JP2002509709A - Materials and methods for novel retroviruses - Google Patents

Abstract

  (57) [Summary] The present invention relates to a novel retrovirus associated with an autoimmune disease. The present invention provides nucleotide and amino acid sequences related to retroviral GAG, PRO and POL proteins, as well as diagnostics and diagnostic antibodies. Retrovirus (HRV-5) according to the invention is detected in inflamed joints (rheumatoid arthritis (RA), osteoarthritis (OA), reactive arthritis, psoriatic arthritis) but not in the normal synovium. It is a thing. In addition, HRV-5 proviral DNA was detected in blood obtained from patients with RA and systemic lupus erythematosus (SLE).

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION The present invention relates to materials and methods related to novel retroviruses associated with autoimmune diseases, as well as diagnostic techniques and kits, antibodies that bind the retroviruses and their use in diagnosis. Also included are methods of treating autoimmune diseases and compositions used in the methods.

Description of the Related Art Most indirect data suggest that retroviruses have a range of autoimmune diseases, such as rheumatoid arthritis (RA), Sjogren's syndrome (SS), and systemic lupus erythematosus (S
Although we support the hypothesis that it may be a pathogen such as LE), there is currently no convincing direct evidence.

[0003] The hypothesis that retroviral infection plays a role in the pathogenesis of RA is:
Joints in which human T-cell lymphocytic virus type I (HTLV-I) (the pathogen of adult T-cell leukemia (ATL) and tropical spastic paraparesis (TSP)) share many features with RA (Nishioka. K., et al., The Lancet 19) have been supported by studies showing that the disease is usually associated with the disease (usually chronic and oligoarticular).
89, I: 441). In addition, transgenic mice into which the HTLV-I tax gene has been introduced
Develop polyarthritis similar to RA (Iwakura.Y. Et al., Science 1991, 253: 1026-10
28). These mice express high levels of the viral transactivator protein Tax in joints with high levels of interleukin-1α mRNA. Other reports have reported that human synovial cells transfected with the Tax protein gene had increased proliferative potential and GM-CS.
F production (Sakai. M. et al., J. Clin. Invest. 1993, 92: 1957-1966; and Nak
ajima. T. et al., J. Clin. Invest. 1993, 92: 186-193), exhibiting further increased IL-6 production (Mori. N. et al., J. Rheumatol. 1995, 22: 2049-2054). Has been demonstrated. A model animal for spontaneous inflammatory arthritis induced by retrovirus is a goat infected with goat arthritis encephalitis virus (CAEV). This disease is similar to RA in that CAEV-induced lesions contain a large number of inflammatory cells, including activated macrophages, macrophage-like A synovial cells and B synovial fibroblasts, in addition to T cells. It has several features (Wilkerson. M. et al., J. Rheumatol., 1995, 22: 8
-15). CAEV infects monocytes and macrophages, and proviral DNA has been detected at many sites (Zink. M. et al., Am. J. Pathol., 1990, 136: 843-854). This suggests that the expression of the virus depends on the maturation state of monocytes and that the macrophages at the lesion show high levels of viral gene expression.

[0004] We have recently described the cloning and sequence analysis of a 930 bp fragment of the novel human retroviral genome (JC96) from tissues and particles purified from cultured cells or tissues (Griffiths. D. Et al., J. Virol. 1997, 71: 2866-2872). This sequence corresponded to a part of a novel pol gene containing a part of protease (PR) and an overlapping reading frame encoding reverse transcriptase (RT). This information is available from Griffiths
They form part of European Patent Application No. 96912159.9, previously filed under these names.

The similarity of JC96 to the rodent IAP gene indicates that the novel retrovirus is Garry et al.
arry. RF et al., 1990, Science 250: 1127-1129), suggesting that it may encode human IAP. However, IAP is thought to be encoded by an endogenous retrovirus with a defective envelope gene (Kuff, EL
Et al., 1988, Adv. Cancer Res. 51: 183-276). In addition, extracellular virions have been
(Garry. RF et al., 1990, Science 250: 1127-1129) were not detected in the cultures studied.

Due to the low abundance of JC96 in tissues, high sequence similarity between different isolates, and the maintenance of two open reading frames of the enzyme, the novel retrovirus is an exogenous retrovirus The hypothesis of being part is supported.

[0007] Further research on retroviruses has been hampered by the inability to amplify similar sequences from human cell lines and tissues due to their extremely low abundance. RT-PCR using degenerate primers based on other conserved regions of the retroviral genome and standard PCR proved unsuitable for us to extend that sequence to gag or env .

SUMMARY OF THE INVENTION The present invention relates to the further characterization of the novel retrovirus previously reported in European Patent Application No. 96912159.9.

The majority of the endogenous retroviral sequences described previously (Nakagawa. K. et al., A
rthritis and Rheumatism 1997, 40: 627-638; and Ratience. C. et al., Trends
Unlike in Genetics 1997, 13: 116-120), this new retrovirus has all the characteristics of an exogenous (ie, infectious) virus. The only four infectious human retroviruses known to date are HIV 1 and 2, and HTLV-I and II (recently, "human" foamy viruses have been found to be zoonotic). (Weiss R. et al., Nature 1996, 380: 201). Therefore, this new retrovirus is named human retrovirus-5 (HRV-5) and the present invention relates to this virus.

In our early studies, HRV-5 RNA was derived from 18 patients or tissue homogenates layered by sucrose density gradient centrifugation from both SS patients and normal patients with salivary glands. Detected in 6 of them. However, this method, although very sensitive, is not suitable for epidemiological studies. The inventors have realized that it is desirable to detect proviral DNA, which is a less sensitive but more robust assay. Since the original sequence was cloned from SS patients, we tested 97 salivary gland biopsies from patients and controls. Surprisingly,
Only two positives were found. One was from an RA patient with secondary SS (Rigby et al., Arthritis and Rheumatism 1997, 40: 2016). Thus, the present inventors concluded that HRV-5 did not appear to be replicating in the salivary glands, and thus demonstrated other autoimmune and inflammatory diseases with respect to the presence of the HRV-5 proviral DNA sequence. Screened. In the course of these new studies, other primer sets were evaluated, and from these they found that HRV-5 was preferentially recruited to synovial tissue, especially to inflamed joints.

However, with this knowledge, a further characterization of HRV-5 is that H
Certain primers that are more sensitive than other primers in detecting RV-5 DNA ("
It has only become possible since the set of "best" primers was designed. For the first time, additional nucleotide sequences were obtained from positive DNA samples using these primers.

The present inventors now detect HRV-5 proviral DNA in inflamed joints (RA, osteoarthritis (OA), reactive arthritis and psoriatic arthritis) but not in the normal synovium. did. In addition, HRV-5 proviral DNA was used in RA patients, systemic lupus erythematosus (SLE
) Was also detected in blood from patients and patients with inflammatory bowel disease. This is because the virus is tropic to cell types such as macrophages and fibroblasts, which are abundant in these tissues. Some types of arthritis are considered abnormal responses to normal infection. Table I shows additional disease states in which we detected HRV-5.

[0013] Therefore, most generally, the present invention relates to HRV-5 related materials for use in the treatment, diagnosis or therapy of autoimmune diseases such as arthritis and SLE and other inflammatory diseases. And provide a method.

In a first aspect, the invention relates to a nucleic acid comprising the novel nucleotide sequence shown in FIG. 1, FIG. 3, FIG. 6, FIG. 10, FIG. 12 or FIG. 13 or a variant, mutant or fragment thereof. Provide molecules. FIG. 1 shows the gag and protease (pro) genes (encoding the nucleocapsid, dUTPase and the N-terminal part of the protease). FIG. 3 shows the pol gene (encoding RT / RNaseH and integrase). FIG.
Indicates a combination of the gag sequence and the pro sequence shown in FIG. 1 and FIG. Nucleotide sequences according to the invention are shown in upper case. FIG. 10 shows additional gag sequences with nucleocapsid regions in lower case. FIG. 12 shows the fully determined HRV-5 sequence.

Further, the present invention provides a nucleic acid molecule having a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in FIGS. 1, 2, 3, 6, 10, 11, 12 or 13 or a part thereof. FIG. 2 shows a comparison between the amino acid sequence (HRV-5) shown in FIG. 1 and amino acid sequences obtained from seven samples. As can be seen from this figure, mutations in the HRV-5 amino acid sequence occur naturally between individuals.

The coding sequence may be as shown in FIG. 1, 3, 6, 10, 11, 12 or 13 or may be a mutant, variant, derivative or allele of these sequences. This sequence may differ from the shown sequence by changes that are one or more additions, insertions, deletions and substitutions of one or more nucleotides of the shown sequence. Changes in nucleotide sequence may or may not result in amino acid changes at the protein level, as determined, for example, by the genetic code shown in FIG.

As used herein, “variants” refer to gag, pol, protease, nucleocapsid, RT / RNaseH, integrase or dUTPase genes in FIGS.
A retroviral sequence homologous to the sequence shown in FIG. 10, FIG. 12 or FIG. 13, for example,
At least 80%, or at least 85%, or at least 90% of said sequence
%, Preferably 95%, more preferably 98%, applied to retroviral sequences with homology. The term "fragment" refers to a fragment large enough to hybridize under stringent conditions to the sequence. Suitably, such fragments are from 20 bases to 1 kilobase in length, preferably from 400 to 500 bases in length.

In general, the nucleic acids according to the invention are provided as isolates, in isolated and / or purified form, or free or substantially free of substances with which they are naturally bound, For example, one that does not contain or substantially does not contain nucleic acids adjacent to the gene in the human genome. Nucleic acids can be wholly or partially synthetic and can include genomic DNA, cDNA or RNA. Where the nucleic acids of the invention comprise RNA, references to the indicated sequence should be construed as referring to RNA equivalents using U instead of T.

The nucleic acid sequence encoding all or part of the protease, gag, pol, integrase, RT / RNaseH, nucleocapsid or dUTPase gene and / or its regulatory element can be obtained by using the information and literature contained therein. And can be readily prepared by those skilled in the art using techniques known in the art (eg, Sambrook,
Fritsch and Maniatis, "Molecular Cloning, A Laboratory Manual", Cold Sp
ring Harbor Laboratory Press, 1989 and Ausubel et al., Short Protocols in
Molecular Biology, John Wiley and Sons, 1992). These techniques involve the use of the polymerase chain reaction (PCR) to amplify a sample of this type of nucleic acid (eg, from a genomic source or chemical synthesis). Modifications of the HRV-5 sequence can be made, for example, by site-directed mutagenesis to express the modified HRV-5 polypeptide and take into account codon preferences in the host cell for nucleic acid expression.

To obtain expression of a HRV-5 nucleic acid sequence, the sequence can be incorporated into a vector having control sequences operably linked thereto to control expression of the HRV-5 nucleic acid. The vector may comprise a promoter or enhancer for driving the expression of the inserted nucleic acid, a nucleic acid sequence for producing the HRV-5 polypeptide as a fusion, and / or a polypeptide produced in the host cell. Other sequences may be included, such as a nucleic acid encoding a secretion signal to cause Next, transforming a host cell (in which the vector functions) with the vector, culturing the host cell to produce the polypeptide, and recovering the polypeptide from the host cell or surrounding medium. Can obtain a specific polypeptide. Prokaryotic and eukaryotic cells are used in the art for this purpose, including, for example, E. coli, yeast, and eukaryotic cells such as COS or CHO cells. To control the nature of the polypeptide expressed by the host cell, e.g., to control where the polypeptide accumulates in the host cell or to affect properties such as glycosylation, Cell selection is performed. The above vectors and host cells each constitute a separate aspect of the present invention.

[0021] PCR techniques for amplifying nucleic acids are described in US Patent No. 4,683,195.
Generally, such techniques involve the use of both ends of the target sequence to allow the design of appropriate forward and reverse oligonucleotide primers to be identical or similar to the polynucleotide sequence targeted for amplification. Sequence information must be known. PCR involves the steps of denaturation (if double-stranded) of the template nucleic acid, annealing of the primer to the target, and polymerization. The nucleic acid probed or used as a template in the amplification reaction may be genomic DNA, cDNA or R
Can be NA. PCR can be used to amplify specific sequences from genomic DNA, specific RNA sequences, cDNA transcribed from mRNA, bacteriophage or plasmid sequences. With the HRV-5 nucleic acid sequences provided herein, one of skill in the art can design PCR primers. For references on the general use of PCR technology, see Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51: 263 (1987).
); Ehrlich (eds.), PCR technology, Stockton Press, NY, 1989; Ehrlich et al., Sci.
ence, 252: 1643-1650 (1991); "PCR protocols: A Guide to Methods and Appl
ications ", edited by Innis et al., Academic Press, New York, (1990).

