uses p-aminobenzoic acid (pABA) and sulfamethoxazole as substrates. NAT2 has been shown to metabolize isoniazid (INH) and arylaminesulfonamide.

The cytosolic NAT enzymes all share high sequence identity and appear to be conserved throughout evolution. The conserved amino acid sequence described by the one-letter code as PFENL within the N-terminal region may be involved in substrate binding due to its capacity to make hydrophobic interactions with aromatic groups. When d is either Y or W, the RGGdC region in the N-terminal half of the molecule is also highly conserved. Using site-directed mutagenesis, a conserved cysteine in the RGGdC amino acid sequence found in all characterized NATs (C69 in Salmonella typhimurium) has been shown to be essential for activity. . Further, a variable C-terminal region may confer substrate specificity.

In another aspect, the invention encodes a protein sequence that exhibits at least 80% similarity to the following sequence: PFENL (X) _{n = 5-50} RGGdC, where d is W or Y By means of identifying the nucleotides or amino acids containing them, a putative enzyme that is a strong target for antimycobacterial drugs, or a putative enzyme useful for the synthesis of antimycobacterial drugs, is at least partially Methods for identifying an encoding nucleic acid sequence, or an amino acid sequence that at least partially encompasses it, are provided.

Preferably, the similarity is greater than 90%, most preferably greater than 95%.
In calculating the similarity between the sequence in question and a similar sequence, the identification of the intervening (X) _{n = 5-50} residues is not considered. Preferably, n is between 20 and 30, and more preferably, n is equal to 24 so that the first R residue is 29 residues C-terminal to the P residue. Using this method, sequences, such as those found in DNA, expressed sequence tags or protein databases, can be screened for NAT
A putative enzyme that closely resembles is identified. Such enzymes potentially share a similar acetylation function, and are thereby potentially useful as targets for anti-pneumonia drugs or for the synthesis of anti-mycobacterial drugs. Such a screening method can be performed using sequence analysis software known in the art.

The present invention provides one or more sense primers encoding the amino acid sequence PFENL, and one or more sense primers encoding the amino acid sequence RGGdC, wherein d is either W or Y. Using antisense primers,
By means of a primer extension reaction such as the polymerase chain reaction, a genomic or at least partially encoding a putative enzyme that is a primary target for an antimycobacterial drug, or a putative enzyme useful for the synthesis of an antimycobacterial drug. cDNA
Also provided are methods of isolating DNA sequences obtained from any of the following sources. The products of the primer extension reactions are sequentially labeled and treated with DNA by methods known in the art.
It can be used as a probe to screen libraries, genomes or cDNAs, and can be of the same organism as the source of template DNA used in the primer extension reaction. Ideally, a mixture of degraded sense primers and a mixture of degraded antisense primers, all containing the potential to encode a sequence for the amino acid sequence, are used in a primer extension reaction. As described using the IUPAC-IUB code, a possible primer mix is: sense primer: 5′CCNTTYGAARAAYYTN3 ′ antisense primer: 5′RCAVYANCCNCCCK3 ′.

“N” = A, T, G or C; “Y” = T or C; “R” = G or A;
K "= G or T; and" V "= A, G or C. More preferred mixtures of primers are similar in corresponding codon usage for the above amino acid sequences, or the same as used by the organism from which the template DNA is derived.

The present invention provides a mycobacterial arylamine N-acetyltransferase 3D structure for the design of compounds that can bind to the arylamine N-acetyltransferase protein described above by methods known in the art.
It also relates to the use of proteins. Further, the present invention provides for determining or deducing the structure of another arylamine N-acetyltransferase protein and for designing such compounds capable of binding to said another arylamine N-acetyltransferase protein. Mycobacterial arylamine N-acetyltransferase with a three-dimensional structure for utilizing the structural information obtained in
It relates to the use of proteins.

The present invention provides the following formula:

Embedded image Also provided is a compound that is a substrate for an arylamine N-acetyltransferase protein, wherein R = C ₁ -C ₂₀ alkyl.

Such compounds may be used as model substrates in screens for compounds that modify NAT activity, used in the manufacture of a medicament for the treatment of mycobacterial infections, or may be used at an effective concentration of anti-microbial agents. It can be included in mycobacterial formulations.

NAT catalyzes the classic ping-pong reaction. The first step involves the acetylation of the enzyme. Enzyme starting conditions may be based on a suitable arylamine substrate such as 4-aminoveratrol (4-AV), anisidine (ANS), p-aminosalicylic acid (PAS), dapsone or a hydrazine substrate such as isoniazid (INH) Is restored by the transfer of the acetyl group. Organisms that do not appear to possess NAT may use other enzymes to duplicate their activity. M. It is reasonable that any such activity by tuberculosis can affect INH efficacy by antagonizing the biological activity of INH. M. Tubaculosis and M. It is also important to identify differences in sensitivity to isoniazid among smegmatis.

Advances in sequencing the bacterial genome have illustrated that sequences homologous to NAT are present in a range of bacterial species. The inventors have described E. coli, B. et al. Subtilis (Bs
ubtilis) and M. A NAT-like sequence was found in tuberculosis. The sequence in E. coli shows 74% nucleotide sequence identity, Strictly similar to the typhimurium sequence.

M. Identification of the NAT-like sequence in tuberculosis is based on the fact that the antibacterial agent isoniazid
The substrate for one of the human NAT isoenzymes, and isoniazid is
Of particular interest as they are rendered inactive by acetylation. Humans that are starving acetylating agents (currently identified as carrying one or two starvating alleles at the NAT2 locus) inactivate isoniazid more quickly than slow acetylating agents.

M. To determine if a sequence that appeared to encode NAT in tuberculosis encodes a similar protein, M. et al. Libraries obtained from tuberculosis were screened. Clones were obtained with the expected sequence. N
The AT region was cloned sequentially into the expression vector pET28b,
Encodes a protein of the expected size by SDS-PAGE analysis (approximately 32 kD
a, which contains a hexahistidine fusion tag). A closely related M. Clones from a library of smegmatis were found and sequenced. It is M. 65% identical to the estimated NAT obtained from tuberculosis. M. expressed in E. coli. The smegmatis NAT shows the predicted molecular weight and N-acetyltransferase activity with a substrate containing isoniazid.

