JP2002512203A - Methods and products related to metabolic interactions in disease - Google Patents

Abstract

SUMMARY The present invention encompasses methods of regulating cell proliferation and cell division to control disease processes by manipulating mitochondrial metabolism and expression of cell surface immune proteins. The invention also includes related compositions and screening assays.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION [0001] The present invention relates to methods of controlling cell growth and division by manipulating mitochondrial metabolism and expression of cell surface immune proteins to control disease processes. The invention also relates to compositions and screening assays.

BACKGROUND OF THE INVENTION Normal tissue develops and is maintained by the normal processes of cell division and cell death. In many diseases (e.g., cancer, type I diabetes, and autoimmune diseases), the normal balance between cell division and cell death is disrupted, resulting in rapid proliferation of unwanted and potentially dangerous cells, or It results in any loss of cells that is essential for maintaining tissue function.

Cell division occurs by a process known as mitosis. During mitosis, dividing cells use glucose lytically at elevated rates as the primary source for energy (ATP) production in a process called glycolysis (Brand, K. et al. A. and U. Hermfise.1997.Aero.
bic glycolysis by proliferating cell
s: a protective strategy against reac
five oxygengens. Phaseb J 11, No. 5: 3
88-95). Glycolysis occurs in the cytosol and is required for mitochondrial energy production. Elevated glycolysis occurs when cells divide, providing more ATP from cytosolic glycolysis. Mitochondrial A
TP synthesis proceeds through coupling of an electron-transfer-dependent oxide-reactive reaction (oxidative phosphorylation) to ATP synthase (Harper, ME 1997. Ob.
ethy research continuities to spring l
eaks. Clinical Investigations in Medi
cine 20, No. 4; 239-244). During this process, a proton gradient is generated by proton extraction from mitochondria (Himms-
Hagen, J.A. 1992. Brown Adipose Tissue. Ob
esity, P.S. Bjornortop and B.A. N. Brodoff. Hen, 1st
Vol. B. Lippincott, Philadelphia. 1), mitochondrial membrane potential increases. Uncoupling pr
(UCP) can reversibly uncouple oxidative phosphorylation from the electron transport chain, thereby reducing mitochondrial membrane potential (Harper, ME et al.
1997. Obesity research continuities to s
ring leaks. Clinical Investigations
in Medicine 20, No. 4; 239-244). Increasing glucose concentration can increase mitochondrial membrane potential (Harper, ME 199).
7. Obesity research continuities to spri
ng leaks. Clinical Investigations in
Medicine 20, No. 4; 239-244).

[0004] Cell death is a physiological process that ensures that homeostasis is maintained between cell generation and cell turnover in self-renewing tissues, and is essential for proper functioning of the immune system It is. Physiological cell death occurs through the processes of apoptosis and necrosis. The boundaries between these processes, once considered clear, blur with the surge in information on development, tissue morphology, regenerative processes, and the role of cell death in the immune system. However, necrotic cell death (sometimes referred to as neoplasia) typically results in osmotic destruction of cells followed by an inflammatory response, whereas apoptotic death involves cell shrinkage, cell fragmentation It is widely accepted to include the fragmentation and phagocytosis of this fragment, often without inflammation. Most cells die in a form of suicide that is characteristically apoptotic and strongly regulated by complex signals (Zakeri, Z., W. Bur).
sch, M .; Tenniswood, and R.A. A. Lockshin. 199
5. Cell Death: Programmed, apoptosis, ne
crosis, or other. Cell Death and Diffe
Retention 2: 87-96). Apoptotic cell death is particularly important in reticulocellular systems, where the balance between mitosis and cell death can determine the efficacy and nature of the immune response (Zakeri, Z., W.). Bursch,
M. Tenniswood, and R.A. A. Lockshin. 1995. Ce
ll Death: Programmed, apoptosis, necros
is, or other. Cell Death and Different
ion 2: 87-96). Deficiency results in an autoimmune disease or lack of immune surveillance.

[0005] Improper cell division or cell death results in serious, life-threatening diseases. Diseases associated with increased cell division include cancer and atherosclerosis.
Diseases resulting from increased cell death include AIDS, neurodegenerative diseases (eg, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa), aplastic anemia, atherosclerosis (eg, myocardium Infarction, stroke, reperfusion injury), and toxin-induced liver disease. Many methods have been proposed for treating these disorders. Although these diseases share a common physiological property of either excessive cell division or immature cell death, strategies for identifying potential therapeutic treatments are more likely to explore a common mechanism. Are also treated individually. It may be desirable to identify a common mechanism by which cell division may be interrupted or cell death may be promoted, treating all of these diseases.

[0006] PC12 cells (Greene and Tischler, 1976), a cell line derived from rat pheochromocytoma, were used to study nerve growth factor (NGF) -induced neuronal differentiation and dependence (Mills et al., 1997), and Serum and / or
Or withdrawal of nutritional factors (Mesner et al., 1995; Fulle et al., 199).
7), is widely used as a model for studying neuronal cell apoptosis resulting from oxidative stress (Vinard et al., 1996) and the addition of calcium ionophores (Fulle et al., 1997). NGF promotes differentiation, neural outgrowth, and acquisition of mature sympathetic neuron morphology on PC12 cells. However, withdrawal of NGF is caused by changes in archetypes (ie, chromatin degradation, nuclear fragmentation, acidification, changes in surface lipids, cell fragmentation, blebbing, and nucleosome formation). Apoptosis of characterized PC12 cells results (Gottlieb et al., 1997).

[0007] PC12 transfected with a variant such as TrkA has been developed to elucidate the role of NGF and signaling in neuronal function.
Nerve growth factor (NGF) has two synergistic receptors (tyrosine kinase A (T
rkA) and p75NGRF) (Canossa et al., 1996).
The PC12 TrkA cell line is a 140k with endogenous tyrosine kinase activity.
It overexpresses the Da protein (Kaplan et al., 1991) TrkA and responds more strongly to NGF stimulation than native PC12 cells.
The NGF-TrkA complex is thought to act as a messenger to deliver growth signals from axon terminals to the sympathetic neuron cell body (Riccio et al.,
1997).

[0008] Epidermal growth factor (EGF) has a different effect on PC12 cells than NGF. When tenative PC12 cells were treated with EGF,
These are induced to undergo proliferation rather than differentiation. In contrast, v-Crk
EGF stimulation of cell lines and TrkA cell lines induces neuronal differentiation (Te
ng et al., 1995).

[0009] Fas, a member of the tumor necrosis factor receptor family that includes the nerve growth factor receptor, has a TCR (T cell receptor) / CD3-induced T cell activation (
Mediates apoptotic cell death in some examples, including Nagata et al., Science). If the Fas molecule interacts with a Fas ligand or an appropriate anti-Fas antibody, cell death can follow (Gottlieb et al., 1997). F
as was originally described for the membrane surface of hematopoietic lineage cells (Itoh et al., 19
91), but its presence has been demonstrated for endothelial cells (Richardson et al., 1994), hepatocytes (Tanaka et al., 1998), and oligodendrocytes in multiple sclerosis lesions (Bonetti and Raine, 1997).

[0010] The B7 molecules, B7.1 (CD80) and B7.2 (CD86), show that they have T cell proliferation (Linsley et al., 1991), produce interleukin-2 (
Freeman et al., 1992), and the ability to costimulate interleukin-2 receptor expression (Razi-Wolf et al., 1996).
Expression of these costimulatory molecules in immune cells is also associated with some bacterial, parasitic and viral infections and autoimmune diseases (Reiser and Stadecker, 1996) (eg, systemic lupus erythematosus (Folz)
enlogen et al., 1997), in the pathogenesis and response of experimental allergic encephalomyelitis (Perrin et al., 1996), and in the rejection phase of the autoimmune response (Akalin et al., 1997).

[0011] B7.1 and B7.2 are members of the immunoglobulin gene superfamily and contain V-like and C2-like extracellular domains. Although originally described for B cells, B7.1 and B7.2 have also been described for monocytes, dendritic cells, and activated T cells (June et al., 1994). B7
. 1 (CD80) and especially B7.2 (CD86) are upregulated on the surface of B lymphocytes in patients with systemic lupus erythematosus (SLE) (Folzen)
logen et al., 1997).

SUMMARY OF THE INVENTION The present invention includes the finding that mitochondrial metabolism plays an essential role in regulating cell division and cell death that occurs in various diseases. The state of a cell's proton motor power, which can be assessed by the coupling between electron transport and oxidative phosphorylation, is a signal that determines whether a cell undergoes cell division, cell differentiation, or cell death Has been found by the present invention to play an important role in This finding has important implications for treating diseases associated with excessive cell division, abnormal differentiation, and immature cell death (eg, for treating cancer, autoimmune diseases, neurodegenerative diseases, etc.) .

[0013] It is also important that the expression of immune recognition molecules on the cell surface is important in regulating the processes of cell division, differentiation and apoptosis that occur in various diseases.
It has been found by the present invention. For example, it has been found by the present invention that the expression of an immune recognition molecule on the surface of a cell correlates with the ability of the cell to undergo differentiation. For example, upon removal of NGF from a nerve cell, the surface expression of the B7 molecule is down-regulated and the nerve cell undergoes apoptosis. The induced kinetics and expression of Fas, B7.1, and B7.2 molecules on the membrane surface of differentiated PC12 cells and mutants thereof, and TrkA cells have been investigated and are described in the Examples below. Has been described.

[0014] The present invention is based on the finding that neural differentiation and apoptosis are determined by the recognition of immune recognition molecules on the nerve cell surface with their counterparts, probably CD28 or CTLA4.
Including the finding that it is regulated by interaction with NGF-producing cells that express.
The interaction between the nerve cells and the NGF producing cells causes the NGF producing cells to release NGF into the local environment. The NGF then stimulates the nerve cells to undergo nerve cell differentiation and innervation.

[0015] Some cell surface proteins have been previously identified as cell death proteins. These proteins are thought to be involved in initiating signals that direct cells to die. Cell death proteins include, for example, Fas / CD95 (Trau
th et al., Science 245: 301, 1989), tumor necrosis factor receptor, immune cell receptor (eg, CD40, OX40, CD27, and 4-
1BB (Smith et al., Cell 76: 959, 1994)), and RI
P (U.S. Pat. No. 5,674,734). These proteins are
It is thought to be an important mediator of cell death. However, these mediators do not always direct cells to death. In some cases, these mediators actually direct the cell to undergo cell division. Prior to the present invention, the mechanisms responsible for the dual functionality of these cell death proteins were not understood. According to the present invention, the intracellular environment, in particular the state of the proton motor power, and the source of fuel for mitochondrial metabolism may be such that stimulation of these cell death proteins results in a signal to death or a signal to cell division. It was found to decide what to do.

Major histocompatibility complex (MHC) class II and costimulatory molecule B
It has also been found by the present invention that the modulation of cell surface expression of 7-1 and B7-2 can be manipulated by modulating the intracellular consumption of proton motor power, which can be assessed for mitochondrial membrane potential. Under conditions where the mitochondrial membrane potential is low (electron transfer and oxidative phosphorylation are uncoupled), the cells are conditioned by a non-glucose carbon source (eg, fatty acids or amino acids) due to mitochondrial oxygen consumption.
And MHC class II molecules and costimulatory molecules B7-1 and B7-1
The surface expression of 7-2 increases. Under conditions where mitochondrial membrane potential is high (electron transfer and oxidative phosphorylation are relatively more coupled and glucose is used as a mitochondrial carbon source), MHC class II molecules and co-stimulatory molecules B7-1 and B7-2 surface expression is reduced.

In one aspect, the invention is a method of reducing mitochondrial membrane potential in a mammalian cell. The method comprises providing an MHC class II HLA-DR ligand,
Selectively embed into MHC class II HLA-DR on cell surface (engag
e) administering to said mammalian cells an amount effective to reduce the mitochondrial membrane potential of said mammalian cells, wherein said mammalian cells are not antigen presenting cells. I do. In one embodiment, the MHC class II H
LA-DR is expressed on the surface of mammalian cells. In another embodiment, the method comprises providing a mammalian cell and MHC class II H on the surface of the mammalian cell.
Contacting an MHC class II HLA-DR inducer in an amount effective to induce LA-DR expression.

[0018] The mammalian cell can be any type of cell other than an antigen presenting cell. In one embodiment, the mammalian cell is a tumor cell. Preferred MHC Class I
The I HLA-DR ligand is administered to the tumor cells in vivo in an amount effective to cause cytolysis of the tumor cells. However, where the mammalian cell is a tumor cell, in some embodiments, the MHC class II HLA-DR inducer does not include adriamycin or gamma interferon. In another embodiment, when the mammalian cell is a tumor cell, the MHC class II HLA-DR inducer does not include adriamycin or gamma interferon.

According to another aspect of the present invention, there is provided a method for reducing mitochondrial membrane potential in a mammalian cell. The method comprises administering to the mammalian cell an effective amount of MHC to induce expression of MHC class II HLA-DR on the surface of the mammalian cell.
Contacting with a class II HLA-DR inducer, wherein the mammalian cell is not an antigen presenting cell.

[0020] In another aspect, the invention is a method for increasing mitochondrial membrane potential in a mammalian cell. The method is effective to increase the mitochondrial membrane potential of the mammalian cell such that the MHC class II HLA-DP / DQ ligand is selectively embedded in the MHC class II HLA-DP / DQ on the surface of the cell. Administering to the mammalian cell in an appropriate amount. In this aspect of the invention, the mammalian cell is not an antigen presenting cell.

[0021] In one embodiment, the MHC class II HLA-DP / DQ is expressed on the surface of a mammalian cell. In another embodiment, the present invention relates to a method for producing a mammalian cell comprising an effective amount of MHC class II HLA-DP / DQ to induce expression of MHC class II HLA-DP / DQ on the surface of the mammalian cell. Contacting with an inducer.

According to another embodiment, the mammalian cell is a type I diabetic pancreatic β cell,
And here the MHC class II HLA-DP / DQ ligand is administered to the pancreatic β cells in vivo.

The method of the present invention is useful for inducing cell division, cell lysis, cell differentiation, and cell apoptosis, depending on the metabolic state of the cell. In one aspect, the invention is a method for inducing lysis of a mammalian cell. Contacting the mammalian cell with an amount of an MHC class II HLA-DR inducer effective to induce expression of the MHC class II HLA-DR on the surface of the mammalian cell;
And an MHC class II HLA-DR on the surface of the mammalian cell and an effective amount of MHC class II HLA-D to cause lysis of the mammalian cell.
Contacting with an R ligand.

In one embodiment, the MHC class II HLA-DR ligand is an endogenous MH
C class II HLA-DR ligand, and mammalian cells and this MHC
The step of contacting with a class II HLA-D ligand is a passive step. In another embodiment, contacting the mammalian cell with the MHC class II HLA-DR ligand is an active step.

[0025] The mammalian cell can be any type of cell other than an antigen presenting cell. The mammalian cell is, in another embodiment, a tumor cell. Preferably, the MHC class II HLA-DR ligand is administered to the tumor cells in vivo in an amount effective to cause cytolysis of the tumor cells. However, if the mammalian cell is a tumor cell, the MHC class II HLA-DR inducer does not include adriamycin or gamma interferon.

In one aspect, the invention is a method for inducing cell lysis in a tumor cell. The method comprises the steps of tumor cells and MHC class II HLA on the surface of the tumor cells.
Contacting an effective amount of MHC class II HLA-DR inducer to induce expression of -DR, and MHC class II HLA on the surface of the tumor cells
Contacting -DR with an amount of MHC class II HLA-DR ligand effective to cause lysis of the tumor cells.

[0027] MHC class II HLA-DR inducers include MHC class II on the cell surface.
Any factor that induces the expression of HLA-DR. Preferably, the inducer is a bacterial by-product such as adriamycin, gamma interferon, lipopolysaccharide, a mycobacterial antigen such as BCG, a UCP expression vector, a TCR
It is selected from the group consisting of αβ engagement molecules, and fatty acids. Once the MHC class II HLA-DR is expressed on the cell surface, the MHC class II HLA-DR ligand will
It can interact with DR and cause cell lysis. Preferably, the MHC class II HLA-DR ligand is an anti-MHC class II HLA-DR antibody, C
D4 molecule, αβ T cell receptor molecule, γδ T cell receptor molecule and MHC
It is selected from the group consisting of Class II HLA-DR binding peptides.

[0028] In one embodiment, the MHC class II HLA-DR inducer and MHC
Class II HLA-DR ligand is administered simultaneously. In another embodiment,
MHC class II HLA-DR inducer and MHC class II HLA-D
The R ligand is administered orally. In yet another embodiment, the MHC class II H
The LA-DR inducer and the MHC class II HLA-DR ligand are administered locally.

In another aspect, the invention is a method for inducing cell lysis in a tumor cell.
The method comprises the steps of treating tumor cells and MHC class II HLA- on the surface of the tumor cells.
Contacting an effective amount of an MHC class II HLA-DR inducer to induce expression of DR in the presence of an MHC class II HLA-DR ligand. Preferably, the MHC class II HLA-DR ligand is an MHC class II
It is an HLA-DR expressing cell. In one embodiment, the inducer is a bacterial by-product such as adriamycin, gamma interferon, lipopolysaccharide,
It is selected from the group consisting of a mycobacterial antigen such as BCG, a UCP expression vector, a TCRαβ embedding molecule, and a fatty acid.

[0030] In another embodiment, the MHC class II HLA-DR inducer and the MHC class II HLA-DR ligand are administered orally. In yet another embodiment,
MHC class II HLA-DR inducer and MHC class II HLA-D
The R ligand is administered locally.

According to another aspect of the present invention, there is provided a method for inducing apoptosis in a tumor cell. The method involves contacting a tumor cell with an amount of a metabolic modifier effective to increase the mitochondrial membrane potential of the tumor cell, which, when exposed to the cell, causes a coupling between electron transfer and oxidative phosphorylation. And contacting the tumor cell with an effective amount of an apoptotic chemotherapeutic agent to induce apoptosis in the tumor cell.

Metabolic modifiers are added to tumor cells to induce the coupling between electron transport and oxidative phosphorylation. Preferably, the metabolic modifier is glucose, phorbol myristate acetate in combination with ionomycin, MHC class II HLA-DP / DQ ligand, GDP, CD40 binding peptide, UCP antisense, dominant negative UCP, sodium acetate, and staurosporine. Selected from the group consisting of Once electron transfer is coupled to oxidative phosphorylation, Fas expression can be induced on the cell surface and apoptotic chemotherapeutic agents can be added to induce tumor cell apoptosis. In one embodiment, the apoptotic chemotherapeutic agent is selected from the group consisting of adriamycin, cytarabine, doxorubicin, and methotrexate.

[0033] In one embodiment, the metabolic improving agent and the apoptotic chemotherapeutic agent are administered simultaneously. In another embodiment, the metabolic improving agent and the apoptotic chemotherapeutic agent are administered orally. In yet another embodiment, the metabolic improving agent and the apoptotic chemotherapeutic agent are administered locally.

[0034] In one embodiment, the tumor cells are resistant to an apoptotic chemotherapeutic agent.
In another embodiment, the tumor cells are sensitive to an apoptotic chemotherapeutic agent, and wherein the amount of a metabolic modifier is effective to increase mitochondrial membrane potential,
And the amount of apoptotic chemotherapeutic agent is effective in inhibiting the growth of this tumor cell when mitochondrial membrane potential increases.

According to yet another aspect of the present invention, there is provided a method of reducing mitochondrial membrane potential in cells of a subject. This method uses MHC class II HLA-DR
Administering to the subject a ligand that is selectively embedded in MHC class II HLA-DR on the surface of the mammalian cell in an amount effective to reduce the mitochondrial membrane potential of the mammalian cell. In one embodiment, the method comprises:
Performed in vivo. In another embodiment, the method is performed ex vivo. In this aspect of the invention, mammalian cells include, but are not limited to, antigen presenting cells, T cells and tumor cells.

[0036] In yet another aspect, the invention is a method of increasing mitochondrial membrane potential in a mammalian cell expressing MHC class II HLA-DP / DQ. The method comprises selectively embedding MHC class II HLA-DP / DQ ligand into MHC class II HLA-DP / DQ on the surface of the mammalian cell.
Administering to the mammalian cell an amount effective to increase the mitochondrial membrane potential of the mammalian cell.

In one embodiment, the mammalian cell is a type II diabetic pancreatic β-cell, and wherein the MHC class II HLA-DP / DQ ligand is administered to the pancreatic β-cell in vivo.

According to another aspect, the present invention is a method for reducing mitochondrial membrane potential in a mammalian cell expressing MHC class II HLA-DR. The method comprises the steps of: providing MHC class II HLA-DR ligand in an amount effective to reduce the mitochondrial membrane potential of the mammalian cell;
Administering to the mammalian cells such that they are selectively embedded in LA-DR. Preferably, the mammalian cell is a type I diabetic pancreatic beta cell, and wherein the MHC class II HLA-DR ligand is administered to the pancreatic beta cell in vivo. In one embodiment, the mammalian cell is a tumor cell, and wherein the MHC class II HLA-DR ligand is administered to the tumor cell in vivo.

In another aspect, the invention is a method of treating a subject having tumor susceptibility to treatment using a combination of an apoptotic chemotherapeutic agent and a metabolic improving agent. The method comprises administering to a subject in need of such treatment a combination amount of a combination of an apoptotic chemotherapeutic agent and a metabolic improving agent effective to inhibit tumor growth, The combined amount is the amount of the apoptotic chemotherapeutic agent and the amount of the metabolic modifier, wherein the amount of the metabolic modifier is effective to increase mitochondrial membrane potential, and the amount of the apoptotic chemotherapeutic agent is When the mitochondrial membrane potential is increased, it is effective for inhibiting the growth of tumor cells.

According to another aspect, the invention is a method of treating a subject having a tumor that is resistant to chemotherapy. The method comprises administering to the subject an amount of an apoptotic chemotherapeutic agent, and substantially simultaneously with administering an amount of a metabolic improving agent, wherein the amount comprises: When administered, it is effective in inhibiting the growth of this tumor.

According to another aspect, the present invention is a method for inducing the expression of an immune recognition molecule on a cell surface. The method includes contacting the cell with an amount of a metabolic inhibitor effective to reduce mitochondrial membrane potential, wherein the reduction of mitochondrial membrane potential is caused by the expression of immune recognition molecules on the cell surface. Cause induction. Preferably,
The immune recognition molecule is selected from the group consisting of MHC class II, B7-1, B7-2, and CD-40. Preferably, the metabolic inhibitor is selected from the group consisting of apoptotic chemotherapeutic agents, bacterial by-products, mycobacterial antigens, UCP expression vectors, and fatty acids.

In another aspect, the present invention is a method for inhibiting pancreatic β-cell death in type I diabetes. Progression of pancreatic beta cell death in type I diabetes involves two steps. I
The first phase of type 2 diabetes is the phase of insulinitis that occurs when the membrane potential increases,
Beta cells become Fas positive on the cell surface but become insensitive to Fas death. At this stage, it is desirable to reduce the membrane potential and cause the cells to use fatty acids as fuel and to make the cell surface Fas negative. If diabetes is not treated during the first phase, then it progresses to the second phase. During this second phase, the membrane potential is reduced and if cell surface Fas positivity is maintained, β
The cells are induced to die. Thus, the present invention contemplates a two-phase approach to the treatment of type I diabetes. In the first phase, the subject is treated to reduce the membrane potential of pancreatic beta cells to prevent or reduce the chance of the disease progressing from the phase of insulitis to the phase of cell death. If the disease has already progressed to the cell death phase, subjects are treated to increase the membrane potential of their pancreatic β cells. The method comprises contacting a type I diabetic pancreatic β cell with an amount of a metabolic modifier effective to increase mitochondrial membrane potential in the pancreatic β cell. Preferably, the metabolic modifier is glucose, phorbol myristate acetate in combination with ionomycin, MHC class II HLA-DP / DQ ligand, G
It is selected from the group consisting of DP, CD40 binding peptide, sodium acetate, UCP antisense, dominant negative UCP, and staurosporine. This method is also useful for promoting wound healing in diabetes. In one embodiment, the metabolic modifier is infused with a glucose antagonist, 2deoxyglucose.

According to another aspect of the present invention, there is provided a method for inhibiting pancreatic β-cell death in type I diabetes. The method includes contacting a type I diabetic pancreatic β-cell with an amount of a Fas binding agent effective to inhibit selective Fas implantation on the surface of the pancreatic β-cell.

According to yet another aspect of the present invention, there is provided a method for inducing pancreatic β-cell death in type II diabetes. The method comprises contacting a type II diabetic pancreatic β cell with an amount of an MHC class II HLA-DR inducer effective to induce expression of MHC class II HLA-DR on the surface of the pancreatic β cell; Selectively embedding MHC class II HLA-DR by contacting the cells with an MHC class II HLA-DR ligand effective to induce pancreatic beta cell death. In one embodiment, the MHC class II HLA-DR inducer is a bacterial by-product such as adriamycin, interferon γ, lipopolysaccharide, a mycobacterial antigen such as BCG, a UCP expression vector, a TCRaβ
It is selected from the group consisting of an embedding molecule and a fatty acid.

[0045] In another aspect, the invention is a method for treating a patient having an autoimmune disease to reduce concomitant cell death. The method includes the step of administering to a subject an amount of a γδ binding peptide that specifically binds to γδ cells and is effective to inactivate γδ cells. Here, inactivation of γδ cells inhibits cell death associated with autoimmune diseases. Preferably, the γδ binding peptide is an anti-γδ antibody.

In accordance with another aspect of the present invention, there is provided a method for treating a subject having an autoimmune disease to reduce concomitant cell death. This method provides an extracellular environment with high concentrations of glucose to provide MHC class II HLA-DP / DQ
Stimulating the induction of M. and providing an extracellular environment with low levels of fatty acids
Inhibiting the induction of HC class II HLA-DR. Where MH
Surface expression of C class II HLA-DP / DQ shows reduced cell death associated with autoimmune disease.

A method for screening a subject for susceptibility to atherosclerosis is provided according to another aspect of the invention. The method includes the following steps. Isolating cells selected from the group consisting of peripheral blood lymphocytes and skin from the subject, and MHC class II HLA- DP / DQ and MH
Detecting the presence of an MHC marker selected from the group consisting of C class II HLA-DR. Here, the presence of MHC class II HLA-DP / DQ indicates susceptibility to atherosclerosis, and MHC class II HLA-DP / DQ
The presence of DR indicates resistance to atherosclerosis.

In another aspect, the present invention is a method for selectively killing a Fas ligand-bearing tumor cell. The method includes contacting a Fas ligand-bearing tumor cell with acetate in an amount effective to induce Fas-associated cell death.
In one embodiment, in an amount effective to sensitize the cells to a chemotherapeutic agent,
The Fas ligand-bearing tumor cells are contacted with acetate. This further involves contacting the cells with a chemotherapeutic agent. A preferred chemotherapeutic is methotrexate. The method can also include administering the Fas ligand to the Fas ligand-bearing tumor cells. In a preferred embodiment, the Fas ligand-bearing tumor cells are selected from the group consisting of melanoma cells and colon cancer cells.

[0049] In another aspect, the invention is a method for promoting a Th1 immune response.
The method comprises administering to a subject exposed to an antigen an effective amount of an MHC class II HLA-DR inducer to induce a Th1 immune response to induce DR on T cells. Include. In one embodiment, the MHC class II
HLA-DR inducers are fatty acids.

The present invention also encompasses screening assays. A method for screening a subject's tumor cells for susceptibility to treatment with a chemotherapeutic agent is described in one of the present inventions.
There are two aspects. The assay includes at least the following steps: isolating the tumor cells from the subject; exposing the tumor cells to a chemotherapeutic agent; and Fas molecules on the tumor cell surface, on the tumor cell surface. Detecting the presence of a cell death marker selected from the group consisting of B7 molecule, MHC class II HLA-DR on the surface of tumor cells, and mitochondrial membrane potential indicative of coupling at the cell. Here, the presence of the cell death marker indicates that the cells are sensitive to treatment with a chemotherapeutic agent.

[0051] In one embodiment, the cell death marker is a Fas molecule on the surface of a tumor cell. Here, this method selectively binds a Fas molecule to a Fas molecule to form a Fas molecule.
Contacting with a detection reagent that detects the presence of the molecule. In another embodiment, the cell death marker is an MHC class II HLA-DR molecule on the surface of a tumor cell. Here, the method comprises converting MHC class II HLA-DR molecules into MHC
Selectively binds to Class II HLA-DR molecules to form MHC Class II HLA-
Contacting with a detection reagent that detects the presence of the DR molecule.

Another screening assay of the invention is a method for identifying an anti-tumor drug for killing tumor cells in a subject. The method comprises the following steps:
Isolating tumor cells from a subject; from the Fas molecule on the tumor cell surface, the B7 molecule on the tumor cell surface, the MHC class II HLA-DR on the tumor cell surface, and the mitochondrial membrane potential indicative of conjugation at the cell Detecting the presence of a cell death marker selected from the group consisting of: exposing tumor cells to a putative drug; and detecting any changes in the presence of the putative cell death marker, wherein the putative drug is administered to the subject. Determining whether the drug is an antitumor drug capable of killing the tumor cells.

[0053] A number of tumor cells are isolated from the subject, and a number of tumor cells are screened using a panel of putative drugs in one embodiment of the assay. In another embodiment, the change in the presence of a cell death marker is detected by contacting the tumor cells with a cell death ligand attached to a solid support. Preferably, the cell death ligand is a Fas ligand.

[0054] Yet another assay of the present invention is a method of screening a subject for susceptibility to a disease. The method comprises the steps of: isolating cells selected from the group consisting of peripheral blood lymphocytes from the subject and skin;
And MHC class II HLA-DP / DQ, B7-2, B7 on cell surface
-1 and MHC selected from the group consisting of MHC class II HLA-DR
Detecting the presence of the marker. Here, MHC class II HLA-DP / D
The presence of Q indicates susceptibility to atherosclerosis and resistance to autoimmune diseases, and MHC class II HLA-DR, B7-2, or B7
The presence of -1 indicates resistance to atherosclerosis and susceptibility to autoimmune disease.

The present invention also includes a kit. One kit of the present invention is a kit for screening a subject for susceptibility to a disease. The kit comprises a container containing a first binding compound that selectively binds to a protein selected from the group consisting of B7-2, B7-1 and MHC class II HLA-DR; MHC class II HLA A container containing a second binding compound that selectively binds to the DP / DQ protein; and the isolated cells of the subject selectively interact with the first or second binding compound. Includes instructions for deciding whether to do so. Here, the MH on the cell surface interacting with the second compound
Presence of C class II HLA-DP / DQ indicates susceptibility to atherosclerosis and resistance to autoimmune disease, and presence of MHC class II HLA-DR on cell surface interacting with first compound Indicates resistance to atherosclerosis and susceptibility to autoimmune disease.

