JP2002508177A - Novel gene called oligofrenin 1, its expression product and its diagnostic and therapeutic use - Google Patents

Abstract

  (57) [Summary] The present invention relates to the identification of a novel gene, designated Olofrenin 1, its expression products, and the diagnostic and therapeutic use of such nucleotide and peptide sequences.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] The present invention relates to the identification of a novel gene, called oligofrenin 1, and its expression products, and the therapeutic use of such nucleotide and peptide sequences.

[0002] The identification of new causes of mental retardation, present in about 3% of individuals but of which the majority is unknown, is a notable challenge to human genes. X-linked mental retardation is recognized as a major cause of severe learning disabilities. Researchers have shown that men have more severe mental retardation than women, and recent studies suggest that this is a consequence of an X-linked condition. X-linked mental retardation (XLMR) is a diverse group of disorders, which are broadly symptomatic (MRXS) or nonspecific (MRXS).
X). Families with symptomatic disorders have significantly different phenotypic presentations, while those with non-specific disorders do not display distinct physical characteristics. FMR1 involved in MRXS state (Verkerk et al., 1991), FRAXE (Knight et al., 1993; Gecz et al. 1996), L1-CAM (Vits et al., 1994), FGD1 and XH2
Despite recent advances in gene identification such as (Gibbons et al., 1995), MR
Genes significantly involved in X have not yet been identified or cloned. Stacks of papers and McKusick's catalog data indicate at least 95 X-linked disorders in which mental retardation is recognized as a major feature. Forty of these 95 cases were localized mapped on the X chromosome by performing linkage studies utilizing DNA markers in a single large family or family population with the same XLMR syndrome. Some loci appear to be in the proximal Xq region. However, it is not possible to determine how many MR genes are actually present, in part due to the size of the location and the presence of multiple overlaps between the allocated intervals. Thus, detailed mapping and identification of genes involved in non-specific X-linked MR essentially relies on exhaustive studies of molecular abnormalities such as equilibrium translocations, inversions or continuous gene deletions associated with MR.

[0003] Bienvenu et al. (1997) reported a molecular and cellular genetic study of the X; 12 equilibrium translocation recently observed in women affected by mild mental retardation, and
The position of the breaking point in No. 2 was determined.

[0004] We have now cloned the genes that govern MRX and refer to them as the oligofrenin 1 gene.

To determine the genomic structure of this gene, the inventors constructed and studied a cosmid / phage contig covering this gene. Determination of exon-intron boundaries was performed through sequence comparison of cDNA clones with genomic DNA, which led to the identification of 25 exons.

The present inventors have thus isolated and characterized the oligofrenin-1 transcript. Such a transcript contains an open reading frame (ORF), which is encoded by exons 2-24. This ORF is 2406 bases in length and 80
It encodes a two amino acid protein, the so-called oligofrenin 1 protein.

The object of the present invention is thus to provide the sequence SEQ ID No. 1 to SEQ ID No
. An isolated nucleic acid sequence having a sequence selected from the group consisting of:

[0008] SEQ ID No. 1 is 5 ′ of the genomic DNA of the human oligofrenin 1 gene
Indicates a fragment.

[0009] SEQ ID No. 2 to SEQ ID No. Reference numeral 25 denotes a fragment of the genomic DNA of the human oligofrenin 1 gene containing the exons shown in Table 1.

[0010]

[Table 1]

[0011] SEQ ID No. 26 indicates a cDNA fragment corresponding to the common open reading frame (ORF).

An object of the present invention is also an isolated nucleic acid having a sequence selected from the group consisting of exons 1 to 25 specified in the Sequence Listing and Table 2, and a homologous nucleotide sequence thereof.

[0013]

[Table 2]

“Homologous nucleotide sequence” means a sequence that differs from the referenced sequence by mutations, insertions, deletions or substitutions of one or more bases.

Preferably, the homologous sequence is SEQ ID No. 1 to SEQ ID N
o. At least 70% homology to any of the 26, preferably 80% homology,
More preferably, it shows 90% homology.

The polynucleotide of the present invention having a homologous sequence has a homologous sequence that hybridizes under the stringent conditions, preferably under stringent conditions, to the mentioned sequence (any of SEQ ID No. 1 to SEQ ID No. 26). The parameters defining stringency conditions depend on the temperature (Tm) at which 50% of the annealed strands separate.

For sequences comprising more than 30 nucleotides, the Tm can be calculated as follows. Tm = 81.5 + 0.41 (% G + C) +16.6 Log (cation concentration) -0.
63 (% formamide)-(600 / polynucleotide base pair size) (Sambro
ok et al., 1989).

For sequences comprising less than 30 nucleotides, Tm can be calculated as follows: Tm = 4 (G + C) +2 (A + T)

Under appropriate stringency conditions to avoid hybridization of non-specific sequences, the hybridization temperature is 5 ° C. to 30 ° C., preferably 5 ° C. to 10 ° C. below the calculated Tm, and the hybridization buffer used The solution is preferably a solution having a high ionic strength, for example an aqueous 6 × SSC solution.

[0020] SEQ ID No. The nucleotide sequence homologous to the open reading derived from No. 26 refers to a mutation or insertion of one or more bases with one or more bases as long as it encodes a polypeptide having the biological activity of the oligofrenin 1 protein as defined below. A nucleotide sequence that differs by deletion or substitution, or that differs by the degeneracy of the genetic code.

