JP2002503470A - Splice variant of P101 protein - Google Patents

Abstract

  (57) [Summary] The present invention relates to the p101 protein splice variant (SVP-1). SVP-1 polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods of using SVP-1 polypeptides and polynucleotides for therapy, and diagnostic assays therefor.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION The present invention relates to newly identified polypeptides, polynucleotides encoding said polypeptides, agonists, antagonists and / or agonists which may be effective in or for the treatment of said polypeptides and polynucleotides. Or for use in identifying compounds that are inhibitors and methods for producing the polypeptides and polynucleotides.

[0002] currently in the background drug discovery process of the invention fundamentally very reduction has occurred. Because it extends to "functional genomics", high-throughput (high-efficiency) genomic or gene-based biology. This approach as a means to identify genes and gene products as therapeutic targets is rapidly replacing relatively early approaches based on "positional cloning." A phenotype, a biological function or a genetic disease, has been identified,
Subsequently, the etiological gene will be identified using the location of the genetic map as a clue.

[0003] Functional genetics is a high-throughput DNA sequencing technology and a variety of bioinformatics tools for identifying gene sequences of interest from many currently available molecular biology databases. Depends heavily. There is still a need to identify and characterize additional genes and their related polypeptides / proteins as targets for drug discovery.

SUMMARY OF THE INVENTION [0004] The present invention relates to SVP-1, a splice variant of the p101 adapter protein, particularly
The present invention relates to VP-1 polypeptide and SVP-1 polynucleotide, a recombinant substance, and a method for producing the same. In another embodiment, the present invention relates to the aforementioned polypeptides and polypeptides, including the treatment of disease states involving leukocyte activation and infiltration (eg, inflammatory diseases such as COPD, ARDS, arthritis and psoriasis). It relates to the use of nucleotides. In other aspects, the present invention provides a method of identifying agonists and antagonists / inhibitors using the agents provided by the invention, and treating a condition associated with SVP-1 imbalance using the identified compounds. About. In yet other embodiments, the present invention relates to diagnostic assays for detecting diseases associated with inappropriate SVP-1 activity or levels.

DESCRIPTION OF THE INVENTION In a first aspect, the present invention relates to SVP-1 polypeptides. Such a peptide may comprise an amino acid sequence having at least 95% identity, preferably at least 97-99% identity to the amino acid sequence of SEQ ID NO: 2 over the entire length of SEQ ID NO: 2. Polypeptides. Such polypeptides include those comprising the amino acid sequence of SEQ ID NO: 2.

[0006] Other peptides of the invention have at least 95% identity, preferably at least 97-99% identity to the amino acid sequence of SEQ ID NO: 2 over the entire length of SEQ ID NO: 2 Includes an isolated polypeptide. Such polypeptides include polypeptides consisting of the amino acid sequence of SEQ ID NO: 2.

[0007] Further peptides of the invention include an isolated polypeptide encoded by a polynucleotide comprising the nucleotide sequence contained in SEQ ID NO: 1.

[0008] The polypeptides of the present invention are believed to be members of the adapter protein family. Therefore, they are interesting. Because the p101 adapter protein is a unique phosphatidylinositol-3-kinase (PI3K) subtype of G
Necessary for protein-dependent activation, the PI3K subtype controls the production of phosphoinositides in which the D3 position of the inositol ring is specifically phosphorylated. For example, phosphatidylinositol-3,4,5-triphosphate (PIP3) is a well-known important second messenger. Although this PI3 kinase is directly activated by the G protein β-γ subunit, PIP3 is thought to regulate several important events in leukocytes, such as adhesion, migration, and degranulation. Thus, for example, by blocking the binding of the G protein β-γ subunit to p101 / PI3 kinase, PIP3
Inhibiting the accumulation of will result in benefits in a variety of disease states involving leukocyte activation. These properties are hereinafter referred to as "SVP-1 activity" or "SVP-1 polypeptide activity" or "biological activity of human SVP-1". Among these activities are also the antigenic and immunogenic activities of the SVP-1 polypeptide, in particular the antigenic and immunogenic activities of the polypeptide of SEQ ID NO: 2. The polypeptide of the present invention is a human SV
Preferably, it exhibits at least one biological activity of P-1.

[0009] The polypeptides of the present invention may be in the form of the "mature" protein or may be part of a larger protein, such as a precursor or a fusion protein. It is often advantageous to include additional amino acid sequences, such as secretory or leader sequences, prosequences, sequences useful for purification such as multiple histidine residues, or stable during recombinant production. There are additional arrangements to ensure the performance.

A variant of the polypeptide, ie, a polypeptide that differs from a reference polypeptide by conservative amino acid substitutions (a certain residue is replaced by another residue having similar properties) is also included in the present invention. included. Typical such substitutions are Ala, Val, Leu
Between Ile and Ile; between Ser and Thr; between the acidic residues Asp and Glu; between Asn and Gln;
Occurs between the basic residues Lys and Arg; or between the aromatic residues Phe and Tyr. In particular,
Mutants in which several, 5 to 10, 1 to 5, 1 to 3, 1 to 2, or 1 amino acids are substituted, deleted or added in any combination are suitable.

[0011] The polypeptide of the present invention can be produced by any appropriate method. Such polypeptides include isolated natural polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. It is. The means for producing such polypeptides are well understood in the art.

[0012] In a further aspect, the present invention relates to SVP-1 polynucleotides. Such polynucleotides include an isolated polynucleotide comprising a nucleotide sequence that encodes a polypeptide having at least 95% identity to the amino acid sequence of SEQ ID NO: 2 over the entire length of SEQ ID NO: 2. It is. In this regard, polypeptides having at least 97% identity are more preferred, while those with at least 98-99% identity are more preferred, with at least 9% being preferred.
Polypeptides with 9% identity are most preferred. Such polynucleotides include polynucleotides comprising the nucleotide sequence contained in SEQ ID NO: 1 encoding the polypeptide of SEQ ID NO: 2.

[0013] Further polynucleotides of the present invention include at least 95% of the nucleotide sequence encoding the polypeptide of SEQ ID NO: 2 over its entire coding region.
An isolated polynucleotide comprising a nucleotide sequence having the identity of In this regard, polynucleotides having at least 97% identity are more preferred, while those with at least 98-99% identity are even more preferred, and those with at least 99% identity are most preferred. .

[0014] Additional polynucleotides of the present invention include SEQ ID NO: 1 over the entire length of SEQ ID NO: 1.
Or an isolated polynucleotide comprising a nucleotide sequence having at least 95% identity to the polynucleotide of the present invention. In this regard, polynucleotides having at least 97% identity are more preferred, but at least 9%.
Even more preferred are those with 8-99% identity, and most preferred are polynucleotides with at least 99% identity. Such polynucleotides include a polynucleotide comprising the polynucleotide of SEQ ID NO: 1 and a polynucleotide of SEQ ID NO: 1.

[0015] The present invention also provides polynucleotides that are complementary to all of the above polynucleotides.