Another kit of the invention is a kit for screening a subject's tumor cells for susceptibility to treatment with a chemotherapeutic agent. The kit comprises a container containing a cell death marker detection reagent; and a Fas molecule on the tumor cell surface, an MHC class II HLA-DR on the tumor cell surface, and a mitochondrial membrane potential indicative of conjugation at the cell. Instructions for using a cell death marker detection reagent for detecting the presence of a cell death marker selected from: Here, the presence of the cell death marker indicates that the cells are sensitive to treatment with a chemotherapeutic agent.

In some embodiments, the kit also includes a container containing the chemotherapeutic agent, or a panel of chemotherapeutic agents housed in separate compartments. In another embodiment, the kit also includes a cell death ligand. Preferably, the cell death ligand is coated on a solid surface. In another preferred embodiment, the cell death ligand is a Fas ligand.

In another aspect, the invention is a method for selectively killing cells. The method includes contacting the cell with a nucleic acid selected from the group consisting of a UCP antisense nucleic acid and a UCP dominant negative nucleic acid in an amount effective to inhibit UCP function.

[0059] In one embodiment, the cell death marker is a Fas molecule on the surface of a tumor cell. Here, the method includes contacting the Fas molecule with a detection reagent that selectively binds to the Fas molecule and detects the presence of the Fas molecule. In another embodiment, the cell death marker is an MHC class II HLA-DR molecule on the surface of a tumor cell. Here, the method comprises selectively binding MHC class II HLA-DR molecules to MHC class II HLA-DR molecules to form MHC class II HLA-D molecules.
Contacting with a detection reagent for detecting the presence of the R molecule.

In another aspect, the present invention is a composition of a metabolic improving agent and an apoptotic chemotherapeutic agent. Preferably, the metabolic modifier is glucose, phorbol myristate acetate in combination with ionomycin, MHC class II HLA-DP.
/ DQ ligand, GDP, CD40 binding peptide, sodium acetate, UCP antisense, dominant negative UCP, and staurosporine. In a preferred embodiment, the apoptotic chemotherapeutic agent is selected from the group consisting of adriamycin, cytarabine, doxorubicin, and methotrexate.

[0061] In one embodiment, the metabolic improving agent and the apoptotic chemotherapeutic agent are present in an amount effective to inhibit tumor cell growth. In another embodiment, the composition comprises a pharmaceutically acceptable carrier.

According to another aspect, the present invention is a composition of an MHC class II HLA-DR inducer and an MHC class II HLA-DR ligand. In one embodiment, the MHC class II HLA-DR inducer is a bacterial by-product such as adriamycin, interferon gamma, lipopolysaccharide, a mycobacterial antigen such as BCG, a UCP expression vector, a TCRαβ embedding molecule, and It is selected from the group consisting of fatty acids. In another embodiment, the MHC class II HLA-DR
Ligands include anti-MHC class II HLA-DR antibodies, CD4 molecules, αβ T cell receptor molecules, γδ T cell receptor molecules, and MHC class II HLA
-Selected from the group consisting of DR binding peptides. According to yet another embodiment,
MHC class II HLA-DR inducer and MHC class II HLA-D
The R ligand is present in an amount effective to lyse the tumor cells. The composition can be formulated in a pharmaceutically acceptable carrier.

The present invention also provides that neuronal differentiation and apoptosis may occur through the interaction of immune recognition molecules on the surface of nerve cells with NGF-producing cells that express their counterparts, such as CD28 or CTLA4. Including the finding that it is regulated. The interaction between neurons and NGF producing cells causes NGF producing cells to release NGF into the local environment. This NGF then stimulates the nerve cells to undergo nerve cell differentiation and innervation.

In another aspect, the invention relates to methods and products for modulating neuronal cell proliferation, differentiation, and apoptosis. In one aspect, the invention is a method for inducing neuronal cell differentiation. The method comprises the following steps:
Contacting the neural cell with an amount of a B7 inducer effective to induce expression of B7 on the surface of the neural cell;
exposing to a activating cell to cause neuronal cell differentiation.

[0065] In another aspect, the present invention is a method for inducing neuronal cell differentiation. This method comprises the steps of: in the presence of endogenous nerve-activating cells, transforming the nerve cells into B7 on the nerve cell surface.
Contacting with a B7 inducer in an amount effective to induce expression of B7.

In some embodiments, the B7 inducer is adriamycin, interferon gamma, fatty acid, lipoprotein, anti-MHC class II HLA-DR antibody, MHC class II HLA-DR binding peptide, B7 expression vector, or U7
It is a CP expression vector.

In another embodiment, the method also comprises the step of contacting the neuron with the B7 inducer prior to contacting the neuron with a B7 inducer.
Contacting the nerve cells with an effective amount of a metabolic modifier (which causes increased coupling between electron transfer and oxidative phosphorylation when exposed to cells) to avoid loss of Include. In some embodiments, the metabolic modifier is glucose, phorbol myristate acetate in combination with ionomycin, MHC
Class II HLA-DP / DQ ligands, GDP, CD40 binding peptides, sodium acetate, UCP antisense, dominant negative UCP, and staurosporine. In another embodiment, the neural activating cell is a T cell, macrophage, or dendritic cell.

[0068] In yet another embodiment, the method includes administering a fatty acid to the nerve cell to stop cell division.

In yet another embodiment, the method comprises inducing expression of a receptor for a nerve growth factor.

According to another aspect, the present invention is a method for inducing apoptosis in a nerve cell. The method comprises the steps of: an amount of a metabolic modifier effective to avoid loss of proton motive force in a nerve cell, which, when exposed to a nerve cell, undergoes electron transport and oxidative phosphorylation. Causing an increase in coupling with oxidation) and contacting the nerve cells, and contacting the nerve activated cells with an amount of a B7 receptor blocker effective to induce apoptosis in the nerve cells.

In various embodiments, the metabolic modifier is glucose, phorbol myristate acetate in combination with ionomycin, MHC class II HLA-DP.
/ DQ ligand, GDP, CD40 binding peptide, sodium acetate, UCP antisense, dominant negative UCP, or staurosporine. In various other embodiments, the B7 receptor blocker is an anti-CD28 antibody, CD28
It is a binding peptide, a CTLA4 analog, an anti-CTLA4 antibody, or a CTLA4 binding peptide.

The present invention also includes compositions related to the above methods. In one aspect, the invention is a composition of a metabolic improver and a B7 receptor blocker.

In various embodiments, the metabolic modifier is glucose, phorbol myristate acetate in combination with ionomycin, MHC class II HLA-DP
/ DQ ligand, GDP, CD40 binding peptide, sodium acetate, UCP antisense, dominant negative UCP, or staurosporine. In various other embodiments, the B7 receptor blocker is an anti-CD28 antibody, CD28
It is a binding peptide, a CTLA4 analog, an anti-CTLA4 antibody, or a CTLA4 binding peptide.

In another embodiment, the metabolic modifier and the B7 receptor blocker are present in an amount effective to induce neuronal apoptosis. In yet another embodiment, the composition also includes a pharmaceutically acceptable carrier.

[0075] Compositions of B7 and CD28 inducers are provided in another aspect of the invention.

In some embodiments, the B7 inducer is a bacterial by-product such as adriamycin, interferon gamma, lipopolysaccharide and lipoprotein, BCG
Mycobacterial antigens such as, and fatty acids, anti-MHC class II HLA-D
R antibody, MHC class II HLA-DR binding peptide, B7 expression vector or UCP expression vector. In another embodiment, the CD28 inducer is T
Cell receptor embedding molecule, CD3 embedding molecule, IL4, or CD28 expression vector. In yet another embodiment, the composition also includes a pharmaceutically acceptable carrier.

In accordance with another aspect of the present invention, there is provided a method for re-innervating damaged tissue. The method involves implanting B7 expressing neurons into the damaged tissue. Here, the transplanted B7-expressing nerve cells undergo nerve differentiation and re-innervate the damaged tissue in the presence of nerve activating cells in the damaged tissue.

[0078] In one embodiment, the B7 expressing neuron constitutively expresses B7. In another embodiment, the B7 expressing neuron is a neuron that constitutively expresses the UCP gene. In yet another embodiment, the B7 expressing neuron is a neuron that constitutively expresses the B7 gene.

In another embodiment, the method comprises administering a B7 inducer effective to induce endogenous B7 expression on the surface of the nerve cell.

The damaged tissue can be any tissue in which the nerve has been damaged. In one embodiment, the damaged tissue is the spinal cord. In another embodiment, the damaged tissue is an amputated limb.

[0081] A method for treating a neurodegenerative disorder is provided according to another aspect of the invention. The method includes administering an amount of a B7 inducer effective to induce expression of B7 on the surface of the nerve cell.

In some embodiments, the B7 inducer is a bacterial by-product such as adriamycin, interferon gamma, lipopolysaccharide and lipoprotein, BCG
Mycobacterial antigens such as, and fatty acids, anti-MHC class II HLA-D
R antibody, MHC class II HLA-DR binding peptide, B7 expression vector or UCP expression vector.

The method also includes inducing CD28 expression on the surface of the nerve activated cells. Preferably, the nerve activating cells are T cells. In another preferred embodiment, the neural activating cells are macrophages, B cells, or dendritic cells.

[0084] In yet another embodiment, the neurodegenerative disorder is complete paralysis, Parkinson's disease,
It is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, and multiple sclerosis.

According to another aspect, the present invention is a method for selectively killing cells. The method includes contacting a cell with a nucleic acid selected from the group consisting of a UCP antisense nucleic acid and a UCP dominant negative nucleic acid in an amount effective to inhibit UCP function.

[0086] In another aspect, the invention is a method for selectively killing tumor cells. The method comprises the steps of: contacting an acetate with a tumor cell in an amount effective to induce cell surface Fas expression; and in an amount effective to induce Fas-associated cell death. Administering a Fas ligand to the tumor cells.
In one embodiment, the tumor cells are contacted with the acetate in an amount effective to sensitize the cells to a chemotherapeutic agent. This further includes contacting the cells with an apoptotic chemotherapeutic agent.

[0087] A method for selectively killing tumor cells is provided according to another aspect of the invention. The method comprises the steps of providing acetate, GDP, glucose in an amount effective to kill tumor cells.
And contacting a tumor cell with a compound selected from the group consisting of apoptotic chemotherapeutic agents.

Each limitation of the present invention may encompass various embodiments of the present invention. It is therefore anticipated that each limitation of the invention, including any one element, or combination of elements, may be included in each method and each product.

[0089] These and other aspects of the invention are described in more detail below.

BRIEF DESCRIPTION OF SEQUENCES SEQ ID NO: 1 is the nucleotide sequence of human B7 (B7.1) cDNA (G
enBank registration number: M27533).

[0091] SEQ ID NO: 2 is the predicted amino acid sequence of the translation product of human B7 (B7.1) cDNA (SEQ ID NO: 1).

[0092] SEQ ID NO: 3 is the nucleotide sequence of human B7.2 cDNA (GenB
ank registration number: U04343).

SEQ ID NO: 4 is the predicted amino acid sequence of the translation product of human B7.2 cDNA (SEQ ID NO: 3).

SEQ ID NO: 5 is the nucleotide sequence of the human uncoupled (UCP-1) cDNA (has GenBank accession number: U28480).

SEQ ID NO: 6 is the predicted amino acid sequence of the translation product of human uncoupled cDNA (UCP-1) (SEQ ID NO: 5).

SEQ ID NO: 7 is the nucleotide sequence of human uncoupled (UCP-2) cDNA (has GenBank accession number: U82819).

SEQ ID NO: 8 is the deduced amino acid sequence of the translation product of human uncoupled cDNA (UCP-2) (SEQ ID NO: 7).

SEQ ID NO: 9 is the nucleotide sequence of the human uncoupled (UCP-3S) cDNA (having GenBank accession number: U82818).

SEQ ID NO: 10 is the predicted amino acid sequence of the translation product of human uncoupled cDNA (UCP-3S) (SEQ ID NO: 9).

SEQ ID NO: 11 is the nucleotide sequence of the human CD28 cDNA (Ge
nBank registration number: J02988).

SEQ ID NO: 12 is the predicted amino acid sequence of the translation product of human CD28 cDNA (SEQ ID NO: 11).

[0102] SEQ ID NO: 13 is the amino acid sequence of the peptide.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to methods and products related to controlling cell division, differentiation, death, and apoptosis by modulating cell surface immune recognition molecules. 1 of the present invention
According to one aspect, the proton motor force
e) (evaluated as mitochondrial metabolism) was found to be implicated in the regulation of cell division and cell apoptosis. The ability to manipulate mitochondrial metabolic processes has led to the development of methods for treating diseases associated with excessive cell proliferation or immature cell death. In addition, the ability of neurons to manipulate the expression of cell surface immune recognition molecules so that they can stimulate local NGF production from NGF producing cells is a potential method of treating neurodegenerative diseases associated with immature cell death. Has led the development.
Also, according to the present invention, regulation of proton motor power (mitochondrial metabolism)
It is directly related to the expression of these cell surface immune recognition molecules involved in the signaling process of cell death and immune response signaling, and thus can be manipulated as one way to regulate the expression of immune recognition molecules. The ability to control the expression of these cell surface molecules is useful and is a powerful technique for therapeutically manipulating the processes of cell death, apoptosis, differentiation, and proliferation. Monitoring the expression of these proteins is also useful for screening assays to assess disease states and mitochondrial metabolic status of cells.

Based on all of these findings, the present invention in some aspects encompasses methods for increasing or decreasing mitochondrial membrane potential in mammalian cells. The ability to manipulate the mitochondrial membrane potential of a cell provides the ability to control the fate of the cell. If the membrane potential of a cell decreases and the cell uses fatty acids as fuel, the cell may interpret the signal as a signal of cell death. However, if the membrane potential of the cell rises and the cell is using glucose as fuel, the same signal can be interpreted as a signal that divides rather than cell death. The present invention includes mechanisms for controlling these complex interactions to regulate cell death and division processes.

One way to cause a decrease in mitochondrial membrane potential and to switch to the use of fatty acids as fuel is to use MHC class II H on the surface of cells.
By inducing the expression of LA-DR. Low levels of MHC class II HLA-D
If R is already expressed on the surface, the cell is treated with MHC class II HL
Contact with A-DR ligand can cause a further decrease in mitochondrial membrane potential. The cell has been induced to express MHC class II HLA-DR on the cell surface, so that electron transfer is uncoupled, the cell is using fatty acids as fuel, and the cell is When in contact with a II HLA-DR ligand, the cell then generally interprets the signal as a signal of cell death and causes cell lysis.

The present invention also includes a method for causing an increase in mitochondrial membrane potential. This increase is achieved in some aspects by inducing expression of MHC class II HLA-DPDQ to the surface of cells, with the use of glucose as a fuel. If low levels of MHC class II HLA-DPDQ are already expressed on the surface, the cells are contacted with MHC class II HLA-DPDQ ligands, further increasing mitochondrial membrane potential and estimating electron transfer and oxidative phosphorylation. It can cause an increase in conjugation. MHC class II on the cell surface
HLA-DPDQ has been induced to express, so that electron transfer is
If relatively conjugated and the cell is using glucose as a fuel, and the cell has been contacted with an MHC class II HLA-DPDQ ligand, then the cell will generally use the signal as a cell division signal Interpret and cause cell division.

The methods of the present invention have broad utility in regulating mammalian cell growth and death in vitro, in vivo, and ex vivo. Since mammalian cells utilize the fundamental processes of mitochondrial metabolism in regulating their own growth and differentiation, any type of mammalian cell can be manipulated according to the methods of the present invention. A method for increasing or decreasing mitochondrial metabolism is described in MHC Class I
I HLA-DPDQ or -DR expressing cells were isolated from MHC class II H
When performed in vitro by contacting with LA-DPDQ or -D ligand, the method is not performed on antigen presenting cells. However, if the same methods are performed ex vivo or in vivo, they can be performed on antigen presenting cells as well as on any type of mammalian cells. "Antigen-presenting cell" is used herein consistent with its well-known meaning in the art, and includes, for example, dendritic cells, macrophages, and the like. The in vitro methods of the invention are useful for various purposes.
For example, the method of the present invention can be used to identify a drug that has an effect, such as a prophylactic effect on cell division or cell death, by contacting a cell that has been made to undergo cell division and cell death by manipulation of the present invention. May be useful for

In addition to in vitro methods, the methods of the invention may be performed in vivo or ex vivo in a subject, and may manipulate one or more cell types in the subject. As used herein, an “ex vivo” method is a method that involves the isolation of cells from a subject, the manipulation of cells outside the body, and the retransplantation of the engineered cells into the subject. Ex vivo procedures can be used on autologous or heterologous cells, but are preferably used on autologous cells. In a preferred embodiment, the ex vivo method is performed on cells isolated from a body fluid, such as peripheral blood or bone marrow, but can be isolated from any source of cells. When returned to the subject, the engineered cell is programmed for cell death or cell division depending on the treatment to which it has been exposed. Ex vivo manipulation of cells is described in several references in the art (Engleman, EG, 1
997, Cytotechnology, 25: 1; Van Schoten.
, W.S. , Et al., 1997, Molecular Medicine Today,
June, 255; Steinman, R .; M. , 1996, Experime
ntal Hematology, 24, 849; and Gluckman, J
. C. , 1997, Cytokines, Cellular and Mole.
Cultural Therapy, including 3: 187). Ex vivo activation of the cells of the invention can be performed by conventional ex vivo manipulation steps known in the art. In vivo methods are also well known in the art. A subject as used herein refers to humans, horses, cows, pigs, sheep, goats, dogs, cats, and rodents. Accordingly, the present invention is useful for therapeutic purposes and also for research purposes, such as testing in animals or in vitro models of medical, physiological, or metabolic pathways or conditions.

[0109] In a preferred embodiment of the present invention, the mammalian cells are tumor cells. Although this method is useful for inducing cell lysis in many types of mammalian cells,
In particular, it is useful for inducing cell lysis in tumor cells. As used herein, "tumor cell" refers to a cell that has undergone unwanted mitotic growth. As used in the in vitro aspects of the invention, tumor cells can be isolated from a tumor in a subject or can be part of an established cell line. The tumor cells in the subject can be part of any type of cancer. Cancers include, but are not limited to: biliary tract cancer; brain cancer (including glioblastoma and medulloblastoma);
Breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; hematological neoplasms (including acute lymphoid and myeloid leukocytes); multiple myeloma; AIDS-related leukemia and adult T cells Leukemia lymphoma; In situ neoplasms (including Bowen's disease and Paget's disease); liver cancer; lung cancer; lymphoma (including Hodgkin's disease and lymphocytic lymphoma); neuroblastoma; oral cancer (including squamous cell carcinoma) ); Ovarian cancer, including those arising from epithelial, stromal, germ, and mesenchymal cells
Pancreatic cancer; prostate cancer; rectal cancer; sarcomas (including leiomyosarcoma, rhabdomyosarcoma, liposarcoma, fibrosarcoma, and osteosarcoma); skin cancer (melanoma, Kaposi's sarcoma, basal cells (b
testicular cancer (including germ cell carcinoma (ger)
minal tumour) (seminoma, nonseminoma [teratoma, choriocarcinoma]),
Thyroid carcinoma (including thyroid and medullary carcinoma); including stromal tumor and germ cell carcinoma;
And kidney cancer (including adenocarcinoma and Wilms tumor).

[0110] The mammalian cell is a tumor cell and the cell is an MHC class II HLA
In aspects of the invention that are treated only with a -DR inducer but not with an MHC class II HLA-DR ligand, the MHC class II HLA-DR inducer does not include adriamycin and gamma interferon. When the MHC class II HLA-DR inducer is adriamycin or gamma interferon, the method of lysing tumor cells comprises:
An additional step of contacting the R ligand and causing cell lysis is required.

Cell lysis is necrotic cell death caused by osmotic rupture.

As used herein, “MHC class II HLA-DR inducer” refers to MHC class II HLA-DR inducer.
It is a factor that causes HC class II HLA-DR to be expressed on the cell surface. Preferably, the MHC class II HLA-DR inducer is a pharmacological agent that causes uncoupling and oxidative phosphorylation of electron transfer, resulting in a decrease in mitochondrial membrane potential in the cell. MHC class II HLA-DR
Inducers include, but are not limited to, adriamycin, gamma interferon, bacterial by-products (eg, lipopolysaccharide), mycobacterial antigens (eg, BCG), UCP expression vectors, TCRαβ embedding molecules, and fatty acids. Gamma interferon is used for MHC class II HLA-DR and MHC
MHC class II, which induces expression of both HC class II HLA-DP / DQ, but still binds selectively to MHC class II HLA-DR, but does not bind to MHC class II HLA-DP / DQ It can be used in combination with an HLA-DR ligand. MHC class II HLA-DR inducer is an isolated molecule. An isolated molecule is one that has been removed from its natural environment and has been formulated for administration to an organism. Adriamycin, gamma interferon, bacterial by-products (eg, lipopolysaccharide), mycobacterial antigens (eg, BCG) are all well known compounds that can be purchased from a variety of commercial sources. UCP expression vectors can be prepared by methods well known in the art. Such a method is described in detail below. Fatty acids are also well-known compounds that can be purchased commercially from many sources. Preferred fatty acids include, but are not limited to, oleic acid, palmitate, myristic acid. As used herein, “TCRaβ embedded molecule” refers to any compound that can bind to the cell surface and cause cross-linking of CD4 and αβT cell receptor (αβTCR) at the cell surface. Such compounds are well-known in the art. For example, heterobifunctional antibodies can crosslink CD4 and αβ TCR by interacting with both molecules on the cell surface. Other CD4
A / αβ TCR binding molecule can be identified using routine experimentation and is also encompassed by the term TCRαβ embedding molecule. Conventional screening methods for identifying such binding molecules are set forth below.

[0113] MHC Class II HLA-DR refers to a subregion of the human major histocompatibility class II locus. As used herein, “MHC class II HLA-
"DR" is a protein expressed on the surface of cells corresponding to the MHC class II HLA-DR locus. Although the term HLA-DR refers to the human subclass of MHC, the present invention refers to other species of corresponding MHC subclasses, which have different nomenclature such as the IE region in the corresponding subclass of mouse. It is intended to include.

As used herein, “MHC class II HLA-DR ligand”
Binds to MHC class II HLA-DR and binds to MHC class II HLA-D.
R-specific intramolecular signal stimulation A molecule that stimulates cell lysis. MHC class II
HLA-DR ligands are MHC class II HLA-DR binding peptides that result in cell surface cross-linking of MHC class II HLA-DR molecules. Such ligands are well known in the art and are available from anti-MHC class II HLA-DR antibodies (eg, those commercially available from Becton Dickinson and many other sources), CD4 peptides, γδ T cell receptors (TCR C) peptides, αβ TCR peptides, and other binding peptides, including but not limited to, optionally linked to a delivery vehicle such as a liposome.
The CD4, γδ TCR, and αβ TCR peptides are well-known cell surface molecules. These peptides can be used as ligands in a soluble form, or can be conjugated or conjugated to carriers such as liposomes or particles (other chemical / physical vectors useful for this purpose). Is
Described below). In addition to these known binding peptides, other MHC Class II HLA-DR binding peptides can be identified using routine experimentation and are also encompassed by the term MHC Class II HLA-DR ligand. Conventional screening methods for identifying such binding molecules are set forth below.

Cell lysis can be assessed by any method known in the art for making such measurements. For example, cell lysis includes direct histological analysis, comparison of intact cell numbers using a coulter counter,
And flow cytometry. These methods are well known in the art and some are described in more detail in the Examples section below.

“MHC class II HLA-DR ligand” as used herein is an isolated molecule. An isolated molecule is one that has been removed from its natural environment and has been formulated for administration to an organism.

[0117] The methods of the invention in some aspects also include endogenous MHC class II HL.
This can be done using A-DR ligands. "Endogenous MHC class II HLA-
The "DR ligand" is an isolated composition of "MHC class II" used above.
HLA-DR ligand ". For example, endogenous MHC class II HL
The A-DR ligand can be a cell having a cell surface MHC class II HLA-DR binding peptide. In this case, the method comprises placing the tumor cells on the surface of the tumor cells in the presence of endogenous MHC class II HLA-DR ligand.
Effective amount of MHC class II HLA-D to induce expression of HLA-DR
Only the step of contacting with the R inducer is included.

Endogenous MHC class II HLA-DR ligands are already MHC class II
If the cell has a cell surface MHC class II HLA-DR binding peptide that is close enough to interact with HLA-DR, the cell need not be manually contacted with MHC class II HLA-DR. Absent.

Another aspect of the invention involves the induction of apoptosis in tumor cells, rather than lysis. In both apoptosis and cell lysis, the cells die, but the process occurs by different mechanisms and when the cells are in different metabolic states. As noted above, when the method of the invention is performed to induce cell lysis in a tumor cell, the cell is in an uncoupled state.
When the method of the invention is performed to induce apoptosis, the cells are brought into a coupled state. A method for inducing apoptosis in tumor cells is to treat the tumor cells with an effective amount of a metabolic modifier (e.g., electron transfer and oxidative (Causing conjugation with phosphorylation) as well as contacting the tumor cells with an amount of a chemotherapeutic agent effective to induce apoptosis in the tumor cells.

Apoptosis is a process of cell death in which cells undergo shrinkage and fragmentation, which then undergo phagocytosis of the cell fragments. Apoptosis is well known in the art and can be assessed by any art-known method. For example, apoptosis is easily determined using flow cytometry, which distinguishes between live and dead cells. Flow cytometry is described in more detail in the examples below.

As used herein, a “metabolic modifier” causes a coupling between electron transfer and oxidative phosphorylation when exposed to a cell, resulting in an increase in mitochondrial membrane potential within the cell. Is a factor that causes Metabolic modifiers include phorbol myristate acetate in combination with glucose, sodium acetate, ionomycin, MH
C class II HLA-DP / DQ ligand, guanosine diphosphate (GD
P), CD40 binding peptide, sodium acetate, UCP antisense, dominant negative UCP, and staurosporine. Glucose, phorbol myristate acetate, ionomycin, GDP, and staurosporine are all well-known commercially available compounds that are available from many sources. A CD40 binding peptide is any peptide molecule that interacts with CD40 and causes CD40 crosslinking on the cell surface. These molecules include
For example, the well-known molecule CD40 ligand is included. CD40 binding peptides include, but are not limited to, CD40 ligand, other molecules that can be identified by routine experimentation. Conventional screening methods for identifying such binding molecules are set forth below. UCP antisense molecules and dominant negative UCP
Molecules are also known in the art and are described in more detail below.

[0122] MHC Class II HLA-DR / DQ refers to another subregion of the human major histocompatibility class II locus. As used herein, “MHC class II
"HLA-DP / DQ" is a protein expressed on the surface of cells corresponding to the MHC class II HLA-DP / DQ locus. Although the term HLA-DP / DQ refers to the human subclass of MHC, the present invention contemplates the corresponding MHC subclasses in other species, which have different nomenclature such as the IA region in the mouse subclass. ).

As used herein, “MHC class II HLA-DP / DQ ligand” refers to an MHC class II HLA-DP / DQ that binds to MHC class II HLA-DP / DQ and Class II A molecule that stimulates HLA-DP / DQ-specific intracellular signal stimulation coupling, resulting in an increase in mitochondrial membrane potential. MHC class II HLA-DP / DQ ligands include anti-MHC class II HLA-DP / DQ ligand antibodies, other binding peptides, and cell surface M
Includes, but is not limited to, cells having an HC class II HLA-DP / DQ binding antigen. MHC class II HLA-DP / DQ ligand
If the cell has a cell surface MHC class II HLA-DP / DQ-binding antigen that is already close enough to interact with class II HLA-DP / DQ, then the cell is identified as having MHC class II HLA-DP / DQ. No manual contact has to be made.

As used herein, the term “proton motor power dissipation” refers to the relative amount of protons in mitochondria. It can be assessed by measuring mitochondrial membrane potential. As used herein, “mitochondrial membrane potential” is the pressure on the inside of the mitochondrial cell membrane measured relative to the extracellular fluid created by the creation and dissipation of charge within the mitochondria. The mitochondrial membrane potential is maintained by the mitochondrial energy generation system. In most tissues, electron transfer is coupled to oxidative phosphorylation, resulting in the production of ATP from glucose. Uncoupling proteins (UCPs) can cause a reversible uncoupling of electron transfer and oxidative phosphorylation, which leads to a decrease in mitochondrial membrane potential. Other tissues, often referred to as immuno-privileged tissues (eg, brain, testis, ovary, eye, and pancreatic beta cells), do not couple electron transfer with oxidative phosphorylation under normal conditions. To express UCP. In these organizations,
Glucose cannot be converted to ATP, while UCP is active for uncoupling and the energy produced is converted to other forms of energy, such as heat, and released. The metabolic processing system in these tissues
If conjugated, the membrane potential increases.

[0125] Absolute levels of mitochondrial membrane potential vary depending on the cell or tissue type. As used herein, "increased mitochondrial membrane potential" is an increase in the cell under test as compared to the normal state, and results from the prevention of dissipation of proton motor power. "Prevention," as used herein, refers to a reduction or reduction in the amount of dissipation normally occurring in the absence of an applied stimulus to cause conjugation in accordance with the methods of the present invention. When electron transfer and oxidative phosphorylation are usually uncoupled in cells, the baseline potential is relatively low, and when the ATP-generating system is conjugated, the mitochondrial membrane potential increases from its baseline level. Is observed. Similarly, "decrease in mitochondrial membrane potential" is a decrease compared to the normal state of the cell being tested, resulting from dissipation of proton motor power. When electron transfer and oxidative phosphorylation are normally coupled in cells, the baseline potential is relatively high, and when the ATP-generating system is uncoupled, a decrease in mitochondrial membrane potential from baseline levels is observed. You.

[0126] Changes in mitochondrial membrane potential can be assessed by any method known in the art for making such measurements. For example, mitochondrial membrane potential can be measured by cytometry by incubating cells with 5 mg / ml JC- ¹³⁹ (a fluorescent probe capable of binding to mitochondria) for 20 minutes at room temperature. The state of aggregation and consequently the fluorescence emission of JC-1 changes as the mitochondrial membrane potential changes. Valinomycin, which disrupts mitochondrial membrane potential, can be used as a positive control treatment. Flow cytometry allows testing of up to four fluorescent markers simultaneously. This method is described in more detail in the examples below. In addition to testing mitochondrial membrane potential, studies can be performed to measure the rate of glucose utilization and oxidation, and measurements of proton efflux can be assessed by top-down elasticity analysis, each of This will be described in more detail by way of example.

The relationship between mitochondrial metabolism and cell surface Fas expression is important for the method of the invention. When cells are conjugated, Fas is expressed on the cell surface, and when cells are unconjugated, Fas is generally transported to an intracellular depot. If the cell is conjugated and Fas is on the surface, implantation of Fas sends a signal to the cell instructing it to divide. When a chemotherapeutic agent is added, the signal then changes to a signal that directs the cells to undergo apoptosis. If the cells are not conjugated, normal Fas will not be expressed on the cell surface. Under certain disease states, such as type I diabetes (discussed in more detail below), or when cells are being irradiated, Fas may be expressed on the surface of uncoupled cells. When this occurs, implantation of Fas signals the cell to die.