The embodiments described below will be more clearly described with reference to the following drawings.

FIG. 1 shows the nucleotide and derived protein sequences of the tuberculosis NAT gene. The letters below the sequence represent the deduced amino acids in the one letter code.
The two number codes indicate the nucleotide and estimated number of amino acids, respectively. The stop codon is marked by an asterisk. Bold amino acids represent regions of the conserved NAT gene. The previously reported conserved arginine II (; Biochem J, (1997) De
lomenie et al.) and cysteine § (; J. Biol. Chem, (1992) Dupret & Grant and J. Biol. Chem (1992) Watanabe et al.).

FIG. 1 shows the nucleotide and derived protein sequences of the smegmatis NAT gene. The letters below the sequence represent the deduced amino acids in the one letter code. 2
One number code indicates the nucleotide and estimated number of amino acids, respectively. The stop codon is marked by an asterisk. Bold amino acids represent regions of the conserved NAT gene. The previously reported conserved arginine II (; Biochem J, (1997) Delo
menie et al.) and cysteine § (; J. Biol. Chem, (1992) Dupret and Grant and J. Biol. Chem. (1992) Watanabe et al.).

FIG. 1 shows the nucleotide and derived protein sequences of the Tifimulium NAT gene. The letters below the sequence represent the deduced amino acids in the one letter code. The two number codes indicate the nucleotide and estimated number of amino acids, respectively.
The stop codon is marked by an asterisk. Bold amino acids are general NAT of conservation
Represents the region of the gene. A previously reported conserved arginine II (; Biochem J, (1997)
Delomenie et al.) And cysteine § (; J. Biol. Chem., (1992) Dupret & Grant
And J. Biol. Chem. (1992) Watanabe et al.).

FIG. 4 shows 4-AV, ANS, p-aminobenzoic acid (at 0.2 mM) as substrate
And heterologously expressed M. with Isoniazid (at 0.015 mM). 2 shows the specific activity of NAT of smegmatis. The y-axis shows the activity in E. coli lysate associated with anisidine (1 equivalent per 14 namonols / min / mg protein).

FIG. 5 shows M. in the presence of isoniazid (INH). M. in the growth of smegmatis. The effect of expression of tuberculosis nat is shown. PACE-1 alone (open circles) grown in minimal medium containing acetamide, or M.A. M. transformed with any of pACE-1 (filled circles) containing tuberculosis nat. Cultures of smegmatis and M. grew in minimal medium containing glucose (triangles). Results were shown for a culture of pACE-1 containing tuberculosis nat.

FIG. Tifimurium NAT, M. Tuba culosis NAT, M. The sequence comparison between Smegmatis NAT and human NAT2 "is shown. ^(*)
Represents an active cysteine residue. The underlined area is M. Represents the conserved region found in all NATs used to screen Smegmatis NAT. Black shadows indicate conserved amino acids.

FIG. Smegmatis and S. Recombinant and endogenous NAT gene products of T. typhimurium, and also M. Figure 5 shows a Western blot analysis of endogenous NAT in smegmatis soluble cell extracts. Recombinant protein was expressed in E. coli. Purified recombinant S. Protein was detected using a polyclonal antibody raised against T. typhimurium NAT. Lane A = M. 500 ng total protein, including smegmatis recombinant NAT. Lane B = Recombinant S. 200 ng total protein including typhimurium NAT. Both recombinant proteins contain a histidine tag to aid purification, which adds an extra 2 to the native protein size.
. Add 1 kDa. Lane C = 40 μg em. Smegmatis soluble cell extract. Polyclonal antibodies were used at a dilution of 1: 100000.

FIG. 8 shows SDS-PAGE and Western blot analysis of bacterial lysates. Total lysate concentration was adjusted by multiplying the equivalent of the recombinant protein. A. Marker (M; kDa), BL21 / PET28b (E. coli strain transformed only with PET28b), S.E. Typhimurium NAT (BL21 cells transformed with PET28b and S. typhimurium nat); Tuba culosis NA
T (BL21 transformed with PET28b and M. tuberculosis nat)
Cells), M. Smegmatis NAT (PET28b and M. smegmatis n
at transformed BL21 cells) and mycobacterial chimera NAT
SDSPAGE of (BL21 cells transformed with PET28b and a chimera of M. smegmatis and M. tuberculosis nat). B. 1: 100,0
00 used at a dilution of 00. Antiserum raised against pure total protein of T. typhimurium NAT; M. used at a dilution of 1: 5,000. Antiserum raised against a 13-mer C-terminal peptide specific for smegmatis NAT, and D
. 1: M used at a dilution of 100,000. Western blot analysis using antiserum raised against pure total protein of tuberculosis NAT.

FIG. 1 shows a schematic representation of a construct (3.6 kbp) used to excise the endogenous nat gene of smegmatis. Gene knockout was achieved using a suicide vector approach. This allows the construct to be ligated to a vector incapable of replicating in mycobacteria. This was achieved by electroporating smegmatis. Selection was based on kanamycin resistance.

FIG. 10 shows PC for strong nat gene knockout and targeted integration.
The R analysis is shown. A representative sample of 40 kanamycin resistant colonies is shown.
A. M. PCR amplification using primers specific for smegmatis nat
The absence of the gene in sample KO9 (accordingly
Represents a gene knockout) (828 bp). The up arrow is inserted in nat
Represents the product (2.1 kbp) obtained with the selected kanamycin gene. When predicted
This is not present in MC2155 (wild type M. smegmatis),
It retains only the nat gene. Lane: M; (HindIII / Bam
HI1 digested lambda phage marker), C¹No template DNA, C2
M. Vector containing smegmatis nat, C³M. N during smegmatis
The knockout construct, MC2155, used to create at gene excisions
Wild-type M; Smegmatis, KO3, 4, 8, 16, 21, and KO27
Is a single crossover (meiosis) event and KO9; double crossover or gene knock
Indicates an out event. B. PCR amplification of the same sample used in FIG. Primer
A, which uses a probe designed for amplification outside the knockout cassette
Represents the 3 'end of the kanamycin insert that moves in the 5' direction with the primer. this is
Determine integration and targeting events at the 3 'end. C¹, C², C³And MC ² 155 does not carry the sequence required to generate the product. All others
Is at least correctly integrated at the 3 'end of nat and has a 2.1 kbp
Produce product size.

FIG. 2 shows “A” gel electrophoresis and “B / C” Southern blot analysis of selected potent knockout strains of smegmatis. Lanes: A; vector containing gene knockout construct (M. smegmatis nat gene with kanamycin insert); B; Vector containing only the smegmatis nat gene, C; blank lane, Mc2155; Smegmatis, KO
3-27; kanamycin resistant M. Represents selected strains of smegmatis. KO9 is n
At gene knockout events are clearly represented. Panel A shows equal amounts of digested chromosomal DNA using EcoRI and HindHI visualized using ethidium bromide.
Figure 2 illustrates an agarose gel analysis of Panel B is a Southern blot of Panel A using the nat gene open reading frame as a probe. Panel C is Panel B cut with the kanamycin gene and reprobed.

FIG. 12 shows recombinant M. Smegmatis NAT, endogenous M. Smegmatis NA
T. and M with the deleted nat gene. M. containing smegmatis (KO9). Figure 3 shows the acetylation capacity of isoniazid by smegmatis lysates. The y-axis shows acetylated isoniazid per mg total protein per hour. The experiments were performed in triplicate.

FIG. Smegmatis wild-type (Mc2 155), M. M. overexpressing tuberculosis nat. Smegmatis (TBNAT), and M. p. Shows the sensitivity to the concentration of isoniazid during growth in 7H9 medium smegmatis _{(KO9) (OD 600nm)} is increasing. TBNAT illustrates increased resistance to isoniazid, and nat gene knockout illustrates increased susceptibility to isoniazid.

FIG. 14 shows the equation:

Embedded image In the range of long-chain (C2-C12) aminophenol ethers represented by
5 is a plot of the rate of acetylation by

The synthetic compound was The rate of acetylation was determined by analysis on Tiffimrilium NAT. The 200 μl assay contains 9% DMSO, 91% 20 mM Tris-H.
It contained Cl buffer (pH 7.5), 90 μM compound, 400 μM acetyl-CoA and 1 μg NAT. The rate of acetylation is compared to the same solution without NAT enzyme, and the difference is due to the enzyme.

FIG. 15 shows that wild-type M. 1 shows the effect of a long-chain (C2-C12) aminophenol ether compound on smegmatis growth. M. Smegmatis cultures were grown in the presence of approximately 25 mg / ml of each compound and 580 nM.
Measurement of growth via optical density reading in m was taken after 24 hours. The percent inhibition of growth for the C4, C6, C8, C10, and C12 para and ortho compounds as compared to cultures in the absence of the compound was demonstrated.

[0063]

【Example】

Example 1 Mycobacterium tuberculosis arylamine N-acetyltransferase recombinant protein production Recombinant M. tuberculosis N-acetyltransferase expression The inventors investigated the genome sequence of Mycobacterium tuberculosis by:
This has led to a surprising observation of N-acetyltransferase-like sequences. S. Many known NAT proteins, including the typhimurium enzymes, are available from M.E. Some strains of tuberculosis acetylate isoniazid, a resistant anti-mycobacterial drug.

Once M. Once isolated from the isoniazid-sensitive strain of tuberculosis, this putative gene for arylamine N-acetyltransferase (NAT) was cloned into the expression vector pET28b (Novagen Inc.). This vector contains a T7 polymerase promoter controlled by IPTG via the lac operon, which transcribes any insert with the T7 polymerase promoter. Recombinant M. Tuba culosis NAT
There are no published data for. In the case of this insert, the nucleotide sequence is S. cerevisiae exhibiting demonstrated NAT activity. The open reading frame (O) which is 56% identical to the gene obtained from T. typhimurium and corresponds to the 32 kDa protein
RF). M. To determine that the tuberculosis gene encoded an enzyme possessing NAT activity, it was expressed and tested for activity using a chromometer assay (3). Cloned M.p. in pET28b. Combined supernatants and pellets from cultures of BL21 E. coli containing tuberculosis NAT appeared to be enzymatically inactive when analyzed on a colorimeter with the arylamine substrate anisidine.

Soluble M. Additional expression studies were performed under a variety of conditions to determine if tuberculosis NAT could be produced. If the concentration of soluble protein was too low to be elucidated by SDSpage, a chromometer assay was used to measure NAT activity. Initially, it was shown that the expression of insoluble protein increased at a time after introduction. Similarly, long-term expression of insoluble protein decreased at temperatures down to 12 ° C, while no corresponding increase in soluble protein was observed.

M. Expression of the tuberculosis NAT clone produced an inactive inclusion body of the 32 kDa protein when visualized by denaturing SDS-PAGE. No NAT activity was shown, which is the expected size for NAT. The proteins are not soluble, and this type of only cytosolic enzymes only show activity when they are expressed in a soluble form. Inclusion body formation was achieved by purifying the protein using simple physical techniques. Sequencing of the N-terminal amino acid of the purified recombinant protein further confirmed its identity.

Recombinant M. To determine if Tubaculosis NAT metabolizes arylamine substrates such as isoniazid, refold the insoluble protein,
It was necessary to be active. M. Tuberculosis NTA was denatured with 6M urea, a standard denaturant that causes the inclusion bodies to refold. M. at 50 mg / ml. Tubaculosis NAT is almost totally soluble in 6M urea. 6
Urea at M did not affect NAT activity, but changed the absorbance of the solution at 450 nm in a linear form. The detection limit of the device allowed the measurement to be up to 60 mM urea with maximum confidence at urea concentrations below 10 mM. M. dissolved in 6M urea. The solution of tuberculosis NAT was dialyzed against refold buffer (50 mM Tris-HCl, 2 mM EDTA) at pH 8 to a final urea concentration of 9 mM. A marked specific activity was seen with anisidine having a confidence limit of greater than 95%.