The homologous sequence preferably includes a mammalian gene encoding a primate, bovine, ovine, porcine or rodent oligofrenin 1 protein and allelic variants thereof.

The nucleic acid sequences of the present invention are useful for detecting abnormalities, such as mutations, in the oligofrenin 1 gene or transcript of the oligofrenin 1 gene. Such an analysis allows for an in vitro diagnosis of the neuropathy associated with said abnormality.

An object of the present invention is a method for in vitro diagnosis of a neuropathy associated with an abnormality in the oligofrenin 1 gene or a transcript of the oligofrenin 1 gene, wherein one or more of the methods preferably induces alteration in the expression of the oligofrenin 1 gene. Are detected in the oligofrenin 1 gene or transcript of the oligofrenin 1 gene.

A further object of the present invention is to provide SEQ ID No. 26 or a homologous sequence thereof, with the proviso that SEQ ID NO. Nucleotide 1 as shown in 26
578 is a nucleic acid having a single base deletion.

The present invention relates to an in vitro diagnostic method, wherein the nucleic acid sequence of the present invention or a probe or primer derived therefrom is used for detecting abnormal synthesis or gene abnormality at the oligofrenin-1 gene level.

The present invention more particularly relates to an in vitro diagnostic method, which comprises contacting a biological sample containing DNA with a specific oligonucleotide which allows the amplification of the whole or part of the oligofrenin 1 gene. The DNA contained in the sample is suitably hybridizable, and the contacting is carried out under conditions in which hybridization of the primer with the DNA contained in the biological sample occurs. Amplifying said DNA; detecting said amplification product; comparing the resulting amplification product with the amplification product obtained from a normal control biological sample; thus a possible abnormality in the oligofrenin 1 gene; Detecting.

[0027] The method of the present invention comprises converting mRNA contained in a biological sample to, for example, RT-P.
By amplifying by CR, it can be applied to detection of abnormalities in the transcript of oligofrenin 1 gene.

Thus, another subject of the present invention is the aforementioned in vitro diagnostic method, which produces cDNA from mRNA contained in a biological sample; Contacting a part of the specific oligonucleotide capable of being amplified with a primer under conditions where hybridization between the primer and the cDNA is performed; amplifying the cDNA; detecting the amplified product; Comparing the amplification product obtained with a normal control biological sample, thus detecting possible abnormalities in the transcript of the oligofrenin 1 gene;

The comparison of the amplification product obtained from the biological sample with the amplification product obtained from a normal biological sample can be carried out, for example, by hybridization of a specific probe, sequencing or restriction site analysis.

An object of the present invention is also a nucleic acid sequence that specifically hybridizes to the above-described nucleic acid sequence of the present invention or its complementary sequence.

By “sequence that specifically hybridizes to [...]” is meant a sequence that hybridizes under high stringency conditions with the recited sequence (Sambrook et al., 1989).
. Such a sequence is preferably an oligonucleotide having at least 15 and more preferably at least 20 bases.

Such sequences useful as primers or probes for the diagnostic method according to the present invention are preferably those of SEQ ID No. 2 to SEQ ID No
. Selected from the group consisting of 26 nucleic acid fragments or their complementary sequences.

[0033]

[Table 3]

Those skilled in the art are familiar with standard methods for analyzing DNA contained in biological samples and diagnosing genetic disorders. Numerous strategies for genotype analysis are useful (Antonarakis et al., 1989, Cooper et al., 1991).

Preferably, a DGGE method for detecting an abnormality in the oligofrenin 1 gene (
Denaturing gradient gel electrophoresis) or the SSCP method (single-stranded conformation polymorphism) can be used. Preferably, such a method is followed directly by sequencing. RT-PCR
The method is preferably used to detect abnormalities in the oligofrenin 1 transcript, since it makes the results of splicing mutations such as exon skipping or aberrant splicing based on activation of cryptic sites visible. Preferably, this method is also followed by direct sequencing. Recently developed techniques utilizing DNA chips can also be easily implemented to detect abnormalities in the oligofrenin 1 gene (Bellis et al., 1997).

The cloning of the oligofrenin 1 gene and the identification of the various mutations responsible for the neuropathy according to the invention allow a direct or semi-direct diagnosis. The specificity and reliability of such diagnostic methods are greatly appreciated in prenatal diagnosis. The nucleic acid sequences of the present invention are a very interesting tool for gene counseling.

The present inventor has reported that the oligofrenin 1 protein is a rho-GAP protein,
They have shown that constitutive loss of oligofrenin 1 activity in humans leads to cognitive impairment. Deficiencies in the oligofrenin 1 gene or oligofrenin 1 gene product can cause inactivation of the oligofrenin 1 protein, which results in constitutive activity of its target GTPase.

[0038] Such constitutive activation of rho family members provides significant changes in certain actin-based processes. Alter the cytoskeleton in cultured cells (Nobes et al., 1995
), And have been shown to affect cell migration and axonal outgrowth in vivo (Luo et al., 1994). Furthermore, this constitutively active Rac1 rho-GT
Pase is a neuropathological change in transgenic mice, such as mouse P
Produce extraaxonal growth and dendritic spine morphogenesis in urkinje cells (Luo
Et al., 1996).

Similarly, rho-GTPa derived from the loss of function of the oligophrenin 1 protein
Constitutive activation of se results in failure of signaling pathways involved in cell migration and extraaxonal growth during nervous system development. Mental retardation can be a clinical manifestation of such neuropathological changes.