“Apoptotic chemotherapeutic agents” as used herein are a group of molecules that function by a variety of mechanisms to induce apoptosis in rapidly dividing cells. Apoptotic chemotherapeutic agents are a class of chemotherapeutic agents well known to those skilled in the art. Chemotherapeutic agents include Goodman and Gilman's "The Phar
Maclogic Basic of Therapeutics ", 8th edition, 1990, McGraw-Hill, Inc (Health Profile
session Division, Chapter 52, Antineoplastic Agents (Paul Calab), incorporated herein by reference.
resi and Bruce A. Chabner) and its introduction, 120
2-1263. Suitable chemotherapeutic agents can have various mechanisms of action. Suitable classes of chemotherapeutic agents include: (a) Nitrogen mustards (eg, mechlorethamine, cyclophosphamide (cylo)
phosphamide, ifosfamide, melphalan, chlorambucil)
, Ethyleneimine, and methylmelamine (eg, hexamethylmelamine, thiotepa), alkylsulfonates (eg, busulfan), nitrosoureas (
For example, columnastin, also known as BCNU, lomustine, also known as CCNU, semustine, also known as methyl CCNU, chlorozotocin (ch
lorozoticin), streptozocin), and alkylating agents such as triazines (e.g., dicarbazine also known as DTIC); (b) folate analogs (e.g., methotrexate), pyrimidine analogs (e.g., 5-fluorouracilfuroxy) (C) Vinca alkaloids; uridine, cytarabine, and azauridine, and their prodrug forms azaribine), and purine analogs and anti-metabolites such as related substances (eg, 6-mercaptopurine, 6-thioguanine, pentostatin); (Eg, vinblastine, vincristine), epipodophyllotoxin (epipod)
ophylotoxin) (eg, etoposide, teniposide), antibiotics (eg, dactinomycin, also known as actinomycin D, daunorubicin, doxorubicin, bleomycin, plicamicin).
, Mitomycin, 4-epidoxorubicin epirubicin, 4-dimethoxydaunorubicin idarubicin, and mitoxantrone (mitoxan
throne)), enzymes (eg, L-asparaginase), and natural products such as biological response modifiers (eg, interferon α); (d) platinum coordination complexes.
) (Eg, cisplatin, carboplatin), substituted ureas (eg, hydroxyurea), methylhydrazine derivatives (eg, procarbazine), adrenal cortex (a
Drecortical) inhibitors (eg mitotane, aminoglutethimide)
Miscellaneous Agents such as Taxol (Miscellaneou Agent); (
e) corticosteroids (eg, prednisone), progestins (eg, hydroxyprogesterone caproate, medroxyprogesterone acetate, megesterol acetate), estrogens (eg, diethyl estilbestrol, ethinyl estradiol, etc.), antiestrogens (eg, For example,
Hormones and antagonists such as tamoxifen), androgens (eg, testosterone propionate, fluoxymesterone, etc.), antiandrogens (eg, flutamide), and gonadotropin-releasing hormone analogs (eg, leuprolide), and (F) adriamycin Such DNA damaging compounds.

In addition to methods of engineering cells, the present invention also provides for screening cells, such as tumor cells, alone or in combination with treatment with chemotherapeutic agents or other cellular signals, wherein the cells are cells. Useful for determining whether or not susceptibility to division or cell death, and for kits for performing such screening assays. The screening method involves isolating tumor cells from a subject and exposing the tumor cells to a chemotherapeutic agent, preferably several different doses of several different chemotherapeutic agents can be screened at one time. It can be achieved by a process. The presence of a cell death marker can then be detected. The level of the cell death marker indicates that the cells are sensitive to treatment with a chemotherapeutic agent.

A “cell death marker” as used herein is a cell surface molecule that indicates that a cell is susceptible to cell death. Although there are various cell death markers, preferred cell death markers useful according to the invention include Fas molecules on the surface of tumor cells, MHC class II HLA-DR on the surface of tumor cells, and Includes mitochondrial membrane potential, an indicator of conjugation. Fas and MHC molecules are
It can be detected using a detection reagent (eg, an antibody) that binds to the protein.

[0131] This screening method is particularly useful for determining whether a tumor is sensitive to a chemotherapeutic agent. However, a tumor may be initially sensitive to a particular chemotherapeutic agent, and then, as the therapy progresses, the tumor may become resistant to the chemotherapeutic agent. The methods of the invention can be used to prevent a tumor from becoming susceptible to a chemotherapeutic agent during therapy. The method comprises administering to a subject in need of such treatment a chemotherapeutic agent and a metabolic modifier in a combined amount effective to inhibit the growth of the tumor. This metabolic modifier causes a coupling between the electron transfer process and the oxidative phosphorylation process, thus resulting in an increase in mitochondrial membrane potential in the cell. As the cells are kept in this coupled state, Fas is expressed on its surface and the chemotherapeutic agent can stimulate Fas-mediated apoptosis. The cell is prevented from becoming resistant.

The combined amount of a metabolic modifier and an apoptotic chemotherapeutic agent effective to inhibit the growth of the tumor cell may be used to inhibit the growth of the tumor cell when its mitochondrial membrane potential is increased. It is an effective amount. An effective amount is to delay the onset of the particular condition being treated, to inhibit the progress of the particular condition being treated, or to completely stop the onset or progression of the particular condition being treated. Or the amount necessary to diagnose the particular condition being treated. Generally, an amount effective to treat a tumor cell is that amount required to stop the growth of that cell.
In one embodiment, the effective amount is the amount that kills the cell. Generally, an amount effective to treat cancer is that amount required to favorably affect mammalian cancer cell growth in situ. When administered to a subject, the effective amount will, of course, depend on the particular condition being treated, the severity of the condition, and the individual patient's parameters, including age, physical condition, height and weight. ), Depending on the concurrent treatment, the frequency of treatment, and the mode of administration. These factors are well known to those skilled in the art and can be considered by no more than routine experimentation. It is generally preferred that the maximum dose be used, ie, the highest safe dose according to sound medical judgment.

In some cases, the screening assay may indicate that the tumor is almost resistant to a chemotherapeutic agent. Resistant tumors can also be treated by the methods of the present invention. One aspect of the invention involves the discovery that resistant tumor cells have a mitochondrial metabolic state in which electron transport is not coupled to oxidative phosphorylation. By changing the metabolic state of tumor cells so that electron transfer is coupled to oxidative phosphorylation, it is possible to return the resistant cells to sensitivity to chemotherapy This has been discovered according to the present invention.
The method of the invention is practiced by administering to a subject an amount of a chemotherapeutic agent, and substantially simultaneously, together with an amount of a metabolic modifier effective to inhibit the growth of the tumor. You. This metabolic modifier causes the electron transport in the cell to be coupled to oxidative phosphorylation. As discussed above, once these processes are coupled, Fas is expressed on its surface and the cells become susceptible to apoptosis induced by the chemotherapeutic agent.

Other screening assays according to the invention can be performed to identify anti-tumor drugs for killing tumor cells in a subject. These assays isolate tumor cells from a subject and include the following: Fas molecule on the surface of the tumor cell, B7 molecule on the surface of the tumor cell, MHC class II HLA-DR on the surface of the tumor cell.
And detecting the presence of a cell death marker selected from the group consisting of mitochondrial membrane potential, which is an indicator of conjugation in cells, exposing the tumor cells to a putative drug, and By detecting any change in the presence of a cell death marker that determines whether the drug is an anti-tumor drug capable of killing
Achieved. The assay is performed on one or more tumor cells.
And may be performed with a single drug or with multiple drugs.

[0135] The assay may be performed using conventional equipment known in the art. For example, an alteration in the presence of a cell death marker can be detected by contacting the tumor cell with a cell death ligand attached to a solid support.

The invention also includes a kit for screening a subject for susceptibility to a disease. This kit comprises: B7-2, B7-1 and M
A container containing a first binding compound that selectively binds to a protein selected from the group consisting of HC Class II HLA-DR; MHC Class II HLA-DP /
A container containing a second binding compound that selectively binds to the DQ protein; and determining whether the isolated cells of the subject selectively interact with the first or second binding compound. Including at least instructions for performing
Presence of MHC class II HLA-DP / DQ on the cell surface that interacts with the first compound is an indicator of susceptibility to atherosclerosis and resistance to autoimmune diseases, and interacts with the first compound The presence of MHC class II HLA-DR on the cell surface is an indicator of resistance to atherosclerosis and susceptibility to autoimmune diseases.

Other kits include kits for screening a subject's tumor cells for susceptibility to treatment with chemotherapy. These kits comprise a container containing a cell death marker detection reagent; and: a Fas molecule on the surface of the tumor cell;
Using a cell death marker detection reagent to detect the presence of a cell death marker selected from the group consisting of MHC class II HLA-DR on the surface of the tumor cells and mitochondrial membrane potential, which is an indicator of conjugation in cells Including instructions for doing
Here, a cell death marker indicates that the cell is sensitive to treatment with a chemotherapeutic agent. The kit also includes a container containing the chemotherapeutic agent. If desired, the kit can include a panel of chemotherapeutic agents housed in separate compartments.

The present invention also includes the discovery that regulation of mitochondrial metabolism is directly related to the expression of immune recognition molecules on cell surfaces. As used herein, an "immune recognition molecule" is a cell surface protein that characterizes a cell for identification by immune cells. MHC (particularly MHC class II HLA-DR, B
7-1, B7-2 and CD-40).
If the mitochondrial metabolic state of the cell is such that its electron transfer is not coupled to oxidative phosphorylation, cell surface expression of the immune recognition molecule is increased. If the mitochondrial metabolic state of the cell is such that electron transfer is coupled to oxidative phosphorylation, the cell surface molecules of the immune recognition molecule are reduced. However, under these circumstances, the expression of MHC class II HLA-DP / DQ is effectively increased. For the purposes of this patent application, MHC class II HLA-DP / DQ is not defined as an immune recognition molecule.

Based on these findings, the present invention includes a method for inducing the expression of an immune recognition molecule on a cell surface. The method comprises contacting the cell with an amount of a metabolic inhibitor effective to reduce mitochondrial membrane potential, wherein the decrease in mitochondrial membrane potential is caused by the expression of an immune recognition molecule on the cell surface. Cause induction.

As used herein, a “metabolic inhibitor” refers to an electron transport that is not coupled to oxidative phosphorylation, and as such, for example, an apoptotic chemotherapeutic agent , Bacterial by-products, mycobacterial antigens, UCP expression vectors, and fatty acids.

Diabetes mellitus (including type I (ie, insulin-dependent diabetes mellitus (IDDM)) and type II (ie, non-insulin-dependent diabetes mellitus (NIDDM)) affects more than 100 million individuals worldwide. It is known that Although the exact cause of diabetes is unclear, it is believed that diabetes can result from any of a variety of physiological situations, such as: genetic syndromes, viral infections, maintaining a glycemic response Age-related deterioration of the structures responsible for it, pancreatic disease, hormonal abnormalities, certain drugs or certain chemicals, abnormal insulin receptors, etc. "Type I diabetes (patient)" is a subject having diabetes caused by the destruction of beta cells in the pancreas. Type I diabetics require daily insulin administration, which can be reduced by careful dietary restriction but not completely eliminated.

Neither the genetic / environmental effects that trigger immune-mediated destruction nor the intrinsic β-cell characteristics are completely understood. However, two features that are important in the susceptibility to beta cell destruction are the expression of the cell surface molecule Fas and the metabolic state of beta cells. Fas can induce mitosis or apoptosis depending on its cell and experimental environment. During the pre-diabetic state of type I diabetes, β-cell compensatory hypertrophy of insulin occurs, and this process is achieved by cell surface expression of the molecule Fas. NOD mice (animal model for type I diabetes) have the lpr mutation (Fas
When crossed with a mouse having a (deficiency), the animal is less susceptible to diabetes. Furthermore, when the Fas ligand is placed on the insulin promoter, N
Acceleration of β cell destruction at OD.

It has been discovered according to the present invention that changes in mitochondrial metabolic processes that alter mitochondrial membrane potential and Fas expression contribute to Fas-induced β-cell destruction. β-cell glucose-induced insulin secretion results in increased intracellular A
Depends on TP. Mitochondrial synthesis of ATP occurs through coupling of electron transfer-dependent redox reaction (oxidative phosphorylation) with ATP synthesis. During this process, a proton gradient is created by the pumping of protons from mitochondria, which increases the mitochondrial membrane potential. Uncoupling protein (UCP) reversibly uncouples electron transfer and oxidative phosphorylation, reducing mitochondrial membrane potential. Normal pancreatic β cells are in an uncoupled state and have Fas on their cell surface.
Does not appear. When diabetes progresses to the first stage, where the patient is ill but before the pancreatic β-cells are destroyed, the patient's pancreatic β-cells are conjugated and express Fas on their cell surface I do. Diabetes then progresses to a stage where pancreatic beta cells begin to be killed. Before the cell is killed, its metabolic state changes again to become uncoupled, and Fas is still expressed on its surface. If the cell is uncoupled and Fas is expressed on the cell surface,
The cells are killed as soon as Fas is implanted without the need for any other agents.

The methods of the present invention include methods for inhibiting pancreatic β-cell death in Type I diabetes by altering mitochondrial metabolic status. The method is performed by contacting pancreatic β cells of type I diabetes with a metabolic modifier in an amount effective to increase mitochondrial membrane potential in pancreatic β cells. The metabolic modifier causes the pancreatic beta cells to return to or remain conjugated. Although these cells are not normal for pancreatic beta cells, these cells are not killed and the organs of the patient are not destroyed.

Another method for inhibiting pancreatic β-cell death in type I diabetes is to transform pancreatic β-cells of type I diabetes into effective inhibitors of Fas selective implantation on the surface of pancreatic β-cells. It can be achieved by contacting an amount of a Fas binder. F on cell surface
By inhibiting the selective implantation of as and allowing the cell to remain uncoupled, the cell remains healthy and has a normal pancreatic β-cell phenotype.

A Fas binding agent useful according to the present invention is a molecule that binds to Fas but does not activate Fas. Fas binding agents can be identified by screening the library using the extracellular region of Fas (eg, the screening methods described below). The Fas binding agents can then be easily tested without undue experimentation in vitro for their ability to bind to Fas but not induce cell death in uncoupled cells. Uncoupled cells can be prepared according to the methods described above. Fas can be induced to be expressed on the surface of cells using irradiation, as previously identified in the prior art. Once uncoupled cells expressing Fas have been developed, potential Fas binding agents can be incubated with these cells, and cell lysis can be performed using the methods described herein or the methods described herein. It can be assayed by other methods known in the art.

The present invention is also useful for treating type II diabetes. "Type II diabetes (
"Patient)" is a subject having diabetes mellitus caused by abnormal insulin secretion and / or resistance to insulin action in the target tissue. I
Physiological problems that occur in Type I diabetics are very different from those that occur in Type I diabetics. In type II diabetes, pancreatic β cells experience excessive proliferation. It is desirable to inhibit the growth of these cells.

One method for inducing pancreatic β-cell death in type II diabetes is to convert II-diabetic pancreatic β-cells to induce MHC class II HLA-DR expression on the surface of pancreatic β-cells. Contacting a large amount of an MHC class II HLA-DR inducer and MHC class II effective to induce pancreatic β-cell death of the cells
MHC class II HLA-DR by contacting with HLA-DR ligand
Is selectively embedded.

Another finding in accordance with the present invention is that mitochondrial metabolism and MHC on the surface of cells
The associated expression of Class II was to be an indicator of the susceptibility of the host of the cell to developing atherosclerosis, autoimmune disease or multiple sclerosis. When electron transfer and oxidative phosphorylation are coupled in a cell, the cell expresses MHC class II HLA-DP / DQ on the surface. When electron transfer and oxidative phosphorylation are uncoupled in a cell, the cell expresses MHC class II HLA-DR on the surface. MHC on the surface
Coupled cells with Class II HLA-DP / DQ are stimulated to divide when MHC Class II HLA-DP / DQ is implanted. Uncoupled cells with MHC class II HLA-DR on the surface are stimulated to lyse when MHC class II HLA-DR is implanted.

It has been found according to the present invention that these different metabolic states of the cell predict the individual's susceptibility to developing the disease. A subject is susceptible to developing atherosclerosis if the subject's cells are conjugated and express MHC class II HLA-DP / DQ on their surface. The subject's cells are uncoupled and have MHC class II on their surface.
When expressing HLA-DR, the subject is susceptible to developing an autoimmune disease.

The present invention includes a method for screening a subject for susceptibility to atherosclerosis. These methods involve isolating cells that are useful for screening such as peripheral blood lymphocytes or skin cells from a subject, as well as: MHC class II HLA on the surface of peripheral blood lymphocytes
Detecting the presence of an MHC marker selected from the group consisting of DP / DQ, B7-2, B7-1 and MHC class II HLA-DR, wherein M
The presence of HC Class II HLA-DP / DQ is an indicator of susceptibility to atherosclerosis, and the presence of MHC Class II HLA-DR is an indicator of susceptibility to atherosclerosis.

Atherosclerosis is a group of diseases affecting the cardiovascular system, and myocardial infarction,
Includes seizures, angina and peripheral cardiovascular disease. Despite considerable progress in therapy, cardiovascular disease remains the single most common cause of morbidity and mortality in the developed world. Many individuals are susceptible to developing future cardiovascular disorders, and this sensitivity is usually associated with premature ischemic heart disease, hyperlipidemia, smoking, hypertension, low HDL cholesterol, It is defined for risk factors such as diabetes, hyperinsulinemia, abdominal obesity, and a family history of high lipoproteins. The present invention includes a novel method for determining an individual's susceptibility to developing atherosclerosis. As used herein, susceptibility to atherosclerosis is 10% above the average for developing atherosclerosis.
Indicates a probability of exceeding.

The invention also includes a method for screening a subject for susceptibility to an autoimmune disease. These methods comprise the steps of isolating peripheral blood lymphocytes from a subject and the following: MHC class II HL on the surface of peripheral blood lymphocytes
Detecting the presence of an MHC marker selected from the group consisting of A-DP / DQ, B7-2, B7-1 and MHC class II HLA-DR, wherein the presence of MHC class II HLA-DR is It is an indicator of susceptibility to autoimmune disease, and the presence of MHC class II HLA-DP / DQ is an indicator of susceptibility to autoimmune disease.

An autoimmune disease is a type of disease in which an individual's own antibodies react with host tissues, or in which immune effector T cells are autoreactive for endogenous self-peptides and cause tissue destruction. It is. It is well established that MHC class II alleles act as major genetic elements in susceptibility to various autoimmune diseases. These include systemic lupus erythematosus (SLE), the basic form for rheumatoid arthritis, celiac disease, pemphigus, and autoimmune diseases. The present invention includes a novel method for determining an individual's susceptibility to developing an autoimmune disease. As used herein, susceptibility to an autoimmune disease indicates a likelihood of developing an autoimmune disease that is greater than 10% above the average.

The methods of the present invention also include methods for treating a subject having an autoimmune disease that reduces associated cell death. One method is to use MHC class II HLA
Based on the interaction between -DR expressing cells and γδ T cells. γδ T cells are
It specifically recognizes MHC class II HLA-DR on the cell surface and stimulates cell death. If γδ T cells recognize tissue with significant amounts of MHC class II HLA-DR, they will be activated and proliferate to kill more of the recognized cells. These methods of treatment are based on the idea of removing activated γδ T cells from the body. These cells can be removed by isolating a sample of peripheral blood and identifying activated γδT cells by evaluating activation markers using flow cytometry. Antibodies to specific activated γδ T cells can then be generated, and the antibodies can be used to selectively bind to and inactivate γδ T cells in a subject. This inactivation of γδ T cells can inhibit cell death associated with autoimmune diseases.

Similarly, cells expressing cell surface MHC class II HLA-DR that are normally recognized and killed by γδ T cells can be used in diseases involving excessive cell proliferation (eg,
Glioma). The cells can be induced to undergo cell death by stimulating excess activated γδ T cells in the subject.
This can be achieved using bacterial by-products.

It has been found according to the present invention that an association exists between Fas expression, mitochondrial metabolism and susceptibility to Fas-dependent cell death. Thus, by modulating mitochondrial metabolism, susceptibility to Fas-dependent cell death can be controlled. This phenomenon is described below for pancreatic β-cells, but is applicable to all biological systems described herein.

Type I diabetes mellitus (diabetes mellitus) is a pancreatic β-cell selective autoimmune disease that results in insulin deficiency. Neither the genetic / environmental effects that trigger immune-mediated destruction nor the intrinsic characteristics of beta cells are fully understood. Apoptosis has been suggested as a mechanism of β-cell death in a mouse model of type I diabetes. Two features that correlate with susceptibility to beta cell destruction are the metabolic state of beta cells and the cell surface molecule F
as (CD95), a member of the TNF family of "death-inducing" receptor / ligand pairs. During pre-diabetes of type I diabetes mellitus, insulin β
Cellular glucose-dependent hypersection results in a response to high glucose concentrations, and this process is consistent with cell surface expression of Fas. When NOD mice are crossed with mice having the lpr mutation (Fas deficiency), the animals are less susceptible to disease. Furthermore, β cell destruction in NOD is promoted when the Fas ligand is located on the insulin promoter. In the NOD model, apoptotic beta cells are observed in 15-week-old islets, which is consistent with the earliest onset of diabetes as determined by blood glucose measurements, urine glucose measurements, and pancreatic immunoreactive insulin measurements . The event of apoptosis decreases until week 18 when 50% of those animals have overt diabetes. Virtually all apoptotic cells were immunohistochemically determined to be positive for insulin production. Interestingly, β-cell apoptosis precedes the appearance of T cells in islets. The ability to up-regulate Fas expression on beta cells is also acquired during the early stages of type I diabetes mellitus.

It is contemplated according to the present invention that the metabolic status of the β-cell determines the susceptibility of the β-cell to Fas-mediated death. β-cell glucose-induced insulin secretion
Depends on increased intracellular ATP. Mitochondrial synthesis of ATP results from coupling of an electron transfer-dependent redox reaction to ATP synthetase (oxidative phosphorylation). During this process, a proton gradient is created by pumping protons across the mitochondrial membrane, resulting in an increase in mitochondrial membrane potential. Uncoupling proteins (UCP) reversibly consume proton gradients, resulting in a decrease in membrane potential. Mitochondrial damage (arising from virus, inflammation, aging, or oxidative stress) also consumes proton gradients and reduces mitochondrial membrane potential. However, in the latter case, changes in mitochondrial metabolism are irreversible.
For example, increased intracellular NO production in β-cells is known to alter β-cell mitochondrial membrane potential and render β-cells susceptible to Fas-induced death. Our data (provided in the examples below) show that β cells express intracellular UCP. In addition, we show that β-cell surface Fas expression and mitochondrial membrane potential increase as a function of environmental glucose concentration. Taken together, these results are consistent with the notion that mitochondrial glucose metabolism and the resulting mitochondrial membrane potential play an important regulatory role in susceptibility to Fas-induced β-cell death.

Increased environmental glucose results in increased cell surface Fas expression and functionally coupled mitochondrial ATP synthesis, suggesting a link between mitochondrial glucose metabolism and susceptibility to Fas-induced cell death I do. ATP is required for insulin secretion. As glucose levels decrease, cell surface F
As levels are reduced, newly synthesized Fas is stored intracellularly, and mitochondrial ATP synthesis does not couple with respiration, and mitochondrial ATP is produced less. This is shown schematically in FIG. The reversibility of this process may explain the beat of insulin secretion in response to nutrients. In either the conjugated or uncoupled state, the damaging factor (eg, diabetogenic virus, inflammation, ischemia, aging, or oxidative stress, respectively) can damage mitochondrial metabolism. Can increase cell surface Fas expression and render the cells susceptible to Fas-induced apoptosis or neoplasia. One possibility is that during the insulitis phase of type I diabetes mellitus, apoptosis (right of panel) (
This is thought to occur "silently" without further inflammation) occurs on some β-cells, and the late-stage disease in which neoplasia results from T-cell mediated (FasL-dependent) β-cell destruction It occurs in a period.

The present invention, in another aspect, relates to a method for selectively killing tumor cells bearing a Fas ligand. The method includes contacting a tumor cell bearing the Fas ligand with an amount of acetate effective to induce Fas-related cell death. A tumor cell bearing a Fas ligand is any tumor cell that has induced or constitutively expressed a Fas ligand on the cell surface. Such cells can be readily identified by one skilled in the art. This is because Fas ligand is a well-known molecule. These cells include, but are not limited to, melanoma cells and colon cancer cells.

Although acetate alone is not enough to kill tumor cells that carry Fas ligand, the cells also contain chemotherapeutic agents and / or Fas to promote killing.
can be treated with s-ligand. The use of these secondary compounds reduces the use of acetate used to achieve this cell killing. The combination of acetate with a chemotherapeutic agent and / or Fas ligand uses less than all three reagents than would otherwise be required to kill the cell.

In addition, tumor cells that do not express cell surface Fas ligand can also be killed by the methods of the present invention. The killing involves contacting the tumor cells with an amount of acetate effective to induce cell surface Fas ligand expression and replacing the Fas ligand with
This can be achieved by administering to the tumor cells an amount effective to induce Fas-related cell death. Fas ligand is used for NK cells, γδ T cells, CD4 T cells, C
It is expressed on surfaces such as D8 T cells.

Another method for selectively killing a cell is to use a UC selected from the group consisting of a UCP antisense nucleic acid and a UCP dominant negative nucleic acid.
Contacting with an effective amount of nucleic acid to inhibit P function. Cells also
The cells may be killed according to the present invention by contacting the cells with an effective amount of a compound selected from the group consisting of acetate and GDP and an apoptotic chemotherapeutic agent to kill the cells.

[0165] The present invention also includes a method for promoting a Th1 immune response. The method is performed by administering to a subject exposed to the antigen an amount of an MHC class II HLA-DR inducer effective to induce a Th1 immune response to induce DR on T cells. . MHC class II HLA-DR inducers are discussed in detail above and include, for example, fatty acids.

The invention, in another aspect, comprises contacting a neural cell with a B7 inducing agent in an amount effective to induce expression of B7 on the surface of the neural cell, and contacting the neural cell with a neuron-activating cell. This is a method for inducing nerve cell differentiation by exposing the nerve cells to differentiating cells.

The complex processes of immune cell activation and proliferation are based on diverse interactions such as antigen presentation, cell-cell contacts, and soluble immune mediators (eg, cytokines or lymphokines). Many of these interactions are mediated in T cells and other immune cells through surface receptors. For example, T helper cells
It requires both antigen presentation and activation of secondary signals by antigen presenting cells (APCs) associated with the major histocompatibility complex (MHC). This secondary signal is
It may be a soluble factor or may involve interaction with another set of receptors on the surface of T cells and other immune cells. However, antigen presentation in the absence of secondary signals is not sufficient to activate T helper cells.

The CTLA-4 / CD28 / B7 system is a group of proteins involved in regulating T cell proliferation through secondary signaling pathways. The proliferative response of T cells is controlled by the interaction of B7 family proteins, which are expressed on the surface of APCs, with CTLA-4 (cytotoxic T lymphocyte antigen # 4) and CD28.

This B7 family of proteins is composed of structurally related glycoproteins, including B7-1, B7-2 and B7-3 (Galea-Lauri et al., Cancer Gene Therapy, Vol. 3, 2022). 213 pages (19
96); Boussiotis et al., Proc. Nat. Acad. Sci. US
A, Vol. 90, pp. 11059-11063 (1993)). Different B7 proteins appear to have different expression patterns on the surface of antigen presenting cells. For example, B7-2 is constitutively expressed on the surface of monocytes, while B7-1 is not expressed, but B7-1 expression occurs when cells are stimulated with interferon gamma (IFN-γ). Is induced in these cells. This different expression pattern indicates that B7
Different roles may be indicated for each member of the family. The B7 protein is thought to be involved in events related to stimulating the immune response by its ability to interact with various immune cell surface receptors. For example, if B7 is a B2 with CD28 receptor
7 are thought to play a role in enhancing T cell proliferation and cytokine production through interactions.

CD28, a homodimeric glycoprotein with two disulfide-linked 44 kd subunits, is responsible for 95% of CD4 ⁺ cells and 50% of CD88 ⁺ cells.
%. Studies with monoclonal antibodies reactive with CD28 have demonstrated that CD28 is involved in a secondary signaling pathway in the activation of T cell proliferation. Antibodies that interfere with the interaction of CD28 with its ligand have been found to inhibit T cell proliferation in vitro, resulting in antigen-specific T cell anergy (Harding et al., Nature, 356). Volume 6,
07 (1991)).

Recently, CTLA-4, a T cell surface receptor protein with about 20% sequence homology to CD28, has been identified. CTLA-4 is not expressed endogenously on the surface of T cells, but expression of CTLA-4 is induced when CD28 interacts with B7 on the surface of APCs. Once CTLA-4 is expressed on the surface of T cells, CTLA-4 can interact with B7.

It has been discovered according to one aspect of the present invention that neural cells can be induced to express B7 and interact with T cells and other immune cells through the B7 / CD28 / CTLA4 molecule. B7 on the nerve cell surface stimulates immune cells simultaneously,
CD28 / CTL on the surface of immune cells to effect activation of the immune cells
A4 can be embedded. The activated immune cells then release nerve growth factors that stimulate the nerve cells.

[0173] As used herein, a "B7 inducer" refers to a B7 inducer on the surface of a nerve cell.
(And other related family members that retain sequence homology to B7). In one preferred embodiment, the B7 inducer is
It is a pharmacological factor that results in the consumption of a proton driving force, such as reducing the intracellular mitochondrial membrane potential by uncoupling electron transport with oxidative phosphorylation. B7 inducers that result in the consumption of proton motive forces include, but are not limited to, adriamycin, gamma-interferon, bacterial by-products such as lipopolysaccharides, lipoprotein BCG, fatty acids, cAMP inducers and UCP expression vectors. Not done. As used herein, “cAMP inducer” refers to cAMP
Any compound that increases intracellular levels of Such compounds include, but are not limited to, isoproterenol, epinephrine, norepinephrine, phosphodiester inhibitors, theophylline, and caffeine. In another preferred embodiment, the B7 inducing factor is a B7 expression vector.
Such vectors can be stably expressed in nerve cells and produce B7 which can be expressed on the cell surface. This B7 inducer is an isolated molecule. An isolated molecule is a molecule that is taken from its natural environment and formulated for administration to an organism.

As used herein, “the amount of a B7 inducer effective to induce B7 expression on the surface of a neuronal cell” refers to the consumption of a proton motive force, thereby resulting in a loss of neuronal activity. An amount effective to reduce mitochondrial membrane electrons in cells.
This amount is preferably the amount required to induce expression of at least a single B7 molecule on the cell surface.