The scope of the present invention also includes antisense oligonucleotide sequences based on the HRV-5 nucleic acid sequences described herein. Antisense oligonucleotides are designed to hybridize to the complementary sequence of a nucleic acid, preventing the production of a polypeptide encoded by a given DNA sequence, or simply preventing the retroviral replication and entry process. The construction and use of antisense sequences is described in Peyman and Ulman, C
chemical Reviews, 90: 543-584 (1990); Crooke, Ann. Rev. Pharmacol. Toxico
l., 32: 329-376 (1992) and Xamecnik and Stephenson, PNAS 75: 28
0-284 (1974).

As with the full length sequence (and mutants, alleles, variants and derivatives)
Oligonucleotide probes or primers can also be used to HR test samples containing nucleic acids.
Useful for screening for the presence of V-5, where the probe hybridizes to a target sequence from a sample obtained from the individual to be tested. Hybridization conditions can be controlled to minimize non-specific binding, with stringent to moderately stringent hybridization conditions being preferred. Those skilled in the art can easily design such probes, label them, and select conditions suitable for the hybridization reaction by referring to textbooks such as Sambrook et al. (1989) and Ausubel et al. (1992). Can be.

The binding of a probe to a target nucleic acid (eg, DNA) can be freely determined by one of skill in the art using any of a variety of techniques. For example, the probe can be labeled with radioactivity, fluorescence or an enzyme. Other methods that do not use probe labeling include testing for restriction fragment length polymorphisms, amplification by PCR, RNAase cleavage, and searching for allele-specific oligonucleotide probes.

A standard Southern blotting method is used for probe search. For example, DNA is extracted from cells and digested with various restriction enzymes. Next, the restriction fragments are separated by agarose gel electrophoresis, then denatured and transferred to a nitrocellulose filter. Hybridize the labeled probe with the DNA fragment on the filter and measure the binding. DNA for probe search can be prepared from RNA preparations from cells.

Preliminary experiments may be performed by hybridizing various probes to a Southern blot of DNA digested with restriction enzymes under low stringency conditions.
Suitable conditions are achieved when a large number of hybridizing fragments are obtained, while the background hybridization is low. Using these conditions,
Nucleic acid libraries, for example, cDNA libraries representing expressed sequences, can be searched.

Those skilled in the art are well aware that factors such as oligonucleotide length and base composition, temperature, and the like, may be taken into account to adopt appropriate conditions of desired stringency for selective hybridization. It is possible. Generally, specific primers are 14 nucleotides or more in length, but are at most 18 to 24 nucleotides.
One of skill in the art is well versed in designing primers for use in methods such as PCR.

According to the present invention, nucleic acids (eg, probes or primers) that have a reasonable sequence homology to any of the protein coding regions of the nucleic acid sequences described herein,
Identification can be achieved by using appropriate stringency hybridization and washing conditions. For example, hybridization was performed according to the method of Sambrook et al. (22) using 5X SSC, 5X Denhardt's reagent, 0.5-1.0% SDS, 100 μg / ml denatured fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50%. It can be performed using a hybridization solution containing formamide. Hybridization is performed at 37-42 ° C for at least 6 hours. After hybridization, the filters are washed as follows. (1) 5 minutes in 2X SSC and 1% SDS at room temperature, (2) 15 minutes in 2X SSC and 0.1% SDS at room temperature, (3) in 1X SSC and 1% SDS
30 minutes to 1 hour at 37 ° C, (2) 2 hours at 42-65 ° C in 1X SSC and 1% SDS, changing the solution every 30 minutes.

One general formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of specified sequence homology (Sambrook et al., 1989)
Is as follows: Tm = 81.5 ° C + 16.6 Log [Na +] + 0.41 (% G + C)-0.63 (% formamide)-600
/ Double-stranded #bp

As an example of the above formula, using [Na +] = [0.368] and 50% formamide,
Assuming a content of 42% and an average probe size of 200 bases, the Tm is 57 ° C. The Tm of a DNA duplex decreases by 1-1.5 ° C for each 1% decrease in homology. Thus, targets with sequence identity greater than about 75% will be observed using a hybridization temperature of 42 ° C. Such sequences are considered substantially homologous to the nucleic acid sequences of the present invention.

A further aspect of the invention relates to oligonucleotides of the nucleotide sequence or the complementary sequence shown in FIG. 1, 3, 6, 10, 12 or 13, especially for use in a method for obtaining and / or screening nucleic acids. Alternatively, a polynucleotide fragment is provided. The above sequence may be modified by the addition, substitution, insertion or deletion of one or more nucleotides, but preferably does not lose its ability to selectively hybridize to the HRV-5 nucleic acid, Preferably, the homology of the oligonucleotide or polynucleotide to the sequence is sufficiently high.

In some preferred embodiments, the oligonucleotide of the invention, which is a fragment of any of the sequences shown in FIGS. 1, 3, 6, 10, 12, or 13, has a length of at least about 10 nucleotides, more preferably Is at least about 15 nucleotides, more preferably at least about 20 nucleotides. Such fragments as such individually represent embodiments of the present invention. Fragments and other oligonucleotides can be used as primers or probes as described above, but can also be generated (e.g., by PCR) in a method related to determining the presence of HRV-5 in a test sample. .

[0033] Methods that require the use of nucleic acids in connection with diagnosis and / or prognosis, eg, when examining the presence of HRV-5, are described below.

The present invention also provides a polypeptide encoded by the nucleic acid sequence shown in FIG. 1, 3, 6, 10, 12, or 13.

One skilled in the art can use the techniques described herein and other techniques known in the art to use as a medicament, for use in the development of a drug, or for its in vivo properties and role. Can be produced in large quantities to produce nucleocapsid, dUTPase, protease, RT / RNase H and integrase polypeptides, or fragments or active portions thereof. Furthermore, within the scope of the present invention also include viral proteins such as superantigens or regulatory proteins produced by HRV-5. Such proteins are usually located near the 3 'end of the virus. HRV-5 proteins and polypeptides or fragments thereof have commercial value all of which will be apparent to those of skill in the art, for example, to raise virus-specific antibodies as antigens for vaccines. Alternatively, it is useful for serological assays such as ELISA and Western blot.

Thus, a further aspect of the present invention is a polypeptide having the amino acid sequence shown in FIGS. 1, 2, 3, 6, 10, 11 or 12, to which a substance (eg, Free or substantially free of other polypeptides or human endogenous polypeptides other than the HRV-5 polypeptide, or natural glycosylation (eg, if produced by expression in prokaryotic cells). Provided in an isolated and / or purified form lacking (non-glycosylated).

[0037] Also provided by the invention are polypeptides that are variants, alleles, derivatives or mutants of the amino acid sequence. Polypeptides that are variants, alleles, derivatives or mutants can be obtained by adding one or more additions, substitutions, deletions and insertions of one or more amino acids shown in FIG. , 11, 12 or 13 may have different amino acid sequences. Each variant shown in FIG. 2 constitutes another aspect of the present invention. Preferred such polypeptides have HRV-5 function, ie, have one or more of the following properties: immunologically with an antibody that reacts with the polypeptide sequenced in Figure 1, 2, 3 or 6. Cross-reactivity; sharing an epitope with a polypeptide whose amino acid sequence is shown in FIG. 1, 2, 3, 6, 10, 11, 12, or 13 (eg, as determined by immunological cross-reactivity between two polypeptides) ).

Polypeptides that are variants, alleles, derivatives or mutants of the amino acid sequence shown in FIG. 1, 2, 3, 6, 10, 11, 12 or 13 are shown in FIG. ,Ten
, 11 or 12 and at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% It may include amino acid sequences having sequence identity. Each amino acid sequence variant has one amino acid, 2
3, 4, 5 to 10, 10 to 20, 20 to 30, 30 to 50, 50 to 100, 100 to 150, or 150
1, 2, 3, 6, 10 by insertion, addition, substitution or deletion of more than one amino acid.
, 11 or 12 may be different. Examples of variants are shown in FIG. 2, each of which constitutes another aspect of the present invention.

Screening for the presence of one or more of these polypeptides in a test sample has diagnostic and / or prognostic uses, for example, in determining the presence of HRV-5, as described below. .

The present invention also includes active portions, fragments, and derivatives of the HRV-5 polypeptides of the present invention.

A “fragment” of an HRV-5 polypeptide is at least about 5-7 contiguous amino acids, often at least about 7-9 contiguous amino acids, typically at least about 9-13 contiguous amino acids A stretch of amino acid residues, most preferably at least about 15, 20 to 30 or more contiguous amino acids, is meant. HRV-
Fragments of the five polypeptide sequences may contain antigenic determinants or epitopes useful for raising antibodies against a portion of the amino acid sequence.

A polypeptide of the invention can be isolated and / or purified (eg, using an antibody) after being produced, for example, by expression from the encoding nucleic acid. In addition, the polypeptide of the present invention can be synthesized in whole or in part by chemical synthesis. The isolated and / or purified polypeptide is used in formulating a composition comprising at least one additional component, for example, a pharmaceutical composition comprising a pharmaceutically acceptable excipient, vehicle or carrier. Compositions comprising a polypeptide of the invention can be used in prophylactic and / or therapeutic treatments, as described below.

The polypeptides, peptide fragments, alleles, mutants or variants according to the invention are used as immunogens or else in obtaining specific antibodies. Antibodies are useful for the purification and other manipulation of polypeptides and peptides, and are also useful for diagnosis, screening and therapy. This is described further below.

The polypeptide of the present invention is used in screening for a molecule that affects the activity or function or regulates the activity or function. Such molecules are useful in the context of therapy, possibly including prophylaxis.

A further important use of the HRV-5 polypeptide is in raising antibodies, or at least an antibody binding domain having the property of binding specifically to an HRV-5 polypeptide, or a fragment or fragment thereof. Is to bring the active part.

The production of monoclonal antibodies is well-established in the art. Monoclonal antibodies can be subjected to recombinant DNA technology techniques to produce other antibodies or chimeric molecules that retain the specificity of the original antibody. Such an approach involves introducing DNA encoding the immunoglobulin variable or complementarity-determining regions (CDRs) of one antibody into the constant or framework and framework regions of a different immunoglobulin. See, for example, EP-A-184187, GB-A-2188638, or EP-A-239400. A hybridoma producing a monoclonal antibody may be subject to genetic mutation or other changes, which may or may not alter the specificity of the antibody produced.

The provision of a novel HRV-5 polypeptide enables, for the first time, the production of antibodies that can specifically bind to it. Thus, a further aspect of the present invention is illustrated in FIGS.
, 10, 11, 12 or 13 are provided which are capable of specifically binding to the polypeptide whose sequence is shown. Such an antibody discriminates between a polypeptide to which it can bind and other human endogenous polypeptides that do not or substantially display no binding affinity (eg, a binding affinity less than about 1000x). It can be unique in the sense that it can do it. Specific antibodies bind to an epitope on a molecule that is absent or unacceptable on other molecules. An antibody according to the present invention may be specific for a wild-type polypeptide. Antibodies according to the present invention are useful in diagnostic and prognostic methods, as described below, and are more or less specific mutants, variants, alleles or derivatives of the molecule and wild-type HRV-5 polypeptide. It may be specific for a polypeptide. Antibodies are also useful for purifying polypeptides that bind to the antibody, eg, after production by recombinant expression from the encoding nucleic acid.

Preferred antibodies of the present invention are isolated in the sense that they are free of contaminants and / or free of serum components, such as antibodies capable of binding other polypeptides. Although monoclonal antibodies are preferred for some purposes, polyclonal antibodies are also within the scope of the invention.

[0049] Antibodies can be obtained using techniques standard in the art. The method for producing antibodies is
Immunizing a mammal (eg, mouse, rat, rabbit, horse, goat, sheep, monkey) with the protein or a fragment thereof. Antibodies are obtained from the immunized animal using any of the various methods known in the art, and preferably screened using the binding of the antibody to the antigen of interest. For example, Western blotting or immunoprecipitation is used (Armitage et al., Nature, 357: 80-82, 1992). Isolation of antibodies and / or antibody-producing cells from an animal may involve sacrificing the animal.

As an alternative or ancillary method for immunizing mammals with the peptides, immunoglobulins expressed using, for example, lambda or filamentous bacteriophages displaying a functional immunoglobulin binding domain on their surface Antibodies specific to the protein can be obtained from recombinantly produced libraries of variable domains. See, for example, WO92 / 01047. Libraries can be naive, ie, constructed from sequences obtained from an organism that has not been immunized with the protein (or fragment), or constructed using sequences obtained from an organism that has been exposed to the antigen of interest. May be done.