The oligofrenin 1 gene may thus be involved in disorders due to abnormal neuronal migration. Such disorders include but are not limited to genetic disorders such as non-specific X-linked mental retardation, as well as incurable epilepsy and neurodegenerative disorders such as Alzheimer's disease and cognitive disorders associated with aging.

The present invention further provides a transgenic non-human animal or cell thereof.

[0042] Such a transgenic animal is capable of transforming the exogenous oligofrenin 1 protein of the present invention based on the presence of a gene encoding and expressing the protein or a part thereof,
Can have.

Transgenic animals and methods for their production are generally well known.

The present invention contemplates non-human animals, ie, transgenic animals, preferably transgenic mammals, that contain the oligofrenin 1 gene of the present invention integrated into the genome of the somatic and germ cells of the animal.

Animals containing the transgene encoding the oligophrenin 1 protein of the invention are typically prepared using standard transgenic techniques described by Hogan et al. (1987) and Palmiter et al. (1986). Transgenic animal production is based on Capecchi (19
89), using the homologous recombination transgenic system. The production of transgenic mammals is also described in WO 94/21670. One technique for transgenically modifying a mammal involves microinjecting rDNA into the male pronucleus of a mammalian fertilized egg, wherein one or more copies of this RNA are introduced into the cells of a developing mammal. Is to be held in

Another method for producing a non-human mammal containing the rDNA of the present invention includes fertilized eggs, embryo-derived stem cells, and totipotent embryonic carcinoma (Ec)
) Includes infection of cells or early dividing embryos (Palmiter et al., (1986)).

The transgenic animal may have a mutation in its own native oligofrenin 1 gene, and thus the oligofrenin 1 protein may be non-functional (ie, a “knock-out” transgenic animal). Such animals are useful because they exhibit clinical symptoms associated with a defect in the mutant oligofrenin 1 protein and further serve as a model for the evaluation of candidate therapeutics to treat subjects with defects in this protein. Because it is.

More specifically, transgenic non-human animals or cultured cells (knockout transgenic animals) that overexpress or preferably render a native oligofrenin 1 protein overexpressed or non-functionalized are rho-G
It may be useful in methods for screening chemicals or drugs that can act on the signal generation pathway to which the AP ^MRX protein (oligofurenin) belongs.

[0049] The transgenic non-human animal or cell overexpressing the oligofrenin 1 protein refers to an animal or a cell thereof expressing the exogenous oligofrenin 1 protein of the present invention in addition to the natural protein.

In one embodiment, the screening method of the present invention comprises: i) the agent to be tested is a transgenic non-human that overexpresses the oligofrenin 1 protein or expresses a naturally-occurring non-functionalized oligofrenin 1 protein Administering to the animal; and ii) observing the clinical manifestation of neuronal changes in in vivo and / or in vitro cultured neurons from the animal and observing the stimulation or recovery of extraaxonal growth or morphogenesis; Comprising the steps of:

In another embodiment, the screening method of the invention comprises the steps of: i) converting the agent to be tested into a neural cell or neural expressing a natural oligofrenin 1 protein overexpressing or preferably rendered non-functional. Contacting the tissue culture; ii) measuring axonal outgrowth;

[0052] In the above embodiments, such cells may be, for example, the transgenic animal transfected with a DNA construct by, for example, a viral vector that allows expression of an exogenous oligofrenin 1 protein or renders native oligofrenin 1 nonfunctional. Or obtained from primary cultures of established cells, such as neuroblastoma or neuronal cells.

The present invention also includes a drug selected by the above-described screening method, and a pharmaceutical composition containing such a drug together with a pharmaceutically acceptable carrier.

According to the present invention, SEQ ID No. OR of the oligofrenin 1 gene shown in 26
F encodes a 802 amino acid protein with a relative molecular weight of 91 kD. Hydrotherapy analysis (Kyte and Doolittle, 1982) suggests that the oligofrenin 1 protein is hydrophilic. Based on a common motif in the PROSITE database (Bairoch et al., 1997), a number of potential phosphorylation sites were estimated, including the tyrosine kinase phosphorylation site at position 142. Comparison of this protein with other sequences in the database suggested that the oligofrenin 1 gene encodes a rho-GAP containing protein.

The sequence alignment shown in FIG. 3 b shows that the putative oligofrenin 1 domain and rho-
It shows significant similarities with other members of the GAP subfamily. This similarity extends to a 180 residue region located in the central part of the putative protein, and
There are three possible structurally conserved regions (SCRs) specific for the o-GAP protein.

Of the rho-GAPs, the oligofrenin 1 protein showed the greatest similarity to the chicken Graf protein (Hildebrand et al., 1996). This similarity is r
Spread on both sides of the ho-GAP domain, oligofrenin 1 does not contain the SH3 domain reported for the Graf protein. The rho-GAP activity of the oligofrenin 1 protein was consistent with a functional analysis of the chicken Graf protein having both the N-terminus and the portion of the rho-GAP domain identified in the oligofrenin 1 protein. Graf protein is GTP binding protein Rh
It was shown to preferentially stimulate GTPase activity of oA and Cdc42 (Hi
ldebrand et al., 1996).

The C-terminal part of the oligofrenin 1 protein does not match any known sequence, whereas the N-terminal domain of the oligofrenin 1 protein has a C. Elegance (C. elegans)
, Similar to a highly conserved protein of unknown function identified in mouse and human (FIG. 3c). This protein shows two isoforms identified as CELZK328 and CELTO4C95 (Genbank) corresponding to the two ORFs.

A further object of the present invention is thus to provide SEQ ID No. 27. An isolated oligofrenin 1 polypeptide substantially comprising the amino acid sequence of SEQ ID NO: 27 or a homologous amino acid sequence thereof.

The term “substantially” means that the isolated oligofrenin-1 polypeptide exhibits the same biological and / or immunological properties as the native oligofrenin-1 protein.

More specifically, the amino acid sequence has SEQ ID No. 26 or a homologous amino acid sequence thereof.

A “homologous amino acid sequence” refers to a sequence as referred to by mutation, insertion, deletion or substitution of one or more amino acids without inducing alteration in biological and / or immunological properties. Mean different sequences. This derived amino acid sequence is shown in SEQ ID N
o. Shows at least 60% homology, preferably 70% homology, preferably 80% homology with the 26 oligophrenin 1 polypeptides.

“Biological properties” of the polypeptides of the present invention refer to the activity of the oligophrenin 1 protein to enhance the GTPase activity of small Ras-like GTPases and thus turn them off.

“Immunological properties” of a polypeptide of the invention refer to the ability of the polypeptide of the invention to induce an immunological response mediated by an antibody that recognizes an Oligofrenin 1 polypeptide of the invention. .

The polypeptide according to the invention can be obtained by any standard method for the purification of soluble proteins, by peptide synthesis or by genetic engineering. This technique involves inserting a nucleic acid sequence encoding a peptide of the invention into an expression vector, such as a plasmid,
And transformation of host cells with this expression vector by any method useful to those of skill in the art, such as, for example, electroporation.

Thus, the invention relates to a vector for cloning and / or expression comprising a nucleic acid sequence according to the invention, and a host cell transfected with such a vector. An expression vector according to the present invention comprises a nucleic acid sequence encoding a polypeptide of the present invention, wherein the nucleic acid sequence is operably linked to an element that enables its expression. The vector advantageously contains promoter sequences, signals for initiation and termination of translation, and appropriate regions for control of translation. Its insertion into the host cell may be transient or stable. Such vectors may also contain specific signals for secretion of the translated protein.

The various control signals are selected according to the host, and can be inserted into a vector that replicates autonomously in the selected host or into a vector that integrates into the genome of the host.

The host cells can be prokaryotic or eukaryotic, and include, but are not limited to, bacteria, yeast, insect cells, mammalian cells, eg, commercially available cell lines.

An object of the present invention is also a method for producing a recombinant oligofrenin 1 polypeptide, wherein the host cell is transfected with the expression vector and the expression of the polypeptide of the present invention is possible. Culture under the following conditions.

The present invention further relates to a monoclonal or polyclonal antibody capable of specifically recognizing the polypeptide of the present invention, or a fragment thereof, or a chimeric or immunoconjugate antibody thereof.

Polyclonal antibodies can be obtained from the sera of animals immunized against oligofrenin 1, which has been produced by genetic engineering as described above according to standard methods well known to those skilled in the art. May be.

[0071] Monoclonal antibodies can be obtained according to standard methods of hybridoma culture (Kohler and Milstein, 1975).

The antibodies of the present invention may be chimeric, humanized, or antigen-binding fragments Fab and F (ab ′) 2. This may be an immunoconjugate antibody or a labeled antibody.

The antibodies are very useful for detecting or purifying the oligofrenin-1 polypeptide of the present invention in a biological sample.

These are extremely useful for detecting abnormal expression of oligofrenin 1 protein associated with the above-mentioned neuropathy.

Another object of the present invention is to provide a purified oligofrenin 1 polypeptide of the invention and / or
Or a homologous polypeptide thereof together with a pharmaceutically acceptable carrier.

A further object of the present invention is a pharmaceutical composition comprising a nucleic acid encoding said polypeptide and a pharmaceutically acceptable carrier. Such nucleic acid, preferably inserted into a vector, may be administered in naked form or together with a transfection facilitating agent.

A further object of the present invention is a pharmaceutical composition comprising an antisense sequence capable of specifically hybridizing to a nucleic acid sequence encoding said polypeptide together with a pharmaceutically acceptable carrier.

A further object of the present invention is a pharmaceutical composition comprising an antibody specific for said antibody together with a pharmaceutically acceptable carrier.

Preferably, the present invention relates to a pharmaceutical composition comprising a purified oligofrenin 1 polypeptide of the invention and / or a homologous polypeptide thereof together with a pharmaceutically acceptable carrier.

The term “homologous polypeptide” as the active ingredient of a pharmaceutical composition means a polypeptide having at least 40%, preferably at least 60%, homology as compared to the oligofrenin 1 protein. Such homologous polypeptides include rho-GA
Any known protein that exhibits P activity is included. Preferably, such a homologous polypeptide is, for example, the protein CELZK328 or CELTO4C95.

The pharmaceutical composition of the present invention is useful for preventing and / or treating a neuropathy involving the oligofrenin 1 protein or a homologous protein thereof. As outlined, the inventors have determined that defects in the Ras-like GTPase (rho-GAP) -dependent signaling pathway are associated with cognitive deficits due to misdirected axonal growth and / or poor cell migration. Indicated. Accordingly, disorders that are more likely to be responsible are disorders of the central nervous system associated with axon development, more specifically disorders associated with cognitive impairment. Such disorders include nonspecific X-linked mental retardation, and epilepsy or neurodegenerative disorders of unknown origin, such as cognitive deficits associated with Alzheimer's disease and aging.

Another subject of the present invention is that the purified oligofrenin 1 polypeptide of the present invention and / or
Another object of the present invention is to utilize a homologous polypeptide thereof together with a pharmaceutically acceptable carrier for the manufacture of a medicament for preventing and / or treating a neuropathy involving the oligofrenin 1 protein or a homologous protein thereof.

The pharmaceutical compositions of the invention may be used in mammals, preferably humans, in need of such treatment.
The subject may be administered according to a dose which can vary widely as a function of the age, weight and health of the subject, the nature and severity of the affliction, and the route of administration.

Suitable dosage unit forms are oral forms, such as tablets, gelatin capsules, powders, granules and oral suspensions or solutions, sublingual and buccal dosage forms, subcutaneous, intramuscular, intravenous, intranasal or intraocular Dosage forms and rectal dosage forms are included.

A further object of the present invention is a method for preventing and / or treating a neuropathy resulting from a defect in the oligofrenin 1 gene or oligofrenin 1 protein or homologous gene or protein, which method requires such treatment. Administering an effective amount of a pharmaceutical composition as described above to prevent and / or alleviate the neuropathy of the subject.

Without limiting the invention, it is further illustrated by the figures and the examples below.

Example 1 Identification of Oligofrenin 1 Gene: Experimental Procedures Case Reports and Family Materials Clinical data and diagnoses for female patients with the t (X; 12) translocation have been published (Luo et al., 1996). Linkage study on The Euro for MRX family
Reported in the pean XLMR Consortium report (1997).

YAC and PAC clones A YAC clone at the Xq12 locus was obtained from the UK HGMP Resource Centre. PA
C clone was obtained from the German resource center (RZPD). The primer sequence corresponding to STS can be obtained from Genome Data Base. STSC16T3 is a 189 bp fragment amplified with the following primers: C16T3F (5 'CAC
AGCAAGCAATAAGCACT 3 ') and C16T3R (5' TGTCTCCTGTGCTCTTTCCA 3 '). Duplication between clones and mapping of STS was performed by a combination of STS / EST amplification and hybridization approaches.

[0089] about 1 × 10 ⁶ recombinant clones of the cDNA of the isolated lgt 10 human fetal brain cDNA library (Clontech) were plated according to standard techniques and screened (Sambrook et al., 1989). Library screening was performed using RT-PCR products generated with primers located within the putative exons as probes. Positive clones were plaque purified and the insert was bluescript
The vector was subcloned into the vector and sequenced. 3'RACE P
CR (Clontech kit) was used to access the 3 'end of the cDNA. The full-length cDNA consists of 14 clones (only 4 clones are shown in FIG. 1a).

Genomic DNA Sequencing of Human Cosmid Clones Human cosmid clones were detected in the Flowsort human X chromosome library of the Imperial Cancer Research Fund (ICRF) (Nizetic et al., 1991) using B2 cDNA as a probe. Cosmids 2C6, 4D2 and 35 shown in FIG.
It is derived from a cosmid library corresponding to AC4690. Exon-intron boundaries were identified through sequence comparison of cDNA and genomic DNA clones. To prepare a genomic sequence, cosmid clone DNA was used as a template and primed with exon oligonucleotides. I of the cosmid clone shown in FIG.
The CRF coordinates are as follows: cos12: ICRFc104J1515Q8, cos15: ICRFc104K
1628Q8, cos7: ICRFc104P0212Q8, cos3: ICRFc104B1719Q8, cos11: ICRFc104
F178Q8, cos5: ICRFc104B1515Q8.

[0091] 2. Results As a first step in identifying potential genes in Xq12 involved in MRX, Bi
Envenu et al. (1997) report a molecular cytogenetic study of the X; 12 equilibrium translocation observed in women affected by mild mental retardation. Xq break points were determined for PGKP1 and DXS15.
ICRF 850 kb YAC clone y900 positive for 9 markers
HO493 (4690).

The present inventor has determined that for a regionally detailed mapping of the X chromosome break, the YAC clone 4690 long-range restriction map, FISH analysis, and somatic hybrids containing the derived chromosome 12 as its only human X chromosome component. A cell line was utilized. FIG. 1a shows a normal X
The location of the upper translocation break is shown, and the YAC, PAC and cosmid contigs across that break are summarized. A probe STSC that detects the connecting fragment and locates this break point on a 9 kb HindIII fragment (FIG. 1b).
16T3 was isolated from cosmid clone 4D2 (FIG. 1a). Abnormal bands confirming this latter result were also obtained by hybridization to DNA from the subject digested with some other enzymes of the probe.

Sequencing of a randomly subcloned HindIII fragment containing a 9 kb fragment isolated from a cosmid clone that straddled this break and a search for homology in the database was performed using the isolated sequence and Sanger Center (C
ambridge, UK), corresponding to PAC clone 360E18 (
Sequence identity with Figure 1a) was shown. The useful sequences were then used for computer analysis and for comparing nucleotide and protein sequences. GRAI
Some of the potential exons identified by the L (Kel et al. 1993) and FEXH / HEXON (Lerman et al., 1987) programs showed significant homology with mouse EST483210. The putative polypeptide corresponding to this EST is human EST387042 on chromosome 11 and C.I. It showed significant homology with Elegance ORF CELTO4C95. Further studies are in C.I. The Elegance ORF was suggested to be on the genomic sequence derived from the PAC clone with eight potential exons spread over 130 kb (FIG. 1a). These estimates were confirmed by RT-PCR experiments utilizing potential exons and primers located within human fetal brain total RNA. In addition, hybridization of the RT-PCR product to a Northern blot containing poly A ⁺ RNA detected the 7.5 kb transcript most highly expressed in fetal brain (FIG. 2). Taken together, these results suggested the presence of a candidate gene located near the translocation break.

To identify full-length cDNAs, we utilized a combination of fetal brain cDNA library screening, PCR and rapid amplification of cDNA ends (RACE). This approach makes it possible to obtain the full-length nucleotide sequence of the complexed cDNA (FIG. 3a).

To confirm that the identified gene was interrupted by a translocation break, the structure of the gene containing the exon-intron boundary was cloned into cDNA and YAC clone 469.
The cosmid library was determined through sequence comparison with cosmid genomic DNA clones isolated from either a cosmid library made from No. 0 or an ICRF flowsort X-specific cosmid library (FIG. 1a). Physical mapping of the 25 exons indicates that the candidate MRX gene is transcribed from the telomere to the centromere, and that the translocation break map in the second intron therefore contains the first two exons, including the one containing the putative translation initiation codon. This led to migration on chromosome 12. Confirmation of this latter result was obtained by FISH analysis using a cosmid clone containing the first two exons of this gene as a probe (cos 12, FIG. 1a). This experiment shows that the cosmid map is exclusively on derived chromosome 12 (data not shown).

To examine gene expression and to consider that both alleles are inactive, the primers located in exons 1 and 2 were used to test and control female and female control EBV-transformed lymphoblastoid lines. RT-P with RNA isolated from (LCL)
A CR experiment was performed. These experiments failed to amplify the normal gene product on the subject's RNA (FIG. 4a). Consistently, the normal X chromosome was found to be late replicative, suggesting preferential X inactivation of the normal X chromosome (Bienvenu et al., 1997). Then, it was confirmed that the MRX candidate gene was subjected to X inactivation.

Example 2: Identification of mutations in the MRX family Experimental Procedure Mutation Analysis Genomic DNA was extracted from EBV transformed lymphoblastoid lines using standard protocols. Twenty-three coding exons and exon-intron boundaries were individually amplified with specific primers. In each amplification, one primer was a 5 'psoralen-modified primer (Fernandez et al., 1993). PCR products were assayed on a standard agarose gel before analysis by DGGE technology. If an abnormal migration pattern is observed, purify the corresponding PCR product and use the Dye Terminator Cycle Sequencin
Both strands were sequenced directly using the g Kit protocol (Applied Biosystems).

FIG. 4 (a) shows a Southern blot of PCR products amplified from total RNA isolated from EBV transformed lymphoblastoid lines. RT-PCR was performed with (+) or without (-) reverse transcriptase and the cDNA was amplified for 40 cycles with primers located in exons 1 and 2 (FIG. 3, double underlined nucleotide sequence). After gel electrophoresis, the Southern blot was hybridized with an internal oligonucleotide (dotted line in FIG. 3). The 650 kb fragment corresponds to amplification from contaminating genomic DNA (intron 1 is 140 bp in length). Lanes of labeled DNA correspond to PCR products obtained from female total genomic DNA. The negative control indicated by Ct (-) corresponds to a PCR experiment without template. RT-PCR amplification of a ubiquitously expressed transcript generated by the periphery of the dystrophin gene was used as an internal standard.

Mutations that co-segregate with the mental retardation phenotype were detected by denaturing gradient gel electrophoresis of the PCR product corresponding to exon 19 of the oligofrenin 1 gene as shown in FIG. 4c. Exon 19 was amplified by PCR with primers 19F (5 'GTT AAT CTT GCC CCT TTT CT 3') and 19R (5 'psoralen-TA GGA AGA CAG GTA GTG AGA AT) to give a 221 bp product. 10 μl of the amplification product was mixed with 10 μl of the normal control PCR product. Denaturation of the heterodimer for 10 minutes, followed by 5 minutes
Made by re-annealing at 6 ° C. for 45 minutes. Samples were denatured 25-65% 6
% Polyacrylamide gel for 7.5 h at 60 ° C. and 160 V. A characteristic shifted profile was exhibited by the mutant allele, facilitating studies of family segregation.

[0100] 2. Results To demonstrate that the isolated genes are responsible for non-specific mental retardation, four unrelated probands from the MRX family previously mapped into gene intervals encompassing candidate genes (The European XLMR Consortium, 1997) was analyzed for the presence of point mutations. This strategy uses PCR for all code exons
Includes studies of the product by DGGE (Lerman et al., 1993) (denaturing gradient gel electrophoresis) and sequencing of exons exhibiting aberrant migration profiles. PCR primers are designed not only to amplify individual exons, but also to amplify sequences adjacent to exons. DGGE analysis of the amplification product corresponding to exon 19 from family D proband IV-3 (FIG. 4c) showed an abnormal shift in mobility. Compared to the normal product, sequence analysis showed that the abnormal product contained a single base pair deletion of nucleotide 1578 (FIG. 4b); the resulting fragment shift mutations resulted in an early translation termination 4 codon downstream of the mutation. Predicted to bring. The co-segregation of the disease with the mutation identified in the large family using DGGE technology (FIG. 2b) and the lack of this mutation in 100 control individuals is responsible for the deletion phenotype Suggested that.

Example 3 Expression of the Oligofrenin 1 Gene A C2 cDNA clone was isolated from a fetal brain cDNA library. C2
DNA probe containing poly (A) ⁺ RNA contained in fetal and many adult tissues
(Clontech®) for hybridization. 7.5kb
Transcripts were observed after overnight exposure at -80 ° C. Hybridization of Northern blots with an actin probe was performed to examine differences between the amounts of loaded poly (A) ⁺ RNA samples.

As shown in FIG. 2, the oligofrenin 1 transcript was the most abundant in RNA from fetal brain. Low levels of expression were also detected in several other tissues, including adult brain. To further examine the distribution of transcripts during development, embryos (E) 10.5
, E12.5, E14, E18 and in situ hybridization were used to examine the expression of mouse homologous genes in mouse embryos and postnatal tissues on day 1 of birth. In addition to low expression in all tissues without significant difference, it was observed that this gene was expressed at high levels throughout the developing sensory epithelium of the neural tube. During late differentiation stages and in the mature brain, significant levels of expression were observed in various structures of the brain without significant distribution of mRNA expression.

Some evidence has shown that oligofrenin 1 is responsible for X-linked non-specific mental retardation. First, the oligofrenin 1 gene was linked by linkage analysis (Lubs et al., 1996, The Euro
A potential mental retardation locus within Xq12 identified by the pean XLMR Consortium (1997) was mapped. Second, complete anthrogen insensitivity syndrome (
CAIS) and a dissertation report on two patients with mental retardation (Davies 199).
7) is located both proximal and peripheral to the AR gene, DXS905 and DXS908
The presence of a deletion containing multiple markers ranging up to. The above mapping data indicate that these markers are within the second and fifth introns of the oligofrenin 1 gene (FIG. 1a), and therefore, in these two subjects with mental retardation, most exons were Indicates a deletion. In contrast, deletions in two CAIS subjects without mental retardation did not extend to the oligofrenin 1 gene, and the deletion was restricted to the androgen receptor gene itself (Davies,
1997). Third, examination of this gene in female subjects with mental retardation and t (X; 12) indicates the absence of expression of both alleles and a second It showed preferential inactivation of alleles. Fourth, rho-GA presumed to result in severely abnormal and non-functional oligophrenin 1
A single base pair deletion within the P domain co-segregates with a recessive mental retardation phenotype in a large affected family that maps to the pericentrim region. Finally, oligofrenin 1 mRNA was highly expressed in fetal brain, a finding consistent with the disease phenotype.

[0104]

[Table 4]

[0105]

[Table 5]

[0106]

[Table 6]

[Sequence list]

[Brief description of the drawings]

FIG. 1. (a) Physical map of the genomic structure of the oligofrenin 1 gene straddling the Xq12 locus and the X chromosome break. YAC, PAC and cosmid contigs are indicated by lines, and STS is indicated by vertical bars. STS C16T3 contains an X-chromosome break (indicated by an arrow). It was constructed from the distal end of a 9 kb HindIII fragment. The oligofrenin 1 gene spans at least 300 kp and consists of 25 exons, 23 of which are coding sequences (open box). (B) X; STS as a probe of HindIII digested genomic DNA derived from a subject exhibiting 12 translocations and a normal female
Southern blot analysis using C16T3. Connection fragments are denoted by JF.

FIG. 2: Poly (A) ⁺ RNA hybridized with C2 cDNA probe (Clontech
Fetal and large numbers of adult tissue Northern blots, 7.5 kb transcripts were observed after overnight exposure at -80 ° C. Hybridization of Northern blots with actin probes was performed to examine differences between the amounts of loaded poly (A) ⁺ RNA samples.

[FIG. 3] (a) The coding part and deduced amino acid sequence of the cDNA of the oligofrenin 1 gene.
Bold nucleotides correspond to exon-exon boundaries. The GAP domain is underlined. X; primers used for RT-PCR to study gene expression in subjects with 12 translocations are double underlined, and internal primers used for hybridization to confirm PCR products are Shown by dotted lines.
The deleted nucleotide at position 1578 is shown in bold italics. (B) GAP domain present in oligofrenin 1 and various rhoGs described in Aelst et al.
Sequence alignment of AP proteins. The GAP domain has three structurally conserved regions (
SCR) (Boguski et al., 1993). CELZK328 is C.I. Elegance This corresponds to the ORF deduced from the genome sequence. (C) Sequence alignment showing high conservation of oligofrenin 1 N-terminal domain. CELTO4C95 is CELZ
Different C.K. It corresponds to the elegance ORF. EST4833210
Is part of the mouse homologous oligofrenin 1 cDNA and EST38704
2 corresponds to the human EST on chromosome 11 by the Whitehead Institute. Identical residues are shown in black and similar residues are shown in gray. Alignment is Mul
Performed using talin (Corpet et al. 1988) and Boxshade software.

FIG. 4 (a) X; subject having 12 translocations and normal female as control (XX
)) Study of oligofrenin 1 transcripts. Southern blot of PCR products amplified from total RNA isolated from EBV transformed lymphoblastoid lines. (B) Nucleotide sequence showing a single base pair deletion. PCR corresponding to exon 19 of the IV-3 proband
Direct sequencing of the product. (C) Segregation analysis of mutant alleles in XLMR family D. White square: healthy male; black square: sick male; white circle: healthy male; dot symbol:
Phenotypically normal carrier female.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification code FI Theme coat ゛ (Reference) A61K 39/395 A61K 48/00 45/00 A61P 25/00 48/00 25/08 A61P 25/00 25 / 28 25/08 C07K 14/47 25/28 16/18 C07K 14/47 C12N 1/15 16/18 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 C12Q 1/02 5/10 1/68 C12P 21/02 G01N 33/15 Z C12Q 1/02 33/50 Z 1/68 P G01N 33/15 C12P 21/08 33/50 C12N 15/00 ZNAA A61K 37/02 C12P 21 / 08 C12N 5/00 A (72) Inventor Caen, Axel France, F-75015 Paris, Rue du Doctor Leux, 10 (72) Inventor Berjol, Sheriff France, F-78300 Poissy, Ryu Jacob Courant, 11 Scan

Claims (25)

[Claims] 1. Sequence SEQ ID No. 1 to SEQ ID No. 1 25
And a homologous nucleic acid sequence having a sequence selected from the group consisting of: 2. A nucleic acid having a sequence selected from the group consisting of exon sequences specified in Table 2, and a homologous nucleic acid sequence thereof. 3. The method according to claim 1, wherein the SEQ ID No. 26. A nucleic acid comprising the sequence shown in 26, and a homologous nucleic acid sequence thereof. 4. The method according to claim 1, wherein the SEQ ID No. 26, with the exception of SEQ ID No. 26. 26. A nucleic acid sequence having a single nucleotide deletion at nucleotide 1578 set forth at 26. 5. The method according to claim 1, wherein the SEQ ID No. 28. An isolated oligofrenin-1 polypeptide substantially comprising the amino acid sequence of SEQ ID NO: 27 or a homologous amino acid sequence thereof. 6. A cloning and / or expression vector comprising the nucleic acid sequence according to claim 1. 7. A host cell transfected with the vector according to claim 6. 8. A nucleic acid sequence that specifically hybridizes to the nucleic acid sequence according to claim 1. 9. The nucleic acid sequence according to claim 8, which is selected from the group consisting of the sequences specified in Table 3, or a complementary sequence thereof. 10. A method for producing a recombinant oligofrenin 1, which comprises transfecting the host cell according to claim 7 with the vector according to claim 6 to express the polypeptide according to claim 5. The method of culturing in. 11. A monoclonal or polyclonal antibody capable of specifically recognizing the polypeptide according to claim 5, or a fragment thereof, or a chimeric or immunoconjugate antibody. 12. Use of the antibody according to claim 11 for detecting or purifying the polypeptide according to claim 5 in a biological sample. 13. Use of the nucleic acid sequence according to any one of claims 1, 2, 3, 8, and 9 for detecting an abnormality in the oligofrenin 1 gene or an abnormality in a transcript of the oligofrenin 1 gene. 14. An in vitro method for diagnosing a neuropathy related to an abnormality in an oligofrenin 1 gene or a transcript of the oligofrenin 1 gene, comprising one or more mutations in the oligofrenin 1 gene or the transcript of the oligofrenin 1 gene. How to detect. 15. The method according to claim 15, wherein the mutation is SEQ ID No. 15. The method of claim 14, wherein the deletion is a single nucleotide deletion at nucleotide 1578 shown in 26. 16. The in vitro method according to claim 14, wherein:
o A diagnostic method comprising: contacting a biological sample containing DNA with a specific oligonucleotide that allows amplification of the entire oligophrenin 1 gene or a portion thereof, wherein the DNA contained in the sample is Optionally, capable of hybridizing, and the contacting is performed under conditions in which hybridization of the primer with the DNA contained in the biological sample occurs; amplifying the DNA; Comparing the resulting amplification product with the amplification product obtained from a normal control biological sample; and thus detecting possible abnormalities in the oligofrenin-1 gene. 17. The in vitro method according to claim 14, wherein:
o a diagnostic method comprising: generating a cDNA from mRNA contained in a biological sample; using the cDNA to amplify a specific transcript of the oligophrenin 1 gene or a part thereof, and a primer; Amplifying the cDNA; detecting the amplification product; and combining the amplification product with an amplification product obtained from a normal control biological sample. Comparing and thus detecting possible abnormalities in the transcription of the oligofrenin 1 gene; a method comprising the steps of: 18. The purified oligofrenin 1 polypeptide of the present invention and / or
Or a homologous polypeptide thereof, or an isolated nucleic acid sequence encoding the polypeptide, together with a pharmaceutically acceptable carrier. 19. A pharmaceutical composition comprising an antisense sequence capable of specifically hybridizing to a nucleic acid sequence encoding said polypeptide together with a pharmaceutically acceptable carrier. 20. A pharmaceutical composition comprising an antibody specific for said polypeptide. 21. A transgenic non-human animal that expresses an exogenous or mutated native Olofrenin 1 protein. 22. A method for screening for a drug capable of acting on a signal generation pathway to which an oligofrenin 1 protein belongs, wherein said drug overexpresses or preferably renders a non-functional oligofrenin 1 non-functional.
A method for testing in a transgenic non-human animal or cultured cell expressing a protein. 23. A drug selected by the method of claim 22. 24. A pharmaceutical composition comprising the agent according to claim 23 together with a pharmaceutically acceptable carrier. 25. A method for preventing and / or treating a neuropathy caused by a defect in an oligofrenin 1 gene or an oligofrenin 1 protein, or a homologous gene or a defect in a protein thereof, wherein the method comprises the steps of: 25. A method comprising administering an effective amount of the pharmaceutical composition according to claim 18 or 24 to prevent and / or alleviate the disorder.