The neuron is contacted with a B7 inducer and results in the expression of B7 on its surface. As used herein, contacting the cells with a B7 inducer can be performed by any known means in the art. For example, when the B7 inducer is applied in vitro, the B7 inducer is simply added to the nerve cell tissue culture dish as part of the cell culture medium. If the method is performed in vitro, then the contacting step can be performed by administering a B7 inducer by commonly used therapeutic techniques, such as parenteral, oral, or topical administration. Other methods are well known to those skilled in the art.

According to the method of the present invention, B7 expressing neurons are exposed to neural activating cells.
As used herein, a "nerve activated cell" is a cell that is capable of producing nerve growth factor when activated and contains a cell surface B7 receptor. As described above, B7 receptors include CD28 and CTLA-4. Many cells that are neural activated cells of the present invention have been described in the prior art. These cells include, for example, T cells (including both γT cells, δT cells, and α-βT cells), macrophages, dendritic cells, CTLA-4 expressing B cells or CD-2
8 expressing B cells.

As used herein, “B7 receptor” refers to a cell surface immune molecule that interacts with B7 on a partner cell and results in activation of the cell in which the B7 receptor is expressed. It is. Preferably, the B7 receptor is CD28
Molecule or CTLA4 molecule.

A nerve cell is exposed to a neural activated cell to cause the cell to differentiate. This exposure step can be performed in vitro by simply mixing the two cell populations, neural cells and neural activated cells. The exposing step can be accomplished in vitro by effecting the accumulation of the nerve activated cells in the local environment of the nerve cells. For example, the neural activated cells can be implanted or the local environment can be manipulated resulting in the accumulation of neural activated cells. For example, stimulation of an immune response in the local environment results in accumulation of T cells, B cells, dendritic cells and macrophages. The nerve stimulator also produces nerve growth factor upon activation,
The cell can then be engineered to express the B7 receptor on its surface (eg, by transfection with a B7 receptor gene that is inducibly or constitutively expressed by the methods described above).

[0179] The methods of the invention in some aspects can also be practiced with endogenous neural activated cells. For example, the endogenous neural activated cells can be cells having cell surface B7 receptors (eg, CD28 and CTLA-4). in this case,
The method only includes the step of contacting the nerve cell with an effective amount of a b7 inducer to induce B7 expression on the surface of the nerve cell in the presence of the nerve activating cell.

If the neural activating cell is a cell that has a cell surface B7 receptor already present in the vicinity that interacts with B7, the cell does not need to be manually contacted with B7 on the neural cell.

When the nerve cells are exposed to nerve activated cells, the cell surface B7
It can interact with receptors to activate this neural activated cell. Once activated, the nerve activated cells can produce nerve growth factor and release it to the local environment. This locally produced nerve growth factor can cause nerve cell differentiation. Although the present invention is not limited to a particular mechanism of action, Applicants believe that the mechanism by which neural differentiation occurs is that nerve growth factor is a nerve growth factor receptor (NGF) on the surface of nerve cells.
For example, it is considered to interact with Trk). It is also believed that implantation or induction of B7 on the cell surface results in expression of nerve growth factor receptor on the nerve surface.

In one embodiment of the invention, the receptor for nerve growth factor can be induced to be expressed on the surface of a nerve cell. Two known nerve growth factors are:
Tyrosine kinase A (TrkA) and p75NGRF. When these receptors interact with nerve growth factor on the surface of a nerve cell, they stimulate the nerve cell to promote neuronal differentiation. Expression of these receptors on the surface of the nerve cell can be performed by any method known in the art. For example, neural cells can be recombinantly engineered to express DNA for these receptors constitutively or inducibly, for example, by the methods described above.

Nerve growth factor (NGF), originally described by Levi-Montalcini and Hamburger in 1953 (Levi-Montalcin
i and Hamburger, 1953) contain two copies of three types of polypeptides, designated α, β and γ, and contain other neurotrophins (ie, brain-derived neurotrophic factor (BDNF), NT-3, NT-4 and NT-5 (S
iegel et al., 1996). It binds to the tyrosine kinase A (TrkA) receptor and the p75 NGF receptor in a synergistic manner (Canossa et al., 1996). Tyrosine kinase B (TrkB
) Receptors and tyrosine kinase C (TrkC) receptors bind preferentially to BDNf and NT-3, respectively (Siegel et al., 1994). Sr
c Intracellular signal proteins (eg, phospholipase C-γ, and phosphatidylinositol 3) through the interaction of the homology 2 (SH20) domain.
The p85 subunit of the kinase) binds to the tyrosine phosphorylated receptor and causes the formation of multimeric protein complexes and leads to the activation of specific signaling pathways (Hempstead et al., 1994).

As shown in the examples below, neurons express molecules essential for T cell activation. This indicates that there are neuroimmunological cell-cell interacting components that occur during neuronal differentiation. NGF and EGF have profound effects on differentiation processes in the uterus and early life and regeneration processes after pathological damage. The data provided in this embodiment is significant. Not only does this data demonstrate the presence of inducible surface molecules in post-mitotic neurons, but also their ability to be kinetically modified by the presence or absence of certain trophic factors. Because it is emphasized. The presence of Fas on the surface of nerve cells suggests that PC12 cells and their variants are susceptible to apoptosis, or that the molecule may transmit mitotic signals, if necessary.

Another aspect of the present invention includes a method for inducing apoptosis in a nerve cell. Contacting the nerve cell with an amount of a metabolic modifier effective to cause the coupling of electron transfer and oxidative phosphorylation when exposed to the nerve cell, and to increase the mitochondrial membrane potential in the nerve cell, And contacting the neural activated cells with a B7 receptor blocker in an amount effective to induce apoptosis in the neural cells. "Metabolism improvers" and "Fas binders" are described above.

[0186] As used herein, a "B7 receptor blocker" is any agent that interacts with the B7 receptor but does not cause activation of cells and prevents the receptor from binding to B7. . These agents include, for example, anti-CD28 antibodies that do not cause receptor activity, CD28 binding peptides, anti-CTLA-4 antibodies, C
Including but not limited to TLA-4 analogs and CTLA-4 binding peptides. Other B7 receptor blockers can be identified by those skilled in the art by routine experimentation using immune cell activation assays, such as T cell activation assays.

This method is useful whenever it is desired to induce neuronal apoptosis. For example, it may be useful to induce neuronal apoptosis in vitro to screen molecules for the ability to prevent neuronal apoptosis. Other uses will be apparent to those skilled in the art.

As discussed above, when cells are coupled, Fas is expressed on the cell surface, and when cells are uncoupled, Fas is generally transported and stored intracellularly. You. When cells are conjugated and Fas is present on the surface, F
The signal is transmitted to the cell by the implantation of as, causing the cell to divide. If the cell is uncoupled, Fas is not normally expressed on the cell surface. However, in the presence of NGF, Fas is down-regulated and is no longer expressed on the cell surface. In a damaged tissue, if a nerve cell is uncoupled and expresses both Fas and B7 on its surface, then the presence or absence of NGF determines the fate of the cell. When an NGF-producing cell according to the invention is present in the local environment, B7 of a neuronal cell stimulates NGF production by interacting with the cell. NGF produced locally is
Causes down-regulation of Fas and differentiates the cells.
If NGF producing cells are not available, or if B7 is not expressed on the surface of neurons, environmental factors can then stimulate Fas to cause apoptosis.

[0189] Another aspect of the invention is a method for re-innervating damaged tissue. The method includes implanting B7 expressing neurons into the injured tissue, wherein the implanted B7 expressing neurons undergo neuronal differentiation in the presence of neural activated cells in the injured tissue. Reinnervate the damaged tissue. Methods for transplanting nerve cells into living tissue are known in the art. For example, nerves can be implanted directly into exposed tissue, or can be implanted in a biodegradable tube that directs nerve extension to surrounding tissue that can differentiate.

[0190] B7 expressing neurons can be prepared by means known in the art. For example, B7 expressing neurons can be genetically engineered to constitutively or inducibly
Can be expressed. The gene encoding the B7 protein can be constitutively expressed in neural cells by transfection procedures known in the art (eg, by the methods described above). The B71 gene is provided herein as SEQ ID NO: 1 and is listed in Genebank under accession number M27533. And the nucleic acid sequence for B72 is provided herein as SEQ ID NO: 2 and is listed in Genebank under accession number U04343. Alternatively, the neural cells may inducibly or constitutively express UCP, which is engineered to induce endogenous B7 expression. In another embodiment, the implanted B7-expressing neurons can also constitutively and inducibly express at least one nerve growth factor receptor, which induces expression of endogenous B7.

[0191] Injured tissue is tissue that has undergone nerve damage. Injured tissue can include, for example, spinal cord injury, a severed or severely injured hip, or any other tissue that can be innervated and damaged nerves. Nerve-activating cells are generally found in skin and muscle around nerves of damaged tissue. These neural activated cells can stimulate the differentiation of the nerve cell once they are activated by interaction with B7 on the surface of the nerve cell.

The present invention also includes a method for treating a neurodegenerative disorder by administering an amount of a B7 inducer effective to induce B7 expression on the surface of a nerve cell. An amount effective to induce expression on a surface is an amount effective to cause consumption of a proton motive force, thereby reducing mitochondrial membrane potential in nerve cells.

A “neurodegenerative disorder” as used herein is a disorder associated with death or damage of neuronal cells. For example, loss of dopaminergic neurons in the substantia nigra eventually leads to Parkinson's disease. Deposition of β-amyloid protein in the brain results in nerve damage that generally leads to Alzheimer's disease. Conditions involving injury, such as cerebral ischemia, spinal cord injury, and amputation of the hips, often result in excessive neuronal cell death. When a nerve is severed, the area of nerve cells distal to the cut is separated from the nerve cell body and degenerates. After such a cut, the nerve cell body can be regenerated by re-extending the cut axon. This process of nerve regeneration does not occur naturally in the absence of certain environmental conditions. In some cases in the prior art, various factors (eg, nerve growth factors) have been added to nerves and attempted to stimulate regeneration. The method of the present invention describes a different system in which nerve cells can be engineered to express an immune recognition molecule on their surface, which can then lead to local expression of nerve growth factors leading to differentiation. This method more closely mimics the natural process of neuronal regeneration. Other neurodegenerative diseases include, but are not limited to, for example, epileptic seizures and amyotrophic lateral sclerosis.

The present invention also includes compositions of the above agents. One composition of the invention comprises a metabolic improver and an apoptotic chemotherapeutic. The pharmaceutical preparations of the present invention are administered to a subject in an effective amount. An effective amount is used to delay the onset of a particular condition being treated, to inhibit the progress of a particular condition, to completely stop the onset or progression of a particular condition, or to reduce a particular condition. It means the amount needed to make a diagnosis. In one embodiment, the metabolic modifying agent and the apoptotic chemotherapeutic agent are present in an effective dose for treating a tumor. In another embodiment, the metabolic improving agent and the apoptotic chemotherapeutic agent are present in a dose effective to treat Type II diabetes. Generally, an effective amount for treating cancer and type I diabetes is that amount necessary to favorably affect the growth of mammalian cells in situ. When administered to a subject, the effective amount will, of course, be the particular condition to be treated; the severity of the condition; the parameters of the individual patient (age, physical condition, size and weight; ;
Including the frequency of treatment; and the mode of administration). These factors are well known to those of skill in the art and can be handled using merely routine experimentation. In general, the maximum dose used, ie the safest dose according to sound medical judgment, is preferred.

Another composition according to the invention is an MHC class II HLA-DR inducer and an MHC class II HLA-DR ligand. In one embodiment, M
The HC class II HLA-DR inducer and MHC class II HLA-DR ligand are present in an effective amount for treating type II diabetes. Generally, an effective amount for treating type II diabetes is that amount necessary to favorably affect the growth of mammalian cells in situ. When administered to a subject, of course, an effective amount is
Depends on the particular condition being treated; the severity of the condition; the parameters of the individual patient (including age, physical condition, size and weight; concurrent treatment; frequency of treatment; and mode of administration) I do. These factors are well known to those of skill in the art and can be handled using merely routine experimentation. In general, the maximum dose used, ie the safest dose according to sound medical judgment, is preferred.

One composition of the present invention is a B7 inducer and a B7 receptor inducer. In one embodiment, the B7 inducer and B7 receptor inducer are present in a dose effective to treat a neurodegenerative disease. Generally, an effective amount for treating a neurodegenerative disease is that amount required to favorably affect neuronal cell differentiation in situ. When administered to a subject, the effective amount will, of course, be the specific condition to be treated; the severity of the condition; the parameters of the individual patient (age, physical condition, size and weight; concurrent treatment; Including the frequency of treatment; and the mode of administration). These factors are well known to those of skill in the art and can be handled using merely routine experimentation. In general, the maximum dose used, ie the safest dose according to sound medical judgment, is preferred.

In general, the dose of active compound is from about 0.01 mg / kg to 1000 m / day
g / kg. 50-500 mg in one or more doses per day
A / kg dose range is expected to be appropriate. If the initially applied dose is insufficient in the subject, a higher dose (or an effective higher dose with a different, more localized route of delivery) is used to the extent that patient tolerance allows. Can be done. Multiple doses per day are intended to achieve the appropriate level of compound.

The present invention relates to several different types of binding peptides or molecules (MHC class II
HLA-DR binding peptide, CD4 / αβ TCR binding molecule, CD40 binding peptide, MHC class II HLA-DP / DQ binding peptide, CD28 / CTLA
-4 binding peptide, and Fas binding peptide). Binding peptides of the invention can be identified using conventional assays, such as the binding and activation assays described in the Examples and elsewhere throughout this patent application.

A binding peptide of the invention is an isolated peptide. As used herein, the term "isolated peptide" with respect to a peptide refers to the extent to which the peptides are substantially pure and are practical and appropriate for their intended use.
It means that there are essentially no other substances with which they can be found in natural or in vivo systems. In particular, the peptides are sufficiently pure and not sufficiently abundant in other biological components of their host cells, for example, to be useful in producing or sequencing pharmaceutical preparations. . Since the isolated peptide of the present invention can be mixed with a pharmaceutically acceptable carrier in a pharmaceutical preparation, the peptide may contain only a small weight percentage of the peptide preparation. Nevertheless, the peptide is substantially pure in that it is substantially separated from related substances in living systems.

[0200] These binding peptides can also be readily synthesized or produced by recombinant means by those skilled in the art. Methods for preparing or identifying a peptide that binds to a particular target are well known in the art. For example, molecular imprinting
It can be used for de novo construction of macromolecular structures such as peptides that bind specific molecules. For example, Kenneth J. et al. Shea, Molecular Imp
printing of Synthetic Network Polymer
s: The De Novo synthesis of Macromole
cultural Binding and Catalytic Sites, TR
IP Volume 2, Issue 5, May 1994; Klaus Mosbach, Mol
eco-Imprinting, Trends in Biochem.
Sci. , 19 (9) January 1994; and Wulfff, G .; , Polyme
ric Reagents and Catalysts (Ford, WT.
Ed.) ACS Symposium Series No. 308, pp. 186-230, A
See American Chemical Society (1986). One method for preparing a mimetic of a known binding peptide is as follows: (i) a functional monomer around the binding region of an antibody that also binds to a known binding peptide or a target (template) that exhibits the desired activity. A polymerization step; (ii) a step of removing template molecules; then (iii) polymerizing a second class of monomers in the gaps left by the template to show one or more desired areas similar to the desired areas of the template. Providing a new molecule. In addition to preparing peptides in this manner, other binding molecules having the same function as the useful binding peptides according to the invention (eg, polysaccharides, nucleosides, drugs, nucleoproteins, lipoproteins, carbohydrates, glycoproteins, steroids, lipids) And other biologically active substances) can also be prepared. This method is useful for designing a wide variety of biological mimetics that are more stable than the natural counterpart. Because they are typically prepared by free-radical polymerization of functional monomers to yield compounds having a non-biodegradable backbone. Other methods for designing such molecules include, for example, the synthesis and evaluation of many compounds and drug design based on structure-activity relationships that require molecular modeling.

The binding peptides can also be used in phage display procedures (see, eg, Hart et al., J. Am.
Biol. Chem. 269: 12468 (1994)). Hart et al. Report a filamentous phage display library to identify novel peptide ligands for mammalian cell receptors. In general, phage display libraries using, for example, M13 phage or fd phage are prepared using conventional procedures (eg, those described in the aforementioned references). This library presents an insert containing 4-80 amino acid residues. This insert can be used to provide a fully degenerated or biased array of peptides (base
d array). Ligands with appropriate binding properties can be obtained by selecting phages that express on the phage surface a ligand that binds to the target molecule. These phages were then subjected to several cycles of reselection,
Identify peptide ligand expressing phage with the most useful binding properties. Typically, phage displaying the best binding properties (eg, highest affinity) are further characterized by nucleic acid analysis to identify the specific amino acid sequence of the peptide expressed on the phage surface and to optimize Identify the optimal length of the expressed peptide to achieve binding. Alternatively, such peptide ligands may be selected from a combinatorial library of peptides containing one or more amino acids. Such libraries can be further synthesized and contain non-peptide synthetic moieties that are less susceptible to enzymatic degradation than their naturally occurring counterparts.

[0202] Any known binding assay may be used to determine whether the peptide binds to the appropriate target. For example, in the case of a peptide that binds to MHC Class II HLA-DR, the peptide can be immobilized on a surface and then contacted with labeled MHC Class II HLA-DR (and vice versa). The amount of MHC class II HLA-DR that interacts with the peptide, or the amount not bound to the peptide, is then quantified to determine if the peptide is MHC class II HLA-DR
Can be determined. Surfaces with known peptides that bind to MHC class II HLA-DR (eg, commercially available monoclonal antibodies immobilized thereon) can be used as a positive control.

[0203] Screening for the peptides of the present invention can also be performed using competition assays. If the peptide being tested competes with a known monoclonal antibody (indicated by a decrease in binding of the known monoclonal antibody), then the peptide and the known monoclonal antibody are likely to bind to the same or closely related epitopes is there. Yet another method for determining whether a peptide has the specificity of a known monoclonal antibody is to preincubate a known monoclonal antibody with a target that is normally reactive, and then The addition of the peptide to be tested is to determine whether its ability to bind the target is inhibited. If the peptide being tested is inhibited, it probably has the same epitope and specificity as a known monoclonal antibody, or a functionally equivalent epitope and specificity.

By using the known MHC class II HLA-DR (and other target) monoclonal antibodies of the present invention, one produces anti-idiotype antibodies that can be used to screen other antibodies, It is also possible to identify whether they have the same binding properties as a monoclonal antibody of. Such anti-idiotype antibodies can be produced using well known hybridoma technology (Koh
ler and Milstein, Nature, 256: 495, 1975).
Anti-idiotypic antibodies are antibodies that recognize unique antigenic determinants present in known monoclonal antibodies. These antigenic determinants are located within the hypervariable regions of the antibody. It is this region that binds to a given epitope, and thus is responsible for the specificity of the antibody. Anti-idiotype antibodies can be prepared by immunizing animals with known monoclonal antibodies. The immunized animal will recognize and respond to the idiotypic determinants of the known monoclonal antibody during immunization, and will produce antibodies to these idiotypic determinants. By using the anti-idiotype antibody of the immunized animal (specific for the known monoclonal antibody of the present invention), the antibody has the same idiotype as the known monoclonal antibody.
It is possible to identify other clones used for immunization. The idiotypic identity between the monoclonal antibodies of the two cell lines demonstrates that the two monoclonal antibodies are identical for recognition of the same epitope. Thus, by using anti-idiotypic antibodies, it is possible to identify other hybridomas that express monoclonal antibodies with the same epitope specificity.

Using this anti-idiotype technology, it is also possible to produce monoclonal antibodies that mimic the epitope. For example, an anti-idiotype monoclonal antibody raised against the first monoclonal antibody contains the first antibody in the hypervariable region.
Has a binding domain that is an image of the epitope bound by the monoclonal antibody.

In one embodiment, a useful binding peptide according to the invention is an antibody or a functionally active antibody fragment. Antibodies are well known to those skilled in immunology.
Many of the binding peptides described herein are available from commercial sources as intact, functional antibodies. As used herein, the term "antibody" means not only intact antibody molecules, but also fragments of antibody molecules that retain specific binding ability. Such fragments are also well known in the art and are used uniformly both in vitro and in vivo. In particular, as used herein, the term “antibody” refers not only to intact immunoglobulin molecules, but also to the well-known active fragments F (ab ′) ₂ and Fab
Also means. F (ab ') ₂ fragments and Fab fragments that lack the Fc fragment of an intact antibody are cleared more rapidly from the circulation and may have less nonspecific tissue binding of the intact antibody (Wahl et al., J. .
Nucl. Med. 24: 316-325 (1983)).

As is well known in the art, the complementarity-determining regions (CDRs) of an antibody are the parts of an antibody that are responsible for a wide range of antibody specificities. CDRs interact directly with antigenic epitopes (see generally, Clark, 1986; Roitt, 1991). In the variable regions of both the heavy and light chains of an IgG immunoglobulin, there are four framework regions (FR1 to FR4), each separated by three complementarity determining regions (CDR1 to CDR3). The framework regions (FR) maintain the tertiary structure of the paratope, which is the part of the antibody that is involved in interacting with the antigen. The CDRs, and particularly the CDR3 regions, and more particularly, the heavy chain CDR3s contribute to antibody specificity. These CDR regions, and in particular C
Since the DR3 regions confer antigenic specificity on antibodies, these regions can be incorporated into other antibodies or peptides and confer the same specificity on that antibody or peptide.

According to one embodiment, the peptides of the invention are intact soluble monoclonal antibodies in isolated form or in a pharmaceutical preparation. An intact, soluble monoclonal antibody is an assembly of polypeptide chains linked by disulfide bridges, as is well known in the art. The two component polypeptide chains, called light and heavy chains, all make up the major structural class (isotype) of the antibody. Both heavy and light chains are further divided into partial regions called variable regions and constant regions. As used herein, the term “monoclonal antibody” refers to a homogenous population of immunoglobulins (eg, of MHC class II HLA-DR) that specifically binds to an epitope (ie, an antigenic determinant). Say.

[0209] Useful peptides according to the methods of the invention can be intact humanized monoclonal antibodies. "Humanized monoclonal antibody", as used herein,
A human monoclonal antibody, or a functionally active fragment of an antibody having a human constant region and a binding CDR3 region from a mammalian species other than human. Humanized monoclonal antibodies can be made by any method known in the art. A humanized monoclonal antibody may be, for example, a non-CDR region of a non-human mammal antibody,
It can be constructed by replacing the analogous region of a human antibody while retaining the epitope specificity of the original antibody. For example, a non-human CDR and optionally some framework regions are covalently linked to a human FR and / or Fc / pFc 'region to produce a functional antibody. In the United States, Protein D
design Labs (Mountain View California)
Companies that commercially synthesize humanized antibodies from specific mouse antibody regions, such as
(tity) exists. For example, Pharm used in the accompanying examples.
Humanized forms of ingen anti-Fas antibodies can be readily prepared and used according to the methods of the present invention.

European Patent Application No. 0239400, the entire content of which is incorporated herein by reference, describes at least the CD (s) of mouse (or other non-human mammal) antibodies.
Provided is an exemplary teaching of producing and using a humanized monoclonal antibody, wherein the R moiety is included in the humanized antibody. Briefly, the following method uses at least a mouse CD
Useful for the construction of humanized CDR monoclonal antibodies containing an R moiety. At least a variable domain of an Ig heavy or light chain, and a variable domain comprising a framework region from a human antibody, and a suitable promoter operably linked to a DNA sequence encoding a CDR region of a mouse antibody. A first replicable expression vector is prepared. Optionally, prepare a second replicable vector comprising at least a suitable promoter operably linked to a DNA sequence encoding the complementary human Ig light or heavy chain variable domain, respectively. . The cell line is then transformed with these vectors. Preferably, the cell line is an immortalized mammalian cell line of lymphatic origin (eg, a myeloma cell line, a hybridoma cell line, a trioma cell line, or a quadroma cell line) or is transformed with a virus. Normal lymphoid cells that have been immortalized. The transformed cell line is then cultured under conditions known to those skilled in the art to produce a humanized antibody.

As shown in European Patent Application No. 0239400, several techniques for making specific antibody domains that are inserted into replicable vectors are well known in the art (preferred vectors and recombinants). The techniques are discussed in further detail below). For example, a DNA sequence encoding a domain can be prepared by oligonucleotide synthesis. Alternatively, CDRs in four framework regions
The synthetic gene lacking the region is ligated at the junction site such that a double stranded synthetic CDR or restricted subcloned CDR cassette with sticky ends can be ligated at the junction of the framework region. Fuse with appropriate restriction sites. Another method involves the preparation of a DNA sequence encoding a variable CDR comprising a domain by oligonucleotide site-directed mutagenesis. Each of these methods is well known in the art. Thus, one of skill in the art can construct a humanized antibody comprising a mouse CDR region without destroying the specificity of the antibody for its epitope.

Human monoclonal antibodies can be made by any method known in the art (eg, US Pat. No. 5,56, issued to Borrebaeck et al.).
No. 7,610, U.S. Pat. No. 565,354 issued to Ostberg, Ba.
U.S. Pat. No. 5,571,893 issued to Ker et al., Kozber, J. et al. I
mmunol. 133: 3001 (1984); Brodeur et al., Monoc.
local Antibody Production Technologies
and Applications, pages 51-63 (Marcel Dek).
ker, Inc., New York, 1987), and Boerner et al., J.
. Immunol. , 147: 86-95 (1991)).
. In addition to conventional methods for preparing human monoclonal antibodies, such antibodies can also be prepared by immunizing a transgenic animal capable of producing human antibodies (eg, Jakobovits et al., PNAS USA, 90
: 2551 (1993); Jakobovits et al., Nature, 362: 2.
55-258 (1993); Bruggermann et al., Year in Im.
muno. , 7:33 (1993) and U.S. Patent No. 5,569,825 issued to Lonberg).

[0213] The binding peptide can also be a functionally active antibody fragment. Importantly, as is well known in the art, only a small region of the antibody molecule, the paratope, is involved in binding an antibody to its epitope (see generally Clark, W. et al.
R. (1986) The Experimental Foundations
of Modern Immunology Wiley & Sons, I
nc. Roitt, I., New York; (1991) Essential
Immunology, 7th edition, Blackwell Scientific
Publications, Oxford). The pFc 'and Fc regions of an antibody are, for example, effectors of the complement cascade but are not involved in antigen binding. An antibody derived from the enzymatically cleaved pFc 'region,
Antibodies produced without the pFc 'region, termed F (ab') ₂ fragments, retain both paratopes of the intact antibody. The isolated F (a
b ') The _two fragments are called divalent monoclonal fragments because they have two paratopes. Similarly, an antibody derived from an enzymatically cleaved Fc region,
That is, antibodies produced without the Fc region, called Fab fragments, retain one paratope of the intact antibody molecule. Proceeding further, the Fab fragment consists of the light chain of the antibody covalently linked and part of the antibody heavy chain denoted Fd (heavy chain variable region). Fd fragments are the major determinant of antibody specificity (one Fd fragment can be bound to up to 10 different light chains without changing the antibody specificity), and the Fd fragment Retains binding ability.

The terms Fab, Fc, pFc ′, F (ab ′) ₂ and Fv are used consistently in their normative immunological sense [Klein, Immunology (
John Wiley, New York, NY, 1982); Clark, W.
. R. (1986) The Experimental Foundation
s of Modern Immunology (Wiley & Sons,
Inc. Roitt, I., New York). (1991) Essenti
al Immunology, 7th edition (Blackwell Scientif)
ic Publications, Oxford)].

The B7 and UCP expression vectors, as well as other suitable expression vectors described herein, can be prepared using conventional procedures known in the art.
Can be prepared and inserted into cells. These procedures are described in more detail below. The term "IRM" (immune recognition molecule) nucleic acid is used herein to refer to each nucleic acid encompassed by the expression vectors described herein. Although UCP is not an immune molecule, the term IRM is used to simplify discussion.
Used to include P nucleic acids. “IRM nucleic acid” as used herein refers to the following nucleic acid molecules: (1) under stringent conditions, having the sequences of SEQ ID NOs: 1, 3, 5, 7, 9, and 11; Nucleic acid molecules that hybridize to nucleic acids, as well as (2) nucleic acid molecules that encode IRM polypeptides (ie, respective immune recognition polypeptides). Preferred IRM nucleic acids are SEQ ID NOs: 1, 3,
The nucleic acid sequences of 5, 7, 9, and 11 (human B7.1, B7.2, U
Nucleic acids encoding polypeptides CP-1, UCP-2, UCP-3S, and CD28). The IRM nucleic acid can be an intact IRM nucleic acid, including nucleic acid sequences of SEQ ID NOs: 1-5, and homologs and alleles of nucleic acids having the sequences of SEQ ID NOs: 1, 3, 5, 7, 9, and 11. Is included. Intact IRM nucleic acids further include nucleic acid molecules that differ from the sequences of SEQ ID NOs: 1, 3, 5, 7, 9, and 11 due to the degeneracy of the genetic code at the codon sequence. IRM nucleic acids of the invention can also be functionally equivalent variants, analogs and fragments of the foregoing nucleic acids. "Functionally equivalent", with respect to variants, analogs or fragments of IRM nucleic acids, refers to nucleic acids that encode IRM polypeptides that can function as immunorecognition molecules or uncoupling proteins. The invention further includes the complement of the aforementioned nucleic acids, or the complement of a unique fragment of the aforementioned nucleic acids. Such complements can be used as antisense nucleic acids to inhibit IRM expression in cells, for example, to create experimental models of cells in which IRM is not expressed.

[0216] IRM nucleic acid molecules can be prepared by conventional techniques, eg, encoding an IRM polypeptide;
And can be identified by identifying nucleic acid sequences that hybridize under stringent conditions to nucleic acid molecules having the sequences of SEQ ID NOs: 1, 3, 5, 7, 9, and 11. The term “stringent conditions” as used herein,
Refers to parameters known in the art. More specifically, stringent conditions, as used herein, refer to hybridization buffer (3.5 × SS
C, 0.02% ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin, 2.5 mM NaH ₂ PO ₄ (pH 7), 0.5% SDS,
Hybridization at 65 ° C. in 2 mM EDTA). SSC is 0
. 15M sodium chloride / 0.15M sodium citrate, pH 7; SDS is sodium dodecyl sulfate; and EDTA is ethylenediaminetetraacetic acid. After hybridization, the membrane onto which the DNA has been transferred is washed with 2 × SSC at room temperature, and then with 0.1 × SSC / 0.1 × SDS at 65 ° C.

There are other conditions, reagents, etc. that can be used, which produce similar stringency. Those skilled in the art are familiar with such conditions, and they are not provided herein. However, it will be understood by those skilled in the art that the conditions may be manipulated slightly to allow unambiguous identification of homologs and alleles of the IRM nucleic acids of the invention. Those skilled in the art are also familiar with methodology for screening cells and libraries for expression of molecules such as IRMs. Such molecules can be isolated, followed by purification and sequencing of the appropriate nucleic acid molecule. In screening for IRM nucleic acid sequences, Southern blots can be performed using the conditions described above with a radioactive probe. After washing the membrane to which the DNA was finally transferred,
The membrane can be placed in contact with an X-ray film to detect the radioactivity signal.