The antibodies according to the present invention can be modified in several ways. In fact, "antibodies"
The term should be construed as covering any binding substance that has a binding domain with the required specificity. Thus, the invention encompasses antibody fragments, antibody derivatives, functional equivalents and analogs of antibodies, for example, synthetic molecules and molecules whose shape resembles that of an antibody and which can bind to an antigen or epitope. .

Examples of antibody fragments capable of binding to an antigen or other binding partner include VL, VH
An Fd fragment consisting of the VH and CH1 domains; an Fv fragment consisting of the VL and VH domains of a single arm of the antibody; a dAb fragment consisting of the VH domain; an isolated CDR region and F (ab ') 2 fragment (a bivalent fragment containing two Fab fragments linked by a disulfide bridge in the hinge region). Single chain Fv fragments are also included.

Also, to obtain antibodies that are less immunogenic than the parent non-human antibody, CDRs from non-human sources can be replaced with human framework regions (typically some modification of framework amino acid residues). ) Are also included in the present invention.

Hybridomas producing the monoclonal antibodies of the invention can be subject to genetic mutation or other changes. Further, those of skill in the art will understand that monoclonal antibodies can be subjected to recombinant DNA technology techniques to produce other antibodies or chimeric antibodies that retain the specificity of the original antibody. Such techniques include introducing DNA encoding the immunoglobulin variable regions or CDRs of one antibody into the constant regions or constant and framework regions of different immunoglobulins. For example,
See EP-A-184187, GB-A-2188638 or EP-A-0239400. Cloning and expression of chimeric antibodies are described in EP-A-0120694 and EP-A-0125023.

Hybridomas capable of producing antibodies with the desired binding characteristics are within the scope of the invention, and eukaryotic or prokaryotic host cells that contain and can express nucleic acids encoding antibodies (including antibody fragments) are also contemplated. Also within the scope of the present invention. The present invention also provides a method for producing an antibody, comprising culturing cells capable of producing the antibody under conditions that produce (preferably, secrete) the antibody.

[0056] The present invention also provides protein antigens obtained from the sequences described herein. Protein antigens can be used in the manufacture of a vaccine. If the purified protein is not antigenic in itself, it can be attached to a carrier to render the protein immunogenic. Carriers include bovine serum albumin,
Keyhole limpet hemocyanin and the like. Vaccination can be performed in the usual manner. For example, whether the antigen is a viral particle or a protein, it is used in a suitable diluent, such as water, saline, buffered solutions, complete or incomplete adjuvant. The immunogen can be administered by standard techniques for inducing antibodies, for example, by subcutaneous administration of a physiologically compatible sterile solution containing inactivated or attenuated virus particles or antigen.

In a further aspect, the present invention provides an agent for use in treating, diagnosing and treating autoimmune diseases and other inflammatory diseases such as HRV-5 associated arthritis and SLE.

The HRV-5 polypeptides, antibodies, peptides and nucleic acids of the invention described above, as well as those derived from the nucleic acid and amino acid sequences shown in FIGS. 1, 2, 3, 6, 10, 11, 12 or 13 are: Can be formulated as a pharmaceutical composition. These compositions may contain, in addition to the above materials, pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those skilled in the art. Such substances are non-toxic and must not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material will depend on the route of administration, eg, oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal.

The present invention provides a method of treating an autoimmune disease or other inflammatory disease, for example,
Including the application of inhibitors of retroviral replication, eg, inhibitors of reverse transcription (eg, chain terminators such as zidovudine) and protease inhibitors, or other antiviral agents. Other examples include inhibitors of integrase or dUTPase activity, or inhibitors of ancillary proteins, such as regulatory proteins produced by the virus.

For use in such methods, the above-mentioned agents are suitably administered in the form of a pharmaceutical composition in combination with a pharmaceutically acceptable carrier or diluent. Such compositions also constitute a further aspect of the present invention.

[0061] Suitable pharmaceutically acceptable carriers include liquid and solid carriers such as water, aqueous ethanol, and the like, as commonly used in the art. The dosage form of the composition may be suitable for oral, topical or parenteral use. Suitable composition forms include tablets, capsules, syringes, creams, suspensions, solutions, powders ready for use, sterile preparations for injection or infusion. Other conventional pharmaceutically acceptable substances such as diluents, binders, preservatives and the like may be added.

The drug is administered in a therapeutically effective amount. Exact dosages will vary depending on the particular drug used. The nature of the disease as well as the patient is positioned and determined by the physician in the usual manner.

The agent can protect a patient immunized therewith from infection or the consequences of infection by the corresponding wild-type virus.

For diagnosis, an assay system developed from knowledge of HRV-5 can be used to detect wild-type virus in tissue samples. For example, the invention provides for the diagnosis of autoimmune and other inflammatory diseases, particularly arthritis, including, for example, (a) a nucleic acid capable of hybridizing to a nucleic acid associated with wild-type HRV-5, (b) 2.) by using specific binding members, such as substances comprising an antibody binding domain having specificity for one or more epitopes or sequences characteristic of the polypeptide expressed by wild-type HRV-5.

If the specific binding member consists of a nucleic acid, simply use the member as a specific probe according to standard techniques and procedures. Alternatively, the specific binding member can be a pair of oligo- or polynucleotide sequences for use in an amplification method such as PCR.

In particular, the present invention relates to polynucleotide sequences (DNA, RNA, single-stranded or double-stranded) comprising or derived from the nucleotide sequence of HRV-5 shown in FIGS. Are provided.

[0067] Primer pairs can be designed using the sequence information provided herein. Once the copy number of the polynucleotide sequence associated with HRV-5 has increased, the amplified sequence can be amplified by standard methods, such as incorporation of radioactive nucleotides into the copied sequence, ethidium bromide staining, sequencing, hybridization probe search, etc. Can be detected.

Therefore, the present invention detects the presence or absence of HRV-5 by collecting an appropriate sample (eg, synovium) from a patient and adding an appropriate specific binding member as described above to the sample. And a method for diagnosing an autoimmune disease (particularly, arthritis).
Where the specific binding member is an oligonucleotide primer pair, the method also includes adding other standard components to perform polynucleotide hybridization amplification (amplification based on a DNA or RNA template), The conditions for hybridization, extension and denaturation or strand separation are used to amplify the new polynucleotide sequence located between the two primers and to check for the presence of the amplification product and to determine the HR
Including the steps of determining the presence or absence of V-5.

Generally, as mentioned above, specific primers are at least 14 nucleotides in length, but at most 18 to 24 nucleotides.

A further aspect of the present invention provides an oligonucleotide or polynucleotide fragment of a nucleotide sequence disclosed herein, or a complement thereof, particularly for use in a method for obtaining and / or screening a nucleic acid. I do. The above sequence can be modified by the addition, substitution, insertion or deletion of one or more nucleotides, but has not lost the ability to selectively hybridize to a nucleic acid characteristic of HRV-5, that is, Preferably, the homology of the oligonucleotide or polynucleotide to one of the given sequences is sufficiently high.

An oligonucleotide of the invention, which is a fragment of any of the sequences disclosed herein, is at least about 10 nucleotides in length, more preferably at least about 15 nucleotides, and even more preferably at least about 20 nucleotides. Such fragments by themselves individually represent embodiments of the present invention.

Preferably, the oligonucleotide primer of the invention comprises the following nucleic acid sequence: 'Preferably, the two primer sets are used in a nested PCR assay, wherein set A is a first stage primer and set B is a second stage primer.

The present invention provides another set of primers comprising the following nucleic acid sequences for use in the above assays: C 5′-CCATCACATTATGGGGAAGAGACA-3 ′ 5′-GAATGTCTTGTTCATGTAGAGGTAT-3 ′ D 5′-GCCATTGTCATGGCTGGACAACAA -3 '5'-CCTTCAGATCGAGTACTATTAATGG-3' Here, set C can be used as a first stage primer, and set D can be used as a second stage primer.

E 5′-GCCATGACACCATCAAGAAGTGCT-3 ′ 5′-TGCTTTGGGATCATAGTAGGAAC-3 ′ F 5′-ATTAGGCTCCAGAGAAGGCAGAAG-3 ′ 5′-CCGGGAGTCCAGGTTGTAATG-3 ′ Here, set E was used as the first stage primer, and set F was used. It can be used as a second stage primer.

Using the nested PCR method, we reduced the viral DNA by 1-10
It has been found that even a sample containing only molecules can be detected. When using this method, the control should be noted to avoid false positives.

The above sequences can also be used to design longer nucleotide probes that are useful for detecting HRV-5 sequences. Additional nucleotide bases (eg, N = 0-200, where N is any nucleotide) can be added to the ends of these primers. Preferably, these additional nucleotide bases are derived from the sequence shown in FIG.

[0077] Immunological methods such as peptide and protein enzyme-linked immunosorbent assays (ELISA) and Western blots, and PCR and other DNA or R
Diagnostic tests for viral infections based on NA detection methods constitute another aspect of the present invention.

As mentioned above, viral antigens constitute another aspect of the present invention. For example, retroviruses or viral antigens can be used to raise monoclonal or polyclonal antibodies in a conventional manner.

The use of such antibodies allows, for example, immunization of samples taken from patients suspected of having arthritis or other diseases, such as synovial membrane samples, and other tissue or cell cultures (eg, peripheral blood cells). Screening for the presence of the virus can be performed by histochemical techniques. Therefore, the present invention also provides an antibody that binds to the above-mentioned antigen, and a diagnostic kit containing the antibody.

Another suitable antigen that can be used to raise antibodies is env, pro, pol, dUTPase
, RT / RNase H, integrase, viral regulatory proteins or superantigens as well as epitopes from matrix (MA) and capsid (CA) and other gag proteins.

The viral antigens according to the invention can be used for eliciting an immune response in a mammalian subject, preferably a human subject, and can be used as such in the manufacture of a vaccine. Conventional vaccines contain either infectious (live) or non-infectious (killed) virus particles. Upon administration, all vaccines should have the following properties: A) cause less severe disease than natural infection; b) stimulate effective and lasting immunity; and c) are genetically stable. Now, the manufacture of vaccines is well developed in the art. In the case of killed virus vaccines, the problem is to produce sufficient material at low cost and to ensure that the infectious virus does not survive by inactivation methods. Therefore, DNA techniques are used to identify portions of the viral genome that encode particular viral proteins against which protective immunity is induced. This includes: a) expression of the whole protein, eg, GAG, CA, ENV, or any other viral protein, especially a regulatory protein; b) expression of a fragment of the protein, including the antigenic site; Chemical synthesis of the peptide, including: In cases a) and b), the viral nucleic acid (eg, FIG. 1, 3, 6, 10, 12, or 13, a variant or fragment thereof) is excised and placed into an appropriate expression vector (promoter, termination and polyadenylation). Insert with signal. In this method, a small portion (non-infectious by definition) of the viral genome is present, which, when inserted into a host cell and cultured on an industrial scale, may produce very large amounts of protein at low cost. Bacterial expression systems can be used. However, eukaryotic cells are used to achieve co-translational and post-translational modifications of eukaryotic cells such as glycosylation and proteolytic cleavage.

Live vaccines derive the most effective immunity by inserting the nucleotide sequence encoding the antigenic site of interest into an existing live virus so that it is naturally expressed as the virus grows. This has previously been done for a variety of viruses, including influenza, rabies, herpes simplex I and hepatitis B viruses, using vaccinia virus as a live vaccine.

[0083] The present invention provides a vaccine comprising the above nucleotide or polypeptide sequence. Further, the present invention provides a method of treating a mammalian subject with such a vaccine to elicit an immune response.

Further, the present invention provides a method for detecting an antibody against a viral protein. Such methods are useful for diagnosing diseases, including RA, systemic lupus erythematosus, and other autoimmune diseases (see, eg, Table I).

Particularly suitable for the detection of antibodies to viral peptides or proteins is EL
ISA. A specific assay device of the invention comprises a retroviral antigen of the invention immobilized on a support. Appropriately purified recombinant viral antigen is used. These antigens can be expressed on eukaryotic or prokaryotic cells such as bacteria, yeast or mammalian cells, preferably bacterial cells. As a capture antigen for immobilization, an affinity-purified antiviral antigen serum, for example, rabbit serum can be used.

In addition, cultured viruses could constitute the basis of a virus isolation assay known in the art. Useful methods for culturing viruses include direct culture methods (eg,
Weiss RA, Chpt 3 in Weiss et al. (Eds.), 1982 RNA Tumor Viruses (Cold Spring H
arbor Laboratory press) and Brookes et al., Brit. J. Rheum. 1995 34: 226-2.
31), co-culture methods (eg, by culturing a tissue sample with a target cell line). In such methods, the tissue sample is digested with trypsin or homogenized using a mortar and pestle. Then, typically take this into a flask containing 10 ⁵ -10 ⁶ tissue culture cells.

Suitable tissue cells that allow the growth of the virus include T and B lymphocytes, monocytes,
Includes macrophages, fibroblasts and epithelial cells.

Alternatively, the virus is administered to a suitable nude mouse or severe combined immunodeficiency (SCI
D) Mice can be cultured by xenotransplantation of the virus. Using this method, a tissue sample such as the synovium is implanted subcutaneously, for example, in the mid-flank of an anesthetized mouse. Evidence of virus growth was then assessed using PCR for RNA and / or DNA or by a sensitive RT assay described in Silver et al., Nucleic Acids Res. 1993, 21: 3593-3594. Is separated.

The association of HRV-5 with autoimmune and inflammatory bowel diseases, as described above, allows for screening methods to look for agents such as compounds that are effective in treating these diseases. Such screening methods, together with the resulting agents, constitute another aspect of the invention.

The present invention further provides a vector for gene therapy comprising a disabled HRV-5. Vectors, such as viral vectors, have been used in the prior art to introduce genes into a variety of different target cells. Typically, the cells are exposed to target cells such that transfection occurs in a sufficient percentage of the cells to obtain a useful therapeutic or prophylactic effect from the expression of the desired polypeptide. Either the transfected nucleic acid is permanently integrated into the respective genome of the target cell to have a long-term effect, or the treatment must be repeated periodically. The disabled HRV-5 viral vector can be prepared by standard methods (Naldini zufferey R
Et al., Nature Biotechnol. 1997, 15: 871-875), by deletion or inactivation of one or more specific viral proteins.

Detailed Description Example 1 Development of a Specific PCR Assay for HRV-5 Three nested PCR assays were developed for HRV-5. Each of these assays used primer sets from different regions of JC96 (Grif
fiths et al., 1997 J. Virol. vol. 71 pp. 2866-2872). The optimal PCR conditions and sensitivity of each primer set were determined using serially diluted plasmids containing the cloned sequences in the presence of 500 ng of human genomic DNA. Under optimal conditions, all primer sets were found to have a sensitivity of nominally one molecule of viral DNA. Five
Since 00 ng of human DNA corresponds to a DNA content of about 75,000 cells, each of these primer sets is sensitive enough to detect one provirus in 75,000 cells.

The primer sets are as follows: Assay 1 First Stage Primers: 4143 5′-TCAGAAGGTGATTGGCCGAAGTCA-3 ′ 4144 5′-GGTCCTCATTTGTTAATGTCAGTC-3 ′ Conditions: Initial denaturation at 94 ° C. for 4 minutes, then 94 ° C. 40 cycles of 45 seconds at 52 ° C, 45 seconds at 72 ° C.

1 μl was transferred to the second stage.

Second stage primers: 4145 5'-CCCTTCAGCCAGGAGATAATACT-3 '4146 5'-ATGTCTCTTCCCCATAATGTGATG-3' Conditions are the same as for the first stage, but only for 30 cycles.

Assay 2 First Stage Primers: 3493 5'-CCATCACATTATGGGGAAGAGACA 3496 5'-GAATGTCTTGTTCATGTAGAGGTAT Conditions: Initial denaturation 94 ° C for 3 minutes, then 94 ° C for 45 seconds, 52 ° C for 45 seconds, 72 ° C for 30 seconds. The 40 cycles.

1 μl was transferred to the second stage.

Second stage primers: 3494 5'-GCCATTGTCATGGCTGGACAACAA 3495 5'-CCTTCAGATCGAGTACTATTAATGG Conditions are the same as for first stage but only 30 cycles.

Assay 3 First Stage Primers: 0831 5'-GCCATGACACCATCAAGAAGTGCT 2061 5'-TGCTTTGGGATCATAGTAGGAAC Conditions: Initial denaturation 94 ° C for 3 minutes, then 94 ° C for 30 seconds, 60 ° C for 60 seconds, 60 ° C for 60 seconds, 72 ° C for 30 seconds The 25 cycles.

1 μl was transferred to the second stage.

Second Stage Primers: 2062 5'-ATTAGGCTCCAGAGAAGGCAGAAG 2063 5'-CCGGGAGTCCAGGTTGTAATG Conditions: Initial denaturation 3 minutes at 94 ° C, then 45 seconds at 94 ° C, 60 seconds at 58 ° C, 30 seconds at 72 ° C for 25 seconds. cycle.

For each PCR, one fifth of the reaction product was analyzed by agarose gel electrophoresis.

Example 2 Detection of HRV-5 in Inflamed Joints In preliminary experiments, several human DNA samples were tested using each PCR assay. Although the different PCR assays had similar sensitivities, it was surprisingly found that Primer Set 1 detected the HRV-5 sequence in more human DNA samples than the other primer sets. That is, many DNA samples that were positive in assay 1 were negative in assays 2 and 3. This indicates that Assay 1 is more sensitive than other assays for detecting HRV-5 DNA in clinical tissue samples. Accordingly, a number of human DNA samples from various tissues and diseases were screened using this primer set (Table 1).

[0103] Table 1 Table 1: Different tissue sample HRV-5 proviral DNA detection frequency tissue disease samples tested positive samples synovial rheumatoid arthritis 25 12 reactive arthritis 5 3 osteoarthritis 5 3 psoriatic arthritis 2 2 Ankylosing spondylitis 1 0 Normal 7 0 Salivary gland Sjogren's syndrome 26 0 Normal 4 0 Lymph node non-malignant 27 0 Bone marrow Various 31 0 Blood Rheumatoid arthritis 26 3 SLE 56 11 Osteoarthritis 3 1 Normal 67 1 Intestinal Crohn's disease 10 1 Ulcerative colitis 98 Out of 38 synovium from patients with various joint diseases, 20 were positive for HRV-5 proviral DNA (53%). Positive samples were identified from patients with rheumatoid arthritis, osteoarthritis, and psoriatic arthritis. Seven normal synovium were negative. In addition, DNA from 27 benign lymph nodes, 26 salivary gland biopsies of primary Sjogren's syndrome patients, 4 normal salivary glands and 31 bone marrow biopsies were negative. Of the 152 peripheral blood DNA samples tested, 16 (8%) were positive (3/26 rheumatoid arthritis, 11/56
Systemic lupus erythematosus (SLE), 1/3 osteoarthritis, and 1/67 normal blood).

Thus, the results of this PCR screening indicate that HRV-5 is rarely detected in most human DNAs, with levels of 1-2% in normal blood. The exception was the inflammatory synovium, with a detection rate of> 50%, in the blood of patients with joint disease and SLE.

Example 3 Cloning of the nucleocapsid region of HRV-5 A DNA sample positive for the HRV-5 sequence was used to amplify the region upstream of the known sequence of the virus. In this PCR, degenerate primers based on the zinc finger sequence conserved in the retroviral nucleocapsid protein were used. This degenerate primer was used in a hemi-nested PCR with a reverse primer (from Assay 1) specific for the protease region of HRV-5. The limited amount of DNA in the samples available for testing and the low amount of HRV-5 in these DNA samples increases the amount of target HRV-5 DNA during PCR, thereby increasing DNA from different sources was pooled to increase the probability of successful amplification. Sources of DNA were apparently normal blood from normal individuals and salivary gland DNA from rheumatoid arthritis patients.

The primers used are as follows: 8532 5'-TGYTTYAARTGYGGIMRIMMIGGICA 4144 5'-GGTCCTCATTTGTTAATGTCAGTC 4146 5'-ATGTCTCTTCCCCATAATGTGATG (where Y is C or T, R is A or G, M is A or C, And I is inosine).

About 1 μg of genomic DNA from each source was combined with 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2 mM MgCl ₂ , 200 μM each of dNTPs, 2.5 units of Taq polymerase (Qiagen), and
Added to a 50 μl PCR reaction containing 20 pmol of primers 8532 and 4144. Reactants
In a Stratagene Robocycler Thermal cycler, first denature at 94 ° C for 3 minutes, then 94 ° C
The amplification was carried out by performing 40 cycles of 1 minute at 42 ° C., 1 minute 30 seconds, and 3 minutes at 72 ° C. Then this PC
3 μl of the product of R was first denatured at 94 ° C. for 3 minutes using primers 8532 and 4146, 40 cycles of 1 minute 10 seconds at 94 ° C., 1 minute 10 seconds at 42 ° C., 3 minutes at 72 ° C. Performed and amplified again. The product of this PCR was cloned into pBluescript using standard methods. Several plasmid clones were sequenced and a consensus was found (Figure 1).
).

Example 4 Amplification of HRV-5 Nucleocapsid Sequence from RA and SLE Patients DNA from RA and SLE patients was ligated with HRV using nested PCR using primers specific for this region of HRV-5. The presence of the -5 nucleocapsid sequence was tested.

In the first stage PCR, DNA was amplified with the following primers: NCF3 5′-GCAGGGGCATCTAATGAGGGAAT-3 ′ NCR1 5′-CTGAAATTGTTTCYGCCCTCACCT-3 ′ (where Y is C or T) Conditions: Initial Denaturation 94 ° C for 4 minutes, then 40 cycles of 94 ° C for 45 seconds, 60 ° C for 45 seconds, 72 ° C for 45 seconds. 1 μl of the product was transferred to the second stage.

Second stage primers: NCF4 5'-AGATTTCCAGCCCGAGATCGGCAG-3 'NCR2 5'-TGTGGCCCCATTTGAGGTGTTAG-3' Conditions are the same as for the first stage, but only for 30 cycles.

After agarose gel electrophoresis, the PCR products were purified, subcloned into pBluescript, and several clones from each patient were sequenced. The amino acid sequence variation is shown in FIG.

Example 5 Cloning of HRV-5 Integrase Region After successful amplification of the upstream region of HRV-5 protease, an attempt was made to clone the downstream region of the known sequence. The DNA used in this experiment was apparently from normal human blood (same sample as above).

The primers used are as follows: 4143 5'-TCAGAAGGTGATTGGCCGAAGTCA 3494 5'-GCCATTGTCATGGCTGGACAACAA 3382 5'-CCAGGICCRTTRTCTGTTTT 3383 5'-TGIGTRACATCCATTTGCCA

About 3 μg of DNA was combined with 50 μl of PCR containing 20 pmol of each of primers 4143 and 3382.
Added to reaction. The reaction is first performed on a Stratagene Robocycler Thermal cycler for 94
Denaturation was performed at 4 ° C. for 4 minutes, followed by 40 cycles of 94 ° C. for 1 minute and 20 seconds, 50 ° C. for 1 minute and 30 seconds, and 72 ° C. for 3 minutes. Next, 1 μl of the product of this PCR was first denatured at 94 ° C. for 4 minutes using primers 3194 and 3383, then 1 minute 20 seconds at 94 ° C., 1 minute 30 seconds at 44 ° C., 72 ° C. 3 minutes to 40
The cycle was performed and amplification was performed again. This PCR product is purified using standard methods using pBluescri
cloned into pt. Several plasmid clones were sequenced and a consensus was found (FIG. 3).

Example 6 Comparison of HRV-5 with other described retroviruses The conclusion from this comparison is that the DNA from cells expressing HIAP-I and HIAP-II particles is
It does not contain V-5 DNA.

The HIAP-I and HIAP-II cell lines described by Garry et al. (Garry, RF et al., 1990, respectively)
Science 250: 1127-1129; and Garry, RF et al., Aids Res. Hum. Retrovirus.
es 1996, 12: 931-940) to test for the inclusion of the HRV-5 sequence in the American Type Culture Collection.
Obtained two cell lines. These cell lines have the accession codes CRL-11213 (HIAP-I) and CRL-11622 (HIAP-II). A vial of purified HIAP-II virus (VR-2503) was also obtained. A HIAP-I (VR-2394) virus preparation is not provided for testing.

Cells were supplied as frozen ampules (on dry ice) and were transferred to liquid nitrogen immediately after receipt and stored. Each vial was then thawed at 37 ° C. and half of each cell stock was diluted in 10 ml of RPMI-1640 medium supplemented with 10% fetal calf serum. The cells were then centrifuged at 1200 g for 5 minutes at room temperature (22 ° C.) and the cell pellet was suspended in 5 ml of RPMI-1640 medium supplemented with 20% serum. The cells are then placed in a humidified atmosphere containing 5% CO ₂
The cells were cultured at 37 ° C.

The other half of each cell stock was used to prepare DNA directly (using standard methods) without culture. The DNA was then tested for HRV-5 sequence using PCR assay 1, and both cell lines were negative, but the PCR of the control genomic sequence was positive. The results demonstrate that the cell line described by Garry et al. Does not contain HRV-5, and thus HRV-5 is not the same virus as HIAP-I or HIAP-II.

Example 7 Detection of HRV-5 DNA in Ulcerative Colitis Intestinal biopsies from patients with Crohn's disease and ulcerative colitis using HRV-5 specific PCR assay 1 (Example 1) DNA was examined. HRV-5 DNA was detected in only one of 10 intestinal biopsies from Crohn's disease. In contrast, HRV-5 DNA was found in intestinal tissue of eight of nine patients with ulcerative colitis. In addition, the content of HRV-5 DNA in these samples was much higher than that observed in other positive samples. In particular, one sample contained a sufficiently high concentration of HRV-5 DNA to allow for an additional 1200 bp cloning of the viral Gag gene (see Example 8).

Example 8 Cloning of Gag Gene Region of HRV-5 After cloning of the nucleocapsid and integrase genes of HRV-5, cloning of an additional region of the Gag gene was attempted. Initial experiments using the degenerate primer PCR approach were not successful. Therefore, a more general PCR method for cloning flanking DNA, namely "chromosome walking", was used. Specifically, V
ectorette PCR system [Arnold and Hodgson, 1991, PCR Methods Appl. 1: 39-4
2], the 1.2 kbp HRV-5 Gag gene was successfully cloned.

In the Vectorette PCR system, restriction enzyme digestion of target DNA and subsequent cleavage of DN
A double-stranded oligonucleotide linker ("Vectorettes") linkage to the A-terminus is used. In fact, the target DNA is digested (separately) with several different enzymes in order to maximize the probability that one of these restriction sites is in the proper range for PCR amplification. In addition, oligonucleotide linkers are designed to minimize non-specific amplification [Arnold and Hodgson, 1991, PCR Methods Appl. 1: 39-42].

For cloning of the HRV-5 Gag gene, Genosys Biotechnologies (UK)
Vectorette PCR was performed using the kit obtained from. A 5 μg aliquot of DNA from colon tissue of an ulcerative colitis patient known to be positive for HRV-5 (using specific assay 1) was digested with the restriction enzymes ClaI, EcoRI, BamHI, and HIndIII (separately). C) digested and ligated the appropriate DNAette linker to the cut DNA. Three rounds of digestion and ligation were performed according to the manufacturer's protocol to minimize concatamer formation. Nested aliquots of the linker product using HRV-5 specific primers along with primers derived from the linker sequence
PCR was performed. This experiment amplified the sequence upstream of the nucleocapsid.
The primers used are shown below. Vectorette primer sequences are proprietary,
unknown. These PCR amplifications are performed on a Stratagene Robocycler PCR machine, and Pfu Turbo DNA polymerase (Stratage
ne) was used.

First Stage PCR: Vectorette Primer I (supplied in Genosys kit) HRV-5 nucleocapsid Primer 5'-CTGAAATTGTTTCYGCCCTCACCT (where Y is C or T) Conditions: Initial denaturation at 95 ° C for 4 minutes 1 minute and 10 seconds at 95 ° C, 1 minute at 62 ° C, 6 minutes at 72 ° C
40 cycles. 1 μl of the product of the first round was transferred to the second stage.

Second stage PCR: Vectorette nested primer II (supplied in Genosys kit) HRV-5 nucleocapsid primer 5'-TGTGGCCCCATTTGAGGTGTTAG Conditions: Initial denaturation at 95 ° C for 4 minutes, then 95 ° C for 1 minute and 10 seconds, 1 minute at 62 ° C, 6 minutes at 72 ° C
40 cycles.

When the second stage PCR product was analyzed by agarose gel electrophoresis, it
Smears in the range of 0 bp were observed. These products were analyzed by Southern blotting and hybridized with a digoxigenin-labeled oligonucleotide probe specific for the HRV-5 nucleocapsid region (5'-GCTGTTGTCCATATACACCTGATC) to identify the HRV-5 fragment present in the smear.

The hybridized probe was Boehringer-Mannh
eim) (DIG detection kit). An approximately 800 bp band was observed and the rest of the PCR product was electrophoresed on an agarose gel to cut out the appropriate region of the gel. DNA purified from this gel slice was subcloned into pBluescript (Stratagene) to identify and sequence a plasmid containing the HRV-5 sequence. The resulting sequence overlaps the known nucleocapsid region of HRV-5 and is EcoRI 480 bp upstream of the NC.
It had extended to the site. This new fragment of the HRV-5 genome was named Gag1. As expected, the region of HRV-5 indicated by degenerate primer 8532 (nucleotides 1-26 in FIG. 1) was found to have many mismatches when compared to the true sequence of Gag1.

Next, additional regions of the HRV-5 Gag gene were cloned using 1 μl of the second stage PCR product of ClaI Vectorette adapted DNA as a template, using primers based on the Gag1 sequence.

Primers used: Vectorette sequencing primer (supplied in Genosys kit) HRV-5 Gag primer (CA2R) 5 'CTGTACTATCTTAGTTAGGCTGTG Conditions: Initial denaturation 4 min at 95 ° C, then 1 min 10 sec at 94 ° C 1 minute and 10 seconds at 51 ° C, 3 minutes at 72 ° C
40 cycles of minutes.

This PCR resulted in a clear band of about 1000 bp after analysis by agarose gel electrophoresis. After cloning and sequencing, the product has a known HRV-5 ga
The g sequence was found to extend to a ClaI restriction site 1250 bp upstream of the original NC fragment. This second region (between the ClaI and EcoRI sites) was called Gag2. HRV-5
The composite sequence of Gag is shown in FIG.

Example 9 Bacterial Expression of Recombinant HRV-5 Gag Protein Bacterial retroviral large capsid protein (CA) is commonly used as a target antigen in immunological detection methods. To develop such an assay for HRV-5, a region of the gag protein of HRV-5, which is likely to be CA, was expressed in a bacterial expression system. The region of HRV-5 most likely to be CA was identified by comparison to the published sequences of other B and D retroviruses (FIG. 11). From the previously obtained cloned PCR fragment, reamplify the appropriate DNA sequence using standard methods,
Gel purified, blunted and cloned into pBluescript.

Primers used: Forward (containing NcoI site) 5'-AGAGACCATGGAACCAGGCCAGGTGTTTCCTG Reverse (containing XbaI site) 5'-GAGATTCTAGAAATTGTCGGGTTACAGCTACTGC Conditions were 94 ° C for 4 minutes, then 94 ° C for 1 minute and 10 seconds, 55 ° C. For 1 minute and 10 seconds and 72 ° C. for 1 minute and 30 seconds for 30 cycles.

The resulting plasmid was sequenced to confirm that the PCR did not incorporate errors in the Gag sequence, and then the selected sequence was digested completely with XbaI and partially digested with NcoI. The 700 bp HRV-5 CA fragment was subcloned into the bacterial expression vector pTrcHis2B (Invitrogen) previously digested with NcoI and XbaI. The resulting plasmid was named pTrc-CA.

The pTrcHis2B expression vector was used to enable the production of the desired protein fused to two epitope tags (ie, a polyhistidine tag and a “myc” tag). The polyhistidine (HIS-6) tag allows the purification of the desired protein using affinity chromatography on nickel-agarose beads [Schmitt et al., 1993, Mol. Biol. Rep., 18: 223]. -230]. The c-myc epitope tag allows detection of expressed proteins on immunoblots using a monoclonal antibody specific for this epitope [Evan et al., 1985, Mol. Cel.
l Biol. 5: 3610-3616].

A 2 ml culture of the transformed bacteria containing plasmid pTrc-CA was grown overnight in Luria Bertani broth supplemented with 100 μg / ml ampicillin. This culture was then diluted 1:10 with fresh medium and grown for 1 hour at 37 ° C. with shaking. Next, to induce expression of the tagged HRV-5 CA protein, IPTG was added to a final concentration of 1 mM.
And the culture was grown for an additional 90 minutes. Then extract the bacterial extract with SDS-PA
Analysis by GE confirmed the production of the desired CA protein by the presence of the 30 kDa protein and subsequent immunoblotting with the anti-myc monoclonal antibody 9E10 [Eva
n et al., 1985, Mol. Cell Biol. 5: 3610-3616].

The protein was then purified by metal chelate chromatography using a commercially available kit (Xpress System, from Invitrogen) and was obtained substantially free of contaminating bacterial proteins. This retroviral HRV-5 CA protein is now ready to be used as a target antigen in immunoblots, ELISAs, and other serological assays for the detection of anti-HRV-5 antibodies in human serum. In addition, this protein
As already done with HRV-5 protease and reverse transcriptase, it could be used to generate specific rabbit polyclonal and rat monoclonal antibodies.

Example 10 Cloning of Additional Fragments of HRV-5 Gag In addition to Vectorette PCR, other DNA walking methods were used to extend the HRV-5 sequence.
Using a method based on 5 ′ RACE (5 ′ amplification of cDNA ends, Frohman et al., 1988, Proc. Natl. Acad. Sci. USA 85: 8998-9002) adapted for use with genomic DNA, 260 bp was cloned. This adaptation was designed to enrich the target DNA with the HRV-5 sequence and prepare a single-stranded DNA that functions as a template in the tailing step of the RACE reaction.

3 μg of DNA from normal blood was used for PCR containing a single primer specific for HRV-5.
Added to reaction.

Primers: HRV-5 Gag primer (CA2R1) 5 '-(biotin) -GCTTCCTGGCTCTCTAAATCCTTC Conditions were: initial denaturation at 94 ° C for 4 minutes, then 94 ° C for 1 minute, 62 ° C for 1 minute and 10 seconds, 72 ° C. For 3 minutes and 40 cycles.

The HRV-5 specific primer used in this reaction is modified in that it was synthesized to have a biotin molecule at its 5 ′ end. The purpose of this single primer PCR is to use HRV
The goal was to create a single-stranded DNA molecule extending from the known region of -5 Gag to the upstream flanking sequence. These single-stranded DNA molecules were purified using streptavidin-coated magnetic beads by utilizing the 5 'biotin modification of the primers used in PCR. This purification was performed as recommended using the KilobaseBINDER kit (Dynal, Sweden).

The selected DNA fragments were then further modified by adding a “tail” of deoxyadenosine nucleotides to the 3 ′ end of the purified DNA. It uses terminal transfection and dATP and basically 3 'and 5' RACE kits as recommended (
Boehringer).

The selected and tailed single-stranded DNA molecules were then designed against HRV-5 specific primers (from a known Gag2 region) and synthetic oligo dA tails (provided with the RACE kit). PCR amplification was performed using the primers.

First stage primer: HRV-5 Gag primer (CA2R2) 5′-CTCACCGGTTCATTACAATAGCTGC Anchor-attached primer: 5′-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTTTV (where V is C, G or A) The cycle was 4 minutes, followed by 1 minute and 10 seconds at 94 ° C, 1 minute and 10 seconds at 55 ° C, and 3 minutes and 30 seconds at 72 ° C. 1 μl of the product of the first round was transferred to the second stage.

Second stage primer: HRV-5 Gag primer (CA2R3) 5′-GCTGCCCTGCCATAATTCTTCCTG Anchor primer: 5′-GACCACGCGTATCGATGTCGAC Conditions are: initial denaturation at 94 ° C. for 4 minutes, then 94 ° C. for 1 minute and 10 seconds, 55 ° C. For 1 minute and 10 seconds and 72 ° C. for 3 minutes and 30 seconds for 40 cycles.

The cloning and sequencing of the second stage PCR product established the sequence of an additional region of HRV-5 upstream of Gag2. This area was called Gag3.

Next, using this modified RACE method, two additional fragments of the HRV-5 gag gene were cloned and called Gag4 and Gag5. The Gag4 fragment was amplified from 1 mg of DNA from colon tissue of a patient with ulcerative colitis.

Single primer PCR: HRV-5 Gag primer (CA3R1) 5 '-(biotin) -TCCCACCTGCCTCCACTGCTGTAG Conditions were: initial denaturation at 94 ° C for 4 minutes, then 94 ° C for 1 minute, 62 ° C for 1 minute and 10 seconds. There were 40 cycles of 3 minutes at 72 ° C. Single-stranded extension products were purified using streptavidin-coated magnetic beads as for the Gag3 fragment. A polynucleotide tail was then added as in the case of the Gag3 fragment, but in this case a deoxyguanosine tail was added instead of polyadenosine. Next, the selected and tailed single-stranded DNA molecule was subjected to PCR amplification using HRV-5 specific primers (from a known Gag3 region) and primers designed for synthetic oligo dG tails. Was.

First stage primer: HRV-5 Gag primer (CA3R2) 5′-ACCAGGGGGACGTCTCTATGACTG Anchor-attached primer: 5′-GACCACGCGTATCGATGTCGACCCCCCCCCCCCCCCCD (where D is A, G or T) The cycle was 4 minutes, followed by 1 minute and 10 seconds at 94 ° C, 1 minute and 10 seconds at 55 ° C, and 3 minutes and 30 seconds at 72 ° C. 1 μl of the product of the first round was transferred to the second stage.

Second stage primer: HRV-5 Gag primer (CA3R3) 5′-CTTAGGAATGCGTGAAATTTCCTC Anchor primer: 5′-GACCACGCGTATCGATGTCGAC Conditions were: initial denaturation at 94 ° C. for 4 minutes, then 94 ° C. for 1 minute and 10 seconds, 55 ° C. For 1 minute and 10 seconds and 72 ° C. for 3 minutes and 30 seconds for 40 cycles.

Cloning and sequencing of the second stage PCR product established an additional 45 bp sequence of HRV-5 upstream of Gag3. This area was called Gag4.

Next, this method was repeated to clone the Gag5 fragment.

Single primer for extension reaction (from HRV5 Gag): 5 '-(biotin) -GCATTCAGCCCATAACGGATGATC Conditions were: initial denaturation at 94 ° C for 4 minutes, then 94 ° C for 1 minute, 61 ° C for 1 minute, 40 minutes at 72 ° C for 2 minutes
It was a cycle. Single-stranded extension products were purified using streptavidin-coated magnetic beads as for the Gag3 fragment. Next, a polydeoxyguanosine tail was added as in the case of the Gag4 fragment. Next, the single-stranded DNA molecule to which the tail was added was subjected to PCR amplification using HRV-5-specific primers (derived from the known Gag3 region) and primers designed for the synthetic oligo dG tail. Was.

First stage primer: HRV5 Gag primer (CA4R2) 5′-AAGATGTAGCCAGTGGGCAAGGAG Anchor-attached primer: 5′-GACCACGCGTATCGATGTCGACCCCCCCCCCCCCCCCD (where D is A, G or T) Conditions: Initial denaturation at 95 ° C. for 4 minutes Then, 40 cycles of 1 minute and 10 seconds at 94 ° C., 1 minute and 10 seconds at 55 ° C., and 2 minutes and 30 seconds at 72 ° C. 1 μl of the product of the first round was transferred to the second stage.

Second stage primer: HRV-5 Gag primer (CA4R3) 5′-GTAGCCAAAGAACTCCATTGTCTG Anchor primer: 5′-GACCACGCGTATCGATGTCGAC Conditions were: initial denaturation at 95 ° C. for 4 minutes, then 94 ° C. for 1 minute and 10 seconds, 55 ° C. For 1 minute and 10 seconds and 72 ° C. for 2 minutes and 30 seconds for 40 cycles.

Cloning and sequencing of the second stage PCR product established an additional 170 bp sequence of HRV-5 upstream of Gag4. This area was called Gag5. All three extension products obtained using the modified RACE method were upstream of the ClaI site of the Vectorette PCR product.
460 bp of sequence information was given. The composite sequence of HRV-5 Gag is shown in FIG.

Example 11 Cloning of an Additional HRV-5 Integrase Fragment An additional 260 bp fragment of the HRV-5 integrase gene was cloned using degenerate primers and the RACE PCR cloning method. As described in Example 10 for the Gag3 fragment, 1 mg of DNA from the colon tissue of a patient with ulcerative colitis was added to the RACE primer extension reaction.

Primers for single primer PCR (from HRV-5 pol gene): Primer (INF6bio) 5 ′-(Phiotin) -GTTGCCATAGTTCCAAAGATTCCTG Conditions were: initial denaturation at 95 ° C. for 4 minutes, then at 94 ° C. for 1 minute 1 minute at 61 ° C, 2 minutes at 72 ° C
It was a cycle. Single-stranded extension products were purified using streptavidin-coated magnetic beads as for the Gag3 fragment. Next, a polydeoxyadenosine tail was added as in the case of the Gag3 fragment. Next, the single-stranded DNA molecule to which the tail was added was subjected to PCR amplification using an HRV-5-specific primer (derived from a known Gag3 region) and a primer designed for the synthetic oligo dA tail. Was.

First stage primer: HRV-5 Pol primer (INF6) 5′-GTTGCCATAGTTCCAAAGATTCCTG Anchor-added primer: 5′-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV (where V is C, G or A) The cycle was 4 minutes, followed by 1 minute and 10 seconds at 94 ° C, 1 minute and 10 seconds at 55 ° C, and 2 minutes at 72 ° C. 1 μl of the product of the first round was transferred to the second stage.

Second stage primer: HRV-5 Pol primer (INF7) 5′-GAGCCAATCCCCGTGGCCTTAAAC Degenerate retrovirus integrase primer (IN-GIP1): 5′-YTGKCCYTGKGG
ATTRTARGG (where Y is C or T; K is G or T; R is A or G
The conditions were: initial denaturation at 94 ° C for 4 minutes, then 35 cycles of 94 ° C for 1 minute and 10 seconds, 50 ° C for 1 minute and 30 seconds, and 72 ° C for 1 minute and 20 seconds.

The cloning and sequencing of the second stage PCR product established an additional 260 bp sequence of the HRV-5 Pol gene. This area was called IN2. This region corresponds to nucleotides 4648 to 4693 of the sequence shown in FIG. nt 4941 to 4961 are derived from the degenerate primer IN-GIP1 and may therefore not be the true sequence of HRV5 in this region.

Example 12 Accession Number The plasmid containing the HRV-5 gag, pro and pol genes (pHRV5gagpol 17.1) contains 1
European Collection of Cell Cultu on March 19, 999, under the accession number 9903901
res (ECACC). This plasmid was made from various PCR amplified fragments of HRV-5. Since the sequence shown in FIG. 12 is a consensus sequence for various PCR fragments, plasmid pHRV5gagpol 17.1 has some nucleotide differences from this consensus sequence. These differences are shown in FIG. Applicants unconditionally agree that these materials are publicly available in accordance with the appropriate national laws governing the deposition of these materials (eg, Rules 28 and 28a EPC). If so, Rule 28 (4) EP
An expert response under C is also required.

Bacterial Expression and Antibody Production To develop antisera and monoclonal antibodies (Mabs) for detection of viral proteins in primary tissues and cultures, fragments of the possible gag, pro and pol proteins of HRV-5 Was expressed in the M15 [pREP4] (Qiagen) bacterial host strain using the bacterial expression vector pTrc99A (Pharmacia). This was performed using the PCR amplified region of the appropriate HRV-5 gene. In addition to the gene-specific nucleotides, the 5 'PCR primer also contains six consecutive histidine residues (Ni ²⁺ -NTA resin) sold by Qiagen to facilitate purification of the protein using Ni ²⁺ -containing resin (Ni ²⁺ -NTA resin). His ₆ -tag). The 3 'primer also encodes a 10 amino acid epitope from the human c-myc gene to enable detection of the protein by western blotting using a monoclonal anti-c-myc antibody (9E10) specific for the epitope (Evan et al., 1985, Mol. Cell Biol. 5: 361).
0-3616). In addition to the His ₆ -tag and the c-myc sequence tag, the PCR primers also contained restriction sites to allow cloning into the pTrc99A vector.

The protein was purified using Ni ²⁺ -NTA resin (Qiagen). Overnight cultures of bacteria with subcloned fragments of HRV-5 were grown on Luria Bertani broth supplemented with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). The next day, the culture was diluted 1:10 in fresh antibiotic-containing medium and grown for 1 hour at 30 ° C. (optical density at 600 nm is about 0.6). Next, isopropyl-thio-galactoside (IPTG
; 1 mM) to induce protein expression, and the culture was continued for an additional 90 minutes (OD ₆₀₀
= 0.9). The cells were centrifuged into a pellet, NTA-purification buffer (pH 8.0) (8M urea, 100mM NaH ₂ PO _3, 10mM Tris - HCl) were resuspended in. The cells were then lysed by three freeze-thaw cycles and then sonicated briefly. The clarified lysate was then incubated with Ni ²⁺ -NTA resin at 4 ° C. for 4 hours and then poured into a chromatographic column support (Bio-Rad). Contaminating proteins were washed away with NTA-purification buffer (pH 6.3) containing 25 mM imidazole. Finally, the purified protein was eluted from the resin with NTA-purification buffer (pH 6.3) containing 250 mM imidazole.

A fragment of the HRV-5 protein was also expressed in E. coli and purified using the glutathione-S-transferase (GST) system (Pharmacia). These proteins were used to raise polyclonal antisera in rabbits. These antisera were used as control antibodies for ELISA (described below).

The identity of the purified protein was confirmed by Western blotting using a 9E10 monoclonal antibody specific for the c-myc epitope tag. The protein is then used to raise rabbit polyclonal antisera in a known manner, preferably using affinity purification to improve serum specificity.

Antibody Production A rat monoclonal antibody specific for the HRV-5 protein can be produced. CBH / Cbi rats are immunized four times at 21 day intervals with 100 μg of either PR or RT protein. The third immunization is preferably performed by intraperitoneal administration and the other three immunizations are performed via Peyer's patches. The immunogen is complete Freund's adjuvant (Difco La
After emulsification in bs), the first inoculation is performed and subsequent immunizations are emulsified with incomplete Freund's adjuvant.

Three days after the last immunization, mesenteric lymph node cells were transferred to rat myeloma Y3-Ag 1,2,
3 [Dean et al., 1986, Methods in Enzymology, Vol 121, pp. 52-59].
The resulting hybridoma-derived supernatant is screened for antibodies to the immunizing antigen by ELISA and immunoblotting.

ELISA plates are prepared by coating them with immunizing antigen at a concentration of 1 μg / ml in PBS and incubating at 4 ° C. overnight. The hybridoma supernatant is then screened for binding to the immunizing antigen. After incubation for about 1 hour at room temperature, the plates are washed three times with wash buffer (PBS, 0.1% BSA, 0.05% Tween 20). The bound rat antibody was a horseradish peroxidase-conjugated goat anti-rat immunoglobulin (Se
ralab) for about 1 hour at room temperature for detection. The plate is washed three times with wash buffer to produce a soluble blue end product over 20 minutes and the TM
B (Sigma) detects bound antibody. Upon acidification with a 0.5 M sulfuric acid stop solution, a yellow color develops and is read at 450 nm using a microplate autoreader.

The immunoblot for immunoproteins is probed using supernatants of candidate hybridomas identified by ELISA. The supernatant was used at a dilution of 1: 200 to 1:25, and a goat anti-rat immunoglobulin-horseradish peroxidase conjugate (Harlin Ser.
alab, diluted 1: 2000) and detected by enhanced chemiluminescence (ECL, using reagents supplied by Amersham).

[0169] Murine monoclonal antibodies are also prepared by conventional methods known in the art.

ELISAs and ELISAs for the detection of antibodies to the immunofluorescent HRV-5 protein are developed. Indirect and capture ELISA systems can be generated.

Indirect ELISA (FIG. 8) ELISA plates are coated with recombinant HRV-5 protein or synthetic peptide (50 μl; 5 μg / ml) obtained from HRV-5 protein and incubated at 4 ° C. overnight. The plate is then washed three times with PBS (100 μl per well) and PBS / 2% casein (1
(00 .mu.l / well) for 1 hour at 37.degree. C. and wash again three times with PBS. Test sera and standard control sera (50 μl; prepared in PBS / 0.5% casein) are incubated on the plates at various dilutions for 1 hour at 37 ° C. and the plates are washed three times with PBS. Next, the anti-human alkaline phosphatase conjugate (Sigma 1: 1000 dilution) was incubated on the plate at 37 ° C. for 1 hour, 4 times with PBS, once with PBS / 0.1% Tween 20, and then with PBS. Wash once (100 μl per well for each wash). Early HRV
Conjugates with human IgG and IgM can be used that can distinguish between -5 infection (IgM antibody) and established HRV-5 infection (IgG). For control wells using polyclonal rabbit antiserum or rat monoclonal antibody, use goat anti-rabbit IgG or goat anti-rat IgG conjugate, respectively. Then add alkaline phosphatase substrate (Sigma-104; 50 μl / well) to develop a yellow color and read the yellow final product at 405 nm using a microplate autoreader (BioTek Instruments).

Capture ELISA (FIG. 9) Anti-c-myc monoclonal antibody (9E10, Evan et al., 1985, Mol.
ell. Biol. 5: 3610-1616) (5 μg / ml; 50 μl / well) and incubate at 4 ° C. overnight. The plate is then washed three times with PBS and PBS / 2% casein (100 μl)
1 / well) at 37 ° C. for 1 hour and wash with PBS as above. The recombinant HRV-5 protein is then bound to the plate (as described above for the indirect ELISA) and the plate is washed three times with PBS (100 μl / well). The test serum is then incubated on the plate and detected using an alkaline phosphatase conjugate as described above for the indirect ELISA. Using a capture ELISA increases the sensitivity of the ELISA since minor bacterial contaminants in the recombinant protein preparation will not bind to the 9E10 coated plate.

[0173] All ELISA results are confirmed by immunoblotting.

Human tissue sections are examined by indirect immunofluorescence using an immunofluorescent anti-HRV-5 monoclonal antibody. Tissue sections (6 μm thick) are cut in OCT compound (Miles Diagnostics), fixed in acetone / methanol 1: 1 at -20 ° C, and air-dried. Next, the section
Incubate with 50 μl of diluted test antibody for 30 minutes at room temperature, wash twice with PBS (5 min each) and once with water. The bound antibody was then purified at room temperature using an anti-rat IgG fluorescein isothiocyanate-conjugated antibody (Sigma F1763; 50 μl).
Minute detection. The slides were then washed twice with PBS (5 min each) and once with water, then fixed in glycerol containing 2.5% (w / v) 1,4 diazobicyclo-2.2.2.octane, Observe under UV light.

Materials and Methods Patient Testing was approved by the Riverside Research Ethics Committee (RREC0102),
All participating patients agreed in writing. Synovial biopsies and peripheral blood samples were obtained from patients attending a rheumatic clinic at Charing Cross Hospital (London, UK). Lymph node DNA samples were kindly provided by Dr. Ruth Jarrett (LRF Glasgow). Blood DNA of 37 (17 rheumatoid arthritis, 3 osteoarthritis, 17 normal) was examined.

DNA extraction from tissue samples Synovial biopsy tissue or labial salivary glands were immediately processed and stored at -20 ° C. Each sample was cut into 0.5 to 1 mm ³ pieces with a sterile scalpel, and 200 μl of a lysis buffer (10 mM
Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl ₂ , 0.5% v / v NP40, 0.5% v / v Tween) and proteinase K added at a final concentration of 2 濃度 / ml for 48 hours at 56 ° C. Incubated. Next, heat at 95 ° C. for 15 minutes to inactivate proteinase K.
Centrifugation was performed at 000 × g for 10 minutes. The supernatant was aliquoted and stored at -20 ° C. DNA for PCR
Is appropriate, as described previously (Griffiths et al., J. Virol. 1997,
71: 2866-2872) Demonstrated using primers for single copy gene ERV-3. DTA
DNA was extracted from peripheral blood lymphocytes using the B / CTAB method (Gustincich et al., Biotechniques, 1991, 11: 298-300) and analyzed as described above.

Cloning of Sequence Tag for Sjo-1 Approximately 10 mg of homogenized SS salivary gland lip biopsy was purified using 10% fetal bovine serum supplemented RPMI.
1640 was co-cultured with 10 ⁵ H9 cells (Biological Industries) in. Cultures were passaged twice weekly at a ratio of 1: 8. 14 days later, ultra-Turrax T25 tissue grinder (IKA La
bortechnik) and homogenized on ice at maximum speed. Cell debris,
The cells were removed by centrifugation at 000 × g at 4 ° C. for 10 minutes. The supernatant was then washed at 20,000 xg for 2 hours at 4 ° C.
Re-centrifugation for 0 min to remove mitochondria and other organelles. The resulting supernatant was layered on a linear 20-65% (w / v) sucrose gradient. Boyd et al., Lancet (1989) ii: 814
A sucrose gradient was prepared and run on a Beckman SW28 as described by -817. These were then centrifuged at 100,000 g for 16 hours. 1 ml fractions were collected and from these 20 μl
The RNA solution was collected as follows: 250 μl sucrose, 750 μl RNAzol B (Biotex
Laboratories, Inc., Texas) was added, followed by 125 μl of chloroform. The mixture was then vortexed briefly, incubated on ice for 5 minutes, and centrifuged at 13000 xg for 15 minutes at 4 ° C. Next, add an equal volume of isopropanol and on ice
The nucleic acid was precipitated from the aqueous phase by incubating for 15 minutes. The precipitated RNA was pelletized by centrifugation (13000 g, 4 ° C. for 15 minutes), and the pellet was washed with ice-cold 75% ethanol. Finally, the RNA was resuspended in 20 μl of water.

These solutions were prepared using the degenerate pol primer described by Shih et al., J. Virol. (1989) 63: 64-75, which can amplify a wide range of retroviral sequences. And subjected to reverse transcriptase-polymerase chain reaction (RT-PCR). The product is then purified by standard methods (Sambrook et al., 1989, Molecular Cloning 2nd ed. (Cold Spring Had
rBlue Laboratory press)) using the pBluescript (KS-) plasmid (Stratag
ene) and sequenced using an Applied Biosystems model 373A automated DNA sequencer. A 126 bp clone was obtained and named Sjo-1. Sjo-1
Part of the deduced amino acid sequence from several other retroviral sequences (Genbank and E
Aligned with FASTA search of all MBL databases). Abbreviations and GenEMBL acceptance codes used in FIG. 4 are as follows.

SRV-2 Simian D retrovirus serotype 2 (gb_vi: M16605) MMTV mouse mammary tumor virus (gb_vi: M15122) Jaag Jaagsiekte sheep retrovirus (gb_vi: M80216) RSV Rous sarcoma virus (gb_vi: D10652) HTLV-1 Human T-cell leukemia virus type I (gb_vi: L10341) HIV-1 Human immunodeficiency virus type I (gb_vi: D21166) MoMLV Moloney murine leukemia virus (gb_vi: J02255) Buoyant density 1.15 to 1
Obtained from fractions with .16 g ml ^-1 (typical density of mature retroviral particles). This sequence was not detected in cocultures that had been passaged for over a month. In these experiments, there appeared to be no transfer of the virus. In addition, if co-culture plays a role, it will stimulate the cells producing the virus.

As shown in FIG. 4, the closest homologues of this short region are the D and B retrovirus sequences, namely SRV-2 (simian retrovirus serotype 2) and MMTV (mouse mammary tumor virus). . The aligned regions are too short for this comparison to be meaningful, but are useful in the design of subsequent primers for flanking regions such that they are biased towards the B and D retrovirus families. Was given information. Sjo-1 was not detected in H9 cells not co-cultured with SS salivary gland biopsy. Co-cultures from three individuals (two for primary SS and one for dryness syndrome) were examined. Both SS co-cultures were positive for Sjo-1 RNA, whereas the drought syndrome sample was negative.

Cloning of Large Fragments of Viral DNA Degenerate primers were designed for the active site of the protease (PR) gene of type B and D retroviruses. The PR gene, which encodes the enzyme, contained the second most conserved region of the retroviral genome. The active site has a conserved aspartate-threonine-glycine (DTG) motif, and this information was used in primer design. When these degenerate primers were used together with specific 3 'primers immobilized within the Sjo-1 sequence, virus RN purified on a sucrose gradient
A further 806 bp sequence was amplified from A. These primers are as follows: 1992 (5 'GAGGTCATCCATGTAGTGTAAAATTTG 3') 1784 (5 'TAAAATTTGTACTTTTGGGCACTGCTG 3') 3095 (5 'TAGAYACKGGAGCWGATGT 3') 3096 (5 'IIIITAGAYACWGGRGCMGA 3') where K is G or T, M is A or C, R is A or G, W is A or T,
Y is C or T, and I is inosine.

The synthesis of the cDNA was started with 100 ng of 1992 and then with 200 ng each of 1992 and 3096 on the PC.
Performed in R. The cycle consisted of 25 cycles of 1 minute at 94 ° C, 1 minute at 94 ° C, 1 minute at 50 ° C, 1 minute and 30 seconds at 72 ° C, and a final extension at 72 ° C for 7 minutes. 1 μl of the product of the first round was transferred to a second PCR reaction using 200 ng each of 3095 and 1784. The cycle consists of 25 cycles of [1 minute at 94 ° C, 1 minute at 52 ° C, 1 minute and 30 seconds at 72 ° C], followed by the final extension.
7 minutes at 72 ° C. The nucleotide sequence and deduced amino acid sequence of this clone (designated JC96) are shown in FIG. The two NcoI restriction sites are shown in bold. This fragment was removed to prepare a PCR positive control plasmid (pJC96ΔNco). Nucleotides 1-1
4 and 918-932 were obtained from the degenerate primers used to clone Sjo-1 and JC96 and may therefore not show the true sequence of this component in these regions.

In FIG. 7, the following annotations are made: CH is obtained from the DNA of the submandibular gland of rheumatoid arthritis and secondary SS patients; JC is the gradient fraction from the lip biopsy of primary SS patients RB is R from the gradient fractionated RNA from the spleen of a primary SS patient with B-cell lymphoma.
FD was cloned by RT-PCR from gradient fractionated RNA from parotid gland of non-SS patients; MB was gradient fraction from submandibular gland of non-SS patients The RNA was cloned by RT-PCR.

The differences were mostly single base changes, but there were obvious base insertions and deletions that did not disrupt the ORF. One interesting observation is that most of the differences between the five sequences, unlike the other four, are present in the CH sequences amplified from DNA. A further observation from this data is that the PR ORF of one clone MB is truncated at 39 amino acids. This will render the virus non-viable if not compensated for by the RT ORF opening 39 amino acids earlier in this clone. The length of overlap of the two ORFs is the same. The significance of these observations is currently unknown.

When considering these data, one should be aware of the fact that PCR is notorious for cross-contaminating samples with the products of previous PCR experiments, giving false positive results. This problem is further exacerbated when a nested PCR experiment is performed as in this example. Therefore, care was taken in the previous experiment to avoid false positives using controls and to monitor the occurrence of cross-contamination. Specifically, the following measures were taken: i) Separating all experimental samples by including a water control used in both stages of the nested reaction; ii) Prior to addition of template DNA, the reaction mixture was UV-crosslink; iii) Use a positive control of a different size than the viral sequence. This was done by removing the internal NcoI fragment from the JC96 clone (shown in FIG. 5).

Further Cloning of the Viral Genome From the above data provided by the present invention, "good" biopsies (ie, those with sufficiently high virus content) are required for HRV-5 to be cloned. Clearly there is. After establishing this, we provided further nested PCR primers and sequence data that have been shown to detect proviral DNA in sample tissues. Thus, this factor is present at very low levels in previously tested samples and the conventional methods (eg, cD prepared from infected tissue)
Given the fact that screening NA libraries cannot be used to clone the rest of the virus, the present invention allows those skilled in the art to obtain additional sequence data for HRV-5. Provide materials and methods to do so. First, using the primers disclosed herein or from the sequence data shown in the figures, the inverse PCR method by Silver et al. (Supra), Ochman et al. (Supra) and Triglia et al. (Supra) was performed. Applicable to genomic DNA obtained from infected biopsies. Second, using degenerate PCR primers obtained from other conserved regions of the retroviral genome along with primers specific for HRV-5, the virus adjacent to the sequence data presented herein for HRV-5 was used. The sequence is amplified. Suitable primers are degenerate primers that operate on various retroviral sequences, but they will be biased towards A, B and D type sequences.

By combining these primers with the specific primers described above, the cloned region of the genome can be extended to include all but the long terminal repeat (LTR) and the 3 'portion of env. Rapid 5 'and 3' amplification of cDNA ends (RACE) (
Natl. Acad. Sci. USA 85: 8998-9002), respectively, can be used to clone these regions. The target of these primers may be genomic DNA or RNA containing the HRV-5 sequence, for example, from inflamed joints or blood of SLE or RA patients.

[Brief description of the drawings]

Aspects and embodiments of the present invention will be described by way of example with reference to the accompanying drawings. Further aspects and embodiments will be apparent to those skilled in the art.
All documents mentioned in the text are incorporated herein by reference.

FIG. 1 shows the nucleotide sequence and derived amino acid sequence of the region encoding HRV-5 nucleocapsid and dUTPase. Both strands of the nucleotide sequence of the new sequence are shown, along with the deduced amino acid sequences of the gag and pro genes. Previously announced regions are shown in lower case. Nucleotides 1-26 were derived from the degenerate primer (8532) and may not represent the true sequence of HRV-5 at these positions. Nucleotides 884-907 represent the specific primer 4146, which was also used to amplify this region.

FIG. 2 shows an alignment of the deduced nucleocapsid amino acid sequences of HRV-5 obtained from seven individuals. The sequences shown were aligned with the prototype HRV-5 clone. A dash (-) indicates identity with HRV-5, and a dot (•) indicates a gap introduced into the alignment in consideration of insertion and deletion. The sequence denoted as NC20 was amplified from DNA derived from blood of a rheumatoid arthritis patient. Other sequences (NC2 to NC11) were amplified from DNA derived from blood of SLE patients.

FIG. 3 shows the sequence of the HRV-5 pol gene. Both strands of DNA are shown. Shows the region of HRV-5 pol downstream of the previously published sequence. Previously published sequences are shown in lower case. Note that nucleotides 1877-1896 were derived from the degenerate integrase primer used to clone this fragment and thus may not represent the true sequence of the virus in this region.

FIG. 4 shows the deduced amino acid sequence of the DNA sequence designated Sjo-1 and the alignment of that sequence with other known retroviral sequences, used as a sequence tag.

FIG. 5 is the nucleotide sequence and translation of JC96 showing two open reading frames. The open reading frame for protease (PR) is frame a, and the open reading frame for reverse transcriptase (RT) is frame c.

FIG. 6 shows the sequence data of the combination of FIGS. 1, 2 and 3. The new sequence is shown in uppercase.

FIG. 7 shows a deduced PR and RT amino acid sequence alignment of JC96 clones obtained from five individuals. Note that the JC96 sequence extends 5 'further than the other clones. This is because JC96 was obtained using degenerate primers, whereas other clones were generated using internal specific primers based on the JC96 sequence.

FIG. 8 shows a schematic of an indirect ELISA using a His-myc tagged protein.

FIG. 9 shows a schematic of a capture ELISA using a His-myc tagged protein.

FIG. 10 shows the sequence of a fragment of the HRV-5 gag gene. The nucleocapsid region (described in Example 3 and FIG. 1) is shown in lower case. The remaining sequence was cloned in five steps. The region between the Eco RI site (nucleotide 1205, shown in bold) and the nucleocapsid was cloned by Vectorette PCR. The region between the Cla I site (nucleotide 262, shown in bold) and the Eco RI site was cloned in another Vectorette PCR. Nucleotides 1-461 were cloned in three steps using the rapid cDNA end amplification (RACE) method modified for use with double-stranded genomic DNA.

FIG. 11 shows a CLUSTALW multiple sequence alignment of the HRV-5 CA protein with CA proteins of other B and D retroviruses. It should be noted that, in general, the primary sequence similarity of this protein between different retroviruses is negligible. The most conserved regions are major homology regions (MHR, Craven et al., 1995,
J. Virology, 69: 4213-4227) and is shown in bold. Conserved residues and conservative substitutions are indicated by * and:, respectively.

FIG. 12 shows the complete HRV-5 sequence (gag-pro-pol) sequence.

FIG. 13 shows the deposited HRV5g aligned with the consensus HRV-5 sequence from FIG.
2 shows the sequence of the agpol 17.1 clone. Matches between the two sequences are indicated by (|) and gaps are indicated by dashes (-).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 48/00 A61P 29/00 A61P 19/02 37/06 29/00 C07K 14/15 37/06 16 / 10 C07K 14/15 C12N 7/00 16/10 C12P 21/08 C12N 7/00 C12Q 1/68 Z C12P 21/08 G01N 33/569 H C12Q 1/68 A61K 35/76 G01N 33/569 C12N 15/00 ZNAA // A61K 35/76 A61K 37/02 (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL , PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, L) S, MW, SD, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA , BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO , RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Wise, Robert, Anthony UK Country N 31 S.S. London, Finchley, Cyprus Avenue 25 (72) Inventors, Venables, Patrick, John, Woodgate, England Essex 115, London, Garfield Road 26 (72) Inventors, Boyd, Mark, Thomas United States 19103 Philadelphia, PA 1901 Sanson Street , Apartment 1

Claims (43)

[Claims] 1. A retrovirus comprising the nucleotide sequence of the protease (PRO), polymerase (POL) or GAG gene shown in FIG. 12, or a mutant, mutant or fragment thereof. 2. The retrovirus of claim 1, wherein said PRO, POL or GAG gene of said nucleotide sequence has at least 90% homology to the sequence shown in FIG. 3. A retrovirus comprising the nucleotide sequence shown in FIG. 12, or a variant, mutant or fragment thereof. 4. The retrovirus according to claim 1, wherein the length of the nucleotide sequence is from 20 bases to 1 kilobase. 5. A retrovirus comprising a nucleotide sequence encoding a polypeptide selected from the group consisting of PRO, POL and GAG shown in FIG. 12, or a mutant, mutant or fragment thereof. 6. The retrovirus of claim 5, comprising the nucleotide sequence encoding the GAG polypeptide shown in FIG. 12, or a variant, mutant or fragment thereof. 7. A nucleic acid molecule encoding a polypeptide comprising the amino acid sequence shown in FIG. 12, b) a nucleic acid molecule encoding a fragment of the polypeptide comprising the amino acid sequence shown in FIG. Wherein the fragment comprises at least 15 contiguous amino acids of the amino acid sequence shown in FIG. 12, and the fragment comprises nucleotide bases 2404 and 3317
C) a nucleic acid molecule encoding a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence shown in FIG. 12, and having the sequence shown in FIG. 12, or a complement thereof. A) a nucleic acid molecule that hybridizes under stringent conditions to d) a nucleic acid sequence that is at least 80% identical to the nucleotide sequence shown in FIG. 12 or a complement thereof, e) a nucleotide sequence shown in FIG. A nucleic acid molecule comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleic acid molecule or a complement thereof; f) hybridizes under stringent conditions to a nucleic acid molecule consisting of the nucleotide sequence shown in FIG. A) a nucleic acid molecule comprising the nucleotide sequence of a base or its complement; g) a plasmid deposited with the ECACC as accession no. Nucleotide nucleic acid molecule comprising a nucleotide sequence or the complement thereof which hybridizes under stringent conditions to the nucleic acid molecule consisting of the sequence, the nucleic acid is selected from the group consisting of molecules of the insert of bromide pHRV5gagpol 17.1. 8. The following nucleotide sequence: (Where N is any nucleotide) a nucleic acid molecule consisting of a nucleotide sequence selected from the group consisting of: 9. A nucleic acid molecule comprising a nucleotide sequence derived from the retrovirus of claim 1. 10. The following polypeptides: a) a polypeptide comprising the amino acid sequence shown in FIG. 12, b) a fragment comprising at least 15 contiguous amino acids of the polypeptide sequence shown in FIG. Nucleotide base 2404 and nucleotide base 33 shown in 12
Said fragment not encoded by the nucleotide sequence between 17), c) a polypeptide sequence comprising the amino acid sequence shown in Fig. 10, d) a fragment comprising at least 15 consecutive amino acids of the polypeptide sequence shown in Fig. 10, e An isolated polypeptide selected from the group consisting of: a polypeptide comprising an amino acid sequence encoded by the nucleic acid sequence according to claim 7. 11. The nucleic acid molecule of claim 7, which encodes a viral antigen. 12. A viral antigen comprising an amino acid sequence encoded by the sequence according to claim 11. 13. An antibody binding domain which is specific for an antigen comprising at least one epitope derived from a PRO, POL or GAG polypeptide of the retrovirus according to any one of claims 1 to 6. 14. The antibody binding domain of claim 13, wherein the at least one epitope is from a GAG polypeptide capsid protein (CA). 15. The antibody binding domain according to claim 13, which is a monoclonal antibody. 16. A method for detecting a retrovirus according to any one of claims 1 to 6 in a sample, wherein a predetermined nucleotide sequence is amplified from the virus using a DNA or RNA amplification method. Detecting the predetermined sequence, wherein the DNA or RNA is derived from the nucleotides shown in FIG. 12, but is not the nucleotide sequence between nucleotide base 2404 and nucleotide base 3317 shown in FIG. 12,
The above method. 17. The method of claim 16, wherein said predetermined sequence comprises the sequence shown in FIG. 12 or a fragment thereof. 18. The method of claim 16, wherein said predetermined sequence encodes the amino acid sequence shown in FIG. 12 or a fragment thereof. 19. The method of any one of claims 16 to 18, wherein the DNA or RNA amplification method is performed using a series of nested primers. 20. A method for detecting a retrovirus according to any one of claims 1 to 6 in a sample, wherein a predetermined nucleotide sequence is amplified from the virus using a DNA or RNA amplification method. Detecting the predetermined sequence, wherein the DNA or RNA comprises: The above method, which is a primer selected from the group consisting of: 21. A virus isolation assay for detecting the presence of a retrovirus according to any one of claims 1 to 6 in a sample, wherein the virus present in the sample is co-cultured with a target cell line. A virus isolation assay as described above. 22. The virus isolation assay of claim 21, wherein the sample is digested with trypsin or homogenized with a mortar and pestle and then placed into a flask containing about 10 ⁵ to 10 ⁶ target cell lines. . 23. The virus isolation assay of claim 21 or 22, wherein said target cell line is selected from T and B lymphocytes, fibroblasts and epithelial cells. 24. A method for detecting an antibody against the retrovirus viral polypeptide according to any one of claims 1 to 6, wherein the amino acid sequence is encoded by the nucleotide sequence according to claim 11. A method comprising detecting an antibody. 25. The method of claim 24, comprising an ELISA. 26. The amino acid sequence comprising a viral antigen, wherein the viral antigen is immobilized on a support by affinity-purified antiviral antigen serum.
The method according to claim 24 or 25. 27. The viral antigen comprises a recombinant viral antigen.
27. The method according to any one of claims 26 to 26. 28. A screening method for detecting an agent effective for inhibiting replication of a retrovirus according to any one of claims 1 to 6, wherein the virus is cultured in the presence of a candidate agent. And subsequently detecting the presence of the retroviral particle. 29. A method for preparing a pharmaceutical preparation for treating a disease associated with a retrovirus according to any one of claims 1 to 6, wherein (a) a candidate compound and a host containing the retrovirus. (B) selecting a compound that blocks the retrovirus identified in step (a); (c) producing a large amount of the compound selected in step (b); )), Wherein the compound produced in (1) is formulated with a pharmaceutical carrier. 30. A pharmaceutical composition for treating a disease associated with a retrovirus according to any one of claims 1 to 6, comprising the nucleic acid molecule according to claim 7 and a pharmaceutically acceptable carrier. 31. A pharmaceutical composition for treating a disease associated with a retrovirus according to any one of claims 1 to 6, comprising the polypeptide according to claim 10 and a pharmaceutically acceptable carrier. 32. A pharmaceutical composition for treating a disease associated with a retrovirus according to any one of claims 1 to 6, comprising the antibody according to claim 13 and a pharmaceutically acceptable carrier. 33. The retrovirus according to any one of claims 1 to 6, comprising an effective amount of the drug identified by the screening method according to claim 28 and a pharmaceutically acceptable carrier or diluent. Pharmaceutical composition for treating a treated disease. 34. A method for treating a disease associated with the retrovirus according to any one of claims 1 to 6, wherein (a) an inhibitor of reverse transcription, (b) a protease inhibitor, (c) Administering an effective amount of a retroviral replication inhibitor selected from the group consisting of: an integrase inhibitor, (d) a dUTPase inhibitor, (e) an antiviral drug, and (f) the antibody of claim 14. The method comprising. 35. The method of claim 34, wherein the reverse transcription inhibitor is an antisense nucleotide sequence derived from the nucleotide sequence shown in FIG. 36. The method of claim 34, wherein said inhibitor is a chain terminator. 37. The method of claim 35 or 36, wherein said disease is an autoimmune disease. 38. A method for raising an immune response in a mammalian subject, comprising administering the viral antigen of claim 12 to the mammalian subject. 39. A vector for gene therapy, comprising the disabled virus according to any one of claims 1 to 6. 40. A method for detecting a viral protein expressed by a retrovirus according to any one of claims 1 to 6 in a sample, wherein the sample is contacted with the antibody according to claim 12, A method comprising detecting binding of an antibody to a candidate viral protein. 41. A kit for detecting a retrovirus according to any one of claims 1 to 6 in a sample, wherein the kit is derived from the nucleic acid sequence shown in FIG. A kit comprising a nucleic acid primer that is not derived from a nucleotide sequence between nucleotide bases 2404 and 3317. 42. It has a sequence corresponding to a portion of the nucleotide sequence shown in FIG. 12 or a sequence complementary thereto, but the nucleotide sequence between nucleotide bases 2404 and 3317 shown in FIG. A kit comprising a pair of oligonucleotide primers. 43. A kit for detecting the presence of a retrovirus according to any one of claims 1 to 6 in a sample, wherein the kit comprises at least one polypeptide derived from a PRO, POL or GAG polypeptide. A solid support on which the antibody-binding domain according to any one of claims 13 to 15 is capable of binding specifically to a polypeptide containing two epitopes, and a sample poly-body bound to the antibody-binding domain. A kit comprising a label for marking the presence of a peptide or the presence of an antibody binding domain that is not bound to a sample polypeptide.