Thus, when the expressed 32 kDa protein was denatured with 6 M urea and dialyzed, it showed NAT activity with anisidine. This means that the cloned gene is Fig. 4 illustrates the coding of a tuberculosis NAT. However, M. M. Tubaculosis NAT When expressed in smegmatis, it appears to be active at isoniazid (FIG. 5). M. Smegmatis (M
C ² 155) is M. When transformed by electropuncture with an inducible mycobacterial expression construct containing T. baculosis NAT, M. Transformed M. containing NAT obtained from tuberculosis. Smegmatis is a wild type M. It was found to show a 50-fold increase resistance to isoniazid (FIG. 5) compared to smegmatis. This is M. NAT obtained from tuberculosis strongly indicates that it is active on isoniazid under these circumstances, and supports the notion that NAT is involved in determining isoniazid susceptibility. Other experiments were performed by M.
The NAT from Smegmatis was generated using the inducible mycobacterial expression constructs. When overexpressed in smegmatis, M. It was shown to be more active against isoniazid than NAT obtained from tuberculosis. M. From smegmatis or M. NAT obtained from tuberculosis is E. coli or M. It was expressed in any of the smegmatis. The lysate was added for 30 minutes to 11,
Centrifugation at 600 g and the amount of protein corresponded to an additional band at 30,000-33,000 mol. The weight on SDS-PAGE as measured by Coomassie blue staining was estimated on samples of supernatant and resuspended pellet. The percentage solubility in each host is shown below.

[0069]

[Table 1] M. Smegmatis and M. Both the tuberculosis NAT enzymes are in soluble form. The total amount of protein expressed in Smegmatis but derived from the two constructs is M. Unlike the Smegmatis construct, M. This results in approximately 5 times more protein expression than the tuberculosis construct. Using this expression system (as opposed to expression in Escherichia coli), M. Smegmatis NAT and M. Both tuberculosis NATs are equally soluble. M. using a vector containing any of the genes cloned downstream of the acetamidase promoter. M in smegmatis. Tuba culosis and M. The optimal conditions for overexpression of Smegmatis NAT were found to be as follows:
Use of minimal medium containing 68 mM acetamide and 50 μg / ml hygromycin; inoculation of minimal medium from starting culture in 1: 200 dilution of unwashed cells; harvest of cells at OD _{600 nm} = 1.1; pause interval of 2 minutes 4 × 5 sonication.

Example 2 Cloning of a Gene from Mycobacterium smegmatis Encoding Arylamine N-Acetyltransferase Smegmatis is a very closely related non-pathogenic species used as a model mycobacterial system. Its genetics is understood, and plasmid expression systems have been developed (4,5).

M. To determine whether Smegmatis also carries NAT, M.M. A truncated library representing the smegmatis genome was constructed using M.I. Tuba culosis NAT c
Screening was performed using DNA. That is the PFENL stored during NAT
And the RGGYC region. A 400 bp probe template obtained from the Tubaculosis NAT open reading frame was selected.

The 400 bp probe template was radiolabeled with a conventional kit (Amesham-Pharmacia Biotech) and It was used to probe a truncated library representing the whole smegmatis genome. PFENL and RGGY to perform low stringency screen and hybridize to the probe
A clone containing the C region was detected. Six clones hybridizing strongly to the 400 bp probe were obtained from the screen. A restriction digest with BamHI was performed to test for insert size. The results were confirmed using Southern blot and examined for hybridization to the original probe. Most clones appeared to contain enough of the entire NAT gene.

The truncated genomic library was screened. Southern blot confirmed that all six of the resulting clones were evident to contain DNA encoding PCENL and RGGdC (where d is W or Y). The sequence was also conserved at NAT. The process of preparing a truncated library using blunt end religation creates BamHI site 1 every four times. All of the clones had at least one BamHI site and were thereby linearized.

Clone “20F22” contains two BamH1 sites, which
Thus, the vector was completely cut to obtain a small fragment. Clone 20
F22 was selected for sequencing along with a second representative clone from the rest (5I15). M. Smegmatis clones 5I15 and 20F
22 was digested with Xhol and pBluescript
The insert from the pt vector (Stratagene) was cut. The fragment was gel purified and analyzed. Clones were also digested with NotI to yield a set of superimposed fragments. Clone 20F22 contained an internal NotI site conferring two fragments. The deleted insert was ligated into pGEM11Z (Promega). Construct
Sequenced with M13 forward and reverse primers.

Separate sequence data from each subclone fragment was spliced to adjacent sequences for each clone. Automated sequencing has been significantly enhanced with the use of proprietary polymerases, and the high GCs found in mycobacteria (Fidelase)
Optimized for content. The final sequence was confirmed by primer walking along both strands of the DNA. Translation of the DNA obtained from clone 20F22 shows that it shows a high degree of homology to NAT at the nucleotide level, but that it is a false positive, which did not contain either the conserved PFENL or the RGGdC region. Reveal. In serial specific PCR, clone 20F22
The absence of the T gene was confirmed. In contrast, translation of the DNA sequence of clone 5115 contained a 275 amino acid residue open reading frame representing both the conserved PFENL and RRGYC sequences. This open reading frame is shown in FIG. Clone 51
Expression of this putative NAT from 15 confirmed its identity (see FIGS. 4 and 7).

Example 3 Arylamine N-acetyl of Mycobacterium smegmatis
825 bp clone (5I15) corresponding to putative 275 residue NAT open reading frame for transferase recombinant protein production
Was inserted into the pET28b recombinant protein expression vector (Novagen) and used to transform BL21 E. coli (Promega). The open reading frame is NA
T protein is relatively short, and similar M. Tuba culosis NAT
Assuming that the ORF contained an extra 24 base pairs, a second transformation was performed with an open reading frame clone and another 105 base pairs beyond the stop codon. Recombinant soluble protein with a relative molecular weight of 32,000 is 30,000
M of 0. Expressed from both transformed bacterial colonies consisting of 2,100 derived from the smegmatis NAT protein and the fused hexahistidine affinity tag.

Recombinant M. with various substrates. The specific activity of smegmatis is 875 bp M.p.
It was measured using a 60 minute assay for soluble NAT expressed from the smegmatis insert. The results of these assays, shown in Figure 4, show that the recombinant enzyme shows potent activity for isoniazid in addition to activity for 4-AV and anisidine, but no activity for p-aminobenzoic acid. It was shown to be scarce.

Example 4 Mycobacterium tuberculosis arylamine N-acetyl
Antibodies raised against transferase . Polyclonal antibodies raised against tuberculosis NAT provide a useful tool for specific protein detection. For example, drug resistance or susceptibility M. Detecting native protein expression from lysates isolated from tuberculosis is essential to understanding the ability of NAT to metabolize isoniazid in vivo.

M. Tuberculosis NAT inclusions were isolated using sonication. A non-ionic detergent was used to remove membrane proteins by the following method.

The resuspended pellet was centrifuged at 10,000 × g for 10 minutes at 4 ° C. Resuspension buffer (50 mM Tris-HCl, 2 mM EDTA, 4 mM DTT and 1 mM Pefabloc (protease inhibitor) (pH 8.0)
) Was replaced with an equal volume of detergent buffer (200 mM NaCl, 1% (w / g) deoxycholic acid, 1% (v / v) Nonidet P40). The pellet was resuspended and centrifuged at 10,000 xg for 10 minutes at 4 ° C. The supernatant was discarded without disturbing the material pellet or the gelatin chains. The pellet
Triton-EDTA solution (1% (v / v) Triton X-100, 1 mM EDT
Carefully resuspended in A) and spun at 10,000 xg for 10 minutes at 4 ° C. Careful removal of the supernatant and resuspension in Triton-EDTA was repeated up to three times until the gelatin layer was no longer apparent. The pellet was resuspended in resuspension buffer.

This product was further purified on an 8% acrylamide gel. The gel fragment containing the protein was mixed with an equal volume of incomplete Freund's adjuvant and injected into rabbits. Rabbits were injected using the following protocol.

[0082]

[Table 2] Remove 2 ml of blood during bleeding, and use dot or western blot or E
Antibodies were tested using LISA. 1 ml em in acrylamide mixed with incomplete Freund's adjuvant. Tuberculosis NAT was injected at each boost and for priming.

Complete Freund's adjuvant relies on components derived from the mycobacterial cell wall that stimulate the immune response of sufficient body fluids to produce antibodies. Incomplete Freund's adjuvant was used to avoid non-specific recognition of other mycobacterial proteins or cell wall components. A suitable immune response was achieved by releasing the protein in the arylamine. The resulting antibodies are described in Tubaculosis N
AT strongly binds, and It was shown to weakly cross-react with Tifimurium NAT.

M. Antibodies were also raised against the peptide of tuberculosis NAT. M. Tuba culosis NAT and M. The hydrophobicity plot generated from the sequence of Smegmatis NAT shows differences between the C-terminal region and the region between residues 160-180. M. Peptide CDELLARQPGA obtained from the C-terminus of tuberculosis NAT
DAP and M. CDVQARVA obtained from the C-terminus of Smegmatis NAT
EVLDT was synthesized and conjugated to soybean trypsin inhibitor as a carrier protein for immunization (750 μg) with incomplete Freund's adjuvant in rabbits and two serial boosts (600 μg). M. The final bleeding antiserum for the C-terminal peptide of tuberculosis NAT was tested by M.E. At a dilution of 1: 500-1: 2000 against tuberculosis NAT total protein, but M. Smegmatis NAT and S.M. It was found that titration was> 1: 100 against T. typhimurium NAT total protein (no longer detectable when used as primary antibody). Sequentially, M. Antisera raised against the C-terminus of Smegmatis NAT was obtained from M.M. > 1: 1 for tuberculosis NAT total protein
Except for M.00. 1: 100 for smegmatis NAT total protein
The titration is off at 00-1: 50,000. Therefore, the antisera raised against these peptides was obtained from M.E. Tubaculosis and M. It has the ability to distinguish between the smegmatis NAT proteins. The terminal regions of both proteins are important antigenic epitopes of NAT. Thus, antibodies raised against this region are useful, for example, for the detection and identification of mycobacteria in a sample, which can be processed to release proteins or protein fragments from within the mycobacterial cell wall.

Example 5 Antibodies raised against smegmatis NAT. Smegmatis NAT inclusions were isolated using sonication. Membrane proteins were removed by the same method outlined in the previous example using Triton × 100 and Igepal-630 surfactant.

[0086] This preparation was further purified on an 8% arylamine gel. The gel fragment containing the protein was mixed with an equal volume of incomplete Freund's adjuvant and injected into rabbits. Rabbits were injected using the same protocol listed in the previous example.

[0087] 2 ml of blood was taken during bleeding and tested for antibodies using dot or western blot or ELISA. 1 ml em in arylamine mixed with incomplete Freund's adjuvant. Smegmatis NAT was injected at each boost and for priming.

Complete Freund's adjuvant relies on components derived from the mycobacterial cell wall to stimulate an immune response in sufficient body fluids to produce antibodies. Freund's incomplete adjuvant was used to avoid non-specific recognition of other mycobacterial proteins or cell wall organisms. A suitable immune response was achieved by releasing the protein in the arylamine.

The resulting antibodies are described in M. Strongly binds T. baculosis NAT and It was shown to weakly cross-react with Tifimurium NAT.

Example 6 Antibodies raised against Tifimurium NAT Rabbits were given as a first injection in pure Freund's adjuvant followed by adjuvant and then twice in saline at two week intervals with pure NAT from Tifimurium (0.6 mg). Used to immunize. A weak reaction was obtained. Animals were boosted with 1 mg of pure protein in incomplete Freund's adjuvant up to four times a month before the last bleed. The antibody is extremely strong at a dilution of 1: 100,000 and NAT obtained from Tifimurium, and M. Reacts non-specifically with NAT obtained from smegmatis. See FIG.

Example 7 Manipulation of Mycobacterial Strains Lacking NAT Activity M. Lacking the Functional nat Gene A smegmatis strain was created by using a DNA construct (shown in FIG. 9) capable of deleting the endogenous nat gene. Gene knockout was performed via M.E. This was achieved using a suicide vector containing the construct that was poured into smegmatis. The vector was not capable of replicating in mycobacteria, and transformants were selected for kanamycin resistance. 40
A representative sample of kanamycin resistant colonies was tested for strong nat gene knockout and target integration by PCR analysis, which is shown in FIG.
And 11. M. PCR amplification using primers specific for smegmatis nat was used to indicate the absence of the gene (and therefore gene knockout) in the sample. One sample is called KO9. PCR amplification of the same sample was to determine integration and / or target events at the 3 'end.

M. Southern blot analysis of selected potent knockout strains of smegmatis was also performed-strain KO9 clearly demonstrated a nat gene knockout event-FIG.
See 1.

M. lacking NAT function. It was noted by the inventors that smegmatis colonies represent a modified form. In addition, preculture is effective when isoniazid treatment is initially less effective with continued exposure to isoniazid. This represents an improvement in the growth seen in clinical isolates of tuberculosis-a similar phenomenon for isoniazid sensitivity. Different metabolic pathways have been exposed to isoniazid for prolonged periods. NAT knockout strains of smegmatis and M. It appeared that both strains of tuberculosis were drawn to circumvent reduced NAT function.

Example 8 M. showing modified NAT expression Isoni using engineered strain of smegmatis
Test of azide Wild type M., a recombinant strain overexpressing NAT and KO9 strains in which the nat gene has been deleted. Lysates were obtained from cultures of smegmatis (Mc2155).
The ability of these lysates to effect isoniazid acetylation was examined. The result is shown in FIG.
As shown in FIG. It can be seen in FIG. 12 that acetylation is increased 4-fold in the NAT overexpressing strain compared to the wild type strain. The KO9 strain shows a decrease in acetylation compared to the other two strains.

M. in the presence of isoniazid. The growth of smegmatis strains was also investigated. Wild type strain (Mc2 155), overexpressed M. The tuberculosis NAT (TBNAT) strain and the KO9 strain lacking NAT function were cultured in 7H9 medium supplemented with acetamide at various concentrations of isoniazid (1, 2 and 10 μg / ml). The results are shown in FIG. It can be seen that TBNAT showed increased resistance to isoniazid, and nat gene knockout showed increased sensitivity to isoniazid.

Example 9 NAT Substrate and Compound Shown to be an Antimycobacterial Agent Using an aliphatic chain to attach the compound to the gel, and using this method, the association between the compound and NAT Determining whether it is possible to determine a constant. Aminophenol ethers in the long chain (C1-C12) range were synthesized according to Nodzu et al. (J. Pharm. Soc. Jap. 74, 872-5, 1954). The synthesized compounds have ethyl (2 carbon atoms, abbreviated Et), butyl (4, But), hexyl (6, Hex), octyl (8, O
ct), decyl (10, Dec) and dodecyl (12, Dod).

[0097]

Embedded image The synthesized compound is The rate of acetylation was determined by assaying with Tyfimurium NAT. The 200 μl assay is 9% DMSO, 91% 20 mM
Tris-HCl buffer (pH 7.5), 90 μM compound, 400 μM acetyl C
oA and 1 μg NAT were included. The rate of acetylation was compared to the same solution without NAT enzyme, and the difference was due to the enzyme. The results are as follows.

[0098]

[Table 3] They are illustrated in the graph in FIG. The four isomer compounds are also E. coli, M. et al. Smegmatis and M. The activity and the NAT obtained from tuberculosis are shown.

The para (4 isomer) and ortho (2 isomer) compounds were prepared as described by M.E. The inhibitory effect on smegmatis growth was further tested. M. Smegmatis cultures were grown in the presence of approximately 25 mg / ml of each compound and growth measurements via optical density reading at 580 nm were taken after 24 hours. The percentage inhibition of growth for C4, C6, C8, C10 and C12 para and ortho compounds as compared to compound-free cultures is shown in FIG. The best NAT of the group
Active C8 para isomer compounds are also described in M. It can be seen that it shows the highest inhibitory effect on the growth of smegmatis. Thus, it is shown that compounds that are excellent substrates for NAT can be used to inhibit mycobacterial growth. Preventing NAT from acting on endogenous substrates, where exogenous substrates are present in the culture, may be a mechanism after the observed weakened growth.

Compounds as described above could be derived by methods known in the art for binding a sample in a screen to a solid support.

In addition to finding compounds that prevent mycobacterial NAT having a target anywhere in the cell from acetylating the antimycobacterial agent, it is also desirable that these experiments be able to act as an antimycobacterial agent .

Example 10 Detection of NAT mutation in tuberculosis. The ANT gene obtained from 16 clinical isolates of the tuberculosis isoniazid resistant strain was amplified by PCR, cloned, and both strands were sequenced.

The two strains represented true allelic variants of the wild-type TB NAT sequence as follows.

[0104]

[Table 4] Wild type M. These base changes for the tuberculosis NAT sequence were observed in the sequencing data of both DNA strands and confirmed using the restriction enzyme BsmAI using RFLP analysis.

To perform RFLP analysis, M.I. The open reading frame of the Tuba culosis NAT sequence
Em. Showing isoniazid resistance using the following primers: 5'GACGAGGTCAGAATGGCAAC3 'and 5'GGGGTTCGTTTGTTCGGGATA3'. Amplified from DNA obtained from tuberculosis clinical isolates.

The obtained amplification product was digested with BsmAI (New England Biolabs). The 619G to A (207Gly to Arg) mutation introduces an extra BsmAI site in the mutated sequence, so the expected fragments from restriction digestion are:

[0107]

[Table 5] Electrophoresis of a 1 kb molecular weight marker ladder on a 1.5% agarose gel, undigested and restricted digests showed that 4 out of a total of 14 isolates carry the 619G to A mutation. .

Thus, analysis of mutations in the NAT gene can give an indication of how sensitive a particular mycobacterial strain is to isoniazid and other NAT ligands.

Conclusions A sequence comparison of mycobacterial NAT (FIG. 6) shows that NAT obtained from mycobacteria differs slightly in size from other known NATs. Mammal N
AT has 290 amino acids; Those obtained from T. murium and E. coli have 281 amino acids. M. Tuba culosis NAT is 283
Having amino acids, and M. Smegmatis has 275 amino acids. In mycobacterial NAT, the active site cysteine and arginine involved in catalysis are conserved.

[0110] The relatively hydrophobic plot is shown by M.E. Tuberculosis NAT shows a 12 residue region, 162-174, which is clearly more hydrophobic than Emsmegmatis NAT. In the absence of three-dimensional structure, it is difficult to say whether this region can induce folding failure during E. coli expression. However, it is immediately regulated by the proposed interdomain loop in eukaryotic NAT. Therefore, these residues have been It is possible to form exposed hydrophobic regions that can cause aggregation of tuberculosis NAT or otherwise prevent correct folding.

M. The NAT enzyme from tuberculosis was able to refold into a form that was not active when expressed in E. coli lysate, but was active on anisidine as a substrate. M. The NAT enzyme obtained from tuberculosis is active on isoniazid as a substrate when expressed in another mycobacterium (M. smegmatis) (FIG. 5).

The stability of the two enzymes can be different. These differences were due to the sensitivity to isoniazid in M. et al. Tuba culosis and M. It may be due to the inherent differences of smegmatis. NAT protein itself or M.E. Mutations affecting any of the expression of the NAT protein in tuberculosis can increase NAT activity in isoniazid-resistant strains of tuberculosis (TB).

Administration of mycobacterial NAT ligand together with isoniazid has been described in M. et al. M. leprae or M. infecting livestock. M. bovis
Can increase its efficacy against other pathogenic mycobacteria. Recent research has provided new insights into the mechanism of isoniazid metabolism in mycobacteria and may help address recent reoperations with tuberculosis, the leading cause of preventable deaths worldwide.

[0114]

[References]

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence and derived protein sequence of the tuberculosis NAT gene.

FIG. 1 shows the nucleotide and derived protein sequences of the smegmatis NAT gene.

FIG. 1 shows the nucleotide and derived protein sequences of the Tifimulium NAT gene.

FIG. 4. Heterologously expressed S. aureus using 4-AV, ANS, p-aminobenzoic acid (at 0.2 mM) and isoniazid (at 0.015 mM) as substrates. 2 shows the specific activity of NAT of smegmatis.

FIG. 5. S. in the presence of isoniazid (INH). M. in the growth of smegmatis. The effect of the expression of natto in T. baculosis is shown.

FIG. NAT of Tifimurium, M. NAT of Tuba culosis, M. 1 shows a sequence comparison between Smegmatis NAT and human NAT2 ″.

FIG. Smegmatis and S. Recombinant and endogenous NA of Tifimurium
T gene product, and furthermore M. Endogenous N in smegmatis lytic cell extracts
4 shows a Western blot analysis of AT.

FIG. 8 shows SDS-PAGE and Western blot analysis of bacterial lysates.

FIG. The construct used to delete the endogenous nat gene of smegmatis (
(3.6 kbp) The following shows a typical example.

FIG. 10 shows PCR analysis for strong nat gene knockout and target integration.

FIG. 2 shows “A” gel electrophoresis and “B / C” Southern blot analysis of selected potent knockout strains of smegmatis.

Figure 12: Recombinant M. Smegmatis NAT, endogenous M. M. with smegmatis NAT and deleted nat gene. M. containing smegmatis (KO9). Figure 3 shows the acetylation capacity of isoniazid by smegmatis lysates.

FIG. Smegmatis wild type (Mc2 155), M. Tuba culosis nat
Overexpressing M. Smegmatis (TBNAT), and M. p. Shows the sensitivity to the concentration of between isoniazid growth in 7H9 medium smegmatis _{(KO9) (OD 600nm)} is increasing.

FIG. 14:

Embedded image In the range of long-chain (C2-C12) aminophenol ethers represented by
5 is a plot of the rate of acetylation by

FIG. 15: Wild-type M. 1 shows the effect of a long-chain (C2-C12) aminophenol ether compound on smegmatis growth.

[Procedural Amendment] Submission of translation of Article 34 Amendment of the Patent Cooperation Treaty

[Submission date] August 22, 2000 (2000.8.22)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Claims

[Correction method] Change

[Correction contents]

[Claims]

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (Reference) C12Q 1/48 C12Q 1/68 A 1/68 G01N 33/15 Z G01N 33/15 33/50 Z 33 / 50 33/68 33/68 C12R 1:32) // (C12N 15/09 ZNA C12N 15/00 ZNAA C12R 1:32) (72) Inventor Peyton, Mark United Kingdom, OEX 2.0 BB, Oxford Shah, Oxford, Ozney Island, South Street 3 (72) Inventor Sinclair, John United Kingdom, Wyo 3.7BH, Yorkshire, York, Marygate 60

Claims (43)

[Claims] 1. An arylamine N-acetyltransferase protein of Mycobacterium tuberculosis having the sequence shown in FIG. 1 or a peptide fragment larger than five adjacent amino acid residues thereof. 2. The Mycobacterium tuberculosis arylamine N-acetyltransferase protein according to claim 1, wherein the amino acid at position 207 as shown in FIG. 1 is arginine. 3. A Mycobacterium smegmatis arylamine N-acetyltransferase protein having the sequence shown in FIG. 2 or a peptide fragment larger than five adjacent amino acid residues thereof. 4. An arylamine N-acetyltransferase gene of Mycobacterium smegmatis having the sequence shown in FIG. 2 or an oligonucleotide fragment larger than its eight adjacent nucleotide residues. 5. The amino acid at position 207 is represented in FIG. 1, characterized in that it is one of glycine or arginine or is a peptide fragment larger than its five adjacent amino acid residues. An antibody raised against a Mycobacterium tuberculosis arylamine N-acetyltransferase protein having the sequence. 6. An antibody raised against a Mycobacterium smegmatis arylamine N-acetyltransferase protein having the sequence shown in FIG. 2, or a peptide fragment larger than five adjacent amino acid residues thereof. 7. Salmonella typhimurium having the sequence represented in FIG.
(Salmonella typhimurium) arylamine N-acetyltransferase protein, or an antibody raised against a peptide fragment larger than its five adjacent amino acid residues. 8. A mycobacterial bacterium by contacting one or more molecules of an N-acetyltransferase protein with one or more compounds to be screened for binding and detecting said binding. N-
A method for screening for a compound that binds to an acetyltransferase protein. 9. A method comprising: (i) immobilizing one or more test compounds on a solid support; (ii) contacting an aliquot of an N-acetyltransferase protein with said immobilized test compound; (iii) 9. The method of claim 8, comprising removing unbound protein from the solid support, and (iv) detecting the bound protein. 10. The method according to claim 8, wherein the N-acetyltransferase protein is an arylamine N-acetyltransferase obtained from Mycobacterium or a fragment thereof. 11. The N-acetyltransferase protein according to claim 8, wherein the N-acetyltransferase protein is an arylamine N-acetyltransferase obtained from Mycobacterium tuberculosis or a fragment thereof, or Mycobacterium smegmatis or a fragment thereof. Item 10. The method according to Item 9. 12. The method according to claim 8, wherein the N-acetyltransferase protein is an arylamine N-acetyltransferase obtained from Salmonella typhimurium or a fragment thereof. 13. A screened compound known to bind to mycobacterial N-acetyltransferase is continuously tested for binding to human NAT1 or NAT2, or other eukaryotic NAT.
A method according to claim 8 or claim 9. 14. The method of claim 13, wherein the detection of bound human NAT1 or NAT2 protein in a serial test is by an antibody raised against human arylamine N-acetyltransferase or a fragment thereof. 15. The method according to any one of claims 8 to 13, wherein the detection of the binding protein is performed by an antibody raised against an arylamine N-acetyltransferase obtained from Mycobacterium tuberculosis or a fragment thereof. Method. 16. The method according to any one of claims 8 to 13, wherein the detection of the binding protein is performed by using an antibody raised against an arylamine N-acetyltransferase obtained from Mycobacterium smegmatis or a fragment thereof. Method. 17. The method according to any one of claims 8 to 13, wherein the detection of the binding protein is performed by an antibody raised against an arylamine N-acetyltransferase obtained from Salmonella typhimurium or a fragment thereof. Method. 18. The method according to any one of claims 8 to 17, wherein the compound to be screened is a ligand for a mycobacterial arylamine N-acetyltransferase protein. 19. The compound according to any one of claims 8 to 18, wherein the compound to be screened modulates acetylation of aromatic amines and hydrazines by the mycobacterial arylamine N-acetyltransferase protein. The described method. 20. A method of controlling mycobacterium growth by contacting said mycobacterium with a compound that is a ligand for an arylamine N-acetyltransferase protein expressed by said mycobacterium. 21. The method according to claim 20, wherein the ligand is a substrate for an arylamine N-acetyltransferase. 22. The method according to claim 20, wherein the ligand is an inhibitor of arylamine N-acetyltransferase. 23. The method according to claim 20, wherein the Mycobacterium is Mycobacterium tuberculosis, Mycobacterium leprae or Mycobacterium bovis. 24. In the manufacture of a medicament for treating a mycobacterial infection,
Use of a compound that is a ligand for the mycobacterial arylamine N-acetyltransferase protein. 25. An anti-mycobacterial formulation comprising an effective concentration of a compound that is a ligand of a mycobacterial arylamine N-acetyltransferase protein. 26. The antimycobacterial formulation of claim 25, wherein the ligand is a substrate for an arylamine N-acetyltransferase protein. 27. The formulation of claim 25, wherein the ligand is an inhibitor of an arylamine N-acetyltransferase protein. 28. The manufacture of a medicament for treating a mycobacterial infection,
Use of a compound that reduces the activity of a mycobacterial arylamine N-acetyltransferase protein for a second compound that is an aromatic amine or hydrazine. 29. A method for producing a mixture of an effective concentration of an anti-mycobacterial aromatic amine or hydrazine and an effective concentration of a compound capable of reducing the activity of a mycobacterial arylamine N-acetyltransferase protein. Characterized antimycobacterial prescription. 30. The anti-mycobacterial aromatic amine or hydrazine
30. The anti-mycobacterial formulation of claim 29, which is at least one of the group consisting of isoniazid, ethionamide, dapsone and p-aminosalicylate. 31. Use of an antibody according to any one of claims 5 to 7 for detecting mycobacteria in a biological sample. 32. Providing a biological sample that has been treated to release a mycobacterial cytoplasmic component present in the sample; b) providing the treated sample with a mycobacterial arylamine N-acetyltransferase Contacting with one or more antibodies raised against, c) determining the binding of said antibodies to one or more cytoplasmic components of the sample, in a biological sample. Method for detecting mycobacteria. 33. The method of claim 32, wherein the sample is processed by sonication. 34. Within said sequence, by means of identifying a nucleotide encoding a protein sequence showing 80% or more similarity to PFENL (X) _{n = 5-50} RGGdC, or an amino acid comprising it, A method for identifying a nucleic acid sequence that at least partially encodes, or an amino acid sequence that at least partially contains, a putative enzyme that is an important target for an antimycobacterial drug, a putative enzyme useful for the synthesis of an antimycobacterial drug. 35. The method of claim 23, wherein “n” is between 20 and 30. 36. One or more sense primers encoding the amino acid sequence PFENL and one or more antisense primers encoding the amino acid sequence RGGdC, wherein d is either W or Y. By means of a primer extension reaction using a sense primer, a DNA sequence encoding a putative enzyme that is a major target for an anti-mycobacterial agent, or at least in part, a putative enzyme useful for the synthesis of an anti-mycobacterial agent, A method of isolating from any source of genomic or cDNA. 37. The product of the primer extension reaction is sequentially labeled and
The method according to claim 36, which is used as a probe for screening the A library. 38. The method according to claim 36, wherein the sense primer used is a mixture corresponding to 5'CCNTTYGARAAYYTN3 ', and the antisense primer used is a mixture corresponding to 5'RCAVYANNCNCCNCCK3'. 39. Use of a mycobacterial arylamine N-acetyltransferase protein in a three-dimensional structure for the design of a compound capable of binding to the arylamine N-acetyltransferase protein. 40. The structure of another arylamine N-acetyltransferase protein is determined or deduced and so obtained for the design of a compound capable of binding to said another arylamine N-acetyltransferase protein. Use of a mycobacterial arylamine N-acetyltransferase protein in three-dimensional structure to utilize the obtained structural information. 41. A mycobacterial strain transformed with a synthetic DNA construct encoding the protein of any one of claims 1-3. 42. The mycobacterial strain according to claim 41, wherein the DNA construct encodes a hybrid protein of the protein of any one of claims 1 to 3. 43. A mycobacterial strain transformed with a synthetic DNA construct that abolishes endogenous arylamine N-acetyltransferase activity.