Generally, homologs and alleles are typically represented by SEQ ID NOs: 1, 3, 5, 7,
9 and 11 share at least 40% nucleotide identity; in some cases at least 50% nucleotide identity; and in other cases at least 60% nucleotide identity. Preferred homologs have at least 70% sequence homology to SEQ ID NOs: 1, 3, 5, 7, 9, and 11. More preferably, preferred homologs are SEQ ID NOs: 1, 3, 5, 7,
9, and 11 to 5, at least 80%, most preferably at least 9
Has 0% sequence homology.

[0219] The present invention also includes degenerate nucleic acids. The degenerate nucleic acid includes alternative codons for naturally occurring nucleic acids that encode human IRM polypeptides. For example, serine residues are encoded by codons TCA, AGT, TCC, TCG, TCT and AGC. Each of the six codons is equivalent for the purpose of encoding a serine residue. Thus, it will be apparent to one of skill in the art that any of the serine-encoding nucleotide codons may be utilized in vitro or in vivo to direct a protein synthesizer to incorporate a serine residue. Similarly, triplets of nucleotide sequences encoding other amino acid residues include, but are not limited to: CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA And AGG (codon for arginine); ACA, ACC, ACG and ACT (codon for threonine); AAC and AAT (codon for asparagine); and ATA, ATC
And ATT (codon for isoleucine). Other amino acid residues can be encoded by multiple nucleotide sequences as well. Thus, the invention encompasses degenerate nucleic acids that differ in codon sequence from naturally occurring nucleic acids due to the degeneracy of the genetic code.

[0220] In one embodiment, the IRM nucleic acid is operably linked to a gene expression sequence, which directs the expression of the IRM nucleic acid in a eukaryotic cell. A “gene expression sequence” is any regulatory nucleotide sequence, such as a promoter sequence or a promoter-enhancer combination, which is operably linked to an IR sequence.
Facilitates efficient transcription and translation of M nucleic acids. The gene expression sequence can be, for example, a mammalian or viral promoter, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, promoters for the following genes: hypoxanthine phosphoribosyltransferase (HPTR), adenosine deaminase, pyruvate kinase, and β-actin. Exemplary viral promoters that function constitutively in eukaryotic cells include, for example, simian virus, papilloma virus, adenovirus, human immunodeficiency virus (
HIV), the promoter derived from the long terminal repeat (LTR) of Rous sarcoma virus, cytomegalovirus, Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those skilled in the art. Promoters useful as gene expression sequences of the present invention also include inducible promoters. An inducible promoter is expressed in the presence of an inducing factor. For example, metallothionein promoters are induced to promote transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those skilled in the art.

In general, gene expression sequences include, where necessary, 5 ′ non-transcribed and 5 ′ untranslated sequences (eg, TATA boxes, capping sequences, CAAT sequences, etc.) that are involved in the initiation of transcription and translation, respectively. In particular, such 5 'non-transcribed sequences include a promoter region that includes an operably linked promoter sequence for transcriptional control of an IRM nucleic acid. Gene expression sequences may optionally include enhancer or upstream activator sequences, as desired.

Preferably, an IRM nucleic acid of the invention is linked to a gene expression sequence that allows expression of the IRM nucleic acid in cells of the local environment (eg, damaged nerve cells). In some embodiments, the gene expression sequence allows for expression of the IRM nucleic acid in human neural cells or neural activated cells. Sequences that allow expression of the IRM nucleic acid in nerve cells or nerve activated cells are those sequences that are selectively active in nerve cells or activated nerve cells, and therefore, in these cells.
Causes expression of the RM nucleic acid. One of skill in the art can readily identify promoters that can express IRM nucleic acids in neural or activated neural cells, as well as other known cells.

The IRM nucleic acid sequence and the gene expression sequence are covalently linked in such a way that they place the transcription and / or translation of the IRM coding sequence under the influence or control of the gene expression sequence. It is said to be "operably linked." I
If it is desired that the RM sequence be translated into a functional protein, two D
The NA sequence is characterized when the induction of a promoter within the 5 'gene expression sequence results in transcription of the IRM sequence, and the nature of the linkage between the two DNA sequences does not result in (1) induction of frameshift mutations ( 2) the corresponding RNA which does not interfere with the ability of the promoter region to direct transcription of the IRM sequence, or (3) translates into protein
It is said to be operably linked if it does not interfere with the ability of the transcript. Therefore,
A gene expression sequence is operably linked to an IRM nucleic acid sequence if the gene expression sequence can affect transcription of the IRM nucleic acid sequence and the resulting transcript can be translated into a desired protein or polypeptide. You.

[0224] The IRM nucleic acids of the invention can be delivered to a cell alone, or can be delivered to a cell in conjunction with a vector. In the broadest sense, a "vector" is any medium that can facilitate (1) delivery of an IRM molecule to a target cell, or (2) uptake of the IRM molecule by a target cell. Preferably, the vector transports the IRM molecule to the target cell with a reduced degree of degradation as compared to the degree of degradation that occurs in the absence of the vector. If desired, a "target ligand" can be attached to the vector to selectively deliver the vector to cells that express a cognate receptor for the target ligand on the cell surface. In this manner, vectors (including IRM nucleic acids) can be selectively delivered into cells (eg, damaged nerve tissue). Vectors useful in the present invention generally fall into two classes: biological vectors and chemical / physical vectors. Biological vectors are useful for delivery / uptake of IRM nucleic acids to / by target cells. Chemical / physical vectors are also useful for delivery / uptake of IRM nucleic acid to / by target cells.

Biological vectors include, but are not limited to: engineered by insertion or integration of a nucleic acid sequence of the invention and a free nucleic acid fragment that can be attached to a nucleic acid sequence of the invention. Plasmids, phagemids, viruses, and other vehicles derived from viral or bacterial sources. Viral vectors are a preferred type of biological vector, and include, but are not limited to, nucleic acid sequences derived from the following viruses: retroviruses (eg, Moloney murine leukemia virus; Harvey mouse sarcoma) Virus; mouse mammary gland virus; rous sarcoma virus; adenovirus; adeno-associated virus;
SV40 virus; polyoma virus; Epstein-Barr virus; papilloma virus; herpes virus; vaccinia virus; polio virus; and RNA virus (eg, any retrovirus). Other vectors, which are known in the art but are not named, can be readily used.

Preferred viral vectors are based on non-cytotoxic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytotoxic viruses include retroviruses. The retroviral life cycle involves reverse transcription of genomic viral RNA into DNA, followed by insertion of the provirus into host cell DNA. Retroviruses have been approved for human gene therapy trials.
Generally, retroviruses are replication deficient (ie, they can direct the synthesis of a desired protein, but cannot produce infectious particles). Such genetically altered retroviral expression vectors are commonly used for efficient transduction of genes in vivo. Standard protocols for producing replication-defective retroviruses (integrating exogenous genetic material into a plasmid, transfecting a packaging cell line with a plasmid, and producing a recombinant retrovirus from a packaging cell line) Collecting the virus particles from the tissue culture medium, and infecting the target cells with the virus particles) comprises Kriegler
, M .; , "Gene Transfer and Expression, A
Laboratory Manual "W. H. Freeman Co. , Ne
w York (1990) and Murry, E .; J. Hen "Methods i
n Molecular Biology ", Volume 7, Humana Press
, Inc, Cliffton, New Jersey (1991).

Another preferred virus for certain applications is an adeno-associated virus, which is a double-stranded DNA virus. Adeno-associated virus can be engineered to be replication-defective and can infect a wide range of cell types and species. This further has advantages such as thermostability and lipid solvent stability; high transduction frequency in a diverse lineage of cells; and lack of superinfection inhibition (thus allowing multiple lineage transductions). Have. As reported, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the potential for insertional mutagenesis and variability in the expression of the inserted gene. I do. In addition, wild-type adeno-associated virus infection continues in tissue culture for more than 100 passages in the absence of selective pressure, indicating that adeno-associated virus genome integration is a relatively stable event. Is shown. Adeno-associated virus can also function in an extrachromosomal manner.

In addition to biological vectors, chemical / physical vectors have been used to
The molecule can be delivered to a target cell, thereby facilitating uptake. As used herein, a “chemical / physical vector” refers to a natural or synthetic molecule other than a molecule from a bacteriological or viral source that can deliver an IRM molecule to a cell. Say.

The preferred chemical / physical vectors of the present invention are colloidal dispersion systems. Colloidal dispersion systems include oil-in-water emulsions, micelles, mixed micelles, and lipid-based systems including liposomes. The preferred colloid system of the present invention is a liposome. Liposomes are artificial membrane containers useful as delivery vectors in vivo or in vitro. It has been shown that large unilamellar containers (LUV), ranging in size from 0.2-4.0 μm, can encapsulate macromolecules. RNA, DNA, and intact virions can be encapsulated in an aqueous interior and delivered to cells in a biologically active form (Fraley et al., Tre
nds Biochem. Sci. (1981) 6:77). For a liposome to be an efficient gene transfer vector, one or more of the following features should be present: (1) highly efficient encapsulation of the gene of interest with retention of biological activity;
(2) preferential and substantial binding to target cells as compared to non-target cells; (3) efficient delivery of aqueous contents of vesicles to target cell cytoplasm; and (4) inheritance. Accurate and effective expression of information.

[0230] Liposomes are useful for certain ligands (eg, monoclonal antibodies, sugars, glycolipids,
Alternatively, the coupling of the liposome to a protein (eg, a protein) can be targeted to a particular tissue (eg, a tumor site). Ligands that may be useful for targeting liposomes to tumor cells include, but are not limited to: intact IRM intact or fragments of IRM that interact with tumor cell-specific receptors, and cells of tumor cells A molecule (eg, an antibody) that interacts with a surface marker. Such ligands can be easily identified by binding assays well known to those skilled in the art. In addition, the vector can be coupled to a nuclear targeting peptide, which directs the IRM nucleic acid to the host cell nucleus.

[0231] Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN ^™ and LIPOFECTACE ^™ , which contain N- [1- (2,3).
Dioleyloxy) -propyl] -N, N, N-trimethylammonium chloride (DOTMA) and dimethyldioctadecyl ammonium bromide (DDA
It is formed from cationic lipids such as B). Methods for making liposomes are well known in the art and have been described in many publications. Liposomes also
Gregoriadis, G .; , Trends in Biotechnolo
gy, (1985) 3: 235-241.

In one particular embodiment, a preferred vehicle is a biocompatible microparticle or implant that is suitable for implantation into a mammalian recipient. An exemplary bioerodible implant useful according to this method is PCT
International Application No. PCT / US / 03307 (Publication No. WO 95/24929, entitled "Polymeric Gene Delivery System", priority over U.S. Patent Application No. 213,668 filed March 15, 1994. Claim). PCT / US / 0307 describes a biocompatible, preferably biodegradable, polymer matrix for containing an exogenous gene under the control of a suitable promoter. This polymer matrix is used to achieve sustained release of the exogenous gene in the patient. According to the present invention, the IRM nucleic acids described herein are PCT / US / 03307
Encapsulated or dispersed within a biocompatible polymer matrix, preferably a biodegradable polymer matrix, as disclosed in US Pat.

The polymer matrix is preferably microspheres (where the IRM molecules are dispersed throughout a solid polymer matrix) or microcapsules (micro).
capsule (where the IRM molecule is stored in the core of the polymer shell). Other forms of polymer matrices for containing IRM molecules include films, coatings, gels, implants, and stents. The size and composition of the polymer matrix device are selected to produce advantageous release kinetics in the tissue into which the matrix is introduced. The size of the polymer matrix is further selected according to the method of delivery to be used, typically injection into tissue or administration of a suspension by aerosol to the nasal and / or pulmonary regions. Preferably, when an aerosol route is used, the polymer matrix and the IRM molecules are included in the surfactant vehicle. The polymer matrix composition has both an advantageous rate of degradation when the matrix is administered to the injured nasal and / or pulmonary surfaces, and also because it is formed from a material that is bioadhesive. Thus, it can be selected to further increase the effectiveness of metastasis. The matrix composition may also be selected not to degrade, but rather to release by diffusion over an extended period of time.

In another embodiment, the chemical / physical vector is a biocompatible microsphere that is suitable for oral delivery. Such microspheres are available from Chi
Kering et al., Biotech. And Bioeng. , (1996) 5
2: 96-101 and Mathiowitz et al., Nature, (1997).
386: 410-414.

[0235] Both the non-biodegradable polymer matrix and the biodegradable polymer matrix
It can be used to deliver an IRM nucleic acid of the invention to a subject. Biodegradable matrices are preferred. Such a polymer may be a natural polymer or a synthetic polymer. Synthetic polymers are preferred. The polymer is selected based on the time period over which release is desired (generally on the order of several hours to one year or longer). Typically, release over a period ranging between several hours and 3-12 months is most desirable. The polymer can optionally be added to water at about 9% of its weight in water.
In the form of a hydrogel that can absorb up to 0% and, optionally,
Crosslinked with polyvalent ions or other polymers.

Generally, IRM nucleic acids are delivered using bioerodible implants, by diffusion, or more preferably, by degradation of a polymer matrix. Exemplary synthetic polymers that can be used to form a biodegradable delivery system include: polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terephthalates, polyvinyl alcohols, polyvinyl ethers , Polyvinyl esters, poly-vinyl halides,
Polyvinylpyrrolidone, polyglycolide, polysiloxane, polyurethane, and copolymers thereof, alkylcellulose, hydroxyalkylcellulose,
Cellulose ether, cellulose ester, nitrocellulose, acrylic ester and methacrylic ester polymers, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, Carboxyethyl cellulose, cellulose triacetate, cellulose sulfate sodium salt (cellulose sulfate sodium sa)
lt), poly (methyl methacrylate), poly (ethyl methacrylate), poly (butyl methacrylate), poly (isobutyl methacrylate), poly (hexyl methacrylate) (poly (hexylmethacrylate)), poly (isodecyl methacrylate) , Poly (lauryl methacrylate), poly (phenyl methacrylate), poly (methyl acrylate), poly (isopropyl acrylate) (pol
y (isopropyl acrylate), poly (isobutyl acrylate), poly (octadecyl acrylate) (poly (octadecyl acr)
ylate)), polyethylene, polypropylene, poly (ethylene glycol)
, Poly (ethylene oxide), poly (ethylene terephthalate), poly (vinyl alcohol), polyvinyl acetate, polyvinyl chloride, polystyrene, polyvinylpyrrolidone, and polymers of lactic acid and glycolic acid, polyanhydrides, poly (ortho) esters, poly (Butyric acid), poly (valeric acid), and poly (lactide-cocaprolactone) (poly (lactide-cocaprolactone))
And natural polymers (eg, alginate and other polysaccharides (including dextran and cellulose), collagen, their chemical derivatives (substitution, addition of chemical groups (eg, alkyl, alkylene), hydroxylation, oxidation,
And other modifications routinely made by those skilled in the art), albumin and other hydrophilic proteins, zein and other prolamins, and hydrophobic proteins, copolymers and mixtures thereof). Generally, these materials degrade either by enzymatic hydrolysis or exposure to water in vivo, or by surface or bulk erosion.

Examples of non-biodegradable polymers include ethylene vinyl acetate, poly (meth)
Acrylic acids, polyamides, copolymers and mixtures thereof are mentioned.

The bioadhesive polymers of particular interest include those described in H.E. S. Sawhney, C.I. P
. Pathak and J.M. A. Hubbell, Macromolecules,
(1993) 26: 581-587 (the teachings of which are incorporated herein), polyhyaluronic acid, casein, gelatin, glutin, polyanhydride, polyacrylic acid, alginate, Chitosan, poly (methyl methacrylate), poly (ethyl methacrylate), poly (butyl methacrylate), poly (isobutyl methacrylate), poly (hexyl methacrylate), poly (isodecyl methacrylate), poly (lauryl methacrylate) , Poly (phenyl methacrylate), poly (methyl acrylate), poly (isopropyl acrylate), poly (
Isobutyl acrylate), and poly (octadecyl acrylate).

[0239] Fillers can also be used alone or in combination with the biological or chemical / physical vectors of the present invention. "Filler", as used herein, refers to an agent (eg, histone) that neutralizes the negative charge of a nucleic acid, thereby allowing the nucleic acid to be packed into fine granules. Nucleic acid loading facilitates uptake of the nucleic acid by target cells. Fillers can be used alone (ie, to deliver IRM molecules in a form that is more efficiently taken up by cells), or more preferably, in combination with one or more of the above vectors.

Other exemplary compositions that can be used to facilitate uptake of IRM nucleic acids by target cells include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, electroporation and Homologous recombination compositions (eg, for integrating an IRM nucleic acid at a preselected location within the target cell chromosome).

In addition to expression vectors, the invention also encompasses antisense oligonucleotides that selectively bind to an IRM nucleic acid molecule, and the use of a dominant negative IRM to reduce expression of the IRM. Antisense oligonucleotides are
For example, it is useful for preparing an animal model of a subject having a neurodegenerative disorder. Such animal models can be used in screening assays to identify therapeutic drugs for treating a neurodegenerative disorder.

[0242] As used herein, the term "antisense oligonucleotide" or "antisense" refers to the physiological condition, relative to DNA containing a particular gene, or to an RNA transcript of that gene. Oligonucleotides that hybridize underneath, thereby inhibiting the transcription of the gene and / or the translation of its mRNA are described. Antisense molecules are designed to hybridize to a target gene or target gene product, and thereby prevent transcription or translation of a target mammalian cell gene. One skilled in the art will recognize that the exact length of the antisense oligonucleotide and its degree of complementarity with the target will depend on the particular target selected, including the sequence of the target and the specific bases containing that sequence. Recognize Antisense must be a unique fragment. Unique fragments are "signatures" for larger nucleic acids. For example, this
It is long enough to ensure that the exact sequence is not found in molecules outside the IRM gene. As will be recognized by those skilled in the art, the size of a unique fragment will depend on its conservation in the genetic code. Therefore, SEQ ID NOs: 1, 3
Some regions of 5, 5, 9, and 11 require longer segments to be unique, while others require shorter segments (typically 12 and 32 base pairs). Between (eg, 12, 13, 14, 15, 16, 17, 18, 19)
, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31
And 32 bases))).

[0243] Under physiological conditions, so that it selectively binds to the target (ie, substantially more hybridized to the target sequence under physiological conditions than to any other sequence in the target cell). Preferably, antisense oligonucleotides are constructed and arranged. Based on the known sequence of the gene targeted for inhibition by antisense hybridization, or allelic or homologous genomic and / or cDNA sequences, one of skill in the art will recognize any of a number of suitable antisense for use in accordance with the invention. Sense molecules can be easily selected and synthesized. In order to be sufficiently selective and potent for inhibition, such antisense oligonucleotides should comprise at least 7 contiguous bases that are complementary to the target, and more preferably at least 15 contiguous bases It is. Most preferably,
The antisense oligonucleotide contains a complementary sequence of 20 to 30 bases. Although oligonucleotides that are antisense to any region of a gene or RNA (eg, mRNA) transcript may be selected, in preferred embodiments, the antisense oligonucleotide is a 5 ′ site (eg, a translation initiation site, a transcription initiation site, a transcription initiation site). Site or promoter site). These sites are upstream of the gene targeted for inhibition by the antisense oligonucleotide. In addition, the 3'-untranslated region can be targeted. In addition, 5 'or 3' enhancers can be targeted. Targeting to mRNA splice sites has also been used in the art, but is less preferred when alternative mRNA splicing occurs.
In at least some embodiments, the antisense is preferably an mRNA
(See, eg, Sainio et al., Cell Mol.
Neurobiol. , (1994) 14 (5): 439-457) and sites where proteins are not expected to bind.
Selective binding of an antisense oligonucleotide to a mammalian target cell nucleic acid effectively reduces or eliminates the transcription or translation of a mammalian cell nucleic acid molecule. Decreased transcription or translation of a nucleic acid molecule is desirable in preparing animal models to further define the role played by mammalian target cell nucleic acids in modulating adverse medical conditions.

The present invention also includes the use of "dominant negative UCP" polypeptides.
A dominant negative polypeptide is an inactive variant of a protein that interacts with a cellular machinery to displace the active protein from its interaction with the cellular machinery, or Compete, thereby reducing the effect of the active protein. For example, a dominant negative receptor that binds a ligand but does not transmit a signal in response to binding of the ligand may reduce the biological effect of expression of the ligand. Similarly, a dominant negative catalytically inactive kinase that interacts normally with a target protein but does not phosphorylate the target protein can reduce phosphorylation of the target protein in response to a cellular signal. Similarly, a dominant negative transcription factor that binds to a promoter site in the control region of a gene but does not increase gene transcription may decrease the effect of a normal transcription factor by occupying the promoter binding site without increasing transcription.

The end result of expression of a dominant negative polypeptide as used herein in a cell is a reduction in the function of active UCP. One of skill in the art can assess the potential for dominant negative variants of the protein and use standard mutagenesis techniques to generate one or more dominant negative variant polypeptides. For example, one skilled in the art can modify the sequence of UCP by site-directed mutagenesis, scanning mutagenesis, partial gene deletion or truncation, and the like. See, for example, US Pat. No. 5,580,723 and Sambrook et al., Molecul.
ar Cloning: A Laboratory Manual, 2nd edition, C
old Spring Harbor Laboratory Press, 1
See 989. One skilled in the art can then test the population of mutagenized polypeptides for a decrease in the selected activity and / or retention of such activity. Other similar methods for making and testing dominant negative variants of a protein will be apparent to those skilled in the art.

[0246] In another aspect, the invention includes transgenic animals and cells transfected with an IRM. In addition, the complement of the above IRM nucleic acids may be useful as antisense oligonucleotides (eg, by delivering the antisense oligonucleotide to an animal to induce a “knock-out” phenotype).
. Administration of an antisense RNA probe to block gene expression
chtenstein, C.I. Nature 333: 801-802 (198
8).

Alternatively, IRM nucleic acids can be used to prepare non-human transgenic animals. "Transgenic animals" are those that have been artificially inserted into cells.
An animal with cells containing NA, the DNA of which becomes part of the animal's genome emanating from the cells. Preferred transgenic animals are primates, mice, rats, cows, pigs, horses, goats, sheep, dogs and cats. Animals suitable for transgenic experiments include Charles River (Wilmington).
, MA), Taconic (Germantown, NY), Harlan S
It can be obtained from standard commercial sources such as prague dawley (Indianapolis, Ind.). Transgenic animals with certain properties associated with certain diseases are used to study the effects of various drugs and treatment methods on the disease, and thus to serve as a genetic model for the study of many human diseases Can be done. Thus, the present invention includes the use of IRM knockout and transgenic animals as models for the study of neurodegenerative disorders.

A variety of methods are available for producing transgenic animals related to the present invention. DNA can be injected into the pronucleus of a fertilized egg prior to fusion of the male and female pronuclei, or into the nucleus of an embryonic cell (eg, the nucleus of a two-cell embryo) after the onset of cell division. See, for example, Brinster et al., Proc. Nat. Acad. Sc
i. USA, 82: 4438 (1985); Brinster et al., Cell 2.
7: 223 (1981); Costantini et al., Nature 294: 9.
82 (1981); Harpers et al., Nature 293: 540 (198).
1); Wagner et al., Proc. Nat. Acad. Sci. USA 78:
5016 (1981); Gordon et al., Proc. Nat. Acad. Sci
. USA 73: 1260 (1976). The fertilized egg is then implanted into the female recipient's uterus and developed into an animal.

An alternative method for producing a transgenic animal involves the integration of the desired gene sequence into a virus that can affect the cells of the host animal. For example, El
Brecht et al., Molec. Cell. Biol. 7: 1276 (1987)
See Racey et al., Nature 322: 609 (1986); Leopol et al., Cell 51: 885 (1987). Embryos can be infected with viruses, especially retroviruses, that have been modified to carry nucleotide sequences encoding IRM proteins or sequences that disrupt the native IRM gene to produce knockout animals.

Another method of producing transgenic animals involves the injection of pluripotent embryonic stem cells into blastocysts of a developing embryo. Pluripotent stem cells derived from the inner cell mass of the embryo and stabilized in culture can be manipulated in culture to incorporate the nucleotide sequences of the present invention. Transgenic animals can be produced from such cells via implantation into a foster mother and implantation into blastocysts leading to parturition. For example, Robertson
Et al., Cold Spring Harbor Conference Cell.
Proliferation 10: 647 (1983); Bradley et al., Nature 309: 255 (1984); Wagner et al., Cold S.
spring Harbor Symposium Quantitative
See Biology 50: 691 (1985).

Procedures for manipulation of rodent embryos and microinjection of DNA into the pronucleus of a zygote are well known to those skilled in the art (Hogan et al., Supra). Fish, amphibian eggs,
And microinjection procedures for birds are described in Houdebine and Courrout, Experientia, 47: 897-905 (19).
91). Other procedures for introducing DNA into animal tissues include:
U.S. Pat. No. 4,945,050 (Sandford et al., July 30, 1990)
It is described in.

For illustration purposes only, superovulation is induced in female mice to prepare transgenic mice. The female was placed with males, and the mated females are sacrificed by CO ₂ asphyxiation or cervical dislocation and recovered from the oviduct was excised embryos. Remove surrounding hill cells. The pronuclear embryo is then washed and stored until the time of injection. Adult female mice at random cycles are paired with vasectomized males. Recipient females are mated simultaneously with donor females. The embryo is then surgically transferred. The procedure for producing transgenic rats is similar to the procedure for mice. Hamme
See r et al., Cell, 63: 1099-1112 (1990).

[0253] Methods for culturing embryonic stem (ES) cells, and subsequently E using methods such as electroporation, calcium phosphate / DNA precipitation and direct injection
The production of transgenic animals by introducing DNA into S cells is also well known to those skilled in the art. For example, Teratocarcinomas and Em
bryonic Stem Cells, A Practical Appro
ach, E .; J. See Robertson, eds., IRL Press (1987).

In cases involving random gene integration, clones containing the sequences of the invention are co-transfected with the gene encoding resistance. Alternatively, the gene encoding neomycin resistance is physically linked to a sequence of the invention. Transfection and isolation of the desired clone is performed by any one of several methods well known to those of skill in the art (EJ Robertson, supra).
.

The DNA molecules introduced into ES cells can also integrate into the chromosome through the process of homologous recombination. Capecchi, Science, 244: 1288.
-1292 (1989). Positive selection of recombination events (eg, neo resistance)
And methods for double positive-negative selection (eg, neo resistance and ganciclovir resistance), followed by PC
The identification of desired clones by R is described in Capecchi, supra and Joyner.
Nature, 338: 153-156 (1989). The final step in this procedure is to inject the targeted ES cells into the blastocyst and transfer the blastocyst to a pseudopregnant female. The resulting chimeric animal is bred and its progeny are analyzed by Southern blot to identify individuals carrying the transgene.

Procedures for the production of non-rodent mammals and other animals have been discussed by others. Hudebine and Courroute, supra; Pursel
Et al., Science 244: 1281-1288 (1989);
See mms et al., Bio / Technology, 6: 179-183 (1988).

Inactivation or replacement of the endogenous IRM gene can be achieved by a homologous recombination system using embryonic stem cells. The resulting transgenic non-human mammal with knockout characteristics can be used as a model for a neurodegenerative disorder. IR
Neurons that do not express M can be predisposed to apoptosis and cannot differentiate, thus producing a neurodegenerative phenotype. Various therapeutic drugs can be phenotypically administered to neurodegenerative animals to determine the effect of the therapeutic drug on neuronal cell differentiation. In this manner, therapeutic drugs that are useful for preventing or reducing a neurodegenerative disorder can be identified. Such agents are useful, for example, in treating spinal cord injury or Parkinson's disease.

In addition, a normal or mutant version of the IRM can be inserted into the mouse germline to produce a transgenic animal that constitutively or inducibly expresses a normal or mutant form of the IRM. These animals have I
Useful in research to define the role and function of RMs.

The metabolic improvers described herein, apoptotic chemotherapeutic agents, MHC class II HLA-DR inducers, MHC class II HLA-DR ligands, B
The 7 receptor blocker, B7 inducer, and B7 receptor inducer are commercially available compounds, are derived from commercially available compounds, or are synthesized de novo using routine chemical synthesis procedures known to those skilled in the art. Is done.

When administered, the pharmaceutical preparations of the present invention comprise, in pharmaceutically acceptable amounts,
And in pharmaceutically acceptable compositions. Such preparations may routinely contain salts, buffers, preservatives, compatible carriers, and if desired, other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may be conveniently used to prepare their pharmaceutically acceptable salts, And this does not depart from the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic acids Acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid and the like.
Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts. As used herein, a composition of a metabolic modifier and an apoptotic chemotherapeutic refers to the compounds described above and salts thereof, and to MHC class II H
Compositions of LA-DR inducer and MHC class II HLA-DR ligand refer to the compounds described above and salts thereof.

The compositions of the present invention can be combined, if necessary, with a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier"
Means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration to humans or other animals. The term "carrier" refers to a natural or synthetic, organic or inorganic component with which the active component is combined to facilitate application. The components of the pharmaceutical composition can also be mixed simultaneously with the molecules of the invention and with each other in a manner such that there are no interactions that substantially impair the desired efficacy.

The pharmaceutical composition may include a suitable buffering agent, including: acetate; citrate; borate; and phosphate.

The pharmaceutical compositions may also optionally contain suitable preservatives, such as benzalkonium chloride; chlorobutanol; parabens and thimerosal.

Compositions suitable for parenteral administration conveniently comprise a sterile aqueous preparation of the compositions of the present invention, which is preferably isotonic with the blood of the recipient. This aqueous preparation can be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. Carrier formulations suitable for oral, subcutaneous, intravenous, intramuscular administration, etc. are available from Remington's Pharmaceuticals.
technical Sciences, Mack Publishing Co. ,
It can be found in Easton, PA.

[0265] Various routes of administration are available. Of course, the particular mode chosen will depend on the particular drug chosen, the severity of the condition being treated, and the dose required for therapeutic effect. In general, the methods of the present invention employ any mode of administration that is medically acceptable, meaning any mode that produces an effective level of an active compound without causing clinically unacceptable side effects. Can be performed. Such modes of administration include:
Oral, rectal, topical, nasal, intradermal or parenteral routes are included. The term "parenteral" includes subcutaneous, intravenous, intramuscular, or infusion. Intravenous or intramuscular routes are not particularly suitable for long-term treatment and prevention. However, they may be preferred in emergency situations. Oral administration is preferred for prophylactic treatment. This is because of the convenience and dosing regimen for the patient.

The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the composition of the invention into association with the carrier which constitutes one or more accessory ingredients. Generally, this composition is prepared by uniformly and tightly linking the composition of the present invention to a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Is done.