The nucleotide sequence of SEQ ID NO: 1 comprises human p101 (European Patent Application EP 98306696.0; S
mithKline Beecham), which does not have exons 6, 7, 9 and 10. The full length nucleotide sequence of human p101 is shown in SEQ ID NO: 5. SEQ ID NO: 5 is cD
A polypeptide coding sequence (nucleotide numbers 1 to 3630, exon 1 (1
-106), exon 2 (107-205), exon 3 (206-265), exon 4 (266-414), exon 5 (415-479), exon 6 (480-648), exon 7 (649-810) ), Exon 8 (
811-894), exon 9 (895-1616), exon 10 (1617-1778), exon 11 (17
79-1907), exon 12 (1908-2037), exon 13 (2038-2129), exon 14
(2)) included.

SEQ ID NO: 1 is the cDNA sequence and comprises a polypeptide coding sequence (nucleotide numbers 295 to 1722) encoding a polypeptide of 475 amino acids, which is the polypeptide of SEQ ID NO: 2. Even though the nucleotide sequence encoding the polypeptide of SEQ ID NO: 2 is identical to the polypeptide coding sequence contained in SEQ ID NO: 1, the polypeptide of SEQ ID NO: 2 is still identical due to the redundancy (degeneracy) of the genetic code. Code,
It may be a sequence other than the sequence contained in SEQ ID NO: 1. The polypeptide of SEQ ID NO: 2 is structurally related to other proteins in the adapter protein family, and has homology and / or structure to pig (S. scrofa) p101 (LRStephens et al., Cell 89, p105-114). Have similarities.

Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions / properties as the polypeptides and polynucleotides homologous thereto. Further, preferred polypeptides and polynucleotides of the present invention have at least one SVP-1 activity.

The present invention also relates to partial or other polynucleotides and polypeptides initially identified prior to the determination of the corresponding full length sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

Thus, in a further aspect, the present invention provides: (a) at least 95% identity, preferably at least 97-99% identity to the nucleotide sequence of SEQ ID NO: 3 over the entire length of SEQ ID NO: 3 An isolated polynucleotide comprising a nucleotide sequence having at least 95% identity, preferably at least 97-99% identity to the nucleotide sequence of SEQ ID NO: 3 over the entire length of SEQ ID NO: 3. (C) an isolated polynucleotide comprising the polynucleotide of SEQ ID NO: 3, or (d) an amino acid sequence of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4. Polypeptides having at least 95% identity, preferably at least 97-99% identity. Single consisting of a nucleotide sequence isolated polynucleotide, as well as SEQ ID NO: 3 of the polynucleotide.

Further, the present invention includes (a) an amino acid sequence having at least 95% identity, preferably at least 97-99% identity to the amino acid sequence of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4. (B) a polypeptide having an amino acid sequence having at least 95% identity, preferably at least 97-99% identity to the amino acid sequence of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4, c) a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, or (d) a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, and a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO: 3 , I will provide a.

The nucleotide sequence of SEQ ID NO: 3 and the peptide sequence encoded thereby are derived from an Expressed Sequence Tag (EST) sequence. One skilled in the art will appreciate that there will necessarily be some nucleotide sequence reading errors in the EST sequence (Adams, MD et al., Nature 37).
7 (supp) 3, 1995). Thus, the nucleotide sequence of SEQ ID NO: 3 and the peptide sequence encoded thereby suffer from the same inherent limitations in sequence accuracy. In addition, the peptide sequence encoded by SEQ ID NO: 3 may be in the same region as the protein with the highest homology or structural similarity, or with high homology and / or
Alternatively, it contains regions of structural similarity (eg, conservative amino acid differences).

The polynucleotides of the present invention can be obtained by standard cloning and screening from a cDNA library derived from mRNA in cells of human peripheral blood leukocytes (Sambrook et al., Molecular Cloning: A Laboratory Manua).
l, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
(1989)). The polynucleotide of the present invention can be obtained from a natural source such as a genomic DNA library, and can also be synthesized using a commercially available known technique.

When a polynucleotide of the present invention is used for recombinant production of a polypeptide of the present invention, the polynucleotide may include the coding sequence for the mature polypeptide alone, or another coding sequence (eg, a leader or secretory sequence). Sequences, those encoding the pre-, pro- or prepro-protein sequences, or other fusion peptide moieties) in the same reading frame. For example, a marker sequence that facilitates purification of the fusion polypeptide can be encoded. In a preferred embodiment of this aspect of the invention, the marker sequence is provided by the pQE vector (Qiagen, Inc.) and Gentz et al., Proc. Natl. Acad. Sci. USA (
1989) 86: 821-824, or a hexa-histidine peptide, or H
A tag. The polynucleotide may also include 5 'and 3' non-coding sequences, for example, transcribed but not translated sequences, splicing and polyadenylation signals, ribosome binding sites, and mRNA stabilizing sequences.

Further specific examples of the present invention include several, for example, 5 to 10, 1 to 5, 1 to 3,
There is a polynucleotide encoding a polypeptide variant comprising the amino acid sequence of SEQ ID NO: 2, wherein one, two, or one amino acid residue is substituted, deleted or added in any combination. .

A polynucleotide that is identical or sufficiently identical to the nucleotide sequence contained in SEQ ID NO: 1 can be used to isolate full length cDNA and genomic clones encoding a polypeptide of the present invention. Other genes with high sequence similarity to paralogs (including paralogs from human origin and genes encoding orthologs and paralogs from non-human species)
CDNA and genomic DN to isolate cDNA and genomic clones of
It can be used as a hybridization probe for A or as a primer for a nucleic acid amplification (PCR) reaction. Typically, these nucleotide sequences are 70%, preferably 80%, more preferably 9%, of the reference nucleotide sequence.
0%, most preferably 95% identical. Probes or primers generally contain 15 or more nucleotides, preferably 30 or more, and may have 50 or more nucleotides. Particularly preferred probes are those having a range of 30 to 50 nucleotides. Particularly preferred primers are those having a range of 20 to 25 nucleotides.

A polynucleotide encoding a polypeptide of the present invention (including a homologue derived from a species other than human) can be subjected to stringent hybridization using a labeled probe having the nucleotide sequence of SEQ ID NO: 1 or a fragment thereof. Screening a suitable library under conditions, the full length cDN containing the polynucleotide sequence
A and a genomic clone. Such hybridization techniques are known to those skilled in the art. Preferred stringent hybridization conditions are 50% formamide, 5 × SSC (150 mM
NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × De
nhardt solution, 10% dextran sulfate and 20 μg / ml denatured sheared salmon sperm D
Incubate overnight at 42 ° C in a solution containing NA, then filter to 0.1
× Washing at about 65 ° C. in SSC. Thus, the present invention also includes a polynucleotide obtained by screening an appropriate library under stringent hybridization conditions using a labeled probe having the nucleotide sequence of SEQ ID NO: 1 or a fragment thereof.

As will be appreciated by those skilled in the art, the isolated cDNA sequence will often be incomplete, since in many cases the region encoding the polypeptide is truncated at the 5 ′ end of its cDNA. Would. It is due to reverse transcriptase, which originally has a low "processivity" (a measure of the enzyme's ability to remain attached to the template during the polymerization reaction), and the mRNA template during first strand cDNA synthesis. DNA copy cannot be completed.

There are several methods known and available to those skilled in the art for obtaining full-length cDNAs or elongating short-chain cDNAs, such as the cDNA end rapid amplification method (R
ACE) (see, eg, Frohman et al., PNAS USA 85, 8998-9002,
1988). Recent improvements in the above techniques, as demonstrated by, for example, Marathon ^™ technology (Clontech Laboratories Inc.), have greatly simplified the search for longer cDNAs. With Marathon ^™ technology, mR extracted from a given tissue
A cDNA is made from the NA and an "adapter" sequence is ligated to each end. continue,
Nucleic acid amplification (PCR) is performed using a combination of gene-specific and adapter-specific oligonucleotide primers to amplify the "deleted" 5 'end of the cDNA. Next, a “nested” primer, a primer designed to anneal inside the amplification product (typically an adapter-specific primer that anneals further 3 ′ to the adapter sequence and an additional 5 ′ to the known gene sequence) The PCR reaction is repeated using a gene-specific primer that anneals to the side. The product of this reaction is then analyzed by DNA sequencing and either directly binding the product to the existing cDNA or performing another full-length PCR using new sequence information for 5 ′ primer design, Full-length cDNA can be constructed.

[0030] The recombinant polypeptides of the present invention can be produced from genetically engineered host cells containing the expression system using methods known in the art. Thus, in a further aspect, the present invention relates to an expression system containing one or more polynucleotides of the present invention, a host cell engineered with said expression system, and the production of a polypeptide of the present invention by recombinant methods. Cell-free translation systems can also be used to produce such proteins using RNA derived from the DNA constructs of the present invention.

For recombinant production, the host cell is genetically engineered to incorporate the polynucleotide expression system of the invention or a portion thereof. Introduction of polynucleotides into host cells is described in Davis et al., Basic Methods in Molecular Biology (1986) and Sambro.
ok et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbo
r Laboratory Press, Cold Spring Harbor, NY (1989) and many other standard laboratory manuals. Suitable such methods include, for example, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid mediated transfection, electroporation, transduction, scrape loading, bullet loading. Introduction (b
allistic introduction) or infection.

Representative examples of suitable hosts include bacterial cells (eg, Streptococcus, Staphylococcus, E. coli, Streptomyces, Bacillus subtilis), fungal cells (eg, yeast, Aspergillus), insect cells (eg, Drosophila S2) , Spodoptera Sf9), animal cells (eg, CHO, COS, HeLa, C127, 3T3, BHK, HEK293)
, Bowes melanoma cells) and plant cells.

[0033] A wide variety of expression systems can be used. Such expression systems include systems derived from chromosomes, episomes, and viruses, such as bacterial plasmids, bacteriophages, transposons, yeast episomes, insertion factors, yeast chromosomal elements, and viruses (eg, baculovirus, SV40). Such as papovavirus, vaccinia virus, adenovirus, fowlpox virus, pseudorabies virus, and retrovirus), and vectors derived from combinations thereof, such as plasmids such as cosmids and phagemids and bacteriophage genetics. Some come from elements. These expression systems may contain control sequences that regulate as well as cause expression. Generally, any system or vector that can maintain, augment, and express a polynucleotide for the production of a polypeptide in a host can be used. Sambrook et al., Molecula
r Cloning: The appropriate nucleotide sequence can be inserted into the expression system by any of the commonly used and known techniques, such as those described in the A Laboratory Manual (supra). Appropriate secretion signals can be incorporated into the polypeptide of interest to secrete the translated protein into the endoplasmic reticulum lumen, into the periplasmic space, or into the extracellular environment. These signals may be endogenous to the polypeptide of interest or heterologous signals.

When it is desired to express a polypeptide of the present invention for use in a screening assay, it is generally preferred that the polypeptide be produced on the surface of cells. If so, the cells are harvested prior to use in the screening assay.
If the polypeptide is secreted into the medium, the medium is recovered to recover and purify the polypeptide. If produced intracellularly, it is necessary to first lyse the cell and then recover the polypeptide.

To recover and purify the polypeptide of the present invention from recombinant cell culture, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity Known methods including chromatography, hydroxylapatite chromatography, and lectin chromatography can be used. Most preferably, high performance liquid chromatography is used for purification. When the polypeptide is modified during intracellular synthesis, isolation and / or purification,
The active conformation can be restored using known techniques for regenerating proteins.

The present invention also relates to the use of the polynucleotide of the present invention as a diagnostic. Detection of a variant form of the gene characterized by the polynucleotide of SEQ ID NO: 1 associated with a dysfunction may result in a disease resulting from under-expression, over-expression or spatially or temporally altered expression of the gene or a disease thereof. It will provide a diagnostic tool that can be added to or make a diagnosis of susceptibility. Individuals with mutations in the gene can be found at the DNA level by various techniques.

Diagnostic nucleic acids can be obtained from cells of a subject, such as cells from blood, urine, saliva, tissue biopsy or autopsy material. Genomic DNA may be used directly for detection, or may be enzymatically amplified using PCR or other amplification methods prior to analysis. RNA or cDNA can be used in a similar manner. Deletions and insertions can be detected by a change in the size of the amplified product when compared to the normal genotype. Point mutations can be identified by hybridizing the amplified DNA with a labeled SVP-1 nucleotide sequence. Perfectly matched sequences and mismatched duplexes can be distinguished by RNase digestion or by differences in melting temperatures. DNA sequence differences can also be detected by changes in the electrophoretic mobility of the DNA fragments on gels with or without denaturing agents, or by direct DNA sequencing (eg, Myers et al., Science (1985)). 230: 1242). Sequence changes at specific positions can also be confirmed by nuclease protection assays (eg, RNase and S1 protection) or chemical cleavage methods (Cotton et al.,
Proc. Natl. Acad. Sci. USA (1985) 85: 4397-4401). In another embodiment, for example, to perform efficient screening for genetic mutations, an array of oligonucleotide probes (arr
ay) can be constructed. Array techniques are known and have general applicability and have been used to solve various molecular genetics problems, including gene expression, genetic linkage and genetic variability (eg, M Chee et al., Science, Vol. 27
4, pp. 610-613 (1996)).

The diagnostic assay provides a method for diagnosing or determining susceptibility to the above-mentioned diseases by detecting a mutation in the SVP-1 gene by the above-described method. In addition, the disease can be diagnosed by a method of measuring an abnormal decrease or increase in the level of polypeptide or mRNA from a sample obtained from a subject. The decrease or increase in expression can be determined at the RNA level by any of the polynucleotide quantification methods known in the art, such as nucleic acid amplification (eg, PCR, RT-PCR), RNase protection, Northern blotting, and other hybridization methods. Can be measured. Assays for measuring the level of a protein, such as a polypeptide of the present invention, in a sample obtained from a host are well-known to those of skill in the art. Such assays include radioimmunoassays, competitive binding assays, western blot analysis, ELISA assays and the like.

Thus, in another embodiment, the present invention provides: (a) a polynucleotide of the present invention (preferably the nucleotide sequence of SEQ ID NO: 1) or a fragment thereof, (b) complementary to the nucleotide sequence of (a). (C) an antibody against the polypeptide of the present invention (preferably, the polypeptide of SEQ ID NO: 2) or a fragment thereof, or (d) an antibody against the polypeptide of the present invention (preferably, the polypeptide of SEQ ID NO: 2), And a diagnostic kit comprising:

It will be appreciated that in such a kit, (a), (b), (c) or (d) is a substantial component. Such kits are useful in diagnosing a disease or susceptibility to a disease, particularly a disease state involving leukocyte activation and infiltration (eg, inflammatory diseases such as COPD, ARDS, arthritis and psoriasis).

[0041] The nucleotide sequence of the present invention is also useful for chromosome identification. This sequence can target a specific location on an individual human chromosome and hybridize to that specific location. Creating a chromosomal map of related sequences according to the present invention is an important first step in correlating these sequences with gene-related diseases. Once a sequence has been mapped to a precise chromosomal location, the physical location of that sequence on that chromosome can be correlated with genetic map data. This type of data is described, for example, by V. McKusick, Mendelian Inheritance in Man (Johns Hopkins Unive
rsity (available online from the Welch Medical Library). Thereafter, the relationship between the gene mapped to the same chromosomal region and the disease is confirmed by linkage analysis (co-inheritance of physically adjacent genes).

[0042] Differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation may be responsible for the disease.

The gene of the present invention maps on human chromosome 17p12-13.1.

[0044] The nucleotide sequences of the present invention are also useful for tissue localization. By such techniques, the expression pattern of human SVP-1 polypeptide in tissues can be determined by detecting the mRNA encoding them. These techniques include in situ hybridization techniques, and nucleotide amplification techniques (eg, PCR). Such techniques are well-known in the art. The results of these studies provide an indication of the normal function of the polypeptide in an organism. Furthermore, by comparing the normal expression pattern of human SVP-1 mRNA with the expression pattern of mRNA encoded by the human SVP-1 gene, the role of the mutant human SVP-1 polypeptide in disease states or normal Beneficial findings may be obtained about the role of inappropriate expression of various human SVP-1 polypeptides. Such inappropriate expression may be of a temporal, spatial or simply quantitative nature.

The polypeptide of the present invention, a fragment or an analog thereof, or a cell expressing the same can also be used as an immunogen for producing an antibody immunospecific for the polypeptide of the present invention. By "immunospecific" is meant that the antibody exhibits a substantially higher affinity for the polypeptides of the present invention than its affinity for other related polypeptides in the prior art.

An antibody against the polypeptide of the present invention can be prepared in an animal (using a conventional protocol).
(Preferably a non-human animal) by administering a fragment, analog or cell containing the polypeptide or epitope. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. For example, the hybridoma method (Kohler, G. and Milstein, C., Nature (
1975) 256: 495-497), trioma method, human B cell hybridoma method (Kozbor et al.,
Immunology Today (1983) 4:72) and the EBV-hybridoma method (Cole et al., Mo.
noclonal Antibodies and Cancer Therapy, pp.77-96, Alan R. Liss, Inc., 19
85).

To generate single chain antibodies to the polypeptides of the present invention, US Pat. No. 4,946,
Methods for preparing single chain antibodies as described in US Pat. No. 778 can be adapted. Also, transgenic mice or other organisms, including other mammals, can be used to express humanized antibodies.

Using the above-mentioned antibody, a clone expressing the polypeptide can be isolated and identified, or the polypeptide can be purified by affinity chromatography.

[0049] Antibodies to the polypeptides of the present invention may have potential use, inter alia, in the treatment of the aforementioned diseases.

In a further aspect of the present invention, the present invention provides a polypeptide of the present invention or a fragment thereof and a variety of constant regions of H or L chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE). And a genetically engineered soluble fusion protein comprising: The immunoglobulin is preferably the constant part of the heavy chain of human IgG, especially IgG1, in which case the fusion takes place in the hinge region. In certain instances, the Fc portion can be easily removed by incorporating a cleavage sequence that can be cleaved by blood coagulation factor Xa. Furthermore, the invention relates to methods for the genetic engineering of these fusion proteins and their use in drug screening, diagnosis and therapy. A further aspect of the present invention relates to a polynucleotide encoding such a fusion protein. Examples of fusion protein technology are described in International Patent Application WO94 / 2945
8 and WO94 / 22914.

A further aspect of the present invention relates to a method of eliciting an immunological response in a mammal,
The method comprises inoculating a mammal with an antibody and / or a polypeptide of the invention sufficient to generate a T cell immune response, particularly to protect the animal from the disease. Yet another aspect of the invention directs the expression of a polynucleotide encoding a polypeptide of the invention in vivo to elicit an immunological response that produces antibodies that protect the mammal from the disease. A method of eliciting an immunological response in a mammal, comprising providing the polypeptide via a vector.

A further aspect of the present invention relates to immunological / vaccine formulations (compositions) that, when introduced into a mammalian host, elicit an immunological response in the mammal to the polypeptide of the present invention. Contains a polypeptide or polynucleotide of the invention. The vaccine formulation may further comprise a suitable carrier. Since the polypeptide may be broken down in the stomach, it is preferably administered parenterally (eg, by subcutaneous, intramuscular, intravenous or intradermal injection). Formulations suitable for parenteral administration include sterile aqueous and non-aqueous injections, which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the recipient, and suspensions. There are aqueous and non-aqueous sterile suspensions which may contain agents or thickeners. Such formulations may be presented in single or multi-dose containers (eg, sealed ampules and vials) and may also be stored in a lyophilized condition which requires only the addition of a sterile liquid carrier immediately before use. it can. The vaccine formulation may include an adjuvant system to enhance the immunogenicity of the formulation, such as an oil-in-water adjuvant system or other adjuvant systems known in the art. The dose varies with the specific activity of the vaccine, but can be easily determined by routine experimentation.

[0053] The polypeptides of the present invention are involved in a variety of biological functions, including a number of pathological conditions, particularly the aforementioned diseases. Therefore, it is desirable to develop screening methods that identify compounds that stimulate or suppress the function of this polypeptide. Accordingly, in a further aspect, the present invention provides a method of screening a compound to identify a compound that stimulates or suppresses the function of the polypeptide. Generally, agonists or antagonists are used for the purpose of treating and preventing the above-mentioned diseases. Compounds can be identified from a variety of sources, such as mixtures of cells, cell-free preparations, chemical libraries and natural products. The agonist, antagonist or inhibitor so identified may optionally be a natural or modified substrate, ligand, receptor, enzyme, etc., of the polypeptide, and its structural or functional mimetic. (Coliga
n et al., Current Protocols in Immunology 1 (2): Chapter 5 (1991)).

In the screening method, the binding of the candidate compound to the polypeptide of the present invention, or a cell or membrane carrying the polypeptide, or a fusion protein thereof is performed using a label directly or indirectly bound to the candidate compound. And easy to measure. Alternatively, the screening method may use competition with a labeled competitor.
Furthermore, such screening methods can test whether a candidate compound results in a signal resulting from activation or suppression of the polypeptide, using a detection system suitable for cells carrying the polypeptide. . Generally, inhibitors of activation are assayed in the presence of a known agonist to determine the effect of the presence of the candidate compound on activation by the agonist. Constitutively active polypeptides are used in screening methods for inverse agonists or inhibitors by examining whether a candidate compound inhibits activation of a polypeptide in the absence of an agonist or inhibitor. In addition, these screening methods
It simply comprises mixing the candidate compound and a solution containing the polypeptide of the present invention to form a mixture, measuring the SVP-1 activity in the mixture, and comparing the SVP-1 activity of the mixture to a standard. Just need. In high-throughput screening assays to identify antagonists of the polypeptides of the invention, fusion proteins such as those made from the Fc portion and SVP-1 polypeptides described above can also be used (D. Bennett et al., J. Mol. Recognition, 8: 52-58 (1995) and K. Johanson et al., J. Biol. Chem., 270 (16): 9459-9471 (1995)).

In addition, a screening method for detecting the effect of an additional compound on the production of mRNA or polypeptide in cells using the polynucleotide, polypeptide or antibody against the polypeptide of the present invention may be assembled. it can. For example, using a monoclonal or polyclonal antibody by standard methods known in the art to determine the level of polypeptide secretion or cell binding
ISA assays can be constructed, which can be used to search for substances (also referred to as antagonists or agonists, respectively) that suppress or enhance the production of polypeptides from appropriately engineered cells or tissues.

If a membrane-bound or soluble receptor is present, the polypeptide of the invention may be used to identify such receptor by standard receptor binding methods known in the art. Can be used. Such receptor binding methods include, but are not limited to, ligand binding assays and cross-linking assays, in which the polypeptide is labeled with a radioactive isotope (eg, ¹²⁵ I) or chemically modified (eg, ¹²⁵ I). Eg, biotinylated) or fused to a peptide sequence suitable for detection and purification and incubated with a putative receptor source (cells, cell membranes, cell supernatants, tissue extracts, body fluids, etc.). Other methods include biophysical methods such as surface plasmon resonance and spectroscopy. These screening methods can also be used to identify agonists or antagonists of the polypeptide that compete for binding to the polypeptide or its receptor, if present. Standard methods for performing screening assays are well understood in the art.

Examples of potential antagonists of the polypeptide include antibodies, in some cases
Oligonucleotides or proteins (eg, fragments of ligands, substrates, receptors, enzymes, etc.) that are closely related to the ligands, substrates, receptors, enzymes, etc. of the polypeptide, or the polypeptides of the invention that respond Small molecules that do not induce (and thus interfere with the activity of the polypeptide).

Thus, in other aspects, the present invention identifies agonists, antagonists, ligands, receptors, substrates, enzymes, etc., of the polypeptides of the invention, or compounds that decrease or increase the production of such polypeptides. This kit comprises: (a) a polypeptide of the present invention, (b) a recombinant cell expressing the polypeptide of the present invention, and (c) expressing the polypeptide of the present invention. A cell membrane, or (d) an antibody against the polypeptide of the present invention, wherein said polypeptide is preferably the polypeptide of SEQ ID NO: 2. It will be appreciated that in such a kit, (a), (b), (c) or (d) is a substantial component.

Those skilled in the art will readily appreciate that the polypeptides of the present invention can also be used in methods for designing agonists, antagonists or inhibitors of the polypeptides based on their structure. This method comprises the steps of (a) first analyzing the three-dimensional structure of the polypeptide, (b) assuming the three-dimensional structure of a likely reactive or binding site of an agonist, antagonist or inhibitor; Synthesizing a candidate compound that is expected to bind or react with the assigned binding or reactive site, and (d) determining whether the candidate compound is in fact an agonist, antagonist or inhibitor. It will be further appreciated that this is a generally iterative process.

In a further embodiment, the present invention relates to a disease state (eg, COPD, ARDS, ARDS, etc.) associated with either an excess or a deficiency of SVP-1 polypeptide activity, eg, involving leukocyte activation and infiltration. (Eg, inflammatory diseases such as arthritis and psoriasis).

If the activity of the polypeptide is in excess, several approaches are available. One approach is to suppress the function of the polypeptide, for example, by blocking the binding of ligands, substrates, receptors, enzymes, etc., or by reducing an abnormal condition by suppressing a second signal. Administering an inhibitor compound (antagonist) as described above to a patient in an amount effective to do so with a pharmaceutically acceptable carrier. In another approach, soluble forms of the polypeptide that are still capable of binding ligands, substrates, enzymes, receptors, etc., in competition with the endogenous polypeptide can be administered. A typical example of such a competitor is a fragment of an SVP-1 polypeptide.

[0062] In yet another approach, expression of the gene encoding endogenous SVP-1 polypeptide can be suppressed using expression blocking techniques. These known techniques require the use of antisense sequences produced in the body or administered externally (eg, Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (oligodeoxynucleotides as antisense inhibitors of gene expression), CRC
Press, Boca Raton, FL (1988), O'Connor, J. Neurochem (1991) 56: 560). Alternatively, oligonucleotides that form a triple helix with this gene can be provided (eg, Lee et al., Nucleic
Acids Res (1979) 6: 3073; Cooney et al., Science (1988) 241: 456; Dervan et al., Sc
ience (1991) 251: 1360). These oligomers can be administered as such, or the relevant oligomer can be expressed in vivo. Synthetic antisense or triplex oligonucleotides can include modified bases or backbones. Examples of the latter include methylphosphonates, phosphorothioates or peptide nucleic acid backbones. Such scaffolds are incorporated into antisense or triplex oligonucleotides to provide protection from nuclease degradation and are known in the art. Antisense and triplex molecules synthesized using these or other modified scaffolds also form part of the invention.

Further, expression of the human SVP-1 polypeptide can be prevented by using a ribozyme specific for the human SVP-1 mRNA sequence. Ribozymes are catalytically active RNAs, which may be natural or synthetic (e.g., Usman,
See N et al., Curr. Opin. Struct. Biol. (1996) 6 (4), 527-33). Synthetic ribozymes can be designed to specifically cleave human SVP-1 mRNA at selected sites, thereby preventing translation of human SVP-1 mRNA into a functional polypeptide. Ribozymes can also be synthesized using natural ribose phosphate backbones and natural bases, such as are commonly found in RNA molecules. It is also possible to synthesize ribozymes, eg, 2′-O-methyl RNA, using non-natural scaffolds to provide protection from ribonuclease degradation, which ribozymes may contain modified bases.

For treating abnormal conditions related to an under-expression of SVP-1 and its activity, several approaches are also available. One approach involves administering to a patient a therapeutically effective amount of a compound that activates a polypeptide of the invention (ie, the agonist) together with a pharmaceutically acceptable carrier to alleviate the abnormal condition. It becomes. Alternatively, gene therapy can be used to produce SVP-1 endogenously in the relevant cells of the patient. For example, a polynucleotide of the invention may be engineered for expression by a replication defective retroviral vector as described above. The retroviral expression construct is then isolated and introduced into packaging cells transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention. As a result, the packaging cells will produce infectious viral particles containing the gene of interest. In vivo cell manipulation and in v
These producer cells are administered to a patient for ivo polypeptide expression. For an overview of gene therapy, see Human Molecular Genetics, T Strachan and A.
Chapter 20, Gene Thera in P Read, BIOS Scientific Publishers Ltd (1996)
See py and other Molecular Genetic-based Therapeutic Approaches (and references therein). Another approach is to administer a therapeutic amount of a polypeptide of the invention together with a suitable pharmaceutical carrier.

In a further aspect, the invention provides a therapeutically effective amount of a polypeptide (eg, a soluble form of the polypeptide of the invention), an agonist or antagonist peptide, or a small molecule compound in a pharmaceutically acceptable carrier or Pharmaceutical compositions are provided that contain together with excipients. Such carriers include, but are not limited to, saline, saline, dextrose, water, glycerol, ethanol, and combinations thereof. The present invention further provides a composition comprising one or more of the above-described compositions of the present invention.
It relates to a pharmaceutical pack and a kit comprising the above container. The polypeptides and other compounds of the present invention may be used alone or in conjunction with other compounds, eg, therapeutic compounds.

The pharmaceutical composition can be adapted to the route of administration, for example by a systemic or an oral route. A suitable form for systemic administration is infusion (injection), typically intravenous.
Other injection routes, such as subcutaneous, intramuscular or intraperitoneal, can also be used. Alternative means of systemic administration include transmucosal and transdermal administration using penetrants such as bile salts, fusidic acid, and other surfactants. In addition, oral administration is possible provided the polypeptide or other compound of the present invention can be formulated as an enteric coating or capsule. These compounds may be administered topically and / or localized in the form of an ointment, paste, gel or the like.

The required dosage range depends on the choice of peptide or other compound of the invention, the route of administration,
It depends on the nature of the formulation, the condition of the patient and the judgment of the physician. However, suitable dosages range from 0.1 to 100 μg / kg of patient weight. Given the variety of compounds available and the differing efficiencies of the routes of administration, the required dosage will vary widely. For example, oral administration would be expected to require higher dosages than intravenous administration. Such variation in dosage level can be adjusted using standard empirical optimization procedures, as is well understood in the art.

The polypeptide used for the treatment can also be produced in the body of a patient in a treatment called “gene therapy” as described above. For example, cells from a patient
It is genetically engineered ex vivo by a polynucleotide such as DNA or RNA encoding the polypeptide, for example, using a retroviral plasmid vector. Thereafter, these cells are introduced into the patient.

[0069] Polynucleotide and polypeptide sequences provide a valuable source of information in identifying alternative sequences having similar homology. This involves storing such sequences in a computer readable medium and then using the stored data to generate GCG and Lag.
Searching the sequence database with known search tools such as the sergene software package is most facilitated. Accordingly, in a further aspect, the present invention provides a computer readable medium having stored thereon a polynucleotide comprising the sequence of SEQ ID NO: 1 and / or a polypeptide encoded thereby.

The following definitions are intended to facilitate understanding of terms often used in the above description.

As used herein, “antibody” includes polyclonal and monoclonal antibodies, chimeric antibodies, single-chain antibodies, humanized antibodies, as well as Fab fragments, including Fab or the products of other immunoglobulin expression libraries. It is.

“Isolated” means altered “by the hand of man” from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or separated from its original environment, or both.
For example, a polynucleotide or polypeptide naturally occurring in the body of a living animal is not "isolated", but a polynucleotide or polypeptide separated from its naturally occurring co-localized material is described herein. As used herein, "isolated".

“Polynucleotide” generally refers to any polyribonucleotide or polydeoxyribonucleotide, which is unmodified RNA or DNA
Or modified RNA or DNA. “Polynucleotide” includes, but is not limited to, single- and double-stranded DNA, DNA in which single- and double-stranded regions are mixed, single- and double-stranded RNA, single-stranded RNA with mixed region and double-stranded region, hybrid molecule containing DNA and RNA (may be single-stranded or more typically double-stranded, where single-stranded and double-stranded regions are mixed May be included). In addition, "polynucleotide" may be RNA or D
NA or a triple-stranded region consisting of both RNA and DNA. The term "polynucleotide" also refers to DNA or RNA containing one or more modified bases.
And DNA having a backbone modified for stability or for other reasons
Also includes NA. "Modified" bases include, for example, tritylated bases and special bases such as inosine. Various modifications can be made to DNA and RNA. Thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides which are commonly found in nature, as well as DNA and RNA chemical forms characteristic of viruses and cells. . "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.

“Polypeptide” means a peptide or protein comprising two or more amino acids linked by a peptide bond or a modified peptide bond (ie, a peptide isostere). A "polypeptide" is a short chain (usually called a peptide, oligopeptide or oligomer) and a long chain (usually called a protein)
Refers to both. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino acid sequences that have been modified by natural processes, such as post-translational processing, or by any of the chemical modification methods known in the art. Such modifications are elaborated in basic textbooks, more detailed scholarly articles and research literature. Modifications can be made anywhere in the polypeptide, including the peptide backbone, amino acid side chains, amino or carboxyl termini. The same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides can be branched for ubiquitination or cyclic, with or without branching. Cyclic, branched or branched cyclic polypeptides can result from post-translation natural processes and can also be produced by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, biotinylation, covalent attachment of flavin, covalent attachment of the heme moiety, covalent attachment of nucleotides or nucleotide derivatives, covalent attachment of lipids or lipid derivatives, phosphatidylinositol Covalent bond, crosslink, cyclization, formation of disulfide bond, demethylation, formation of covalent crosslink, formation of cystine, formation of pyroglutamate, formylation, γ-carboxylation, glycosylation, GPI anchor formation,
Transfer RNA-mediated addition of amino acids to proteins such as hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, arginylation, ubiquitination (Eg Proteins-Structure and Molecular Properties, 2nd E
d., TE Creighton, WH Freeman and Company, New York, 1993; Posttransl
ational Covalent Modification of Proteins, edited by BC Johnson, Academic Pres
Wold, F., Post-translational Protein Modifications in s, New York, 1983:
Perspectives and Prospects, pgs. 1-12; Seifter et al., “Analysis for protei
n modifications and nonprotein cofactors ", Meth Enzymol (1990) 182: 626-6
46; and Rattan et al., “Protein Synthesis: Post-translational Modificatio
ns and Aging ", Ann NY Acad Sci (1992) 663: 48-62).

“Variant” refers to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains essential properties.
A typical variant of a polynucleotide differs in nucleotide sequence from a reference polynucleotide. Changes in the nucleotide sequence of this variant may or may not alter the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Nucleotide changes can result in amino acid substitutions, deletions, additions, fusions and truncations of the polypeptide encoded by the reference sequence, as described below. A typical variant of a polypeptide differs in amino acid sequence from a reference polypeptide. In general, the sequences of the reference polypeptide and the variant are generally closely similar and limited to differences so that they will be identical in many regions. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, deletions, or additions in any combination. The amino acid residue to be substituted or inserted may or may not be one encoded by the genetic code. The variant of the polynucleotide or polypeptide may be a naturally occurring variant, such as an allelic variant, or a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides can be made by mutagenesis methods or by direct synthesis.

“Identity” as known in the art, is the relationship between two or more polypeptide or polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as determined by the match between strands of such sequences. "Identity" and "similarity" can be calculated without difficulty by a known method, and examples of such a method include, for example, Computational Molecular Biolo
gy, Lesk, AM, Oxford University Press, New York, 1988; Biocomputing:
Informatics and Genome Projects, Smith, DW, Academic Press, New Yo
rk, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and
Griffin, HG, Humana Press, New Jersey, 1994; Sequence Analysis in M
olecular Biology, von Heinje, G., Academic Press, 1987; Sequence Analysi
s Primer, Gribskov, M. and Devereux, J. Ed., M Stockton Press, New York,
1991; and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48: 1073
(1988), but not limited thereto. Preferred methods for determining identity are designed to give the largest match between the sequences considered. In addition, methods for determining identity and similarity have been compiled into publicly available computer programs. A preferred computer program method for determining the identity and similarity between two sequences is the GCG program package (Devereux
, J. et al., Nucleic Acids Research 12 (1): 387 (1984)), BLASTP, BLAST.
TN and FASTA (Atschul, SF et al., J. Molec. Biol. 215: 403-410 (1990
)), But not limited to these. The BLAST X program is generally available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM
NIH Bethesda, MD 20894; Altschul, S. et al., J. Mol. Biol. 215: 403-410 (199
0)). The well-known Smith Waterman algorithm can also be used to determine identity.

Suitable parameters for comparing polypeptide sequences include: 1) Algorithm: Needleman & Wunsch, J. Mol. Biol. 48: 443-453 (1970); Comparison matrix: BLOSSUM62, Hentikoff and Hentikoff, Proc. Natl. Aca
d. Sci. USA, 89: 10915-10919 (1992) Gap penalty: 12 Gap length penalty: 4 A useful program with these parameters is the Genetics Computer Group
(Madison WI) is generally available as a "gap" program. The above parameters are default parameters for peptide comparison.
) (No end gap penalty).

Suitable parameters for comparing polynucleotide sequences include: 1) Algorithm: Needleman & Wunsch, J. Mol. Biol. 48: 443-453 (1970); Comparison Matrix: Match = + 10 , Mismatch = 0 Gap penalty: 50 Gap length penalty: 3 A useful program with these parameters is Genetics Computer Group
(Madison WI) as a "gap" program. The above parameters are default parameters for nucleic acid comparison.

By way of example, the polynucleotide sequence of the present invention is identical to the reference sequence of SEQ ID NO: 1, ie, even though it is 100% identical, it contains up to an integer number of nucleotide mutations with respect to the reference sequence. Is also good. The mutation is selected from the group consisting of deletions, substitutions (including transitions and transversions) or insertions of at least one nucleotide, such mutations being at the 5 ′ or 3 ′ terminal position of the reference nucleotide sequence, or at these terminal positions. Between the nucleotides in the reference sequence, individually or as one or more contiguous groups within the reference sequence. The number of nucleotide variations is determined by multiplying the total number of nucleotides of SEQ ID NO: 1 by the respective percent identity value (divided by 100) and subtracting the product from the total number of nucleotides of SEQ ID NO: 1, ie, : _n n ≦ _x n - can be obtained by _(x n · y). Wherein, n _n is the number of nucleotide alterations, x _n is the total number of nucleotides in SEQ ID NO: 1, y 0.70,80% is about 70% for example
0.80 for 85%, 0.85 for 85%, 0.90 for 90%, 0 for 95%.
95, and the non-integer product of _xn and y is rounded down to the closest integer before subtracting the product from _xn . The alteration of the polynucleotide sequence encoding the polypeptide of SEQ ID NO: 2 results in a nonsense, missense or frameshift mutation in the coding sequence, thereby altering the polypeptide encoded by the polynucleotide after such mutation. be able to.

Similarly, the polypeptide sequence of the present invention is identical to the reference sequence of SEQ ID NO: 2, ie
Even with 100% identity, the percent identity may be less than 100% with respect to the reference sequence, including up to an integer number of amino acid variations. The mutation is selected from the group consisting of a deletion, substitution (including conservative and non-conservative amino acid substitutions) or insertion of at least one amino acid, wherein the mutation is at the amino or carboxy terminal position of the reference polypeptide sequence, or at a It may occur anywhere between positions and may intervene individually between amino acids in the reference sequence, or as one or more contiguous groups within the reference sequence. The number of amino acid mutations for a given% identity is calculated by multiplying the total number of amino acids of SEQ ID NO: 2 by the respective% identity values (divided by 100) and subtracting the product from the total number of amino acids of SEQ ID NO: 2. By that:
Following equation: _{n a} ≦ _{x a} - can be obtained by _(x a · y). Wherein, n _a is the number of amino acid alterations, x _a is the total number of amino acids in SEQ ID NO: 2, y is about 70% for example and the like 0.85 for 0.80,85% for 0.70,80% , and wherein any non-integer product of x _a and y, prior to subtracting it from x _a, rounded down to the nearest integer.

“Homolog” is a general term used in the art to indicate a polynucleotide or polypeptide sequence that has a high degree of sequence relatedness to the sequence of interest. Such relationships can be quantified by determining the degree of identity and / or similarity between the sequences to be compared, as described above. Ortholog means a polynucleotide or polypeptide that is a functional equivalent of a polynucleotide or polypeptide in another species, and functionally similar sequences when considered within the same species The term "paralog" is included in this general term.

“Fusion protein” refers to a protein encoded by two, often unrelated, fused genes or fragments thereof. As an example, EP-A-0 4
64 describes a fusion protein comprising various portions of the constant region of an immunoglobulin molecule and other human proteins or portions thereof. Often, for use in therapy and diagnosis, immunoglobulin Fc as part of a fusion protein
The use of regions is advantageous, for example, to improve pharmacokinetic properties (see, for example, EP-A-0232262). On the other hand, for some uses, it may be desirable to remove the Fc portion after expressing, detecting and purifying the fusion protein.

[0083] The expression pattern of Example SVP-1, standard methods (see, eg, Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spr
Interrogation was performed by Northern blot analysis using Ining Harbor, NY (1989) and Taqman fluorescent PCR (Perkin Elmer). Northern blot showed that the SVP-1 splice variant transcript was approximately 8 kb in size. This Northern blot data detected expression in peripheral blood leukocytes, lymph glands and bone marrow.

[0084] Using Taqman, SVP- in leukocytes observed in Northern blot data
1 expression was further investigated. This Taqman analysis was performed using the following oligonucleotides according to the manufacturer's instructions.

SVP-1 labeled probe: 5 ′ CAAAACCAGGGAAGCTCCATGCCA 3 ′ SVP-1 forward primer: 5 ′ CGCAGCTCCACCGTACACT 3 ′ SVP-1 reverse primer: 5 ′ TGGCGACAGGGATGGG 3 ′ Taqman PCR was performed using a set of human leukocytes (lymphocytes, neutrophils). (Including spheres, platelets and monocytes)
Was carried out. Next, the signal was converted to three different housekeeping genes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine ribosyltransferase (HPRT) and acidic ribosome phosphoprotein P0 (3
6B4). SVP-1 expression was detected on monocytes, macrophages and lymphocytes, and at higher levels on platelets and neutrophils. The highest level of expression was found in activated neutrophils. SVP-1 expression was also observed in microglial cell lines (C1
This expression was also dramatically increased after stimulating the cells with IL-1α.

[0086] SVP-1 expression in monocytes decreased during culture and expression levels further decreased in the presence of GMCSF, whereas in neutrophils SVP-1 expression decreased after 1 hour in culture and 4 hours in culture. Was found to increase again.

All publications, including patents and patent application specifications, cited herein are incorporated by reference in their entirety, as if each publication was clearly and individually indicated. It shall be incorporated here.

Sequence information

[Sequence list]

[Procedure amendment]

[Submission date] September 25, 2000 (2000.9.25)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Claims

[Correction method] Change

[Correction contents]

[Claims]

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 5/10 C12Q 1/48 Z 9/12 1/68 A C12Q 1/48 G01N 33/566 1/68 C12N 15/00 ZNAA G01N 33/566 5/00 A (31) Priority claim number 9908223.7 (32) Priority date January 14, 1999 (1999.1.14) (33) Priority claim country United Kingdom (GB) (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), JP ( 72) Inventor Patel, Lisa C.E.M. 195 ev. Brussels, Harlow, Third Avenue, New Frontiers Science Park South, Smithkla Beechham Pharmaceuticals (72) Inventor McPhee, Colin, Houston C.E.M. 19 195 Able Brew Essex, Harlow, Third Avenue, New Frontiers Science Park South, Smithkline Beechham Pharmaceuticals F Term (Reference) 4B024 AA01 AA11 BA63 CA01 CA12 GA11 HA11 4B050 CC03 DD07 LL03 4B063 QA01 QA07 QA17 QQ42 QQ79 QR32 QR48 QR56 QS33 QS34 QX02 4B065 AA93Y AB01 AC14 BA01 CA24 CA25 CA44 CA46 4H045 AA10 AA11 BA10 BA41 CA40 EA50

Claims (14)

[Claims] 1. An isolated polypeptide comprising a polypeptide sequence having at least 95% identity to the polypeptide sequence of SEQ ID NO: 2. 2. The polypeptide of claim 1, comprising the polypeptide sequence of SEQ ID NO: 2. 3. The isolated polypeptide of SEQ ID NO: 2. 4. An isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide sequence having at least 95% identity to the polypeptide sequence of SEQ ID NO: 2, or complementary to said polynucleotide. Polynucleotide sequence. 5. The method of claim 5, wherein said polynucleotide sequence is at least 95%.
An isolated polynucleotide comprising a polynucleotide sequence having% identity, or a polynucleotide sequence complementary to said polynucleotide. 6. An isolated polynucleotide selected from the following (a) to (d), or a nucleotide sequence complementary to said polynucleotide over its entire length: (a) encoding the polypeptide of SEQ ID NO: 2 (B) a polynucleotide encoding the polypeptide of SEQ ID NO: 2, (c) a polynucleotide of SEQ ID NO: 1, and (d) the library under stringent hybridization conditions. Below,
A polynucleotide obtained by screening using a labeled probe having the sequence of SEQ ID NO: 1 or a fragment thereof. 7. An expression system comprising a polynucleotide capable of producing the polypeptide of claim 1 when the following expression system is present in a compatible host cell. 8. A host cell containing the expression system of claim 7, or a membrane thereof expressing the polypeptide of claim 1. 9. A method comprising culturing the host cell according to claim 8 under conditions sufficient to produce the polypeptide according to claim 1, and recovering the polypeptide from the culture medium. The method for producing a polypeptide according to claim 1, which comprises: 10. An antibody immunospecific for the polypeptide according to any one of claims 1 to 3. 11. A screening method for identifying a compound that stimulates or suppresses the function of the polypeptide according to claim 1, comprising: (a) a candidate compound and the polypeptide (or a polypeptide that expresses the polypeptide); Measuring the binding to the candidate compound with a label directly or indirectly bound to the candidate compound, and (b) a candidate compound and the polypeptide (or the polypeptide). Is measured in the presence of a labeled competitor, and (c) whether the candidate compound results in a signal resulting from activation or inhibition of the polypeptide. (D) using a detection system suitable for cells or cell membranes expressing the polypeptide, and (d) a candidate compound, Preparing a mixture by mixing with a solution containing the polypeptide, measuring the activity of the polypeptide in the mixture, comparing the activity of the mixture to a standard, and (e) determining whether the candidate compound is Detecting the mRNA encoding the peptide and its effect on the production of said polypeptide, for example, using an ELISA assay, said screening method comprising a method selected from the group consisting of: 12. A method for examining, in a subject, a disease associated with the expression or activity of the polypeptide according to claim 1 or a susceptibility to said disease, wherein (a) the method comprises: Determining whether there is a mutation in the nucleotide sequence encoding the peptide, and / or (b) analyzing the presence or amount of said polypeptide expression in a sample obtained from said subject. Method. 13. An isolated polynucleotide selected from the group consisting of (a) to (d): (a) at least 95% of the nucleotide sequence of SEQ ID NO: 3 over the entire length of SEQ ID NO: 3 An isolated polynucleotide comprising a nucleotide sequence having identity; (b) an isolated polynucleotide comprising a polynucleotide of SEQ ID NO: 3; (c) a polynucleotide of SEQ ID NO: 3; and (d) 2.) An isolated polynucleotide comprising a nucleotide sequence that encodes a polypeptide having at least 95% identity to the amino acid sequence of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4. 14. A polypeptide selected from the group consisting of the following (a) to (e): (a) having at least 95% identity to the amino acid sequence of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4 A polypeptide comprising an amino acid sequence; (b) a polypeptide wherein the amino acid sequence has at least 95% identity to the amino acid sequence of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4; (c) an amino acid sequence of SEQ ID NO: 4 (D) a polypeptide that is the polypeptide of SEQ ID NO: 4; and (e) a polypeptide that is encoded by a polynucleotide that comprises the sequence contained in SEQ ID NO: 3.