Compositions suitable for oral administration can be presented as dispersion units (eg, capsules, tablets, lozenges) each containing a predetermined amount of a composition of the present invention. Other compositions include suspensions in aqueous or non-aqueous solutions (eg, syrups, elixirs or emulsions).

Other delivery systems may include timed release, delayed release, or sustained release delivery systems. Such a system may avoid repeated administration of the composition of the invention described above, which increases convenience for the subject and the physician. Numerous types of release delivery systems are available and known to those skilled in the art. These systems include poly (lactide-
Glycolide), copolyoxalate, polycaprolactone, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polymer-based systems such as polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described, for example, in US Pat. No. 5,075,109. Delivery systems also include the following non-polymeric systems: sterols such as cholesterol, cholesterol esters and fatty acids, or lipids including neutral fats such as monoglycerides, diglycerides and triglycerides; hydrogel releasing systems; silastic. ) Systems; peptide based systems; wax coatings; compressed tablets with conventional binders and excipients; partially fused implants and the like. Specific examples include, but are not limited to: (a) U.S. Patent Nos. 4,452,775, 4,667,014, and 4,748,0.
Erosional systems comprising the compositions of the present invention in matrix form, such as described in US Pat. No. 34 and 5,239,660; and (b) US Pat. No. 3,832,253, and No. 3,854,480,
A diffusion system in which the active ingredient penetrates at a controlled rate from a polymer. Further, a pump-based hardware delivery system may be used. Some of these are adapted for transplantation.

Use of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions. As used herein, extended release means that the implant has at least 3
It is meant to be constructed and arranged to deliver therapeutic levels of the active ingredient for 0 days (and preferably for 60 days). Long-term sustained release implants are well known to those skilled in the art and include some of the release systems described above.

The following examples are provided to illustrate specific examples of the practice of the present invention, and are not intended to limit the present invention to these examples. As will be apparent to those skilled in the art, the present invention finds application in a variety of compositions and methods.

Examples Example 1: Metabolic status of cells is an indicator of cell surface Fas expression and susceptibility / resistance to cell death. Resistance to apoptosis is characterized by the inability to express Fas: cell lines utilized herein include: L12
10, a leukemia cell line; HL60, a human promyelocytic cell line; and PC12, a brown cell lineage cell (which can be induced to differentiate into a neuronal cell line in the presence of NGF) (
Lindenboim, L et al., Cancer Res, 1995, 55: 124.
2-7). Each cell line was tested in parallel with the following apoptosis resistant sublines: L1210 DDP, HL60 MDR, and PC12Trk. L1210
DDP is resistant to cisplatin and methotrexate; HL60 M
DR is resistant to adriamycin-induced apoptosis; PC12 Trk
A, transfected with TrkA that results in constitutive expression of the NGF receptor, is not as sensitive to alcohol and NGF withdrawal as PC12 cells.

Apoptosis-sensitive cells from each tissue source were morphologically round, non-adherent, and rapidly dividing cells, except for the PC12 cell line. Apoptosis resistant cells from all tissue sources were morphologically large, adherent, and slowly dividing cells.

The recently characterized molecules, Fas (CD95) and Fas ligand (CD9
5L) are strongly involved in the process of apoptotic death (Muller,
M. et al. Clin Invest, 1997, 99: 403-413). We tested the expression of Fas in the cell lines identified above. Flow cytometric analysis of Fas expression was performed using L1210; PC12; and HL60 cells,
And resistant cell lines L1210DDP, PC12Trk; and HL60MDR
Above, performed using the isotype against FITC-anti-Fas (Pharmingen). Coulter Epics Elite flow cytometer (single excitation wavelength (488 nm) and PE (575 nm), FITC (52
5 nm) and Red 613 (with a band filter for 613 nm)). Each sample population was classified for cell size (forward scatter) and complexity (side scatter) using 40,000 cells,
Gated on the target population and evaluated. Criteria for positive staining were established by comparison with the intensity of an isotype control (thick line). Independent of tissue origin, all apoptosis-resistant strains are unable to express cell surface Fas, both constitutively and in the presence of agents that induce apoptosis in the parental cell line.

[0274] 2. Resistance to apoptosis is characterized by a relatively high rate of glucose oxidation and utilization: we performed experiments to test the correlation between cell surface Fas expression and glucose metabolism. Fas positive cells and Fas
As a prototype for negative cells, we used the L1210 and L1210 DDP cell lines (as Fas positive and Fas negative, respectively). We directly measured the rate of glucose utilization and the rate of oxidation of L1210 and L1210 DDP. Rates were determined using nanomolar values.

Glucose utilization rates were measured by the method of Ashcroft et al. Briefly,
Cells were treated with 100 μl of KRB, glucose (5.5 mM), 1.3 μCi of D- [
5- ³ H] glucose (Amersham, Arlington Heights)
s, IL) for 90 minutes at 37 ° C. The reaction was performed in a 1 ml cup contained in a 20 ml scintillation vial with a rubber stopper (
There is 500 μl of distilled water around the cup in the vial). Glucose metabolism,
Stopped by injecting 100 μl of 1 M HCl through the stopper into the cup. An overnight incubation at 37 ° C. was performed to equilibrate [ ³ H] -H ₂ O in the reaction cup and distilled water, followed by liquid scintillation counting in distilled water.

The glucose oxidation rate was determined using 100 ml of the reaction buffer glucose (2.8,
8.3, 27.7 mmol / l), measured by incubating the cells in 1.7 mCi (U-14C glucose) at 37 ° C. for 90 minutes. The reaction was performed in a 1 ml cup in a 20 ml scintillation vial capped with a rubber stopper having a central well containing filter paper. 1 ml of 300 ml
of HCl l / l, into the cup containing the cells were injected through the stopper to stop the metabolic and liberate CO _2. CO ₂ was trapped on filter paper by injecting 10 ml of 1 mol / l KOH into the center well and measured 2 hours later by liquid scintillation. Cell-free tubes containing NaHCO ₃ were used to evaluate the recovery of ¹⁴ CO _{2 on} filter paper (typically close to 100%).

The results are shown in Table 1.

[0278]

[Table 1] L1210 and L1210 DDP cells are tumor cell lines and appear to have increased ratios of glucose oxidation to glucose utilization (Warburg, O.D.).
(Klin Woch, 1926, 5: 829-832), so we measured glucose utilization in normal lymphocytes. We used 10 ⁶ spleen lymphocytes in C57BL / 6 animals, Fas-deficient C57BL / 6 (B6.
lpr) and FasL deficient C57BL / 6 (B6.gld) animals. Table 2 demonstrates the glucose utilization rates and glucose oxidation rates of Fas deficient and FasL deficient lymphocytes. The ratio of glucose utilization to glucose oxidation is
It is highest in lpr lymphocytes and lowest in wild type normal resting lymphocytes.

[0279]

[Table 2] These data (Tables 1 and 2) show that both tumor lines have higher rates of glucose utilization and glucose oxidation compared to normal lymphocytes; and compared to wild-type.
It demonstrates higher rates of glucose utilization and glucose oxidation in apoptotic resistant strains. There are important differences in the ratio of glucose utilization to glucose oxidation between normal animals and Fas- or FasL-deficient animals. This ratio is higher for lymphocytes from animals from both mutant strains. The result of uncoupling is
Decreased mitochondrial membrane potential; use of fat as a carbon source increased the rate of glycolysis and increased the rate of electron transport and energy dissipation (in forms other than ATP). These data suggest that there is an increased proton leak in cells that have a faster rate of glucose oxidation and utilization than normal cells. This suggests that some uncoupling could have occurred in these cells.

[0280] 3. Fas expression increases as a function of glucose: We tested the effect of increasing glucose concentration on cell surface Fas expression. L1210 cells and L1210 / DDP cells were cultured for 16 hours in RPMI medium without glucose or medium supplemented with insulin and glucose. Intracellular Fas
Expression and extracellular Fas expression were measured using FITC-conjugated anti-Fas antibody (Pharmi
ngen) or FITC-conjugated isotype control, and then determined by subtracting the fluorescent intensity of the isotype staining from the Fas staining for each treatment group.

These data show that Fas expression increases as a function of glucose concentration,
As a result, cell surface Fas negative L1210 / DDP was
Began to develop.

[0282] 4. L1210 DDP on staurosporin
Treatment of cells restores Fas expression and susceptibility to drug-induced apoptosis: L1210 (but not L1210 DDP) causes apoptotic cell death. We treated L1210 cells or L1210 DDP cells with saturosporin (inhibiting protein kinase C and increasing mitochondrial membrane potential) or the anticancer drug adriamycin, where both cells are sensitive. Fas expression in the presence of saturosporin or adriamycin
Elevated or induced on both L1210 and L1210 DDP, respectively. L1210 DDP, which changed morphologically and started dividing rapidly, changes. This appeared to correspond to the reversion of the L1210 cells to the phenotype. These results demonstrate that Fas expression occurs in response to altered metabolic activity.

[0283] 5. Confocal microscopy shows that resistance to apoptosis is characterized by intracellular (but not extracellular) Fas expression: L1210 D
DP cells do not express cell surface Fas. To address the possibility that Fas was expressed but targeted to subcellular organelles, we permeabilized L1210 cells and L1210 DDP cells, and added fluorochrome-conjugated anti-Fa
Staining was performed using the s antibody (J02.2, Pharmingen). The cells were examined with a confocal microscope. (This experiment represents four experiments).

[0284] Our data indicate that L1210 DDP cells express Fas in their cytosolic components. A fluorochrome-conjugated isotype compatible with the antibody was used as a control. In addition, these data also demonstrate that Fas-negative apoptosis-resistant cells express intracellular Fas.

[0285] 6. Fas-deficient (lpr) lymphocytes express intracellular Fas (but not extracellular) molecules: we have C57BL / 6 mice and lpr mutant (Fa
Lysocytes were isolated from spleens of C57BL6 transgenics with a loss of S sensitivity. Cells were stained with fluorescein-conjugated hamster anti-Fas and examined on a confocal microscope.

The results demonstrate that unstimulated, non-permeabilized spleen cells from C57BL / 6 animals express Fas at lower levels compared to isotype controls. Interestingly, significant levels of Fas expression were detected in permeabilized normal lymphocytes. As expected, C57BL6. Non-permeabilized cells from lpr animals do not express detectable cell surface Fas as compared to the isotype control. Interestingly, C57Bl / 6. Intracellular Fas staining of permeabilized spleen cells from lpr animals indicates intracellular expression of Fas. These results demonstrate that variants affecting susceptibility to Fas-induced death prevent cell surface expression of Fas molecules but not intracellular expression.

[0287] 7. Anti-cancer drug induces susceptibility to Fas-induced cell death: the anti-cancer drug methotrexate is resistant to Fas-induced cell death by L1210 cells or L1210 / D
To determine whether to sensitize DP cells, we cultured L1210 cells in the presence or absence of 10 ⁻⁸ M methotrexate for 72 hours. Uncoated plates or 10 μg / ml anti-Fas on each group of cells
(Jo. 2.2, Pharmingen).
We analyzed cell death using flow cytometry. Forward angle light scatter and 90 degree light scatter were used to distinguish between live and dead cells. Dead cells were gated as low / high ethidium bromide bearing cells by forward angle light scatter. Mortality was calculated for the total number of cells obtained. Hereinafter, in Table 3, the values indicate the percentage of dead cells exceeding the background of untreated cells.

[0288]

[Table 3] Furthermore, L1210 cells and L1210 / DDP cells were cultured for 24 hours at 10 ^-8 M
Treated with methotrexate. Flow cytometry analysis is based on forward side scatter (
Two populations are shown based on the forward side scatter. The forward scatter high population did not take up ethidium bromide and was therefore viable. The forward scatter low population, in contrast, incorporated ethidium bromide. L1210 cells took up moderate amounts. Analysis of the DNA fragments indicates that L1210 produced a ladder of nucleosome-sized fragments that exhibited apoptosis, while L1210 / DDP cells did not. This latter phenotype (loss in forward scatter and membrane permeability without "DNA laddering") is a hallmark of neoplasia.

[0289] 8. Fas-deficient lymphocytes are also drug resistant to methotrexate: we have determined that age-matched wild-type C57BL / 6 mice and C57B
L6. lpr and C57BL. gld. From the spleen lymphocytes. C5
Isolating spleen cells from 7BL / 6lpr or gld animals, depleting erythrocytes,
Then a single cell suspension was prepared. Cells were cultured in the absence of methotrexate or in the presence of 5 × 10 ⁻⁸ M methotrexate for 18 or 32 hours. Cells were harvested and viability was determined by flow cytometry analysis and confirmed by trypan blue exclusion.

This data demonstrates reduced susceptibility to methotrexate-induced apoptosis in Fas-deficient lymphocytes. These data are consistent with the notion that Fas is required for drug sensitivity.

[0291] 9. Drug-resistant cells express intracellular fas, UCP and bcl-2: we show that wild-type cells and / or drug-resistant cells have intracellular and surface fa.
It was determined whether to express s, UCP and bcl-2. We stained non-permeabilized L1210 cells and L1210 / DDP cells for cell surface Fas or intracellular Fas. This data indicates that in the absence of cell surface expression of Fas on drug / apoptosis resistant cells, drug resistant cells express high levels of intracellular Fas. Drug resistant cells are negative for cell surface Fas and protect against death resulting from altered mitochondrial permeability transition.

Example 2: Pancreatic B cells express UCP and do not have cell surface fas. Loss of antigen in β-cell tumors: two responsive T cell clones (BDC-
2.5 and BDC-6.9) were analyzed using NOD peritoneal cells as APC and freshly prepared NOD islet cells (control) or β tumor cells, or NIT-1 (NOD- Β established from RIPTag mice
Tumor cell lines). When recovering islet tumors, the resulting β cells are completely the same antigenic as normal NOD islet cells. The NIT-1 strain is also antigenic for these T cell clones, but only at low passage numbers; in continuous culture, the strain changes its morphology and growth rate and undergoes complete antigen loss.

[0293] 2. Pancreatic B cell response to glucose: The experiments described below
Was designed to test the hypothesis that may be associated with immune recognition and destruction.
Glucose utilization was determined by 5- [^Three[H] from glucose [^ThreeH] H _Two Measured as O production. Glucose oxidation is U- [¹⁴C] from glucose¹⁴
C] CO_TwoIt was measured as production. This data is a function of increasing glucose concentration.
Shows increased glucose utilization and glucose oxidation in β cells.

[0294] 3. Normal β cells express intracellular UCP2 and do not express cell surface Fas: Normal β cells have a specialized glucose response based on cells that respond to physiological glucose concentrations. The processes that mediate glucose responsiveness are those that involve the flow through glycolysis. Glucose use of β cells is mediated through the relatively specific system (with a high K _m glucose transporter (GLUT2) and glucose phosphorylation isoform specialized (glucokinase)). We isolated β cells from C3H mice, stained the isolated cells with anti-Fas, and electrically gated surviving cells. In parallel, permeabilize the cells and
Antibodies to CP2 (Drs. Jean Himms-Hagen and ME
. (Courtesy of Harper).

This result indicates that normal β cells express intracellular UCP2 and cell surface Fas
Is not expressed.

[0296] 4. Fas expression and mitochondrial membrane potential are functions of glucose concentration in mouse β cells.

The main question is whether Fas expression is altered by changes in physiological glucose concentration in normal β-cells, and whether mitochondrial membrane potential is elevated (this is the ATP To have a synthesis). Islets were isolated with trypsin and a cell strainer and dispersed. The tissue debris and dead cells are removed and the cells are
Subject to a Percoll gradient of 66. The cells were electrically gated and the population of islet cells was separated. The part with the larger cells is gated as β cells, where:
Portions with smaller cells were gated as α cells. Other larger cells were excluded because they contained delta cells. The cells were treated overnight with either physiological 11.1 mM glucose or high glucose 55.5 mM glucose. Fas expression was determined by staining with FITC-conjugated antibody. The average fluorescence of the staining with the isotype control antibody was subtracted. Mitochondrial membrane potential was measured using JC-1 as a fluorescent probe. The relative membrane potential was read by obtaining the red average fluorescence (JC-1 labeled aggregation) divided by the average green fluorescence (monomer JC-1) labeled fluorescence. Our data show that when the glucose concentration is increased, a large β-cell subset of gated cells increased Fas expression and at the same time increased mitochondrial membrane potential, but at a smaller (possibly
α, glucagon producing cells) suggest that this was not the case.

5. Determination of mitochondrial membrane potential in β cells isolated from four animal strains.

[0299] Mitochondrial membrane potential was measured by mitotracker red.
ed) to evaluate the flow cytometry. The amount of membrane potential is described in more detail below in four strains of animals AB-, AB-Ea, C57B1 / 6, BI
It was measured by TgEa. Mitochondrial membrane potential was highest in the AB line, followed by the AB-EA line. In the C57B1 / 6 and BITgEa lines, the mitochondrial membrane potential was much lower.

Example 3 Relationship Between Cell Metabolic Status and Expression of MHC Class II Molecules 1. Analysis of Mechanisms of Signaling Via MHC Class II Molecules i. Classes in Resting B Cells Early disruption demonstrated that ligation of IE molecules to quiescent B cells resulted in rapid production of intracellular cAMP in those cells (Cambier).
Et al., Nature (1987)). This observation and death and cA in quiescent B cells
Based on our more recent evidence that elevated MP levels are correlated, we studied cAMP production in more detail. This data provides a comparative analysis of changes in levels of cAMP induced by antibodies to IE and IA. Cells were purified using anti-Ig (Jackson Immunochemicals) and IL- using antibodies against MHC class I (from ATCC).
Stimulated with 4 (Genzyme) or with isoproteronol (Sigma). We have isolated B cells from wild type, lpr or gld animals, which express C57BL, which expresses IA but does not express IE molecules.

This data shows that the lpr or gld mutations were the result of the anti-IA
Figure 4 shows that it does not alter the signal transmitted by MHC class II engagement at the mAb dose. These data indicate that under the conditions we used to stimulate cells, anti-IE antibodies are more effective at increasing concentrations of intracellular cAMP. To investigate the probability that differences in the ability of IA and IE to alter levels of cAMP could be the result of a dose-dependent difference, and that anti-IA antibodies could
To determine whether to actually elicit an increase in P, we determined that C57BL
Volume titration of anti-IA stimulation on B cells from / 6 animals was performed. These data demonstrate oscillations in cAMP levels and reflect changes in signaling due to differences in MHC class II aggregation status.

[0302] Analysis of DNA fragmentation from quiescent B cells was also performed. Cells were incubated with medium alone, anti-class II (IA), anti-class II (IAβ chain), anti-class II IE, isoproteronol, or dibutyryl cAMP, and cultured overnight. Cells were harvested, nuclei were separated, fragmented (not clear) DNA was precipitated, and the samples were electrophoresed on agarose gels. Bands were visualized using ethidium bromide and ultraviolet light detection. This data is presented in the table below.

[0303]

[Table 8] (Ii. Anti-Class II mAbs Induce Increased Apoptotic Cell Death in Resting B Cells) Our data indicate that treatment of resting B lymphocytes with anti-Class II mAbs indicates that nucleosome-sized DNA It demonstrates that it results in B cell apoptosis as measured by increased fragments. The apoptotic index was generated by comparison with maximal apoptotic death when stimulated by isoproterenol. This data indicates that ligation of class II molecules in quiescent but not activated B cells results in apoptotic death. Resting B cells,
In vitro activated B cells (anti-Ig and recombinant IL-4) or fresh ex vivo activated cells were isolated from 10 μg / ml anti-IA ^k mAb (17/227).
Treated with anti-Ig and 16 units of recombinant IL-4, or 10 μM isoproteronol. B cells were treated with the indicated stimuli at 37 ° C. for 10 minutes, cultured overnight, harvested and assayed. (The in vitro activated cells may contain additional anti-I
No treatment with g and rIL-4. 2.) Fragmented DNA was isolated by centrifugation and run on an agarose gel. The ethidium bromide stained gel was photographed and scanned. The apoptotic index was calculated by employing [(experimental area-medium alone area) / (isoproterenol area-medium alone area)]. Treatments that generate a score of 0 show background levels of apoptosis, whereas treatments that are protective generate a score of <0. Data from four independent experiments are averaged for normal animals; mean and standard error are shown.

(Iii. MHC class II induced death in quiescent B cells from normal mouse lines but not from mouse lines with lpr and gld mutations.) Mechanism of IA-mediated death To test the hypothesis that contains the receptor ligand pair CD95 / CD95L, we used a mouse strain with an lpr or gld mutation. This strain has deletions in CD95 and CD95L, respectively (Watanabe-Fukunaga, R et al., Nature (L
ondon), 1992.356, 314-317; Suda, T et al., Cell.
, 1993, 75: 1169-1178). Total splenic B cells were obtained from C3H, AKR, C
3H. lpr and MRL. gld mice. All of these lines are H- ^2k . The cells are cultured overnight, harvested, permeabilized with saponin, stained with propidium iodide (PI) that intercalates into DNA,
And it analyzed by the flow cytometry. After 15 hours of culture, a significant percentage of cultured B cells fragment their DNA without stimulation (Newell, MK et al., Pr.
oc. Natl. Acad. Sci. USA, 1993, 90: 10459-1.
0463). Cross-linking MHC class II IA (HLA-DP / DQ in humans) to B cells from wild type animals results in increased apoptosis. Unlike normal B cells, MHC class II to B cells from lpr or gld mice
There is no increase of less than 2x DNA after crosslinking.

2. Interaction of B cells with T cells The results of mAb binding to MHC class II do not, a priori, reflect the results of interactions with physiologically relevant ligands. To examine the probability that a physiological ligand for MHC class II is expressed in CD4 + T cells, we tested the effects of class II signaling resulting from T cell: B cell interactions (Table 4). . Resting spleen B cells are subjected to T cell depletion and density gradient centrifugation (Perc
all). Then, the B cells and the self-reactive I-Ak-specific T
Cell hybridoma (Ka1-68.4) or hen egg lysozyme (HEL) peptide-specific I-Ak restricted T cell hybridoma (A6.A2)
Combined with or without trypsinized lysozyme as a source of the required peptide. Cells were cultured overnight at 37 ° C. and then examined under a fluorescent microscope. Apoptotic cells were scored based on their morphology and uptake of Hoechst Dye 33342 at a final concentration of 5 μg / ml (C
ohen, J.M. J. Et al., Ann Rev Immun, 1992, 10, 267.
-293). B cells and T cells can be distinguished by morphology.

[0306]

[Table 4] ^a Equal numbers (5 × 10 ⁵ ) of B and T cells were incubated in a 24-well microtiter plate at 37 ° C. for 16 hours.

^B A6. A2 is an I-Ak restricted T cell hybridoma specific for hen egg lysozyme peptide HEL (aa34-45). The titer of IL-2 is H
T-cells were determined as previously described (36).

^C Trypsin digest of HEL containing HEL (aa 34-45) at 1 mg / m
1 used.

^D Ka1-68.4 is a self-reactive I-Ak-specific T cell hybridoma.

3. Phenotypic Characterization of Apoptotic B Cells The present inventors applied a technique using terminal deoxynucleotidyl transferase (TdT) to convert fluorochrome-conjugated deoxyribonucleotides into apoptotic cells. Attached to free ends of DNA for flow cytometry analysis (Go
ld, R et al., J Histochem Cytochem, 1993, 41: 1.
023-1030). Apoptotic cells are stained light green with dUTP-FITC (deoxyuridine triphosphate) because the fragmented DNA of apoptotic cells has significantly more free ends than the DNA of non-apoptotic cells. On the other hand, surviving cells remain dull. After 16 hours of incubation with Ka1-68.4 autoreactive T cell hybridomas, quiescent B cells from AKR mice show 46-47% apoptotic cells, confirming the results using two other methods. did. This method allows for counterstaining of cells with antibodies directed against various surface receptors expressed by B cells.

A two-color flow cytometric analysis of apoptotic resting B cells was performed. AKR
Resting B cells and Ka1-68.4 T hybridoma cells were incubated overnight. Cells are stained with a biotin-conjugated mAb directed against B7-1, B7-2 or Fas, followed by PE-streptavidin, and apoptotic cells are stained with TdT / dUTP-FITC. was detected. The contour plots generated showed counterstaining with the indicated mAb for B cells harvested from cultures with labeled versus T cells using dUTP-FITC (a measure of apoptotic death). This ratio indicates the relative number of cells in the viable (dUTP-FITC insensitive) and apoptotic (dUTP-FITC light) populations.

B cells cultured overnight with Ka1-68.4 compared to quiescent B cells
7-1, B7-2 and Fas were up-regulated, the up-regulation of B7-1 was most prominent and resulted in a bimodal distribution. By two-color analysis, B cells from these cultures were viable (deoxyuridine-FI
It could be divided into low (TC) and apoptotic (high deoxyuridine-FITC) populations, with apparent differential expression of counterstained receptors in the two populations. The histogram of the fluorescence intensity of the stained receptor shows that Fas and especially B7-1 are up-regulated in the apoptotic population,
On the other hand, B7-2 indicates that it is expressed at a high level in the surviving population.

4. Class II-Mediated Signaling of (NZB × NZW) F1 and (NZB × SWR) F1 in Mice i. Class II engagement in resting B cells from the murine autoimmune lineage
Does not result in an increase in cAMP compared to background levels. Experiments with B cells from (NZB × NZW) F1 and (NZB × SWR) F1 mice show that the potential between class II-mediated B cell signaling and autoimmunity in these mice An association was suggested. Newell, M
K et al. (Proc. Natl. Acad. Sci. USA 1993, 90:10).
In accordance with the protocol for quiescent B lymphocytes from normal mice described in
Resting B cells from spleens of (SWR) F1 mice were separated by Percoll gradient and cells were treated with antibodies against class II molecules. In the experiment, 3
Young mice under the age of month were used. These mice do not have elevated serum levels of IgG autoantibodies to histones and DNA, and do not show evidence of immune complex glomerulonephritis.

The data show that (NZB × SWR) F in contrast to B cells from normal mice.
1 and (NZB × NZW) F1 resting B cells from their class II
Does not raise intracellular cAMP in response to molecular ligation. In contrast, the response to isoproterenol is normal. Resting (1.079 <r <1.N.) From normal mice; (NZB × NZW) F1 mice;
085) B cells were treated with stimuli at 37 ° C for 10 minutes. Surface MHC is present between normal mouse quiescent cells and (NZB × SWR) F1 mouse quiescent cells.
It should be noted that there are no significant differences when defined by Class II expression and density (Julius, M. and Haughn, L, Eu).
r. J Immun, 1992, 22, 2323-2329).

(Ii. Class II-mediated apoptosis does not occur in resting B lymphocytes from autoimmune mice.) We have shown that (NZB × NZW) F1 and (NZB × SWR) F1 from mice. Both quiescent and activated B cells were stimulated with antibodies to class II molecules. Young animals before the development of lupus-like autoantibodies and renal disease were used in these studies. D from high density resting B cells (1.079 <r <1.085)
Agarose gel electrophoresis of the NA fragment was performed as described above. Normalized regions were defined as normal mice; (NZB × SWR) F1 mice; or (NZB × NZW)
Generated by scanning density on gel for F1 mice. This data was normalized to background levels rather than calculating an apoptotic index. (NZB × NZW) F1 cells did not show a significant increase in apoptosis when treated with isoproterenol. Since the experiments were performed on different days, it was difficult to compare background levels of apoptosis for each stain. It should be noted, however, that there was significant variation in the background levels of apoptosis and that the levels for (NZB x NZW) F1 animals tended to be apparently higher than for the other strains. is there.

These data indicate that, in contrast to normal B cells, quiescent B cells from (NZB × NZW) F1 mice; and (NZB × SWR) F1 mice were MHC class I
Demonstrated refractory for I-mediated apoptosis. These data also indicate that, despite normal cAMP production after isoproterenol,
NZB x NZW) F1 induced minimal evidence of apoptosis in B cells. Intermediate levels of isoproterenol-induced apoptosis (NZB
XSWR) was evident in B cells from F1 mice. Thus, the summarized results indicate that quiescent B cells from both autoimmune lineages are associated with class II molecule ligation and cAMP.
Cells that lack the conjugation with the production of (NZB × NZW) F1 animals,
It demonstrates that it appears to have a second lesion in the apoptotic pathway that is downstream of cAMP generation. Therefore, these data are (NZB × NZW) F1
FIG. 4 shows that ligation of class II molecules in resting B cells from animals and (NZB × SWR) F1 animals does not result in apoptotic death.

(Iii. Phenotypic Characterization of Apoptotic B Cells from Autoimmune-Prone Mice) Our results show that when B cells from (NZB × NZW) F1 animals are used, these animals Show that they are refractory to class II-induced apoptosis. This indicates that loss of class II-mediated apoptosis provides a mechanism for polyclonal gamma globulin hyperemia, a hallmark of autoimmune diseases. Resting B cells can present sufficient self-peptide to allow interaction with "self-reactive" T cells, and class I in resting B cells
Lack of availability of I-mediated apoptosis can result in polyclonal gamma globulin hyperemia.

(5. Structural features and details of MHC 1A and 1E molecules associated with cell death
UCP expression in L1210 cells and L1210 / DDP cells was
Measured in response to rosporin and PMA. L1210 cells
Low level UCP (approximately 110 Geo MFI against background)
Was expressed. UCP levels were measured in cells treated with staurosporine (approximately
Cells treated with 175 Geo MFI for background and PMA (and
Increased at approximately 175 Geo MFI over background). X
IA (approximately 190 Geo MFI against background) and XIE
(Roughly 240 Geo MFI over background) is also higher
Had a level of UCP. USP levels in L1210 / DDP cells also
, Significantly higher than L1210 cells (approximately
300 Geo MFI) (Sequence of MHC IA and MHC IE molecules) IA^kAnd IE^kΒ- and α-chain transmembrane (TM) domains and cytoplasm (
Cy) Domain sequence comparisons show both conserved and unique sequences
Was. The differences between IA and IE and the human equivalent are generally common. IA^k
And IE^kOf the 22 amino acids conserved in the TM domain
It has 18 amino acids. These changes are basically preserved, while
Cy domains differ in length and composition. IA^kThe Cy domain of
With two prolines and two more positive charges (R, H) with internal leaflet
It also has at the proximal end of the nearby Cy domain. PKC transition and cAM respectively
As required by P, Wada et al. (Int Immunol. 1994, 6:14).
57-1465)^kRegion of the Cy domain (RH
RSQKGP) (SEQ ID NO: 13) differs from the sequence found in IE, but differs from residue QK
G is the same. This sequence similarity indicates that the ligation of the IA or IE can result in intracellular cAMP
May explain the observation that it can signal an increase in RH residue or PP residue
Is missing in the IE means that it is introduced into the Cy domain by multiple P residues.
Resulting from the deletion of any of the binding sites defined by the positive charge of the created defect,
Explain the lack of Fas induction.

6. Correlation between surface expression and type of cell death. Cell surface phenotype of MHC class II ⁺ cells Many of our studies have been performed with wild-type MHC class II molecules or mutated MH.
Signaling phenotype M12. Each of C3 and K46J (these are cAMP and C46J, respectively)
Responses Generated by a ++ (Wade, WF et al., Int Immunol, 1994
6: 1457-1465)). The results of flow cytometry analysis to phenotype the expression of cell surface markers in each of these strains are combined in Table 5 with a summary of what we know about the mode of cell death. . These data were generated by flow cytometry, either by assessing changes in forward and sideways scatter using ethidium bromide incorporation, or by morphological assessment and trypan blue exclusion.

[0320]

[Table 5] Example 4: Involvement of IA versus IE in resistance and susceptibility to immune-mediated cardiovascular disease Coxsackievirus-mediated myocarditis To assess the role of MHC class II antigens in immune-mediated myocarditis susceptibility , Transgenic mice were isolated from the Mayo Clinic Dr. Chel
I was donated by la David. Dr. David was supplied the following lines: 1) AB ⁰ mice lacking IA molecules and IE molecules of MHC class II (class II knockout (KO) mice); 2) AB ⁰ Ea ^b is functional It has a transgenic IE chain so that the animal expresses IE but
A is a non-expressing MHC class II KO mouse; 3) Bl. Tg. Ea ^b
Mice express wild-type IA and IE molecules; and wild-type C57B
16 expresses IA only.

Male mice 4-5 weeks of age were given 100 μg of GL3-3 in 0.5 ml of PBS.
A (anti-γδ) monoclonal antibody or PBS alone was injected intraperitoneally between -2 and +2 days against the virus. Animals received 10 ⁴ PFU of CVB3 on day 0 and surviving animals were sacrificed on day 7. Hearts were removed from the animals on days 5-7 for analysis. The heart was split and the apex was formalin-fixed, sectioned, and evaluated by image analysis for the percentage of affected myocardium. The remaining tissues were titrated for virus by plaque formation assay. Groups consisted of four mice each. The results are summarized in Table 6 below.

[0322]

[Table 6] Mice that do not express class II MHC antigens or that express only IA were resistant to myocarditis with little or no myocardial inflammation and without animal lethality. In contrast, mice with IE showed increased mortality with substantial myocardial necrosis. AB ⁰ Eα mice, which express only IE, began dying early (3 days post-infection), and Bl. Tg. Eα mice (IA + and IE
+), Which had more extensive aggregated myocardial necrosis with limited cardiac inflammation. Bl. Tg. Myocardial lesions in Eα mice were restricted to areas of mononuclear cell infiltration and were characterized by extensive cardiomyocyte leakage. Virus titers also differed by mouse strain, with the highest titers being AB ⁰
And AB ⁰ Eα in mice. This suggests that IA expression is important in removing the virus. Also, elevated viral titers in AB ⁰ Eα mice must not be a direct cause for necrotic heart lesions in this strain. This is because AB ⁰ mice also have elevated virus concentrations but no histological evidence of cardiac damage. Thus, either by animal mortality or histology, the presence of IE in C57BL / 6 mice exacerbated CVB3-induced disease. Treatment of the BLtgEαk strain with an antibody to deplete γδ T cells conferred resistance to myocarditis. We measured cytokine profiles from total splenocytes of the animal before and after infection. We have found that increased gamma interferon and Bl. TG. Higher levels of IL4 were observed in Eαk animals. γ
Depletion of δT cells resulted in an increase in the percentage of cells resulting in post-IL4 infection (data not shown). This result demonstrates that cytokine bias is important in the development of myocarditis lesions.

Example 5 MHC Class II IE Molecules Confers Protection from Early Atherosclerotic Lipid Lesions Some studies have shown that CD4 ⁺ T lymphocytes are responsible for lipid-induced atherosclerotic lesions. Suggest that it contributes to etiology (Emeson, EE et al., Am. J. Path.
1996, 149: 675-685). We have identified IA and / or IE
We examined the probability that the expression of the protein affected the development of lesions resulting from a high-fat diet.

Transgenic mice of C57BL / 6 that differ in MHC class II antigen expression were obtained from Dr. Donated by Celli David (Mayo Clinic). Four to ten three week old mice per line were on a high lipid, high cholesterol diet (Teklad, # 96354; 20% total lipids, 1.5% cholesterol, 0.5% sodium cholate). The mice were then sacrificed after 15 weeks for aortic and splenocyte evaluation. An additional group of 7 C57BL / 6 mice was placed on the high lipid diet described above, but 100 μg of a monoclonal rat anti-CD4 antibody (clone Gk1.5; American Type Tissue Collection, Bethesda, MD) was given every two weeks. It was injected intraperitoneally. Using this protocol previously, CD4 + T cell deficient mice were maintained for long periods in an experimental allergic encephalomyelitis (EAE) model. The ascending aorta, including the heart and aortic arch, was removed and evaluated for lipid lesions of atherosclerosis using Oil Red O-stained serial sections according to the method of Plump et al. In short, the heart,
The ventricles were fixed in 10% buffered formalin, embedded in 25% gelatin, grossly cut off the ventricles parallel to the atrium, frozen in OCT, and sectioned by cryostat. Sections of 10 μm thickness were placed on 5% gelatin coated slides and
. Stained with 24% oil red O (neutral lipid) and 2.4% hematoxylin (nuclear and basophil tissue) and 0.25% light green (remaining tissue)
Was used for counterstaining. Lesions were morphometrically determined using a compound light microscope.

[0325]

[Table 7] Our data demonstrate that the presence of MHC class II IA correlates with susceptibility to lipid lesions in the heart of C57BL / 6 animals and that the presence of IE molecules confers protection from lipid lesions I do. The role of CD4 cells in this process was confirmed by the finding that removal of CD4 cells from susceptible C57BL / 6 eliminated pathology in the heart. Expression of IE and IL-4
It should be noted that the correlation between the increased production of and the protection from lipid lesions is obtained from a high lipid diet. The results in Table 7 demonstrate that CD4 + T cells contribute to early lipid deposition in the aortic sinus and that the IE molecule suppresses the lesion. The MHC class II molecules IA or IE regulate susceptibility to the development of early atherosclerotic plaques and their cytokine profiles are altered (
Not shown).

Example 6 NGF and EGF Dependent Changes in Expression of Fas (CD95), B7.1 (CD80) and B7.2 (CD86) on PC12, TrkA, and v-Crk Neuron Cell Surfaces Materials and Methods Cell Culture: Rat pheochromocytoma cell line, including PC12, TrkA, and v-Crk cells, was kindly provided by Dr. Raymond Birge. Those,
In 5% CO humidified incubator containing _2, 7% heat-inactivated fetal calf serum and 3% heat inactivated horse serum full-supplemented RPMI 1640 (GIBCO
) At 37 ° C. PC12 transfectants were generated as previously described (Glassman et al., 1997; Hempstead et al., 1994). Cells were plated into 6-well culture plates in 5 mL of complete medium in a concentration range of 2-8 × 10 ⁶ cells / well according to the growth kinetics of the cell type. NGF-7S (Sigma Chemical) derived from mouse submandibular gland
Co. ) Or EGF donated by Dr. Raymond Bridge
A concentration of 0 ng / ml culture medium was added and the cells were incubated for 24 or 48 hours.

Cytofluorometric analysis: Cells were collected after a 10 minute incubation period on ice to reduce adherence to plastic culture flasks. The cells were spun at 1210 rpm for 7 minutes, resuspended in medium and counted after trypan blue staining. The same number of cells were placed in a 12 × 75 mm flow tube (range: 0
. 1-1 × 10 ⁶ cells / tube), washed in PBS and 5% FBS, and 4 ° C.
Stained. The following stains were used: a) Fluorescein isothiocyanate (F
ITC) Hamster IgG isotype standard, b) FITC anti-mouse Fas, c
) FITC anti-mouse CD80 (B7.1), d) phycoerythrin (PE) mouse IgG2b K isotype standard, and e) PE anti-mouse CD86 (B7.
2). All antibodies were obtained from Pharmingen.

After a 20 minute incubation on ice, cells were washed, PBS and 5% F
Resuspend in CS and flow cytometry (Becton Dickin
son). Histogram plots were derived from gated dot plots for the population of viable cells according to the forward scatter ratio versus side scatter ratio (Cell Quest Program). The absolute values of Fas, B7.1 and B7.2 shown on this graph were obtained by subtracting the geometric mean fluorescence of the specific antibody from the mean synergistic fluorescence of its corresponding isotype. Values were subjectively considered positive (+) if the difference was statistically significant (p <0.001) according to the applied Kilmogorov-Smirnov statistical analysis.

Results Fas cell surface expression after NGF stimulation: The data showed that Fas is constitutively expressed on the surface of PC12 and TrkA cells. NGF stimulation is 2
At 4 hours, Fas expression on PC12 cells is abrogated, and its expression on Trk cells is paradoxically increased. Fas level was measured 48 hours after NGF stimulation.
It tends to return to basal values for 2 cells and remains constant for TrkA cells. Constitutive cell surface Fas expression of v-Crk is minimal, but statistically significant, and is completely suppressed 48 hours after NGF stimulation.

Fas cell surface expression after EGF stimulation: EGF stimulation at 24 and 48 hours also down-regulated Fas expression on PC12 and Trk cells; EGF stimulation at 48 hours Completely suppresses Fas expression on cell types. On the other hand, EGF stimulation at 24 hours significantly up-regulates Fas expression on v-Crk cells, but its Fas expression is again down-regulated and suppressed by EGF stimulation at 48 hours.

B7.1 cell surface expression after NGF stimulation: B7.1 is unstimulated PC1
It is highly constitutively expressed on the surface of 2 cells and Trk cells. Its expression is minimal on unstimulated v-Crk cells. NGF stimulation is PC in 24 hours
B7.1 expression on 12 cells was first down-regulated,
It tends to recover to the base value over time. NGF stimulation stimulates Trk cells and v-Cr
Has no effect on B7.1 expression on the surface of k cells.

B7.1 cell surface expression after EGF stimulation: EGF stimulation at 24 hours
Detection of high B7.1 levels on the surface of cells is significantly reduced; EGF stimulation at 48 hours restores its basal values. As in PC12 cells, B7.
1 expression decreases 24 hours after EGF stimulation of Trk cells and is restored at 48 hours. EGF stimulation induced B7.1 expression on v-Crk cells in culture 24
Significantly increase at time and 48 hours.

B7.2 cell surface expression after NGF stimulation: B7.2 cell surface expression is minimal on unstimulated PC12 cells. NGF stimulation at 24 hours has no effect on its expression, whereas stimulation at 48 hours completely abrogates its expression. Trk
B7.2 cell surface expression is also minimal on unstimulated cells,
Slight downregulation by NGF stimulation at 24 hours
Will be deterred by discontinuing the use of. There is no B7.2 cell surface expression on v-Crk cells and it is not induced by NGF stimulation.

B7.2 cell surface expression after EGF stimulation: EGF stimulation at 48 hours
Up-regulates B7.2 expression on Trk cells and v
-Most significant on the surface of Crk cells. EGF stimulating at 48 hours is the only example by which there is a significant induction of the constitutive absence of the B7.2 molecule on v-Crk cells. Discontinuation of EGF completely eliminates this effect,
And the B7.2 level cannot be detected again.

In PC12 cells and mutant variants thereof, NGF enhances cell differentiation as reflected by increased size and flattening of neuronal cell bodies, and especially by inducing axonal growth. Induces proteins required for sympathetic neuron acquisition of phenotype (Ray Paper, J. BioChem)
1995). In contrast, EGF stimulation of these cells induces these cells to enter the cell cycle and thus to proliferate, by binding to another receptor that also belongs to the tyrosine kinase receptor family (Hempstead).
Siegel et al., 1994). NGF receptor pathway and EG
The F receptor pathway appears to be very similar. Both activate the receptor tyrosine kinase, the Erk2 / MAPK pathway, and
s protein (Chao, 1992; Ray, ibid, Mene).
ndez Iglesias et al., 1997). However, according to the present invention, it has been found that the effects of these molecules are very different for the induction and suppression of the expression of Fas, B7.1 and B7.2 on the surface of neuronal cells, which indicates that This suggests that induction of these molecules by the factors NGF and EGF is mediated by different intracellular signaling pathways, albeit dependent on tyrosine kinase activation.

As described above, Fas, B7.1 and B7.2 were used to maintain Ps maintained in culture.
It is constitutively expressed on C12 cells and TrkA cells. Fas expression on PC12 cells is significantly reduced by NGF stimulation (NGFS). Early NGFS in TrkA cells induces an increase in Fas expression above basal levels. Microglial cells constitutively express Fas ligand (Bonetti and Raine).
Menendez Iglesias et al., 1997), and perhaps direct cell-cell contact between neurons and microglial cells, Fas and F.
Required for interaction with as ligand and generation of apoptotic or costimulatory mitotic signals. In TrkA cells overexpressing the Trk receptor, NGF-induced Fas expression is associated with cell division, as NGF stimulates mitosis during that time and plays a synchronous role in the differentiation and development of the filopodia. Can promote. On TrkA cells, higher induction of Fas expression correlates with an increase in the number of tyrosine kinase A surface receptors, thus increasing the persistence for mRNA translation of Fas protein and its secondary expression on its cell surface. Correlated with the occurrence of the applied stimulus.

EGF stimulation (EGFS) significantly reduces and even arrests Fas expression on PC12 and TrkA cells. However, its expression is dependent on v-Crk.
Transient 3-fold increase in cells at 24 hours post-EGFS and 48 post-EGFS
Disappears in time. EGFS induces axonal outgrowth on PC12 v-crk mutants but not on native PC12 cells (Hempst
ead et al., 1994), which clearly correlates with the induction of Fas on the v-Crk membrane cell surface, but does not explain the down-regulation of Fas observed in Trk and PC12 cells. EGF receptors are also expressed on cortical neurons, cerebellum and hippocampus, and appear to act on mitotic and post-mitotic neurons (Yamada et al., 1997).
.

NGFS and NGFW modulate a slight up-regulation of B7.1 on PC12, TrkA and v-Crk cells; however, NGFW at 48 hours does not prevent B7.1 on v-Crk cells. 1 Reduce expression by 60%. In contrast, we consider the effect of NGF on B7.2 on all three cell types to be negligible. However, EGFS at 48 hours significantly increases B7.1 expression on all cell variants, but its expression clearly decreases after EGFW. EGFS at 48 hours also significantly increases B7.2 expression on PC12 and Trk cells and induces B7.2 expression on v-Crk cells. EGFW at 24 hours and 48 hours was performed with PC12 cells and Trk.
Correlates with down-regulation of B7.2 in A cells, and paradoxically 2
Does not increase B7.2 expression on v-Crk at 4 hours; it is immediately downregulated 48 hours after EGFW. Therefore, Fas on v-Crk cells
Expression and B7.1-B on all cell types (but especially on v-Crk cells)
7.2 expression appears to be EGF-dependent. v-Crk cells were obtained from Src homology regions 2 and 3 (SH2 and SH3) (Hempstead et al., 1994).
Is characterized by the presence of a fusion protein comprising a viral gag sequence fused to the cellular sequence of E. coli. C-src also retains tyrosine kinase activity (V
aingankar and Martins-Green, 1998), and perhaps these modifications in its sequence indicate that C-src itself acts similarly on the EGF receptor and that the signal intensity for the expression of these cell surface molecules. To increase. Discontinuation of use of this stimulus (EGFW)
Restore expression of these molecules to basal levels.

Identification of Immune Recognition Molecules on Treated Ganglia vs. Untreated Ganglia Ganglia are removed from the brain of Po (1 day old mice) and plated in culture. . Sensory neurons do not have to be separated from Schwann cells. The isolated ganglia are cultured for at least 72 hours under the following conditions.

1) No treatment 2) In the presence of nerve growth factor (NGF) for 56 hours 3) Subsequently, harvest, wash and replating in the presence of antibodies to NGF. The cells are collected by scraping the cells and dispersed to a single cell suspension. Cells were isolated from cell surface B7-1, B7-2, CDR8, and TrkA (NGF
Receptor) using monoclonal antibodies against these molecules.

The cells are cultured as described above, except that they are in the presence of CTLA-4-HuIg to inhibit cell interactions (synapses) that protect Group I from death. This means that B7-bearing cells are converted to CD28 + cells or CTLA4 + cells by N
It releases GF and promotes innervation. In addition, the histological sections are stained by immunofluorescence (using anti-B7 and TrkA antibodies) in the immediate vicinity of intact mouse brain ex vivo.

Example 7 UCP is present in a panel of tumor cells We extended our analysis of UCP intracellular expression to other tumor cells. Intracellular UCP expression was tested by flow cytometry on cells permeabilized and stained as indicated. The histogram shows the FITC isotype control versus rabbit anti-UCP (Mary Ellen Harper
Represented by FITC anti-rabbit stained at the outer step. Coulter Epics Elite flow cytometer (single excitation wavelength (488 nm) and PE (575 nm), FITC (525 nm)
And with a band filter for Red 613 (613 nm)) were used to analyze the stained cells. Each sample population was gated for the population of interest and evaluated using 40,000 cells, cell size (
(Forward scatter) and complexity (side scatter). Criteria for positive staining were established by using the isotype control (thin line) and comparing to a specific stain (thick line).

All tumor cell lines tested express UCP intracellularly. These data indicate that UCP expression in tumor cells can be generalized to all tumor cells and that the well-documented mitochondria to cytosol of cell fraction production of ATP as cells divide Is likely to result from the shift of Importantly, these data also demonstrate that UCP2 expression is not specific for lymphoid tumors. The L929 cells are fibroblasts and PC12 Trk cells, respectively, derived from a pheochromocytoma cell line. EL4 cells are a mouse thymoma cell line, and Jurkat is a human T cell tumor cell.

To confirm that UCP expression detected by flow cytometry was mitochondrial, we determined that L1210 and L1210 DDP
Mitochondria were isolated and Western blot analysis blotting was performed using a rabbit anti-UCP antibody. Mitochondria were isolated using differential centrifugation as employed from REF. REF (Reinhart, PH
, Taylor, WM, and Bygrave FL (1982) A proc
edure for the rapid preparation of m
itochondia from rat liver. Biochem. J
. 204: 731-735. And Sims NR (1990) Rapid
isolation of metabolically active mi
tochondria from rat brain and subreg
ions using Percoll density gradient
centrifugation. J. Neurochem. 55: 698-70
7. ). The following samples were run: molecular weight marker (BIORAD Biot)
Inlylated SDS-PAGE standard; L1210 / 0 mitochondrial protein from two different mitochondrial preparations (40 μg); L1210 / DDP mitochondrial protein from two different mitochondrial preparations (40 μg); and rat brown adipose tissue (UCP1) Uncoupled protein standard from (expressing ~ 3) (0.75 μg). Rabbit anti-hamster UCP was used at a dilution of 16,000. Secondary antibody: 1: 10,000 in HRP
Goat anti-rabbit IgG conjugated with 0. Chemiluminescence detection: Amersham EC
L kit.

Blots showed higher levels of mitochondrial UCP in drug resistant L1210 / DDP than L1210 / 0. The mitochondrial protein detected has an approximate molecular weight of 30 kDa, which is the estimated molecular weight of UCP2 (
33 kDa).

To determine whether increased UCP corresponded to increased mitochondrial proton leakage and lower mitochondrial membrane potential (ΔΨm), we determined that intact L1210 wild-type and The characteristics of non-phosphorylated respiration in L1210 DDP cells were evaluated. ΔΨm (x in state 4 in DDP cells
mV) is significantly lower (p <0.001) than wild-type cells (ymV) and D
State 4 oxygen consumption in DP cells is significantly higher than in wild type cells, indicating increased mitochondrial proton leakage.

Example 8: Glucose utilization, oxidation and cell surface F in melanoma cells
B16 cells were cultured in the presence of different concentrations of sodium acetate and Fas
Expression was measured. The data shows the level of cell surface Fas expression on non-permeabilized B16 melanoma cells and the level of intracellular Fas expression on permeabilized B16 melanoma cells. As the concentration of sodium acetate increases, the level of intracellular Fas decreases,
And the level of cell surface Fas increased. This demonstrates the transfer of Fas from intracellular storage to the cell surface.

Next, the rate of glucose utilization and glucose oxidation in B16 melanoma cells was measured. Again, cells were cultured in the presence of various concentrations of sodium acetate. Both glucose utilization and glucose oxidation (measured in nmoles) decreased with increasing concentrations of sodium acetate. This demonstrates that it correlates with the expression of cell surface Fas in the same cells.

Example 9: Normal mouse T cells express IE Previous studies with human T cells showed that activation of T cells by antigen or CD4 implantation resulted in HLA DR on the surface of T cells. Is expressed. Expression of MHC class II on mouse T cells is controversial. The report shows both positive and negative results. Studies to date have not distinguished between not expressing IA and not expressing IE. Normal mouse T cells are IE
To address the possibility of expressing, we isolated lymph nodes or spleen as indicated from strains of animals representing IE, Balb / c, CBA, and AKR mice. Spleens or lymph nodes were removed from 4-week old mice, subdivided into single cell suspensions, and red blood cells were removed by treatment with Gey. Then, the splenocytes were collected from Cell Columns (Cytovax, Edmonton, Calif.).
Nada) to purify the CD4 ⁺ T cells. CD4 ⁺ T cells were collected and 98
. It was found to be 5% pure and contaminants were identified as NK cells and γδ T cells by flow cytometry. CD4 T cells were treated with an antibody against CD4 (GK1.5) at 10 μg / ml / 10 ⁷ cells, washed, and treated with a rabbit anti-rat antibody for 45 minutes at 37 ° C., followed by washing. The cells were cultured overnight and stained with FITC-conjugated anti-IE antibody (14-4.4S) or stained with 14-4.4S and counterstained with anti-TCR.

For PCR experiments, purified CD4 ⁺ T cells (5 × 10 ⁶ / ml) were added to CD4
Biotinylated antibody against CD28 (GK1.5), biotinylated antibody against CD28, C
Incubation was carried out for 8 hours with biotinylated antibodies against D3 (145.2C11) alone, with biotinylated antibodies against CD4 and CD28, with or without treatment with biotinylated antibodies against CD3 and CD28. The experimental setup consisted of purified T cells and potential MHC
Included wells of Percoll isolated B cells added for control for Class II ⁺ contaminants. B cells (5 × 10 ⁵ cells) were 5% of the purified T cells (even more than the 1.5% contaminants found after Cell Column purification) and were added to the T cell wells. The cells are then washed, harvested, and total RNA is analyzed using an RNA isolation kit, RNEasy (Oiagen, C
hatsworth CA). The single-stranded DNA is
Script II reverse transcriptase (GIBCO / BRL Gaithersbu)
rg, MD) using 2 μg of RNA. PCR was performed using MHC class II (IE, exon 3, 5′-TAGCTGAGCCCAAGGTGAC
T and 5 'TCACCAGGGTCTGGGTAGTC) primers. The PCR protocol was: 1 minute at 94 ° C, 1 minute at 60 ° C, and 72 minutes.
There were 35 cycles of 2 minutes at ° C. After PCR, samples were loaded on a 1% agarose gel, stained with ethidium bromide, and visualized with UV light.

The results demonstrated that IE was expressed in cells treated with CD4 or CD4 and CD3 but not in cells that had not been treated. Cells treated with CD3 or CD28 showed low levels of expression.

Example 10 Use of Fatty Acid as Mitochondrial Carbon Source Use of fatty acid (oleic acid) as a mitochondrial carbon source was measured. The rate of oleic acid oxidation was determined using 100 μl of reaction buffer, glucose (2.8, 8.3,
(27.7 mmol / l), measured by incubating the cells in 1.7 mCi (U-14C oleic acid) at 37 ° C. for 90 minutes. The reaction was performed in a 1 ml cup in a 20 ml scintillation vial capped with a rubber stopper having a center well containing filter paper. Stop metabolism and remove CO ₂ ,
300 μl of 1 mol / l HC injected through this stopper into a cup containing cells
1 to release. CO ₂ is introduced into the center well in a volume of 10 ml at 1 mol / l.
Captured in filter paper by injecting KOH, then liquid scintillation counting after 2 hours. Using a tube containing NaHCO ₃ and no cells,
The recovery of ¹⁴ CO _{2 in} the filter paper (conventionally approaching 100%) was evaluated. value is,
Figure ₂ shows the rate of CO2 production by L1210 DDP or L1210 cells.
L1210 DDP uses oleic acid at a much faster rate than L1210 cells.

Example 11: cAMP levels in L1210 and L1210 DDP cAMP levels in L1210 versus cAMP levels in L1210 DDP were tested. Increasing cAMP at the intracellular level is required for uncoupled protein activity. We have shown that class II implantation results in increased cAMP, and we have determined that the mitochondrial membrane potential of L1210 DDP cells is lower than L1210 cells. Therefore, we used a radioimmunoassay to determine cAMP levels in L1210 (left panel) versus cAMP levels in L1210DDP (right panel).
Cells were used without any means, using antibodies against IA, using antibodies against IE,
Or isoproterenol, a beta-adrenergic agonist (10 μM)
For 10 minutes. Cells were harvested and cAMP was extracted from those cells and cAMP levels were measured using 125 I-labeled cAMP in the inhibition of competition in the presence of antibodies to cAMP (radioimmunoassay).

CAMP levels were measured in untreated cells and cells treated with antibodies to IA,
In cells treated with an antibody against IE or cells treated with isoproterenol, a β-adrenergic agonist, L1210 cells
Significantly higher in DDP cells.

Example 12: Sodium acetate as a mitochondrial modifier Sodium acetate as a mitochondrial modifier was tested. L1210 cells or L1210 DDP cells were cultured in the presence of graded concentrations of sodium acetate in the medium. Cells were stained with Jo2.2, fluorescein-conjugated anti-Fas antibody, or isotype control. Cell surface staining was measured by flow cytometry. The percentage of the mean fluorescence intensity against the isotype control was plotted. The data show that the presence of acetate indicates that cell surface F
4 shows increasing as expression.

The effect of acetate on susceptibility to Fas-dependent cell death was also tested. Cells cultured with acetate were loaded with 51Cr and plated on FasL-bearing or mock-transfected fibroblasts to determine susceptibility to Fas-induced cell death. Results are reported as percentage of chromium release from cells in the presence of FasL-bearing cells relative to mock transfectants. The data show that, in a dose-dependent manner, culture of both cell types with acetate
4 shows that susceptibility to as-dependent cell death occurs.

Each of the above patents, patent applications, and references is incorporated herein by reference. These include US Provisional Application No. 60/082 filed April 17, 1998.
U.S. Provisional Application No. 60 / 101,58, filed Sep. 24, 1998.
No. 0, and U.S. Provisional Application No. 60 / 094,51, filed July 24, 1998.
No. 9, from which the present application claims priority under 35 USC 119 (e). Although the invention has been described with respect to particular embodiments, it should be understood that many modifications and changes can be made by those skilled in the art without departing from the spirit of the invention. Such alterations, modifications, and equivalents are intended to be within the scope of the following claims.

The present invention may be more readily and more completely understood when considered in conjunction with the accompanying drawings.

[Sequence list]

[Brief description of the drawings]

FIG. 1 is a schematic showing that increased peripheral glucose results in increased cell surface Fas expression and functionally coupled mitochondrial ATP synthesis, which is associated with mitochondrial glucose metabolism. Suggests an association between susceptibility to Fas-induced cell death. As glucose levels decrease, cell surface Fa
The level of s is reduced, the newly synthesized Fas is stored intracellularly, and mitochondrial ATP synthesis is uncoupled from respiration, and less mitochondrial ATP is produced.

[Procedural Amendment] Submission of translation of Article 34 Amendment of the Patent Cooperation Treaty

[Submission date] May 22, 2000 (2000.5.22)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0011

[Correction method] Change

[Correction contents]

[0011] B7.1 and B7.2 are members of the immunoglobulin gene superfamily and contain V-like and C2-like extracellular domains. Although originally described for B cells, B7.1 and B7.2 have also been described for monocytes, dendritic cells, and activated T cells (June et al., 1994). B7
. 1 (CD80) and especially B7.2 (CD86) are upregulated on the surface of B lymphocytes in patients with systemic lupus erythematosus (SLE) (Folzen)
logen et al., 1997). Street et al. [Gynecological Oncology, 65, 2
65-272 (1997)] and references cited therein describe the use of IFN-g to induce expression of MHC class I and class II, and thus enhance lysis of tumor cells by CTL. . Addition of monoclonal antibodies to class I blocked cell lysis, while addition of monoclonal antibodies to class II did not block cell lysis.

[Procedure amendment 2]

[Document name to be amended] Statement

[Correction target item name] 0128

[Correction method] Change

[Correction contents]

“Apoptotic chemotherapeutic agents” as used herein are a group of molecules that function by a variety of mechanisms to induce apoptosis in rapidly dividing cells. Apoptotic chemotherapeutic agents are a class of chemotherapeutic agents well known to those skilled in the art. Chemotherapeutic agents include Goodman and Gilman's "The Phar
Maclogic Basic of Therapeutics ", 8th edition, 1990, McGraw-Hill, Inc (Health Profile
session Division), Chapter 52, Antineoplastic
Agents (Paul Calabresi and Bruce AC)
habner) and its preambles, 1202-1263. Suitable chemotherapeutic agents can have various mechanisms of action. Suitable classes of chemotherapeutic agents include: (a) nitrogen mustards (eg, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil), ethyleneimine, and methylmelamine (eg, , Hexamethylmelamine, thiotepa), alkylsulfonates (eg, busulfan), nitrosoureas (eg, columnustin also known as BCNU, lomustine also known as CCNU, semstin also known as methyl CCNU, chlorozotocin, streptozocin) ), And alkylating agents such as triazines (eg, dicarbazine also known as DTIC); (
For example, methotrexate), pyrimidine analogs (e.g., 5-fluorouracil floxyuridine, cytarabine, and azauridine, and its prodrug form azaribine), and purine analogs, and related substances (e.g.,
Antimetabolites such as 6-mercaptopurine, 6-thioguanine, pentostatin); (c) vinca alkaloids (eg vinblastine, vincristine);
Epipodophyllotoxin (e.g., etoposide, teniposide), antibiotics (e.g., dactinomycin also known as actinomycin D, daunorubicin, doxorubicin, bleomycin, plicamycin, mitomycin, 4-epidoxorubicin) Epirubicin, idarubicin 4-dimethoxydaunorubicin, and mitoxanthrone), enzymes (eg, L-
Natural products such as asparaginase) and biological response modifiers (eg, interferon α); (d) platinum coordination complexes (platinum coor)
Dation complexes (eg, cisplatin, carboplatin), substituted ureas (eg, hydroxyurea), methylhydrazine derivatives (eg, procarbazine), adrenocortical inhibitors (eg, mitotane, aminoglutethimide), such as taxol Miscellaneous drugs (Mis
(e) corticosteroids (eg, prednisone, etc.), progestins (eg, hydroxyprogesterone caproate, medroxyprogesterone acetate, megesterol acetate), estrogens (eg, diethyl estilbestrol, ethinyl estradiol, etc.) ), Hormones and antagonists such as antiestrogens (eg, tamoxifen), androgens (eg, testosterone propionate, fluoxymesterone, etc.), antiandrogens (eg, flutamide), and gonadotropin-releasing hormone analogs (eg, leuprolide) , And (
F) DNA damaging compounds such as adriamycin.

[Procedure amendment 3]

[Document name to be amended] Statement

[Correction target item name]

[Correction method] Change

[Correction contents]

European Patent Application No. 0239400 provides an exemplary teaching of the production and use of a humanized monoclonal antibody, wherein at least the CDR portion of a mouse (or other non-human mammal) antibody is included in the humanized antibody. . Briefly, the following method is useful for constructing a humanized CDR monoclonal antibody that includes at least a mouse CDR portion. At least a variable domain of an Ig heavy or light chain, and a variable domain comprising a framework region from a human antibody, and a suitable promoter operably linked to a DNA sequence encoding a CDR region of a mouse antibody. A first replicable expression vector is prepared. Optionally, prepare a second replicable vector comprising at least a suitable promoter operably linked to a DNA sequence encoding the complementary human Ig light or heavy chain variable domain, respectively. . The cell line is then transformed with these vectors. Preferably, the cell line is an immortalized mammalian cell line of lymphatic origin (eg, a myeloma cell line, a hybridoma cell line, a trioma cell line, or a quadroma cell line) or is transformed with a virus. Normal lymphoid cells that have been immortalized. The transformed cell line is then cultured under conditions known to those skilled in the art to produce a humanized antibody.

[Procedure amendment 4]

[Document name to be amended] Statement

[Correction target item name] 0305

[Correction method] Change

[Correction contents]

2. Interaction of B cells with T cells The results of mAb binding to MHC class II do not, a priori, reflect the results of interactions with physiologically relevant ligands. To examine the probability that a physiological ligand for MHC class II is expressed in CD4 + T cells, we tested the effects of class II signaling resulting from T cell: B cell interactions (Table 4). . Resting spleen B cells are subjected to T cell depletion and density gradient centrifugation (PERC
OLL®). Then, the B cells and the self-reactive I-
Ak-specific T cell hybridoma (Ka1-68.4) or hen egg lysozyme (
(HEL) Peptide-specific I-Ak restricted T cell hybridomas (A6.A2) were combined with or without trypsinized lysozyme as a source of the required peptide. Cells are cultured overnight at 37 ° C., then
Inspection under a fluorescence microscope. Apoptotic cells were tested for their morphology and 5 μg / ml
(Cohen, JJ, et al., Ann Rev Immun, 1992;
10, 267-293). B cells and T cells can be distinguished by morphology.

[Procedure amendment 5]

[Document name to be amended] Statement

[Correction target item name] 0344

[Correction method] Change

[Correction contents]

To confirm that UCP expression detected by flow cytometry was mitochondrial, we determined that L1210 and L1210 DDP
Mitochondria were isolated and Western blot analysis blotting was performed using a rabbit anti-UCP antibody. Mitochondria were isolated using differential centrifugation as employed from REF. REF (Reinhart, PH
, Taylor, WM, and Bygrave FL (1982) A proc
edure for the rapid preparation of m
itochondia from rat liver. Biochem. J
. 204: 731-735. And Sims NR (1990) Rapid
isolation of metabolically active mi
tochondria from rat brain and subreg
ions using PERCOLL (registered trademark) density gra
dient centrifugation. J. Neurochem. 55:
698-707. ). The following samples were run: molecular weight marker (BIORA)
D Biotinylated SDS-PAGE standard; L1210 / 0 mitochondrial protein (40 μl) from two different mitochondrial preparations
g); L1210 / DDP mitochondrial protein (40 μg) from two different mitochondrial preparations; and rat brown adipose tissue (this is UCP1-
3) (0.75 μg). Rabbit anti-hamster UCP was used at a dilution of 16,000. Secondary antibody: 1 for HRP
: Goat anti-rabbit IgG conjugated at 10,000. Chemiluminescence detection: Amers
ham ECL kit.

[Procedure amendment 6]

[Document name to be amended] Statement

[Correction target item name] 0350

[Correction method] Change

[Correction contents]

For PCR experiments, purified CD4 ⁺ T cells (5 × 10 ⁶ / ml) were added to CD4
Biotinylated antibody against CD28 (GK1.5), biotinylated antibody against CD28, C
Incubation was carried out for 8 hours with biotinylated antibodies against D3 (145.2C11) alone, with biotinylated antibodies against CD4 and CD28, with or without treatment with biotinylated antibodies against CD3 and CD28. The experimental setup consisted of purified T cells and potential MHC
PERCOLL added for control for class II ⁺ contaminants (
® wells of isolated B cells. B cells (5 × 10 ⁵ cells) represent 5% of the purified T cells (1% found after Cell Column purification).
. 5% more contaminants) and added to T cell wells. The cells are then washed, collected, and the total RNA is analyzed using an RNA isolation kit, RNEasy (Oi
agen, Chatsworth CA). The single-stranded DNA was converted to SUPERSCRIPT® II reverse transcriptase (GIBCO / BR
L Gaithersburg, MD) using 2 μg of RNA. PCR was performed using MHC class II (IE, exon 3, 5'-TAGCTGA
GCCCAAGGTGACT and 5 'TCACCAGGGTCTGGGTAG
GTC) using primers. The PCR protocol is: 1 minute at 94 ° C,
There were 35 cycles of 1 minute at 60 ° C and 2 minutes at 72 ° C. After PCR, samples were loaded on a 1% agarose gel, stained with ethidium bromide, and visualized with UV light.

[Procedure amendment 7]

[Document name to be amended] Statement

[Correction target item name] 0357

[Correction method] Deleted

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (Reference) A61K 31/7088 A61K 31/7088 38/17 45/06 38/21 A61P 3/10 45/06 35/00 A61P 3/10 G01N 33/574 35/00 A61K 37/12 C12N 15/00 37/66 G G01N 33/574 C12N 15/00 (31) Priority claim number 60 / 101,580 (32) Priority date Heisei 10 September 24, 1998 (September 24, 1998) (33) Priority country United States (US) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), AU, CA, JPF terms (reference) 4B024 AA01 AA15 DA03 4C084 AA02 AA27 BA46 DA24 MA02 NA05 NA14 ZA011 ZA021 ZA151 ZA161 ZB091 ZB261 ZC351 ZC422 ZC 4C085 AA14 4C086 AA01 AA02 BC75 CB09 EA10 EA16 MA02 MA04 NA05 NA14 ZA01 ZA02 ZA15 ZA16 ZB09 ZB26 ZC35 ZC42 ZC75

Claims (142)

[Claims] 1. A method for reducing mitochondrial membrane potential in a mammalian cell, said method comprising: providing an amount of an MHC class II HLA-DR ligand effective to reduce the mitochondrial membrane potential of said mammalian cell. Administered to a mammalian cell, the M on the cell surface
Selectively embedding in HC Class II HLA-DR, wherein said mammalian cells are not antigen presenting cells. 2. The method of claim 1, wherein MHC class II HLA-DR is expressed on the surface of said mammalian cell. 3. An effective amount of MHC class II HLA to induce expression of said mammalian cells and MHC class II HLA-DR on the surface of said mammalian cells.
2. The method of claim 1, further comprising contacting with a -DR inducer. 4. The mammal cell is a tumor cell, and the MHC class II HLA-DR ligand is administered to the tumor cell in vivo in an amount effective to cause cytolysis of the tumor cell; The MHC Class II HL
4. The method of claim 3, wherein the A-DR inducer does not include adriamycin and gamma interferon. 5. The method of claim 3, wherein said MHC class II HLA-DR inducer is adriamycin. 6. The method of claim 3, wherein said MHC class II HLA-DR inducer is gamma interferon. 7. The MHC class II HLA-DR inducer is selected from the group consisting of a UCP expression vector, a TCRαβ embedding molecule, and a fatty acid.
The method of claim 3. 8. The method of claim 3, wherein said MHC class II HLA-DR ligand is an anti-MHC class II HLA-DR antibody. 9. The MHC class II HLA-DR ligand according to claim 3, wherein the MHC class II HLA-DR ligand is selected from the group consisting of a CD4 molecule, an αβ T cell receptor molecule, a γδ T cell receptor molecule and an MHC class II HLA-DR binding peptide. Method. 10. The method of claim 3, wherein said MHC class II HLA-DR inducer and said MHC class II HLA-DR ligand are administered simultaneously. 11. The method of claim 3, wherein the MHC class II HLA-DR inducer and the MHC class II HLA-DR ligand are administered orally. 12. The method of claim 3, wherein said MHC class II HLA-DR inducer and said MHC class II HLA-DR ligand are administered locally. 13. A method for reducing mitochondrial membrane potential in a mammalian cell, said method comprising: said mammalian cell; and MHC class II HLA-D on the surface of said mammalian cell.
Contacting an effective amount of an MHC class II HLA-DR inducer to induce R expression, wherein the mammalian cell is not an antigen presenting cell,
A method comprising: 14. A method of increasing mitochondrial membrane potential in a mammalian cell, comprising: an amount of MHC class II H effective to increase the mitochondrial membrane potential of said cell.
Administering a LA-DP / DQ ligand to the mammalian cell to selectively embed the MHC class II HLA-DP / DQ on the surface of the mammalian cell, wherein the mammalian cell Is not an antigen presenting cell. 15. The method of claim 14, wherein MHC class II HLA-DP / DQ is expressed on the surface of said mammalian cell. 16. An effective amount of MHC class II to induce expression of said mammalian cells and MHC class II HLA-DP / DQ on the surface of said mammalian cells.
2. The method according to claim 1, further comprising the step of contacting with an HLA-DP / DQ inducer.
4. The method according to 4. 17. The mammalian cell is a type I diabetic pancreatic β-cell and the MHC class II HLA-DP / DQ ligand is a pancreatic β-cell in vivo.
15. The method of claim 14, wherein the method is administered to a cell. 18. A method for inducing lysis of a mammalian cell, the method comprising the step of: locating the mammalian cell and MHC class II HLA-D on the surface of the mammalian cell.
Contacting an effective amount of an MHC class II HLA-DR inducer to induce R expression, and lysing the MHC class II HLA-DR on the surface of the mammalian cell and the mammalian cell. Contacting an effective amount of MHC class II HLA-DR ligand to cause. 19. The method wherein the MHC class II HLA-DR ligand is an endogenous M
HC class II HLA-DR ligand, and said mammalian cell and said M
19. The method of claim 18, wherein the step of contacting with an HC class II HLA-DR ligand is a passive step. 20. The method of claim 18, wherein contacting the mammalian cell with the MHC class II HLA-D ligand is an active step. 21. The MHC class I, wherein the mammalian cell is a tumor cell.
An I HLA-DR ligand is administered to the tumor cells in vivo in an amount effective to cause cytolysis of the tumor cells, and the MHC class II HLA-
19. The method of claim 18, wherein the DR inducer does not include adriamycin and gamma interferon. 22. The mammalian cell is a pancreatic β cell of type II diabetes,
19. The method of claim 18, wherein said MHC class II HLA-DR ligand is administered to said pancreatic beta cells in vivo. 23. The method of claim 18, wherein said MHC class II HLA-DR inducer is adriamycin. 24. The method of claim 18, wherein said MHC class II HLA-DR inducer is gamma interferon. 25. The MHC class II HLA-DR inducer is UCP
19. The method of claim 18, wherein the method is selected from the group consisting of an expression vector, a TCRαβ embedding molecule, and a fatty acid. 26. The endogenous MHC class II HLA-DR ligand
19. The method according to claim 18, which is an MHC class II HLA-DR expressing cell. 27. The method of claim 18, wherein said MHC class II HLA-DR inducer is administered orally. 28. The method of claim 18, wherein said MHC class II HLA-DR inducer is administered locally. 29. A method for inducing apoptosis in a tumor cell, comprising:
The method comprises contacting a tumor cell with an amount of a metabolic modifier effective to increase the mitochondrial membrane potential of the tumor cell, which, when exposed to the cell, causes a coupling between electron transfer and oxidative phosphorylation. And contacting the tumor cell with an effective amount of an apoptotic chemotherapeutic agent to induce apoptosis in the tumor cell. 30. The method of claim 29, wherein said metabolic improver is glucose. 31. The method according to claim 31, wherein the metabolic improving agent is MHC class II HLA-DP / DQ.
30. The method of claim 29, which is a ligand. 32. The method of claim 26, wherein the metabolic modifier is phorbol myristate acetate in combination with ionomycin, GDP, a CD40 binding peptide, sodium acetate,
30. The method of claim 29, wherein the method is selected from the group consisting of UCP antisense, dominant negative UCP, and staurosporine. 33. The method of claim 29, wherein said metabolic improver is GDP. 34. The method of claim 29, wherein said apoptotic chemotherapeutic agent is selected from the group consisting of adriamycin, cytarabine, doxorubicin, and methotrexate. 35. The method of claim 29, wherein said metabolic improving agent and said apoptotic chemotherapeutic agent are administered simultaneously. 36. The method of claim 29, wherein said metabolic improving agent and said apoptotic chemotherapeutic agent are administered locally. 37. The tumor cell is resistant to an apoptotic chemotherapeutic agent.
A method according to claim 35. 38. The tumor cell is sensitive to an apoptotic chemotherapeutic agent and the amount of the metabolic modifier is effective to increase mitochondrial membrane potential;
30. The method of claim 29, wherein the amount of the apoptotic chemotherapeutic agent is effective to inhibit the growth of the tumor cells when the mitochondrial membrane potential is increased. 39. A method of reducing mitochondrial membrane potential in a cell of a subject, the method comprising: providing an amount of an MHC class II HLA-DR ligand effective to reduce the mitochondrial membrane potential of the mammalian cell. MHC on the surface of the cells upon administration to the subject
Selectively embedding in Class II HLA-DR. 40. The method of claim 39, which is performed in vivo. 41. The method of claim 39, wherein the method is performed ex vivo. 42. The method of claim 39, wherein said mammalian cells are antigen presenting cells. 43. The method of claim 39, wherein said mammalian cells are selected from the group consisting of tumor cells and T cells. 44. A method for inducing the expression of an immune recognition molecule on a cell surface, the method comprising contacting a cell with a metabolic inhibitor in an amount effective to reduce mitochondrial membrane potential. Reducing the mitochondrial membrane potential to induce induction of expression of an immune recognition molecule on the cell surface. 45. The immune recognition molecule is MHC class II, b7-1, b7
45. The method of claim 44, wherein the method is selected from the group consisting of -2, and CD-40. 46. The method of claim 44, wherein said metabolic inhibitor is selected from the group consisting of an apoptotic chemotherapeutic agent, a bacterial byproduct, a mycobacterial antigen, a UCP expression vector, and a fatty acid. 47. A method of inhibiting pancreatic beta cell death in type I diabetes, comprising the steps of: providing a pancreatic beta cell of type I diabetes and an amount of metabolism effective to increase mitochondrial membrane potential of the pancreatic beta cell. Contacting with an improving agent. 48. The metabolic improver is glucose, phorbol myristate acetate in combination with ionomycin, MHC class II HLA-DP / D.
48. The method of claim 47, wherein the method is selected from the group consisting of a Q ligand, GDP, and staurosporine. 49. A method of inhibiting pancreatic β-cell death in type I diabetes, comprising inhibiting selective implantation of pancreatic β-cells of type I diabetes and Fas on the surface of the pancreatic β-cells. Contacting with an effective amount of a Fas binder. 50. A method of treating a subject having an autoimmune disease to reduce associated cell death, said method comprising specifically binding and inactivating γδ cells in said subject. Effective amount of γ
administering a δ binding protein, wherein the inactivation of the γδ cells inhibits cell death associated with an autoimmune disease. 51. The γδ binding peptide is an anti-γδ antibody.
The method described in. 52. A method of treating a subject having an autoimmune disease to reduce associated cell death, said method comprising administering to a subject an elevated concentration of MHC class II HLA-DP / DQ that stimulates induction of MHC class II HLA-DP / DQ. Providing an extracellular environment having low levels of fatty acids that inhibits the induction of glucose and MHC class II HLA-DR, wherein the MHC class II HLA-D
Wherein the surface expression of P / DQ is indicative of a reduction in cell death associated with the autoimmune disease. 53. A method for selectively killing a Fas ligand-bearing tumor cell, comprising contacting the Fas ligand-bearing tumor cell with an amount of acetate effective to induce Fas-related cell death. A method comprising: 54. The Fas ligand-bearing tumor cell is contacted with the acetate in an amount effective to sensitize the cell to a chemotherapeutic agent, and further comprising the step of contacting the cell with a chemotherapeutic agent. 54. The method according to item 53. 55. The method of claim 54, wherein said Fas ligand-bearing tumor cells are selected from the group consisting of melanoma cells and colon carcinoma cells. 56. The method of claim 53, further comprising administering a Fas ligand to said Fas ligand-bearing tumor cell. 57. A method of stimulating a Th1 immune response, comprising: an amount of M for inducing DR on T cells in an amount effective to induce a Th1 immune response.
Administering an HC class II HLA-DR inducer to a subject exposed to the antigen. 58. The method of claim 57, wherein said MHC class II HLA-DR inducer is a fatty acid. 59. A method of screening a subject's tumor cells for susceptibility to treatment with a chemotherapeutic agent, comprising: isolating the tumor cells from the subject; Exposing; and selecting from the group consisting of: a Fas molecule on the tumor cell surface, a B7 molecule on the tumor cell surface, an MHC class II HLA-DR on the tumor cell surface, and a mitochondrial membrane potential indicative of conjugation at the cell. Detecting the presence of a cell death marker, wherein the presence of the cell death marker indicates that the cells are susceptible to treatment with a chemotherapeutic agent. Method. 60. The cell death marker is a Fas molecule on the surface of the tumor cell, and the method selectively binds the Fas molecule and the Fas molecule to detect the presence of the Fas molecule. 60. The method of claim 59, comprising contacting with a detection reagent. 61. The cell death marker is an MHC class II HLA-DR molecule on the tumor cell surface, and the method comprises:
60. The method of claim 59, comprising contacting the LA-DR molecule with a detection reagent that selectively binds to the MHC class II HLA-DR molecule and detects the presence of the MHC class II HLA-DR molecule. the method of. 62. A method for identifying an anti-tumor agent for killing a tumor cell in a subject, comprising: isolating the tumor cell from the subject; a Fas molecule on the surface of the tumor cell; Detecting the presence of a cell death marker selected from the group consisting of a B7 molecule on the surface of the tumor cell, MHC class II HLA-DR on the surface of the tumor cell, and a mitochondrial membrane potential indicative of coupling at the cell; Exposing the tumor cells to a putative agent; and detecting any change in the presence of the cell death marker to determine whether the putative agent is an anti-tumor agent capable of killing the tumor cells of the subject; A method comprising: 63. The method of claim 62, wherein a plurality of tumor cells are isolated from said subject and said plurality of tumor cells are screened with a panel of putative drugs. 64. The alteration in the presence of the cell death marker is detected by contacting the tumor cell with a cell death ligand attached to a solid support.
63. The method of claim 62. 65. The cell death ligand is a Fas ligand.
The method described in. 66. A method of screening a subject for susceptibility to a disease, comprising: isolating cells selected from the group consisting of peripheral blood lymphocytes and skin from the subject; And MHC class II HLA-DP / DQ, B7-2, B7- on the surface of the cell
Detecting the presence of an MHC marker selected from the group consisting of MHC class II HLA-DR, wherein the MHC class II HLA-DP
/ DQ indicates susceptibility to atherosclerosis and resistance to autoimmune diseases, and MHC class II HLA-DR, B7-2 or B
Wherein the presence of 7-1 indicates resistance to atherosclerosis and susceptibility to autoimmune disease. 67. A kit for screening a subject for susceptibility to a disease, said kit comprising a protein selected from the group consisting of B7-2, B7-1 and MHC class II HLA-DR. A container containing a first binding compound that selectively binds to MHC class II HLA-DP / DQ protein; and a container containing a second binding compound that selectively binds to MHC class II HLA-DP / DQ protein; Instructions for determining whether the detached cells selectively interact with the first or second binding compound, wherein the cells interacting with the second compound The presence of MHC class II HLA-DP / DQ on the surface indicates susceptibility to atherosclerosis and resistance to autoimmune diseases and interacts with the first compound MHC class II HLA- on the cell surface for use
A kit comprising instructions indicating that the presence of DR indicates resistance to atherosclerosis and susceptibility to autoimmune disease. 68. A kit for screening a subject's tumor cells for susceptibility to treatment with a chemotherapeutic agent, the kit comprising a container containing a cell death marker detection reagent; and a surface of the tumor cells. Fas molecule on MHC class II HL on tumor cell surface
Instructions for using a cell death marker detection reagent to detect the presence of a cell death marker selected from the group consisting of A-DR and mitochondrial membrane potential indicative of conjugation in cells, wherein: A kit comprising instructions, wherein the presence of the cell death marker indicates that the cells are sensitive to treatment with a chemotherapeutic agent. 69. The method according to claim 68, further comprising a container containing the chemotherapeutic agent.
The kit according to 1. 70. The kit of claim 68, further comprising a panel of chemotherapeutic agents housed in separate compartments. 71. The kit of claim 68, further comprising a cell death ligand. 72. The kit of claim 71, wherein said cell death ligand is coated on a solid surface. 73. The cell death ligand is a Fas ligand.
The kit according to 1. 74. A composition comprising: a metabolic modifier; and an apoptotic chemotherapeutic agent. 75. The metabolic improver is glucose, phorbol myristate acetate in combination with ionomycin, MHC class II HLA-DP / D.
75. The composition of claim 74, wherein the composition is selected from the group consisting of a Q ligand, GDP, and staurosporine. 76. The composition of claim 74, wherein said apoptotic chemotherapeutic agent is selected from the group consisting of adriamycin, cytarabine, doxorubicin, and methotrexate. 77. The metabolic improving agent and the apoptotic chemotherapeutic agent,
75. The composition of claim 74, wherein the composition is present in an amount effective to inhibit tumor cell growth. 78. The composition of claim 74, further comprising a pharmaceutically acceptable carrier. 79. A composition comprising: an MHC class II HLA-DR inducer; and an MHC class II HLA-DR ligand. 80. The MHC class II HLA-DR inducer is a bacterial by-product such as adriamycin, gamma interferon, lipopolysaccharide,
80. The composition of claim 79, wherein the composition is selected from the group consisting of a mycobacterial antigen such as BCG, a UCP expression vector, a TCRαβ embedding molecule, and a fatty acid. 81. The MHC class II HLA-DR ligand is CD4
80. The composition of claim 79, wherein the composition is selected from the group consisting of a molecule, an [alpha] [beta] T cell receptor molecule, a [gamma] [delta] T cell receptor molecule, and an MHC class II HLA-DR binding peptide. 82. The composition of claim 79, wherein said MHC class II HLA-DR inducer and said MHC class II HLA-DR ligand are present in an amount effective to lyse tumor cells. 83. The composition of claim 79, further comprising a pharmaceutically acceptable carrier. 84. A method for inducing neural cell differentiation, said method comprising: providing a neural cell with an amount of B effective to induce expression of a B7 molecule on the surface of the neural cell.
Contacting the nerve cell with a nerve-activating cell to cause differentiation of the nerve cell.
A method comprising: 85. The B7 inducer is adriamycin.
The method described in. 86. The B7 inducer is gamma interferon.
4. The method according to 4. 87. The method of claim 84, wherein said B7 inducer is a fatty acid. 88. The method of claim 84, wherein said B7 inducer is a lipoprotein. 89. The method of claim 84, wherein said B7 inducing factor is selected from the group consisting of a B7 expression vector and a UCP expression vector. 90. A proton in the nerve cell that, prior to contacting the nerve cell with the B7 inducer, causes a coupling between electron transfer and oxidative phosphorylation when exposed to the cell. 85. The method of claim 84, further comprising the step of contacting an amount of a metabolic modifier effective to inhibit loss of motor power. 91. The method of claim 90, wherein said metabolic improving agent is glucose. 92. The method wherein the metabolic modifier is phorbol myristate acetate in combination with ionomycin, GDP, a CD40 binding peptide, sodium acetate,
90. The method of claim 90, wherein the method is selected from the group consisting of UCP antisense, dominant negative UCP, and staurosporine. 93. The method of claim 84, wherein said neural activating cells are T cells. 94. The neural activated cell is a macrophage.
The method described in. 95. The method of claim 84, wherein said neural activating cells are dendritic cells. 96. The method of claim 84, further comprising the step of inducing expression of a nerve growth factor receptor. 97. A method for inducing neural cell differentiation, comprising: providing a neural cell and a B7 inducer in an amount effective to induce expression of B7 on the surface of the neural cell. Contacting in the presence of an activated cell. 98. The B7 inducer is adriamycin.
The method described in. 99. The B7 inducer is gamma interferon.
7. The method according to 7. 100. The method of claim 97, wherein said B7 inducer is a fatty acid. 101. The method of claim 97, wherein said B7 inducing factor is selected from the group consisting of a B7 expression vector and a UCP expression vector. 102. The B7 inducer is a lipoprotein.
The method described in. 103. Before contacting the nerve cell with the B7 inducer,
Contacting the neuron with an amount of a metabolic modifier effective to inhibit loss of proton motor power in the neuron that, when exposed to the cell, causes coupling of electron transport with oxidative phosphorylation. 100. The method of claim 97, further comprising: 104. The method of claim 103, further comprising administering fatty acids to said nerve cells to stop cell division. 105. The metabolic modifier selected from the group consisting of glucose, phorbol myristate acetate in combination with ionomycin, GDP, CD40 binding peptide, sodium acetate, UCP antisense, dominant negative UCP, and staurosporine. 104. The method of claim 103, wherein the method is performed. 106. The method of claim 97, wherein said neural activating cells are T cells. 107. The nerve activated cell is a macrophage.
7. The method according to 7. 108. The method of claim 97, wherein said neural activating cells are dendritic cells. 109. A method of inducing apoptosis in a nerve cell, the method comprising the steps of: causing a proton in the nerve cell to cause a coupling between electron transfer and oxidative phosphorylation when exposed to the cell. Contacting an effective amount of a metabolic modifier to inhibit loss of motor power; and contacting the neural activated cells with an effective amount of a B7 receptor blocker to induce apoptosis in the neural cells A method comprising: 110. The method of claim 109, wherein said metabolic improver is glucose. 111. The metabolic modifier is selected from the group consisting of phorbol myristate acetate, GDP, CD40 binding peptide, sodium acetate, UCP antisense, dominant negative UCP, and staurosporine in combination with ionomycin. 110. The method of claim 109. 112. The B7 receptor blocker is an anti-CD28 antibody, CD2
110. The method of claim 109, wherein the method is selected from the group consisting of 8 binding peptides, CTLA4 analogs, anti-CTLA4 antibodies, and CTLA4 binding peptides. 113. A composition comprising: a metabolic modifier; and a B7 receptor blocker. 114. The composition of claim 113, wherein said metabolic modifier is selected from the group consisting of glucose, phorbol myristate acetate in combination with ionomycin, GDP, and staurosporine. 115. The B7 receptor blocker is an anti-CD28 antibody, CD2
114. The composition of claim 113, wherein the composition is selected from the group consisting of 8 binding peptides, CTLA4 analogs, anti-CTLA4 antibodies, and CTLA4 binding peptides. 116. The composition of claim 113, wherein said metabolic modifier and said B7 receptor blocker are present in an amount effective to induce neuronal apoptosis. 117. The method of claim 11, further comprising a pharmaceutically acceptable carrier.
3. The composition according to 3. 118. A composition comprising: a B7 inducer; and a CD28 inducer. 119. The B7 inducer is a bacterial by-product such as adriamycin, gamma interferon, lipopolysaccharide and lipoprotein, BC
119. The composition of claim 118, wherein the composition is selected from the group consisting of G, and a fatty acid. 120. The composition of claim 118, wherein said CD28 inducer is selected from the group consisting of a T cell receptor embedding molecule, a CD3 embedding molecule, IL4, and a CD28 expression vector. 121. The method of claim 11, further comprising a pharmaceutically acceptable carrier.
9. The composition according to 8. 122. A method of re-innervating damaged tissue, comprising the step of transplanting B7 expressing neurons into the damaged tissue, wherein the transplanted B7 expressing neurons are Subjecting the damaged tissue to neural differentiation in the presence of nerve-activating cells to re-innervate the damaged tissue. 123. The method of claim 122, wherein said B7 expressing neurons constitutively express B7. 124. The method of claim 123, wherein said B7 expressing neuron is a neuron that constitutively expresses the UCP gene. 125. The method of claim 123, wherein said B7 expressing neurons are neurons that constitutively express the B7 gene. 126. The method of claim 122, further comprising administering a B7 inducer effective to induce endogenous B7 expression on the surface of said neural cell. 127. The method of claim 122, wherein said damaged tissue is the spinal cord. 128. The damaged tissue is an amputated limb.
3. The method according to 2. 129. A method of treating a neurodegenerative disorder, comprising: administering an amount of a B7 inducer effective to induce expression of B7 on the surface of a nerve cell. . 130. The B7 inducer is adriamycin.
29. The method according to 29. 131. The method of claim 129, wherein said B7 inducer is gamma interferon. 132. The method of claim 129, wherein said B7 inducer is a fatty acid. 133. The B7 inducing factor is an anti-MHC class II HLA-DR
130. The method of claim 129, wherein the method is an antibody. 134. The B7 inducing factor is a B7 expression vector, and UCP
130. The method of claim 129, wherein the method is selected from the group consisting of an expression vector. 135. The method of claim 129, further comprising the step of inducing CD28 expression on the surface of the neural activated cells. 136. The method of claim 135, wherein said neural activating cell is a T cell. 137. The neural activated cell is a macrophage.
35. The method according to 35. 138. The neurodegenerative disorder is selected from the group consisting of Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, paralysis, and multiple sclerosis.
130. The method of claim 129. 139. A method for selectively killing cells, said method comprising selecting from the group consisting of said cells and a UCP antisense nucleic acid and a UCP dominant negative nucleic acid in an amount effective to inhibit UCP function. Contacting the nucleic acid with the nucleic acid. 140. A method for selectively killing tumor cells, comprising contacting the tumor cells with an amount of acetate effective to induce cell surface Fas expression; and Administering a Fas ligand in an amount effective to induce Fas-related cell death. 141. The tumor cell is contacted with an amount of the acetate effective to sensitize the cell to a chemotherapeutic agent, and further comprising the step of contacting the cell with an apoptotic chemotherapeutic agent. 140. The method according to clause 140. 142. A method for selectively killing tumor cells, said method comprising the steps of: killing said tumor cells and an amount of acetate, GDP and an apoptotic chemotherapeutic agent effective to kill said tumor cells. Contacting with a compound selected from the group consisting of: