JP2002360283A - New g-protein-coupled receptor protein and its dna - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new protein useful in screening, etc., of an agonist/an antagonist. SOLUTION: This protein is derived from humans or its salt. A DNA is capable of encoding the protein and a method for determining a ligand to the protein is provided. A method/a kit for screening a compound altering binding properties of the ligand to the protein are provided. The compound obtained by the screening or its salt, etc., are provided. Thereby, the protein derived from the humans or the DNA capable of encoding the same can be used for (1) determining of the ligand to the protein, (2) a prophylactic and/or a therapeutic agents for diseases associated with hypofunction of the protein, (3) screening, etc., of the compound (the agonist, the antagonist, etc.), altering the binding properties of the compound of the protein to the ligand.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a human kidney cDNA.
The present invention relates to a novel G protein-coupled receptor protein or a salt thereof, and a DNA encoding the same.

[0002]

2. Description of the Related Art Many physiologically active substances such as hormones and neurotransmitters regulate biological functions through specific receptor proteins present in cell membranes. Many of these receptor proteins are coupled guanin
Since it transduces intracellular signals through activation of e nucleotide-binding protein (hereinafter abbreviated as G protein) and has a common structure with seven transmembrane domains, it is a G protein-coupled receptor protein. Alternatively, they are collectively referred to as seven transmembrane receptor proteins (7TMR). G protein-coupled receptor proteins are present on the surface of various functional cells of living cells and organs, and are physiologically targeted as molecules that regulate the functions of those cells and organs, such as hormones, neurotransmitters and bioactive substances. Plays an important role. The receptor transmits a signal into a cell through binding to a physiologically active substance, and this signal causes various reactions such as activation and suppression of the cell. To clarify the relationship between substances that regulate complex functions in cells and organs of various organisms and their specific receptor proteins, especially G protein-coupled receptor proteins, it is necessary to clarify the functions of organs and cells in various organisms. And provide a very important means for drug development closely related to their functions.

For example, in various organs of a living body, physiological functions are regulated under the control of many hormones, hormone-like substances, neurotransmitters or physiologically active substances. In particular, physiologically active substances are present at various sites in a living body, and regulate their physiological functions through their corresponding receptor proteins. There are many unknown hormones, neurotransmitters, and other physiologically active substances in the living body.
Many have not been reported so far. Furthermore, it is often unknown whether subtypes exist in known receptor proteins. Clarifying the relationship between a substance that regulates a complex function in a living body and its specific receptor protein is a very important means for the development of pharmaceuticals including agonists and antagonists for the receptor protein. However, conventionally, in order to efficiently screen for agonists and antagonists for receptor proteins and to develop pharmaceuticals, the functions of receptor protein genes expressed in vivo are elucidated and expressed in an appropriate expression system. It was necessary. In recent years, as a means of analyzing genes expressed in vivo, studies of randomly analyzing cDNA sequences have been actively conducted.
It is registered as a Sequence Tag (EST) in the database and published. However, many ESTs have only sequence information, and it is difficult to estimate their functions.

[0004]

Heretofore, substances that inhibit the binding between a G protein-coupled receptor and its ligand, a physiologically active substance, and substances that bind to cause a signal transduction similar to that of a physiologically active substance have been disclosed. As a specific antagonist or agonist of a receptor, it has been utilized as a drug for regulating biological functions. Therefore,
As described above, finding a novel G protein-coupled receptor protein which is not only important in physiological expression in vivo but also a target for drug development, and cloning its gene (eg, cDNA) requires a novel G protein. This is a very important means for finding specific ligands, agonists and antagonists of the coupled receptor protein. However, not all G protein-coupled receptors have been found, and even at this time, unknown G protein-coupled receptors,
In addition, there are many so-called orphan receptors whose ligands have not been identified, and there is an eager need to search for new G protein-coupled receptors and elucidate their functions. G protein-coupled receptors are useful for searching for new ligands (physiologically active substances), and for searching for agonists or antagonists to the receptor, using the signal transduction action as an index. On the other hand, even if a physiological ligand is not found, it is also possible to prepare an agonist or antagonist for the receptor by analyzing the physiological action of the receptor from an inactivation experiment (knockout animal) of the receptor. .
These ligands, agonists or antagonists to the receptor can be expected to be used as preventive / therapeutic agents or diagnostic agents for diseases related to dysfunction of G protein-coupled receptors. Furthermore, a decrease or enhancement of the function of a G protein-coupled receptor in a living body based on a gene mutation thereof often causes some disease. In this case, the present invention is applied not only to administration of an antagonist or agonist to the receptor, but also to gene therapy by introducing the receptor gene into a living body (or a specific organ) or by introducing an antisense nucleic acid to the receptor gene. You can also. In this case, the nucleotide sequence of the receptor is indispensable information for examining the presence or absence of a deletion or mutation in the gene. And diagnostics. The present invention provides a novel G compound useful as described above.
A protein-coupled receptor protein is provided. That is, a novel G protein-coupled receptor protein or a partial peptide thereof or a salt thereof, a polynucleotide encoding the G protein-coupled receptor protein or a partial peptide thereof (DNA, R
A polynucleotide (DNA, RNA, and derivatives thereof) containing the polynucleotide, a recombinant vector containing the polynucleotide, a transformant carrying the recombinant vector, the G protein-coupled receptor protein or A method for producing the salt, an antibody against the G protein-coupled receptor protein or its partial peptide or a salt thereof, a compound that changes the expression level of the G protein-coupled receptor protein, a method for determining a ligand for the G protein-coupled receptor, Compounds that change the binding between a ligand and the G protein-coupled receptor protein (antagonists,
Agonist) or a salt thereof, a screening kit, a screening kit, a compound (antagonist, agonist) or a compound thereof that alters the binding between a ligand obtainable by using the screening method or the screening kit and the G protein-coupled receptor protein Salts, compounds (antagonists, agonists) that change the binding property between the ligand and the G protein-coupled receptor protein, compounds that change the expression level of the G protein-coupled receptor protein, or medicaments containing a salt thereof I will provide a.

[0005]

Means for Solving the Problems As a result of intensive studies, the present inventors have isolated a DNA encoding a novel G protein-coupled receptor protein derived from human kidney cDNA and analyzed the entire nucleotide sequence thereof. Succeeded. And when this base sequence was translated into an amino acid sequence,
The first to seventh transmembrane regions were confirmed on the hydrophobicity plot shown in FIG. 1, and it was confirmed that the protein encoded by this DNA was a seven-transmembrane G protein-coupled receptor protein. The present inventors have further studied based on these findings, and as a result, have completed the present invention.

That is, the present invention relates to (1) SEQ ID NO: 1.
A G protein-coupled receptor protein or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by the following formula (2): (1) the G protein-coupled receptor protein or a salt thereof according to (1), (3) the partial peptide of the G protein-coupled receptor protein or a salt thereof according to (1), (4) the G protein coupling according to (1) above (5) a polynucleotide according to the above (4), which is a DNA; (6) a polynucleotide comprising the base sequence represented by SEQ ID NO: 2; (7) a recombinant vector containing the polynucleotide according to the above (4), (8) a recombinant vector containing the polynucleotide according to the above (7). (9) culturing the transformant according to the above (8) to produce the G protein-coupled receptor protein or a salt thereof according to the above (1). )) The method for producing a G protein-coupled receptor protein or a salt thereof, (10) the G protein-coupled receptor protein according to (1) or (3)
An antibody against the partial peptide or a salt thereof described above, (11)
The diagnostic agent comprising the antibody according to the above (10), which is a neutralizing antibody that inactivates the signal transduction of the G protein-coupled receptor protein according to the above (1), and (12) the antibody according to the above (10). (13) a medicament comprising the antibody of (10), (14) a G protein-coupled receptor protein of (1) or a partial peptide of (3) or a salt thereof. A ligand for the G protein-coupled receptor protein or a salt thereof according to (1) above, (15) a medicament comprising the ligand for the G protein-coupled receptor according to (14), (16) a (1) The G protein-coupled receptor according to (1), wherein the G protein-coupled receptor protein according to (1) or the partial peptide according to (3) or a salt thereof is used. (17) a method for determining a ligand for a puter protein or a salt thereof, (17) a ligand characterized by using the G protein-coupled receptor protein described in the above (1) or the partial peptide described in the above (3) or a salt thereof, and G)
A method for screening a compound or a salt thereof that changes the binding property to a protein-coupled receptor protein or a salt thereof, (18) a G protein-coupled receptor protein described in the above (1) or a partial peptide described in the above (3) or a salt thereof A screening kit for a compound or a salt thereof that alters the binding property between the ligand and the G protein-coupled receptor protein or the salt thereof according to the above (1);
7) A compound or a salt thereof that alters the binding between the ligand obtainable by using the screening method described in the above or the screening kit described in the above (18) and the G protein-coupled receptor protein or the salt thereof described in the above (1). (20) a medicament comprising the compound of (19) or a salt thereof, (21) a polynucleotide that hybridizes with the polynucleotide of (4) under high stringency conditions, (22) (4) a polynucleotide comprising a nucleotide sequence complementary to the polynucleotide described in (4) or a part thereof, (23) a polynucleotide comprising the polynucleotide described in (4) or a part thereof, ) The method for quantifying the mRNA of a G protein-coupled receptor protein according to the above), (24) the method comprising using the antibody according to the above (10) (1) The method for quantifying a G protein-coupled receptor protein described in (1), (25) the function of the G protein-coupled receptor according to (1), wherein the quantification method described in (23) or (24) is used. (26) Screening for a compound or a salt thereof that alters the expression level of the G protein-coupled receptor protein according to (1), characterized by using the quantification method described in (23) above. (27) a method for screening a compound or a salt thereof that alters the amount of the G protein-coupled receptor protein described in (1) above in a cell membrane, which comprises using the quantification method described in (24); (2
6) A compound or a salt thereof that alters the expression level of the G protein-coupled receptor protein according to (1), which can be obtained by using the screening method according to (1), (29) which is obtained using the screening method according to (27). A compound or a salt thereof that alters the amount of the G protein-coupled receptor protein according to the above (1) in a cell membrane that can be obtained;
(30) a medicament comprising the compound of (28) or a salt thereof, (31) a medicament comprising the compound of (29) or a salt thereof, (32) a central disease, an inflammatory disease, (13), (15), (20), which is an agent for preventing or treating endocrine disease, metabolic disease, cancer, cardiovascular disease, respiratory disease, digestive system disease, immune system disease or infectious disease (30) or the medicine according to (31), (33) a mammal, the above (19), (28) or (2)
9) central disease, inflammatory disease, endocrine disease, metabolic disease, cancer, circulatory disease, respiratory disease, digestive disease, characterized by administering an effective amount of the compound or a salt thereof according to the present invention.
(34) Central disease, inflammatory disease, endocrine disease, metabolic disease, cancer, cardiovascular disease, respiratory disease, digestive disease, immune system disease or infection (19), (2) for producing a prophylactic / therapeutic agent for
8) or use of the compound or a salt thereof described in (29).

[0007] Further, (35) the protein may have one or more (preferably one or more) amino acids in the amino acid sequence represented by SEQ ID NO: 1;
About 30 amino acids, more preferably about 1 to 10 amino acids, still more preferably several (1 to 5) amino acids, and 1 or 2 amino acids in the amino acid sequence represented by SEQ ID NO: 1. Above (preferably about 1 to 30, more preferably about 1 to 10, more preferably several (1 to 5
)) In the amino acid sequence represented by SEQ ID NO: 1, or 1 or more (preferably about 1 to 30, more preferably about 1 to 10, and still more preferably G protein-coupled receptor protein or a salt thereof according to the above (1), which is a protein containing an amino acid sequence in which (1 to 5) amino acids have been substituted with other amino acids, or an amino acid sequence obtained by combining them. (36) The ligand according to (16), wherein the G protein-coupled receptor protein or salt thereof according to (1) or the partial peptide or salt thereof according to (3) is contacted with a test compound. (37) the ligand is, for example,
Tyramine, β-phenylethylamine, tryptamine,
Octopamine, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin,
Melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (eg,
PACAP27, PACAP38), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, GHRH, CRF, ACTH, GRP, PT
H, VIP (basoactive intestinal polypeptide), somatostatin, dopamine, motilin,
Amylin, bradykinin, CGRP (calcitonin gene relayed peptide), leukotriene, pancreastatin, prostaglandin, thromboxane,
Adenosine, adrenaline, chemokine superfamily (eg, IL-8, GROα, GROβ, GROγ,
NAP-2, ENA-78, GCP-2, PF4, IP
10, CXC chemokine subfamily such as Mig, PBSF / SDF-1, MCAF / MCP-1, MCP-2, MCP-3, M
CP-4, eotaxin, RANTES, MIP-1α, M
IP-1β, HCC-1, MIP-3α / LARC, MIP-3β / EL
C, I-309, TARC, MIPF-1, MIPF-2 / eota
xin-2, MDC, DC-CK1 / PARC, CC chemokine subfamily such as SLC; C chemokine subfamily such as lymphotactin; CX3C chemokine subfamily such as fractalkine, etc.), endothelin, enterogastrin, histamine, neurotensin, TRH, The method for determining the ligand according to the above (36), which is a pancreatic polypeptide, galanin, lysophosphatidic acid (LPA) or sphingosine 1-phosphate,

(38) (i) contacting a ligand with a G protein-coupled receptor protein or a salt thereof described in (1) above or a partial peptide or a salt thereof described in (3) above; Comparing the G protein-coupled receptor protein or the salt thereof described in the above (1) or the partial peptide or the salt thereof described in the above (3) with a ligand and a test compound. (17) The screening method described in (17), wherein the labeled ligand is brought into contact with the G protein-coupled receptor protein described in (1) above or a salt thereof or the partial peptide described in (3) above or a salt thereof. And (ii) converting the labeled ligand and test compound to the G protein-coupled receptor protein or a salt thereof according to (1) above. Or the G protein-coupled receptor protein or a salt thereof described in the above (1) of the labeled ligand or the partial peptide or a salt thereof described in the above (3) when brought into contact with the partial peptide or the salt thereof according to the above (3). (40) a method for screening a compound or a salt thereof that changes the binding property between a ligand and a G protein-coupled receptor protein or a salt thereof according to the above (1), wherein the amount of binding to a ligand is measured and compared; i) when the labeled ligand is brought into contact with cells containing the G protein-coupled receptor protein described in (1) above, and (ii) when the labeled ligand and the test compound are brought into contact with the G protein described in (1) above.
A ligand characterized by measuring and comparing the amount of a labeled ligand bound to a cell containing a protein-coupled receptor protein when brought into contact with the cell, and comparing the ligand with the G protein-coupled receptor protein according to (1) above. Or a method for screening a compound or a salt thereof that alters the binding property to a salt thereof, (41) (i) contacting a labeled ligand with a membrane fraction of a cell containing the G protein-coupled receptor protein described in (1) above. And (ii) contacting the labeled ligand and the test compound with the membrane fraction of the cell containing the G protein-coupled receptor protein described in (1) above. The amount of binding to the fraction is measured and compared with the ligand and the G protein described in (1) above. A method of screening a compound or its salt that alters the binding property between the mold receptor protein or a salt thereof,

(42) (i) converting the labeled ligand into the above (8)
Culturing the above-described transformant to bring it into contact with a G protein-coupled receptor protein expressed on the cell membrane of the transformant; Measuring the amount of binding of the labeled ligand to the G protein-coupled receptor protein when the transformant is brought into contact with the G protein-coupled receptor protein expressed on the cell membrane of the transformant, and comparing the amounts. (43) (i) a method for screening a compound or a salt thereof that alters the binding property between the characteristic ligand and the G protein-coupled receptor protein or a salt thereof according to the above (1); A compound that activates the type receptor protein or a salt thereof, And (ii) a compound that activates the G protein-coupled receptor protein or a salt thereof described in (1) and a test compound described in (1) above. A ligand characterized by measuring and comparing cell stimulating activity mediated by a G protein-coupled receptor protein when brought into contact with a cell containing a protein-coupled receptor protein, and comparing the ligand with the G protein conjugate according to (1) above. (44) A method for screening a compound or a salt thereof that alters the binding property to a receptor protein or a salt thereof, and (44) a compound for activating the G protein-coupled receptor protein or a salt thereof according to the above (1). G protein expressed on the cell membrane of the transformant by culturing the transformant By contacting the G protein-coupled receptor protein described in the above (1) or a compound activating the salt thereof and a test compound with the transformant described in the above (8). G when it is brought into contact with a G protein-coupled receptor protein expressed on the cell membrane of the transformant
Measuring and comparing the cell stimulating activity mediated by the protein-coupled receptor protein; and a compound or a salt thereof that alters the binding property between the ligand and the G protein-coupled receptor protein or the salt thereof according to the above (1). Screening method,

(45) The compound that activates the G protein-coupled receptor protein according to (1) is tyramine, β-phenylethylamine, tryptamine, octopamine, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, Melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (eg, PAC
AP27, PACAP38), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, GHRH, CRF, ACTH, GRP, PTH, V
IP (basoactive intestinal polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene-related peptide), leukotriene, pancreastatin, prostaglandin, thromboxane, adenosine, adrenaline, chemokine superfamily (Eg, IL-8, GROα, GROβ, GROγ, NA
P-2, ENA-78, GCP-2, PF4, IP1
0, Mig, CXC chemokine subfamily such as PBSF / SDF-1; MCAF / MCP-1, MCP-2, MCP-3, MC
P-4, eotaxin, RANTES, MIP-1α, MI
P-1β, HCC-1, MIP-3α / LARC, MIP-3β / ELC,
I-309, TARC, MIPF-1, MIPF-2 / eotaxin
-2, CC chemokine subfamily such as MDC, DC-CK1 / PARC, SLC; C chemokine subfamily such as lymphotactin; CX3C chemokine subfamily such as fractalkine); endothelin, enterogastrin, histamine, neurotensin, TRH, bread The screening method according to the above (43) or (44), wherein the screening method is a creatic polypeptide, galanin, lysophosphatidic acid (LPA) or sphingosine 1-phosphate;
(46) A compound or a salt thereof that alters the binding between the ligand obtainable by the screening method according to (38) to (45) and the G protein-coupled receptor protein or salt thereof according to (1), (47) A) a compound or a salt thereof that alters the binding property between the ligand obtainable by the screening method according to the above (38) to (45) and the G protein-coupled receptor protein or the salt thereof according to the above (1); A medicament characterized by:

(48) The screening kit according to (18), which comprises a cell containing the G protein-coupled receptor protein according to (1), (49) the G kit according to (1). The screening kit according to the above (18), which comprises a membrane fraction of a cell containing a protein-coupled receptor protein, and (50) the culturing of the transformant according to the above (8), The screening kit according to the above (18), which comprises the G protein-coupled receptor protein expressed in the cell membrane of the transformant, and (51) the screening kit according to the above (48) to (50). A compound or a salt thereof, which can change the binding between the ligand and the G protein-coupled receptor protein or a salt thereof according to the above (1), (52) The above (48) ~
(50) A compound or a salt thereof, which can be obtained by using the screening kit according to (50), which changes the binding property between the ligand and the G protein-coupled receptor protein or salt thereof according to (1). (53) contacting the antibody according to (10) with the G protein-coupled receptor protein according to (1) or the partial peptide or salt thereof according to (3). (1) the method for quantifying the G protein-coupled receptor protein or the partial peptide or the salt thereof according to the above (3); (54) the antibody according to the above (10), a test solution and the labeled above (1); G protein-coupled receptor protein or the above (3)
The partial peptide described above or a salt thereof is reacted competitively, and the labeled G described in (1) above is bound to the antibody.
Measuring the ratio of the protein-coupled receptor protein or the partial peptide or the salt thereof according to (3) above, wherein the G protein-coupled receptor protein according to (1) or (3) above in a test solution.
The method for quantifying the partial peptide or a salt thereof described in (5)
5) After simultaneously or continuously reacting the test solution with the antibody of (10) insolubilized on the carrier and the labeled antibody of (10) above, the activity of the labeling agent on the insolubilized carrier (1) in the test solution, characterized by measuring
And a method for quantifying the G protein-coupled receptor protein described above, the partial peptide described in (3) above, or a salt thereof.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION The G protein-coupled receptor protein of the present invention (hereinafter sometimes abbreviated as receptor protein) is identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 (FIG. 2). A receptor protein containing the same amino acid sequence. The receptor protein of the present invention can be used, for example, in any cells (eg, spleen cells, nerve cells, glial cells, pancreatic β) of humans and mammals (eg, guinea pig, rat, mouse, rabbit, pig, sheep, cow, monkey, etc.). Cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, Mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, hepatocytes or stromal cells, Or progenitor cells of these cells, stem cells or cancer cells, etc.), blood cells, or any tissue where these cells are present, such as the brain, various parts of the brain (eg, olfactory bulb, Nucleus, basal sphere, hippocampus, thalamus, hypothalamus, hypothalamus nucleus, cerebral cortex, medulla, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate nucleus, brain stain, substantia nigra Pituitary, stomach, pancreas, kidney, liver, gonad, thyroid, gall bladder,
Bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testicle, testis, ovary, placenta, uterus, It may be a protein derived from bone, joint, skeletal muscle, etc.
It may also be a synthetic protein.

The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 is, for example, about 50% or more, preferably about 60% or more, more than the amino acid sequence represented by SEQ ID NO: 1. The amino acid sequence preferably has about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more homology. The protein having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 of the present invention has, for example, an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1. However, a protein having substantially the same activity as the amino acid sequence represented by SEQ ID NO: 1 is preferable. Examples of substantially the same activity include a ligand binding activity and a signal transduction action. Substantially the same indicates that their activities are the same in nature. Therefore,
It is preferable that the activities such as ligand binding activity and signal transduction action are equivalent (eg, about 0.01 to 100 times, preferably about 0.5 to 20 times, more preferably about 0.5 to 2 times),
Quantitative factors such as the degree of these activities and the molecular weight of the protein may be different. The measurement of the activity such as the ligand binding activity and the signal transduction action can be performed according to a known method. For example, the activity can be measured according to a ligand determination method and a screening method described later.

[0014] The receptor protein of the present invention may be one or more (preferably about 1 to 30, more preferably about 1 to 10, and more preferably 1 to 30 in the amino acid sequence represented by SEQ ID NO: 1). Preferably several (1 to 5
Amino acid sequence), the amino acid sequence represented by SEQ ID NO: 1 or 2 or more (preferably about 1 to 30, more preferably about 1 to 10, and still more preferably An amino acid sequence to which several (1 to 5) amino acids have been added, one or more (preferably about 1 to 30, more preferably 1 to 10) in the amino acid sequence represented by SEQ ID NO: 1 A protein containing an amino acid sequence in which about, more preferably several (1 to 5) amino acids are substituted with another amino acid, or an amino acid sequence obtained by combining them is also used.

In the present specification, the amino acid sequence of the receptor protein is N-terminal (amino terminal) at the left end and C-terminal (carboxyl terminal) at the right end, according to the convention of peptide labeling. The receptor proteins of the present invention, including the receptor protein containing the amino acid sequence represented by SEQ ID NO: 1, have a carboxyl group (-
COOH), carboxylate (-COO ^-), amide (-CONH
₂ ) or an ester (—COOR).
Here, as R in the ester, for example, methyl,
A C _1-6 alkyl group such as ethyl, n-propyl, isopropyl or n-butyl, for example cyclopentyl,
C _3-8 cycloalkyl groups such as cyclohexyl, for example, C _6-12 aryl groups such as phenyl, α-naphthyl,
For example, phenyl-C _1-2 such as benzyl and phenethyl
In addition to an alkyl group or a C _7-14 aralkyl group such as an α-naphthyl-C _1-2 alkyl group such as α-naphthylmethyl, a pivaloyloxymethyl group commonly used as an oral ester and the like are used. When the receptor protein of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the receptor protein of the present invention. As the ester in this case,
For example, the above-mentioned C-terminal ester and the like are used. Further, in the receptor protein of the present invention, the amino group of the methionine residue at the N-terminus in the above-mentioned protein may have a protecting group (for example, C _2-6 such as formyl group or acetyl).
Those protected with a C _1-6 acyl group such as an alkanoyl group), those obtained by cleavage of the N-terminus in vivo and the resulting glutamyl group undergoing pyroglutamine oxidation, substituents on the side chains of amino acids in the molecule ( for example, -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) a suitable protecting group (e.g., formyl group, C _1-6 acyl group such as C _2-6 alkanoyl group such as acetyl ), Or a complex protein such as a so-called glycoprotein to which a sugar chain is bound. As a specific example of the receptor protein of the present invention, for example, a receptor protein containing the amino acid sequence represented by SEQ ID NO: 1 is used.

The partial peptide of the receptor protein of the present invention (hereinafter sometimes abbreviated as a partial peptide) may be any peptide as long as it is a partial peptide of the receptor protein of the present invention. ,
Among the receptor protein molecules of the present invention, those which are exposed outside the cell membrane and have substantially the same activity are used. Here, “substantially the same activity” indicates, for example, ligand binding activity. The measurement of the ligand binding activity can be performed in the same manner as described above. Specifically, the partial peptide of the receptor protein having the amino acid sequence represented by SEQ ID NO: 1 is shown in FIG.
Is a peptide containing a portion analyzed as an extracellular region (hydrophilic site) in the hydrophobicity plot analysis shown in FIG. Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used.
A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used. The number of amino acids of the partial peptide of the present invention is at least 20 or more, preferably 50 or more, more preferably 10 out of the constituent amino acid sequences of the receptor protein of the present invention.
Peptides having 0 or more amino acid sequences are preferred. A substantially identical amino acid sequence refers to an amino acid sequence having about 50% or more, preferably about 60% or more, more preferably about 70% or more, further preferably about 80% or more, and particularly preferably about 90% or more. , Most preferably about 95% or more homology.

Further, the partial peptide of the present invention may comprise one or more (preferably 1 to 10)
About, more preferably several (1 to 5) amino acids are deleted, and 1 or 2 or more (preferably about 1 to 20, more preferably about 1 to 10) More preferably, several (1 to 5) amino acids are added, or one or more (preferably about 1 to 10, more preferably several, and still more preferably 1 to (About 5 amino acids) may be substituted with another amino acid. In the partial peptide of the present invention, the C-terminus may be any of a carboxyl group (—COOH), a carboxylate (—COO ⁻ ), an amide (—CONH ₂ ), or an ester (—COOR) (where R is as defined above). Show the same meaning). When the partial peptide of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the partial peptide of the present invention. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, the partial peptide of the present invention includes the same as the above-described receptor protein of the present invention,
N-terminal methionine residue whose amino group is protected by a protecting group, Gln formed by cleavage of N-terminal side in vivo
Are pyroglutamine-oxidized, those in which the substituent on the side chain of the amino acid in the molecule is protected by an appropriate protecting group, and those in which a sugar chain is bonded, such as a so-called glycopeptide. Examples of the salt of the receptor protein or its partial peptide of the present invention include a physiologically acceptable salt with an acid or a base, and a physiologically acceptable acid addition salt is particularly preferable. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) acid,
Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used.

The receptor protein of the present invention or a salt thereof can also be produced from the above-described method for purifying a receptor protein from human or other mammalian cells or tissues. Alternatively, it can be produced by culturing a transformant containing the DNA. Also,
The protein can also be produced according to the protein synthesis method described later or according thereto. When producing from human or other mammalian tissues or cells, the homogenized human or other mammalian tissues or cells are extracted with an acid or the like, and the resulting extract is subjected to reverse phase chromatography, ion exchange. Purification and isolation can be achieved by combining chromatography such as chromatography.

For the synthesis of the receptor protein of the present invention, its partial peptide, its salt or its amide, a commercially available resin for protein synthesis can be used. Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, and 4-hydroxymethylmethyl. Phenylacetamidomethyl resin, polyacrylamide resin, 4
-(2 ', 4'-dimethoxyphenyl-hydroxymethyl) phenoxy resin and 4- (2', 4'-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin according to various known condensation methods in accordance with the amino acid sequence of the target protein or peptide. At the end of the reaction, a protein or peptide is cleaved from the resin, and at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target protein or partial peptide or an amide thereof. For the condensation of the above protected amino acids, various activating reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. As the carbodiimides, DCC, N, N′-diisopropylcarbodiimide, N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide and the like are used. Activation by these includes racemization inhibiting additives (eg, HOBt, H
The protected amino acid can be directly added to the resin together with OOBt), or can be added to the resin after activating the protected amino acid as a symmetric acid anhydride or HOBt ester or HOOBt ester in advance.

The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the protein condensation reaction. For example, acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone,
Halogenated hydrocarbons such as methylene chloride and chloroform; alcohols such as trifluoroethanol; sulfoxides such as dimethylsulfoxide; amines such as pyridine; ethers such as dioxane and tetrahydrofuran; nitriles such as acetonitrile and propionitrile. And esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof. The reaction temperature is appropriately selected from a range known to be usable for a protein bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even by repeating the reaction, unreacted amino acids can be acetylated using acetic anhydride or acetylimidazole.

Examples of the protecting group for the amino group of the starting material include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used. The carboxyl group may be, for example, a linear, branched or cyclic alkyl ester such as an alkyl esterified ester (eg, methyl, ethyl, propyl, butyl, tertiary butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl). Aralkyl esterification (eg, benzyl ester, 4-
Nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide, tertiary butoxycarbonyl hydrazide, trityl hydrazide and the like. . The hydroxyl group of serine can be protected, for example, by esterification or etherification.
As a group suitable for the esterification, for example, a lower alkanoyl group such as an acetyl group, an aroyl group such as a benzoyl group, a group derived from carbonic acid such as a benzyloxycarbonyl group and an ethoxycarbonyl group, and the like are used.
Examples of groups suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group. As a protecting group for the phenolic hydroxyl group of tyrosine,
For example, Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br-Z, tertiary butyl and the like are used.
As a protecting group for imidazole of histidine, for example,
Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum,
Boc, Trt, Fmoc and the like are used.

Examples of the activated carboxyl group of the raw material include, for example, a corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-
And esters with hydroxyphthalimide and HOBt). As the activated amino group of the raw material, for example, a corresponding phosphoric amide is used.
As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a stream of hydrogen in the presence of a catalyst such as Pd-black or Pd-carbon, hydrogen fluoride anhydride, methanesulfonic acid, trifluoromethane, etc. Acid treatment with dichloromethane, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., reduction with sodium in liquid ammonia, and the like are also used. The elimination reaction by the acid treatment is generally performed at a temperature of about -20 ° C to 40 ° C. In the acid treatment, for example, anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4 -Addition of a cation scavenger such as butanedithiol, 1,2-ethanedithiol and the like is effective. Also, the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of the functional group which should not be involved in the reaction of the starting material, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining an amide form of a protein, for example, first, after protecting the α-carboxyl group of the carboxy terminal amino acid by amidation, the peptide (protein) chain is extended to a desired chain length on the amino group side, A protein from which only the protecting group for the N-terminal α-amino group of the peptide chain has been removed and a protein from which only the protecting group for the carboxyl group at the C-terminal has been removed, and these proteins are mixed in a mixed solvent as described above. To condense. Details of the condensation reaction are the same as described above. After purifying the protected protein obtained by the condensation, all the protecting groups are removed by the above-mentioned method, and a desired crude protein can be obtained. The crude protein is purified using various known purification means, and the main fraction is freeze-dried to obtain an amide of the desired protein. In order to obtain an ester of a protein, for example, after condensing the α-carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, an ester of the desired protein is obtained in the same manner as the amide of the protein be able to.

The partial peptide of the protein of the present invention or a salt thereof can be produced according to a known peptide synthesis method, or by cleaving the protein of the present invention with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the protein of the present invention with the remaining portion and, when the product has a protecting group, removing the protecting group. Known methods for condensation and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, NewYork (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten The partial peptide of the present invention can be purified and isolated by a combination of purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the partial peptide obtained by the above method is in a free form, it can be converted to an appropriate salt by a known method. it can.

The polynucleotide encoding the receptor protein of the present invention includes a nucleotide sequence (DNA or R
NA, preferably DNA). The polynucleotide includes DN encoding the receptor protein of the present invention.
A, RNA such as mRNA, which may be double-stranded or single-stranded. If double-stranded, double-stranded DNA,
It may be a double-stranded RNA or DNA: RNA hybrid. In the case of a single strand, it may be a sense strand (ie, a coding strand) or an antisense strand (ie, a non-coding strand). Using a polynucleotide encoding the receptor protein of the present invention, a known experimental medicine special edition `` New PCR and its application '' 15 (7), a method described in 1997 or a method analogous thereto, for example, by a method such as TaqMan PCR, The mRNA of the receptor protein of the present invention can be quantified. Examples of the DNA encoding the receptor protein of the present invention include genomic DNA and genomic DN.
A library, cDNA derived from the cells and tissues described above,
Any of the above-mentioned cDNA library derived from cells and tissues and synthetic DNA may be used. The vectors used for the library are bacteriophage, plasmid, cosmid,
Any of phagemid and the like may be used. In addition, reverse transcriptase polymerase was directly used by preparing a total RNA or mRNA fraction from the above cells and tissues
It can also be amplified by Chain Reaction (hereinafter abbreviated as RT-PCR method). Specifically, as the DNA encoding the receptor protein of the present invention, for example, a DNA containing the base sequence represented by SEQ ID NO: 2
A or D having the base sequence represented by SEQ ID NO: 2
DNA that has DNA that hybridizes with NA under high stringent conditions and encodes a receptor protein having substantially the same activity (eg, ligand binding activity, signal transduction activity, etc.) as the receptor protein of the present invention Any one may be used. Examples of the DNA that hybridizes with the DNA having the nucleotide sequence represented by SEQ ID NO: 2 under high stringency conditions include, for example, about 70% of the nucleotide sequence represented by SEQ ID NO: 2
Above, preferably about 80% or more, more preferably about 90% or more, and still more preferably about 95% or more DNA containing a base sequence having a homology of about 95% or more.

Hybridization can be performed by a known method or a method analogous thereto, for example, Molecular Cloning 2nd (J. Sambrook et al.).
al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions. The high stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM.
At a temperature of about 50 to 70 ° C, preferably about 60 to 65 ° C. In particular, a sodium concentration of about 19 mM and a temperature of about 65
C is most preferred. More specifically, SEQ ID NO:
As the DNA encoding the receptor protein containing the amino acid sequence represented by 1, a DNA containing the base sequence represented by SEQ ID NO: 2 or the like is used. A polynucleotide comprising a part of the base sequence of the DNA encoding the receptor protein of the present invention or a part of the base sequence complementary to the DNA is a DNA encoding the following partial peptide of the present invention. It is used to include not only RNA but also RNA. According to the present invention, an antisense polynucleotide (nucleic acid) capable of inhibiting the replication or expression of a G protein-coupled receptor protein gene is cloned or determined and encodes a G protein-coupled receptor protein. Design based on DNA base sequence information,
Can be synthesized. Such polynucleotides (nucleic acids)
RNA of protein-coupled receptor protein gene
And can inhibit the synthesis or function of the RNA, or regulate the expression of a G protein-coupled receptor protein gene through interaction with a G protein-coupled receptor protein-related RNA. Can be controlled. Polynucleotides that are complementary to a selected sequence of a G protein-coupled receptor protein-related RNA, and that are capable of specifically hybridizing to a G protein-coupled receptor protein-related RNA, can be used in vivo and in vitro. It is useful for regulating and controlling the expression of a protein-coupled receptor protein gene, and is also useful for treating or diagnosing a disease or the like. In addition, the 5 'end hairpin loop, 5' end 6-base pair repeat, 5 'end untranslated region, polypeptide translation start codon, protein coding region, ORF translation stop codon, 3' end of the G protein-coupled receptor protein gene The terminal untranslated region, the 3 ′ terminal palindrome region, and the 3 ′ terminal hairpin loop can be selected as preferred target regions, but any region within the G protein-coupled receptor protein gene can be selected as the target.

The relationship between the target nucleic acid and a polynucleotide complementary to at least a part of the target region, that is, the relationship between the target nucleic acid and a polynucleotide capable of hybridizing with the target is “antisense”. it can. The antisense polynucleotide is 2-deoxy-D-
Polydeoxynucleotides containing ribose, D
-Ribose-containing polynucleotides, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, or other polymers having a non-nucleotide backbone (e.g., commercially available protein nucleic acids and synthetic sequence-specific nucleic acids). Polymer) or other polymer containing a special bond (provided that the polymer contains a nucleotide having a configuration that allows base pairing and base attachment as found in DNA and RNA) and the like. . They are double-stranded DNA,
Single-stranded DNA, double-stranded RNA, single-stranded RNA, and D
NA: RNA hybrid and can be unmodified polynucleotides (or unmodified oligonucleotides), as well as those with known modifications, eg, those with labels known in the art, capped , Methylated, one or more natural nucleotides replaced by analogs, modified intramolecular nucleotides, such as uncharged bonds (eg, methylphosphonates, phosphotriesters, phosphoramidates) , Carbamates, etc.), those having a charged or sulfur-containing bond (eg, phosphorothioate, phosphorodithioate, etc.), such as proteins (nucleases, nuclease inhibitors, toxins,
Antibodies, signal peptides, poly-L-lysine, etc., those having side chain groups such as sugars (for example, monosaccharides), those having interactive compounds (for example, acridine, psoralen, etc.), chelating compounds (Eg, metals, radioactive metals, boron, oxidizing metals, etc.), those containing alkylating agents, those having modified bonds (eg, α-anomeric nucleic acids, etc.) There may be. Here, "nucleoside", "nucleotide", and "nucleic acid" may include not only those containing purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. The modified nucleotides and modified nucleotides may also be modified at the sugar moiety, for example, one or more hydroxyl groups may be replaced with halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may be converted to a group.

The antisense polynucleotide (nucleic acid) of the present invention is RNA, DNA, or a modified nucleic acid (RNA, DNA). Specific examples of modified nucleic acids include, but are not limited to, sulfur derivatives and thiophosphate derivatives of nucleic acids, and those that are resistant to degradation of polynucleoside amides and oligonucleoside amides. The antisense nucleic acid of the present invention can be preferably designed according to the following policy. That is, to make the antisense nucleic acid more stable in the cell, to make the antisense nucleic acid more cell permeable, to have a greater affinity for the target sense strand, and to be more toxic if it is toxic. Minimize the toxicity of sense nucleic acids. Many such modifications are known in the art, for example, J. Kawakami et al., Pharm Tech Japan,
Vol. 8, pp. 247, 1992; Vol. 8, pp. 395, 1992; ST
Crooke et al. Ed., Antisense Research and Applica
tions, CRC Press, 1993. The antisense nucleic acid of the present invention may contain altered or modified sugars, bases or bonds, may be provided in a special form such as liposomes or microspheres, may be applied by gene therapy, It could be provided in an added form. Thus, in the form of addition, polycations such as polylysine which acts to neutralize the charge of the phosphate skeleton, lipids which enhance the interaction with the cell membrane or increase the uptake of nucleic acids ( For example, hydrophobic substances such as phospholipid and cholesterol can be mentioned. Preferred lipids for addition include cholesterol and its derivatives (eg, cholesteryl chloroformate, cholic acid, etc.).
These can be attached to the 3 'end or 5' end of the nucleic acid, and can be attached via a base, sugar, or intramolecular nucleoside bond. Other groups include cap groups specifically arranged at the 3 'end or 5' end of nucleic acids, which are for preventing degradation by nucleases such as exonuclease and RNase. Such capping groups include, but are not limited to, hydroxyl-protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol. The antisense nucleic acid inhibitory activity can be examined using the transformant of the present invention, the in vivo or in vitro gene expression system of the present invention, or the in vivo or in vitro translation system of a G protein-coupled receptor protein. it can. The nucleic acid can be applied to cells by various known methods. The antisense polynucleotide having a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of a polynucleotide (eg, DNA) encoding a protein or a partial peptide used in the present invention includes the polynucleotide of the present invention ( Example, DN
Any antisense polynucleotide having a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of A) and having an action capable of suppressing the expression of the polynucleotide (eg, DNA) Although it may be a nucleotide, antisense DNA is preferred. The nucleotide sequence substantially complementary to the polynucleotide (eg, DNA) of the present invention is, for example, a nucleotide sequence complementary to the polynucleotide (eg, DNA) of the present invention (namely, the complement of the polynucleotide of the present invention). Base sequence having about 70% or more, preferably about 80% or more, more preferably about 90% or more, and most preferably about 95% or more homology with the entire base sequence or partial base sequence of the chain). In particular, of the entire base sequence of the complementary strand of the polynucleotide (eg, DNA) of the present invention, the complementary strand of the base sequence of the portion encoding the N-terminal site of the protein of the present invention (for example, the base sequence near the start codon). And about 70
% Or more, preferably about 80% or more, more preferably about 90%
As described above, antisense polynucleotides having a homology of about 95% or more are most preferable. In particular,
A nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of the DNA having the nucleotide sequence represented by SEQ ID NO: 2,
Or an antisense polynucleotide having a part thereof. 5 'untranslated region or 3'
Antisense polynucleotides having a base sequence complementary to or substantially complementary to the base sequence of the untranslated region (preferably the 5 ′ untranslated region), or an antisense polynucleotide having a part thereof are included. Specifically, a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of DNA having the nucleotide sequence represented by SEQ ID NO: 6 or 7 (preferably SEQ ID NO: 6), or An antisense polynucleotide having a part thereof is also included. Antisense polynucleotide is usually about 10 to 40, preferably
It is composed of about 15 to 30 bases. In order to prevent degradation by a hydrolase such as nuclease, a phosphate residue (phosphate) of each nucleotide constituting the antisense polynucleotide is, for example, phosphorothioate,
It may be substituted by a chemically modified phosphate residue such as methylphosphonate or phosphorodithionate. These antisense polynucleotides can be produced using a known DNA synthesizer or the like.

DNA encoding the partial peptide of the present invention
May be any as long as it contains a base sequence encoding the above-described partial peptide of the present invention. In addition, any of genomic DNA, genomic DNA library, cDNA derived from the above-mentioned cells / tissues, cDNA library derived from the above-mentioned cells / tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, RT-P
It can also be amplified by the CR method. Specifically, the DNA encoding the partial peptide of the present invention includes, for example, (1) a DNA having a base sequence represented by SEQ ID NO: 2
A DNA having a partial nucleotide sequence of NA, or (2) a DNA that hybridizes with the DNA represented by SEQ ID NO: 2 under high stringent conditions, and has substantially the same activity as the protein peptide of the present invention. Having a partial base sequence of DNA encoding a protein having, for example, a ligand binding activity, a signal transduction action, etc.
A or the like is used. DN hybridizing with the DNA represented by SEQ ID NO: 2 under high stringent conditions
As A, for example, a base having about 70% or more, preferably about 80% or more, more preferably about 90% or more, and still more preferably about 95% or more homology with the base sequence represented by SEQ ID NO: 2. DNA containing a sequence or the like is used.

As a means for cloning a DNA that completely encodes the receptor protein of the present invention or a partial peptide thereof (hereinafter sometimes abbreviated as the receptor protein of the present invention), the base of the DNA encoding the peptide of the present invention may be used. DNA having partial base sequence of sequence
DNA amplified by the PCR method using primers or incorporated into an appropriate vector is used as a DNA encoding a part or the whole region of the receptor protein of the present invention.
Selection can be performed by hybridization with the fragment A or a fragment labeled with a synthetic DNA.
Hybridization methods are described, for example, in Molecular Cloning 2nd (J. Sambr
ook et al., Cold Spring Harbor Lab. Press, 1989)
And the like. Also,
When a commercially available library is used, it can be performed according to the method described in the attached instruction manual.

The DNA base sequence can be replaced by OD using PCR or a known kit such as Mutan ^™ -superExpress Km (Takara Shuzo) or Mutan ^™ -K (Takara Shuzo).
A known method such as the A-LA PCR method, the gapped duplex method and the Kunkel method, or a method analogous thereto can be used. The DNA encoding the cloned receptor protein can be used as it is depending on the purpose, or can be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. The expression vector for the receptor protein of the present invention may be prepared, for example, by (A) cutting out a DNA fragment of interest from, for example, cDNA containing DNA encoding the receptor protein of the present invention, and (B) placing the DNA fragment in an appropriate expression vector. And ligated downstream of the promoter.

As the vector, plasmids derived from E. coli (eg, pCR4, pCR2.1, pBR322, pBR325, pUC12, pUC1
3), Bacillus subtilis-derived plasmids (eg, pUB110, pTP5, pC1
94), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophage such as λ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., as well as pA1-11, pXT1, pRc / CMV, pRc / RSV , PcDNAI
/ Neo is used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when animal cells are used as hosts, SRα promoter, SV40 promoter, LTR promoter,
CMV promoter, HSV-TK promoter and the like. Among them, CMV promoter, SR
It is preferable to use an α promoter or the like. When the host is Escherichia, trp promoter, la
c promoter, recA promoter, λP _L promoter, lpp promoter, etc., when the host is Bacillus sp. Promoters and ADH promoters are preferred. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.

[0033] In addition to the above, the expression vector may optionally contain an enhancer, a splicing signal, a polyA addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40ori) and the like. Can be used. As a selectable marker, for example, a dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX)
Resistance], an ampicillin resistance gene (hereinafter sometimes abbreviated as Amp ^r ), a neomycin resistance gene (hereinafter referred to as Amp ^r ).
Sometimes abbreviated as Neo ^r, include G418 resistance) and the like. In particular, when the dhfr gene is used as a selection marker using CHO (dhfr ⁻ ) cells, the target gene can be selected using a thymidine-free medium. Also,
If necessary, a signal sequence suitable for the host is added to the N-terminal side of the receptor protein of the present invention. When the host is Escherichia, a PhoA signal sequence;
When the host is Bacillus, the α-amylase signal sequence, the subtilisin signal sequence, and the like are MMP when the host is yeast.
When the host is an animal cell, such as the Fα signal sequence and the SUC2 signal sequence, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule and a signal sequence can be used. A transformant can be produced using the vector containing the DNA encoding the receptor protein of the present invention thus constructed.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of Escherichia bacteria include
Escherichia coli K12 DH1 [Procedings of the National Academy
Of Sciences of the USA (Pro
Natl. Acad. Sci. USA), 60, 160 (1968)], JM1
03 [Nucleic Acids Research
s Research), 9, 309 (1981)], JA221 [Journal of Mol.
ecular Biology)], 120, 517 (1978)], HB101 [Journal of Molecular Biology, 41,
459 (1969)], C600 [Genetics,
39, 440 (1954)], DH5α [Inoue, H., Nojima, H. a
nd Okayama, H., Gene, 96, 23-28 (1990)], DH10B
[Procedings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 87, 4645-4649]
(1990)]. Examples of Bacillus bacteria include, for example, Bacillus subtilis MI1
14 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemis
try), 95, 87 (1984)]. Examples of yeast include Saccharomyces cerevisiae (Saccha
^{romyces cerevisiae) AH22, AH22R -,} 0NA87-11A, DKD-
5D, 20B-12, Schizosaccharomyces pombe (Schizosa
ccharomyces pombe) NCYC1913, NCYC2036, Pichia pastoris and the like are used.

As insect cells, for example, virus is A
In the case of cNPV, a cell line derived from night larvae of larvae (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from eggs of Trichoplusia ni
igh Five ^TM cells, cells derived from Mamestrabrassicae or
Estigmena acrea-derived cells are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mor
iN; BmN cells). Examples of the Sf cells include Sf9 cells (ATCC CRL 1711) and Sf21 cells (Vaughn, JL et al., In Vivo,
13, 213-217 (1977)). As insects, for example, silkworm larvae are used (Maeda et al.,
Nature, Volume 315, 592 (1985)]. As animal cells, for example, monkey cells COS-7, Vero,
Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr ⁻ ) cells), mouse L cells, mouse AtT-20, mouse myeloma cells,
Rat GH3, human FL cells and the like are used.

For transformation of Escherichia, for example, Processing of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69 , 2110 (197
2) and Gene (17), 107 (1982). In order to transform Bacillus sp., For example, Molecular & General Genetic (Molecular & General Genetic)
s), Vol. 168, 111 (1979). To transform yeast, for example, methods in Enzymol
ogy), Volume 194, 182-187 (1991), Procsings
Proc. Natl. Acad. Sc of the National Academy of Sciences of the USA
i. USA), vol. 75, 1929 (1978). To transform insect cells or insects, for example, use Bio / Techno
logy), 6, 47-55 (1988)). To transform animal cells, for example, see Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 26
3-267 (1995) (published by Shujunsha), virology (Virolo)
gy), Vol. 52, 456 (1973). Thus, a transformant transformed with the expression vector containing the DNA encoding the G protein-coupled receptor protein is obtained. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium to be used for the culture. Nitrogen sources, inorganic substances, etc. are contained. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc.As a nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract and the like Examples of the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-43
3, Cold Spring Harbor Laboratory, New York 1972]
Is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added.
When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually performed at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant whose host is yeast,
As a culture medium, for example, Burkholde (Burkholde)
r) Minimal medium [Bostian, KL et al., Processings
Proc. Natl. Acad. Sc of the National Academy of Sciences of the USA
i. USA), Vol. 77, 4505 (1980)] and SD medium containing 0.5% casamino acid [Bitter, GA et al., Prossings of the National Academy of Sciences of the USA]. (Proc. Natl. Acad.
Sci. USA), 81, 5330 (1984)]. Preferably, the pH of the medium is adjusted to about 5-8. The cultivation is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and aeration and stirring are added as necessary.

When culturing an insect cell or a transformant whose host is an insect, Grace's Insect Mediu
m (Grace, TCC, Nature, 195, 788 (1
962)) to which an immobilized additive such as 10% bovine serum is appropriately added. Preferably, the pH of the medium is adjusted to about 6.2-6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or agitation are added. When culturing a transformant whose animal host is an animal cell, examples of the medium include a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122, 501 (1952)], a DMEM medium [Virology, Vol. 8, 396 (1959)],
RPMI 1640 medium [The Journal of the American Medical Association
American Medical Association) 199, 519 (196
7)], 199 medium [Proceding of the Society for the Biological Medicine (Proc
eeding of the Society for the Biological Medicin
e), 73, 1 (1950)]. pH is about 6
~ 8 is preferred. Culture is usually performed at about 30 ° C to 40 ° C.
Run for 15-60 hours, adding aeration and agitation as needed.
As described above, the G protein-coupled receptor protein of the present invention can be produced in the transformant, in the cell membrane, or outside the cell.

The receptor protein of the present invention can be separated and purified from the above culture by, for example, the following method. When extracting the receptor protein of the present invention from cultured cells or cells, after culturing,
The cells or cells are collected by a known method, suspended in an appropriate buffer, and disrupted by ultrasonication, lysozyme, and / or freeze-thawing, etc., and then the crude receptor protein is centrifuged or filtered. A method of obtaining an extract is appropriately used. Protein denaturants such as urea and guanidine hydrochloride, and Triton X-
A surfactant such as 100 ^TM may be included. When the receptor protein is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a known method, and the supernatant is collected. The culture supernatant thus obtained,
Alternatively, the receptor protein contained in the extract can be purified by appropriately combining known separation and purification methods. These known separation and purification methods include:
Methods utilizing solubility such as salting out or solvent precipitation, dialysis, ultrafiltration, gel filtration, SDS-polyacrylamide gel electrophoresis, etc., mainly utilizing differences in molecular weight, ion exchange chromatography A method using a difference in charge such as, a method using a specific affinity such as affinity chromatography, a method using a difference in hydrophobicity such as reversed-phase high-performance liquid chromatography,
A method utilizing the difference between isoelectric points, such as isoelectric focusing, is used.

When the thus obtained receptor protein is obtained in a free form, it can be converted into a salt by a known method or a method analogous thereto. It can be converted to a free form or another salt by a method or a method analogous thereto. The receptor protein produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification. As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The activity of the receptor protein of the present invention or a salt thereof thus produced can be measured by a binding experiment with a labeled ligand, an enzyme immunoassay using a specific antibody, or the like.

The antibody against the receptor protein or its partial peptide or its salt of the present invention may be any of polyclonal antibody and monoclonal antibody as long as it can recognize the receptor protein or its partial peptide or its salt of the present invention. Is also good. An antibody against the receptor protein of the present invention or a partial peptide thereof or a salt thereof (hereinafter, sometimes abbreviated as the receptor protein of the present invention) may be obtained by using the receptor protein of the present invention as an antigen, and using a known antibody or antiserum. It can be manufactured according to the manufacturing method.

[Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The receptor protein of the present invention is administered to a mammal at a site where the antibody can be produced by administration to itself or together with a carrier and a diluent. You. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually performed once every 2 to 6 weeks, for a total of about 2 to 10 times. Examples of the mammal used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, and goats, and mice and rats are preferably used.
When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization. By fusing the contained antibody-producing cells with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting a labeled receptor protein or the like described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation can be performed according to a known method, for example, the method of Kohler and Milstein [Nature, 256, 495 (1975)]. Examples of the fusion promoter include polyethylene glycol (PEG)
And Sendai virus, but preferably P
EG is used. Examples of myeloma cells include NS
-1, P3U1, SP2 / 0, etc., but P3U1
Is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is 1: 1 to 2
0: 1 and PEG (preferably PEG1000 to PEG6
000) is added at a concentration of about 10-80%,
Incubation at about 30 to 37 ° C. for about 1 to 10 minutes enables efficient cell fusion.

Various methods can be used for screening a monoclonal antibody-producing hybridoma. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which an antigen such as a receptor protein is adsorbed directly or together with a carrier. Then, an anti-immunoglobulin antibody labeled with a radioactive substance or an enzyme (an anti-mouse immunoglobulin antibody is used when the cells used for cell fusion are mice) or protein A is added, and the monoclonal antibody bound to the solid phase is added. Detection method: Add hybridoma culture supernatant to solid phase to which anti-immunoglobulin antibody or protein A is adsorbed, add receptor protein etc. labeled with radioactive substance or enzyme, and detect monoclonal antibody bound to solid phase And the like. The selection of the monoclonal antibody can be performed according to a known method or a method analogous thereto.
It can be performed in a medium for animal cells to which T (hypoxanthine, aminopterin, thymidine) is added. As a selection and breeding medium, any medium can be used as long as a hybridoma can grow. For example,
RP containing 1-20%, preferably 10-20% fetal calf serum
An MI1640 medium, a GIT medium containing 1 to 10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) or a serum-free medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.) can be used. The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture can be usually performed under 5% carbon dioxide. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of the monoclonal antibody can be performed by the same method as in the separation and purification of normal polyclonal antibodies, for example, by separation and purification of immunoglobulin [eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, Electrophoresis, adsorption / desorption using an ion exchanger (eg, DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or active antibody such as protein A or protein G to collect only antibodies and dissociate Specific purification method for obtaining an antibody).

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced according to a known method or a method analogous thereto. For example, a complex of an immunizing antigen (an antigen such as the protein of the present invention) and a carrier protein is formed, and a mammal is immunized in the same manner as in the above-described method for producing a monoclonal antibody. The antibody can be produced by collecting an antibody-containing substance against the antibody and separating and purifying the antibody. Regarding a complex of an immunizing antigen and a carrier protein used to immunize a mammal, the type of the carrier protein and the mixing ratio of the carrier and the hapten should be such that the antibody can be efficiently produced against the hapten immunized by crosslinking the carrier. What may be cross-linked at any ratio, for example, bovine serum albumin,
A method is used in which bovine thyroglobulin, keyhole limpet, hemocyanin and the like are coupled in a weight ratio of about 0.1 to 20, preferably about 1 to 5, with respect to 1 hapten. Various coupling agents can be used for coupling the hapten and the carrier. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithioviridyl group, or the like is used. The condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration can usually be performed once every about 2 to 6 weeks, for a total of about 3 to 10 times.
The polyclonal antibody can be collected from blood, ascites, or the like, preferably from blood, of the mammal immunized by the above method. Measurement of polyclonal antibody titer in antiserum
The measurement can be performed in the same manner as the measurement of the antibody titer in serum described above.
The separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as the above-described separation and purification of the monoclonal antibody.

The receptor protein of the present invention or its salt, its partial peptide or its salt, and the DN encoding the receptor protein or its partial peptide
A: (1) Determination of ligand (agonist) for G protein-coupled receptor protein of the present invention;
(2) a prophylactic and / or therapeutic agent for a disease associated with dysfunction of the G protein-coupled receptor protein of the present invention, (3) a gene diagnostic agent, (4) an expression level of the receptor protein of the present invention or a partial peptide thereof. A screening method for a compound to be changed, (5) a preventive and / or therapeutic agent for various diseases containing a compound that changes the expression level of the receptor protein or its partial peptide of the present invention, (6) a G protein-coupled receptor of the present invention Method for quantifying ligand for protein, (7) Screening method for compound (agonist, antagonist, etc.) that alters the binding property between ligand and G protein-coupled receptor protein of the present invention, (8) G protein-coupled receptor of the present invention Compounds that change the binding between protein and ligand (9) a preventive and / or therapeutic agent for various diseases containing
Quantification of the receptor protein of the present invention or its partial peptide or a salt thereof, (10) a method for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in a cell membrane, (11) the receptor protein of the present invention or A prophylactic and / or therapeutic agent for various diseases containing a compound that changes the amount of the partial peptide, (12) neutralization by an antibody against the receptor protein of the present invention or its partial peptide or a salt thereof, (13) G of the present invention It can be used for producing a non-human transgenic animal having a DNA encoding a protein-coupled receptor protein. In particular, by using a receptor binding assay system using the recombinant G protein-coupled receptor protein expression system of the present invention, the binding of a ligand to a G protein-coupled receptor specific to humans or mammals is changed. Compounds (eg, agonists, antagonists, etc.) can be screened, and the agonists or antagonists can be used as agents for preventing or treating various diseases. A receptor protein or a partial peptide of the present invention or a salt thereof (hereinafter sometimes abbreviated as the receptor protein of the present invention), a DNA encoding the receptor protein of the present invention or a partial peptide thereof (hereinafter abbreviated as a DNA of the present invention) The use of antibodies against the receptor protein or the like of the present invention (hereinafter sometimes abbreviated as the antibody of the present invention) will be specifically described below.

(1) Determination of ligand (agonist) for G protein-coupled receptor protein of the present invention The receptor protein of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof is used for the receptor protein of the present invention or a salt thereof. It is useful as a reagent for searching or determining a ligand (agonist). That is, the present invention provides a method for determining a ligand for the receptor protein of the present invention, which comprises contacting the receptor protein of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof with a test compound. As the test compound, known ligands (for example, tyramine, β-phenylethylamine,
Tryptamine, octopamine, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, P
ACAP (eg, PACAP27, PACAP38), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, GHRH, CRF, ACTH,
GRP, PTH, VIP (Vasoactive Intestinal and Related Polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene-related peptide), leukotriene, pancreastatin, prostaglandin, Thromboxane, adenosine, adrenaline, chemokine superfamily (eg, IL-
8, GROα, GROβ, GROγ, NAP-2, EN
A-78, GCP-2, PF4, IP10, Mig, PB
CXC chemokine subfamily such as SF / SDF-1; MCAF
/ MCP-1, MCP-2, MCP-3, MCP-4, eotaxi
n, RANTES, MIP-1α, MIP-1β, HC
C-1, MIP-3α / LARC, MIP-3β / ELC, I-309, T
ARC, MIPF-1, MIPF-2 / eotaxin-2, MDC, DC
-CC chemokine subfamily such as -CK1 / PARC, SLC; C chemokine subfamily such as lymphhotactin;
CX3 chemokine subfamily such as fractalkine), endothelin, enterogastrin, histamine, neurotensin, TRH, pancreatic polypeptide, galanin, lysophosphatidic acid (LP
A), sphingosine 1-phosphate and the like), for example, tissue extracts of humans or other mammals (eg, mice, rats, pigs, cows, sheep, monkeys, etc.),
Cell culture supernatant and the like are used. For example, the tissue extract, cell culture supernatant, or the like is added to the receptor protein of the present invention, and fractionation is performed while measuring cell stimulating activity and the like to finally obtain a single ligand.

Specifically, the ligand determination method of the present invention uses the receptor protein of the present invention or a partial peptide thereof or a salt thereof, or constructs a recombinant receptor protein expression system and uses the expression system. By using the receptor binding assay system that has been used, it binds to the receptor protein of the present invention and exerts cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, intracellular cGMP generation, inositol A compound having an activity of promoting or inhibiting phosphoric acid production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH reduction, etc. (for example, peptide, protein, non-peptidic compound, synthetic) Compounds, fermentation products, etc.) or salts thereof. In the ligand determination method of the present invention, when the receptor protein of the present invention or a partial peptide thereof is brought into contact with a test compound, for example, the amount of the test compound bound to the receptor protein or the partial peptide, the cell stimulating activity, etc. Is measured.

More specifically, the present invention relates to a method for producing a labeled test compound, which comprises contacting the labeled test compound with the receptor protein of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof. Or a method for determining a ligand for a receptor protein of the present invention or a salt thereof, which comprises measuring the amount of binding to a salt thereof, or the partial peptide or a salt thereof, comprising a labeled test compound containing the receptor protein of the present invention. Determining a ligand for the receptor protein of the present invention or a salt thereof, which comprises measuring the amount of a labeled test compound bound to the cell or the membrane fraction when the cell is brought into contact with the cell or the membrane fraction of the cell. Method: A labeled test compound is ligated to the receptor protein of the present invention. When the transformant containing the DNA encoding is contacted with a receptor protein expressed on the cell membrane by culturing, the amount of the labeled test compound bound to the receptor protein or a salt thereof is measured. A method for determining a ligand for the receptor protein of the present invention,

When a test compound is brought into contact with a cell containing the receptor protein of the present invention, cell stimulating activity via the receptor protein (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity to promote or suppress pH reduction, etc.) A method for determining a ligand for a receptor protein of the present invention or a salt thereof, and a test compound, which are expressed on a cell membrane by culturing a transformant containing a DNA encoding the receptor protein of the present invention. Receptor protein when contacted Cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, intracellular cGMP generation, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c- and a method for determining a ligand for the receptor protein of the present invention or a salt thereof, which comprises measuring the activity of promoting or suppressing the activation of fos, the decrease of pH, and the like. In particular, it is preferable to perform the above-mentioned tests after conducting the above-mentioned tests to confirm that the test compound binds to the receptor protein of the present invention.

First, the receptor protein used in the ligand determination method may be any as long as it contains the above-described receptor protein of the present invention or the partial peptide of the present invention. Largely expressed receptor proteins are suitable. The above-described expression method is used for producing the receptor protein of the present invention, and it is preferable to express the DNA encoding the receptor protein in mammalian cells or insect cells. As the DNA fragment encoding the protein portion of interest, cDNA is usually used, but is not necessarily limited thereto. For example, a gene fragment or a synthetic DNA may be used. In order to introduce a DNA fragment encoding the receptor protein of the present invention into host animal cells and express them efficiently, the DNA fragment must be expressed in a nuclear polyhedrosis v. Baculovirus belonging to a baculovirus using an insect as a host.
irus; NPV) polyhedrin promoter, SV40
Derived promoters, retroviral promoters,
Metallothionein promoter, human heat shock promoter, cytomegalovirus promoter, SR
It is preferably incorporated downstream such as the α promoter. The amount and quality of the expressed receptor can be examined by a known method. For example, the literature [Nambi, P .; Et al., The Journal of Biological Chemistry (J. Biol.
Chem.), 267, 19555-19595, 1992].

Therefore, in the ligand determination method of the present invention, the receptor protein of the present invention or its partial peptide or its salt may be a receptor protein or its partial peptide or its salt purified according to a known method. Alternatively, a cell containing the receptor protein or a cell membrane fraction thereof may be used. When cells containing the receptor protein of the present invention are used in the ligand determination method of the present invention, the cells may be immobilized with glutaraldehyde, formalin, or the like. The immobilization method can be performed according to a known method. The cell containing the receptor protein of the present invention refers to a host cell that has expressed the receptor protein of the present invention.
Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells and the like are used. The cell membrane fraction refers to a cell membrane-rich fraction obtained by crushing cells and then obtained by a known method. As a method for crushing cells, a method of crushing cells with a Potter-Elvehjem type homogenizer, crushing with a Waring blender or a polytron (manufactured by Kinematica), crushing with ultrasonic waves, spouting cells from a thin nozzle while applying pressure with a French press, etc. Crushing and the like. For the fractionation of cell membranes, fractionation by centrifugal force such as fractionation centrifugation or density gradient centrifugation is mainly used. For example, the cell lysate is centrifuged at a low speed (500-3000 rpm) for a short period of time (usually about 1 minute to 10 minutes), and the supernatant is further centrifuged at a high speed (15,000 to 30000 rpm), usually for 30 minutes to 2 hours. The resulting precipitate is used as the membrane fraction. The membrane fraction is rich in expressed receptor proteins and membrane components such as cell-derived phospholipids and membrane proteins.

The amount of the receptor protein in the cells containing the receptor protein and in the membrane fraction thereof is preferably 10 ³ to 10 ⁸ molecules per cell, more preferably 10 ⁵ to 10 ⁷ molecules per cell. is there. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which not only enables the construction of a highly sensitive screening system,
A large number of samples can be measured in the same lot. In order to carry out the above-mentioned method for determining a ligand for the receptor protein of the present invention or a salt thereof,
Appropriate receptor protein fractions and labeled test compounds are required. As the receptor protein fraction,
A natural receptor protein fraction or a recombinant receptor fraction having an activity equivalent thereto is desirable. Here, “equivalent activity” refers to equivalent ligand binding activity, signal transduction action, and the like. Labeled test compounds include [ ³ H], [ ¹²⁵ I], [ ¹⁴ C],
Tyramine, β-phenylethylamine, tryptamine, octopamine, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (eg, labeled with [ ³⁵ S]) , PACAP27, PACAP3
8), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, GHRH, CRF, A
CTH, GRP, PTH, VIP (Vasoactive Intestinal and Reited Polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene relayed peptide), leukotriene, pancreastatin, prostaglandin Gin, thromboxane, adenosine, adrenaline, chemokine superfamily (eg, IL-8, GROα, GROβ, GROγ, NA
P-2, ENA-78, GCP-2, PF4, IP1
0, Mig, CXC chemokine subfamily such as PBSF / SDF-1; MCAF / MCP-1, MCP-2, MCP-3, MCP
-4, eotaxin, RANTES, MIP-1α, MIP
-1β, HCC-1, MIP-3α / LARC, MIP-3β / ELC, I
-309, TARC, MIPF-1, MIPF-2 / eotaxin-
2, CC chemokine subfamily such as MDC, DC-CK1 / PARC, SLC; C chemokine subfamily such as lymphotactin; CX3 chemokine subfamily such as fractalkine), endothelin, enterogastrine,
Histamine, neurotensin, TRH, pancreatic polypeptide, galanin, lysophosphatidic acid (LPA), sphingosine 1-phosphate and the like are preferred.

Specifically, in order to carry out the method for determining a ligand for the receptor protein of the present invention or a salt thereof, a cell or a membrane fraction of the cell containing the receptor protein of the present invention is first treated with a buffer suitable for the determination method. To prepare a receptor preparation. The buffer may be any buffer such as a phosphate buffer having a pH of 4 to 10 (preferably pH 6 to 8) or a buffer such as Tris-HCl buffer which does not inhibit the binding between the ligand and the receptor protein. In order to reduce non-specific binding, surfactants such as CHAPS, Tween-80 ^™ (Kao-Atlas), digitonin, deoxycholate and various proteins such as bovine serum albumin and gelatin may be added to the buffer. it can. Furthermore, a protease inhibitor such as PMSF, leupeptin, E-64 (manufactured by Peptide Research Laboratories), pepstatin and the like can be added for the purpose of suppressing the degradation of the receptor or ligand by the protease. To 0.01 to 10 ml of the receptor solution, a fixed amount (5000 to 500,000 cpm) of [ ³ H],
A test compound labeled with [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] or the like is allowed to coexist. A reaction tube containing a large excess of an unlabeled test compound is also prepared to determine the non-specific binding amount (NSB). The reaction is carried out at about 0 ° C. to 50 ° C., preferably at about 4 ° C.
The reaction is carried out at 37 ° C. for about 20 minutes to 24 hours, preferably for about 30 minutes to 3 hours. After the reaction, the mixture is filtered with a glass fiber filter or the like, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or a γ-counter. The count (B-NSB) obtained by subtracting the non-specific binding amount (NSB) from the total binding amount (B) is 0 c
Test compounds above pm can be selected as ligands (agonists) for the receptor proteins of the invention or salts thereof.

In order to carry out the above-mentioned methods (1) to (3) for determining a ligand for the receptor protein of the present invention or a salt thereof, a cell stimulating activity (for example, arachidonic acid release, acetylcholine release, intracellular Ca ^{2 +} Activity to promote or inhibit release, production of intracellular cAMP, production of intracellular cGMP, production of inositol phosphate, fluctuation of cell membrane potential, phosphorylation of intracellular protein, activation of c-fos, decrease in pH, etc.) Can be measured using a known method or a commercially available measurement kit. Specifically, first, cells containing the receptor protein are cultured in a multiwell plate or the like. Prior to ligand determination, replace the medium with a fresh medium or an appropriate buffer that is not toxic to cells, add test compounds, etc., incubate for a certain period of time, and then extract cells or collect supernatant to generate The quantified product is quantified according to each method.
When the production of a substance (for example, arachidonic acid or the like) as an indicator of cell stimulating activity is difficult due to a degrading enzyme contained in a cell, an assay may be performed by adding an inhibitor against the degrading enzyme. In addition, the activity such as cAMP production suppression can be detected as a production suppression effect on cells whose basic production amount has been increased by forskolin or the like.

The kit for determining a ligand that binds to the receptor protein of the present invention or a salt thereof comprises a receptor protein of the present invention or a salt thereof, a partial peptide of the present invention or a salt thereof, a cell containing the receptor protein of the present invention, It contains the membrane fraction of cells containing the receptor protein of the present invention. Examples of the kit for determining a ligand of the present invention include the following. 1. Reagent for ligand determination Measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco) contains 0.0
5% bovine serum albumin (Sigma). The solution may be sterilized by filtration through a 0.45 μm filter and stored at 4 ° C., or may be prepared at use. G Protein-Coupled Receptor Protein Standard CHO cells expressing the receptor protein of the present invention were subcultured on a 12-well plate at 5 × 10 ⁵ cells / well at 37 ° C., 5%
Cultured in CO ₂ , 95% air for 2 days. Labeled test compound A commercially available compound labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], or the like, or labeled by an appropriate method. Stored at ℃
Dilute to 1 μM with the measurement buffer before use. Test compounds that are poorly soluble in water are dissolved in dimethylformamide, DMSO, methanol and the like. Unlabeled test compound The same as the labeled compound is prepared at a concentration 100 to 1000 times higher.

2. Measurement method The CHO cells expressing the receptor protein of the present invention cultured on a 12-well tissue culture plate were mixed with 1 m of a buffer solution for measurement.
After washing twice with 1 l, add 490 μl of measurement buffer to each well. 5 μl of the labeled test compound is added and reacted at room temperature for 1 hour. To determine the amount of non-specific binding, add 5 μl of unlabeled test compound. Remove the reaction solution and wash three times with 1 ml of washing buffer. The labeled test compound bound to the cells was treated with 0.2N NaOH
Dissolve in -1% SDS and mix with 4 ml of liquid scintillator A (Wako Pure Chemical Industries). Radioactivity is measured using a liquid scintillation counter (manufactured by Beckman Coulter).

The ligand capable of binding to the receptor protein of the present invention or a salt thereof includes, for example,
Substances specifically present in the brain, large intestine, small intestine, pancreas, ovaries and the like, specifically, tyramine, β-phenylethylamine, tryptamine, octopamine, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, Serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (eg, PACAP27, PAC
AP38), secretin, glucagon, calcitonin,
Adrenomedullin, somatostatin, GHRH, CR
F, ACTH, GRP, PTH, VIP (Vasoactive Intestinal and Reited Polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene-related peptide), leukotriene, pancreastatin, Prostaglandin, thromboxane, adenosine, adrenaline, chemokine superfamily (eg, IL-8, GROα, GROβ, GROγ, NA
P-2, ENA-78, GCP-2, PF4, IP1
0, Mig, CXC chemokine subfamily such as PBSF / SDF-1; MCAF / MCP-1, MCP-2, MCP-3, MC
P-4, eotaxin, RANTES, MIP-1α, MI
P-1β, HCC-1, MIP-3α / LARC, MIP-3β / ELC,
I-309, TARC, MIPF-1, MIPF-2 / eotaxin
-2, CC chemokine subfamily such as MDC, DC-CK1 / PARC, SLC; C chemokine subfamily such as lymphotactin; CX3 chemokine subfamily such as fractalkine); endothelin, enterogastrin, histamine, neurotensin, TRH, bread Createtic polypeptide, galanin, lysophosphatidic acid (LPA), sphingosine 1-phosphate and the like are used.

(2) Preventive and / or therapeutic agent for diseases associated with dysfunction of the G protein-coupled receptor protein of the present invention In the above method (1), if the ligand for the receptor protein of the present invention becomes clear, Depending on the action of the ligand, the receptor protein of the present invention or a DNA encoding the receptor protein
Can be used as a medicament such as an agent for preventing and / or treating a disease associated with dysfunction of the receptor protein of the present invention. For example, when there is a patient in whom the physiological activity of the ligand cannot be expected because the receptor protein of the present invention is reduced in the living body (deficiency of the receptor protein), the receptor protein of the present invention is administered to the patient and By replenishing the amount of the protein, (a) administering the DNA encoding the receptor protein of the present invention to the patient and expressing it, or (ii) transforming the DNA encoding the receptor protein of the present invention into target cells. After the insertion and expression, the cells can be transplanted into the patient, for example, to increase the amount of receptor protein in the patient's body, so that the effect of the ligand can be sufficiently exerted. That is, the DNA encoding the receptor protein of the present invention is useful as a safe and low-toxic agent for preventing and / or treating diseases associated with dysfunction of the receptor protein of the present invention. The receptor protein of the present invention is a G protein-coupled receptor protein, a neurotransmitter receptor (Biochem. Bioph.
ys. Res. Commun. 242 (3), 575-578 (1998)), which shows a homology of about 44% at the amino acid sequence level.
It is a transmembrane receptor protein. The receptor protein of the present invention or a DNA encoding the receptor protein may be used for central diseases (eg, Alzheimer's disease, dementia, eating disorders, etc.), inflammatory diseases (eg, allergy, asthma, rheumatism, etc.), endocrine diseases (eg, hypertension) Disorders, gonadal dysfunction, thyroid dysfunction, pituitary dysfunction, etc.), metabolic disorders (e.g., diabetes, dyslipidemia, hyperlipidemia, etc.), cancer (e.g., non-small cell lung cancer, ovarian cancer, prostate cancer, Gastric cancer, bladder cancer, breast cancer, cervical cancer, colon cancer, rectal cancer, etc., cardiovascular diseases (eg, hypertension, cardiac hypertrophy, angina, myocardial infarction, arteriosclerosis, etc.), respiratory diseases (Eg, airway obstructive disease, infectious lung disease, etc.), gastrointestinal disease (eg, gastric ulcer, duodenal ulcer, gastritis, reflux esophagitis, etc.), immune system disease (eg, autoimmune disease, etc.), sensation Diseases (e.g., immune dysfunction, pneumonia, influenza, etc.) useful in the prevention and / or treatment of such. When the receptor protein of the present invention is used as the above-mentioned prophylactic / therapeutic agent, it can be formulated according to conventional means. On the other hand, when a DNA encoding the receptor protein of the present invention (hereinafter sometimes abbreviated as the DNA of the present invention) is used as the above-mentioned prophylactic / therapeutic agent, the DNA of the present invention may be used alone or in a retroviral vector, an adenovirus or an adenovirus. After insertion into a suitable vector such as a vector or an adenovirus-associated virus vector, it can be carried out according to a conventional method. The DNA of the present invention can be administered as it is or together with an auxiliary agent for promoting uptake by a gene gun or a catheter such as a hydrogel catheter. For example, the receptor protein of the present invention or DNA encoding the receptor protein can be used as a sugar-coated tablet, capsule, elixir, microcapsule, etc., orally, or water or other pharmaceutical agent, if necessary. It can be used parenterally in the form of injections, such as sterile solutions or suspensions in liquids that are acceptable. For example,
The receptor protein of the present invention or the DNA encoding the receptor protein is required to carry out a generally accepted formulation with known physiologically recognized carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders and the like. Can be prepared by admixing in a unit dosage form. The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. For example, a leavening agent such as sucrose, a lubricant such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (for example, D-sorbitol, D-mannitol, sodium chloride, and the like) and the like are used. For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate)
80 ^TM , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservative (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, it is administered to humans and other mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). can do. The dosage of the receptor protein of the present invention varies depending on the administration subject, target organ, condition, administration method, and the like. In the case of oral administration, for example, in a cancer patient (as 60 kg), it is generally about 0.1-100
mg, preferably about 1.0-50 mg, more preferably about 1.0 mg
2020 mg. When administered parenterally, 1
The dosage may vary depending on the administration subject, target organ, symptom, administration method, and the like. For example, usually in the form of an injection, for example, about 0.01 to 30 mg per day for a cancer patient (as 60 kg), It is convenient to administer preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. 60 for other animals
An amount converted per kg can be administered. The dose of the DNA of the present invention varies depending on the administration subject, target organ, condition, administration method, and the like. However, in the case of oral administration, generally, for example, in a cancer patient (as 60 kg), about 0.1-100 mg, preferably about 1.0-50 m
g, more preferably about 1.0-20 mg. When administered parenterally, the single dose varies depending on the administration subject, target organ, symptoms, administration method, and the like.
Usually in the form of injections, for example, cancer patients (as 60 kg)
Is about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg per day.
Conveniently, about g is administered by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(3) Gene Diagnostic Agent The DNA of the present invention can be used as a probe to produce human or other mammals (eg, rat, mouse, rabbit, sheep, pig, cow, cat, dog, monkey, etc.). Can detect abnormalities (genetic abnormalities) in DNA or mRNA encoding the receptor protein of the present invention or partial peptides thereof in, for example, damage, mutation, or reduced expression of the DNA or mRNA, or DNA or mRNA. It is useful as a diagnostic agent for genes such as an increase in expression or overexpression. The above-described genetic diagnosis using the DNA of the present invention can be performed, for example, by the known Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, p. 874-879 (198
9 years), Proceedings of the National Academy of Sciences o
f the United States of America), Vol. 86, 2766-27
70 (1989)).

(4) Method for Screening Compounds that Alter the Expression of Receptor Protein or Partial Peptide of the Present Invention The DNA of the present invention can be used as a probe to
It can be used for screening a compound that changes the expression level of the receptor protein of the present invention or its partial peptide. That is, the present invention provides, for example, the receptor protein of the present invention or a portion thereof contained in (i) blood of a non-human mammal, a specific organ, a tissue or cell isolated from an organ, or (ii) a transformant or the like. A method for screening a compound that changes the expression level of the receptor protein of the present invention or a partial peptide thereof by measuring the mRNA level of the peptide is provided.

The measurement of the mRNA amount of the receptor protein of the present invention or its partial peptide is specifically carried out as follows. (I) a normal or disease model non-human mammal (eg, mouse, rat, rabbit, sheep,
Pigs, cows, cats, dogs, monkeys, etc., more specifically, dementia rats, obese mice, arteriosclerotic rabbits, tumor-bearing mice, etc.) against drugs (eg, anti-dementia drugs,
After applying certain stresses such as anticancer drugs, antiobesity drugs, etc. or physical stress (eg, flooding stress, electric shock, light / dark, low temperature, etc.), blood or specific organs (eg, brain, lung, colon, etc.) ) Or tissue or cells isolated from an organ. The mRNA of the receptor protein of the present invention or its partial peptide contained in the obtained cells can be quantified by, for example, extracting mRNA from cells or the like by a conventional method and using, for example, a technique such as TaqMan PCR. The analysis can also be performed by performing a Northern blot by a known means. (Ii) A transformant expressing the receptor protein of the present invention or its partial peptide is prepared according to the above method, and the mRNA of the receptor protein of the present invention or its partial peptide contained in the transformant is similarly quantified. Can be analyzed.

The screening for a compound that alters the expression level of the receptor protein or its partial peptide of the present invention can be performed by (i) a predetermined time before a drug or physical stress is applied to a normal or disease model non-human mammal ( 30 minutes to 24 hours ago, preferably 30 minutes to 12 hours ago, more preferably 1 hour to 6 hours ago or after a certain time (30 minutes to 3 days later, preferably 1 hour to 2 days later, More preferably after 1 hour to 24 hours), or administering the test compound simultaneously with the drug or physical stress,
After a certain period of time after administration (30 minutes to 3 days, preferably 1
(After 2 hours, more preferably after 1 hour to 24 hours), the amount of mRNA of the receptor protein of the present invention or its partial peptide contained in the cells can be quantified and analyzed, and (ii) the trait When culturing the transformant according to a conventional method, the test compound is mixed in a medium, and after culturing for a certain period of time (after 1 day to 7 days, preferably after 1 day to 3 days, more preferably after 2 days to 3 days). It can be carried out by quantifying and analyzing the mRNA amount of the receptor protein of the present invention or its partial peptide contained in the transformant.

The compound or a salt thereof obtained by using the screening method of the present invention is a compound having an action of changing the expression level of the receptor protein or its partial peptide of the present invention. By increasing the expression level of the receptor protein of the present invention or its partial peptide, the cell stimulating activity via G protein-coupled receptor (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP)
Production, intracellular cGMP production, inositol phosphate production,
Fluctuation of cell membrane potential, phosphorylation of intracellular protein, cf
(b) a compound that enhances the activity of promoting or suppressing os activation, pH reduction, etc.), and (b) reducing the expression level of the receptor protein of the present invention or a partial peptide thereof to reduce the cell stimulating activity. It is a compound that attenuates. Examples of the compound include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, and the like.
Known compounds may be used. The compound that enhances the cell stimulating activity is useful as a safe and low-toxicity drug for enhancing the physiological activity of the receptor protein or the like of the present invention. The compound that attenuates the cell stimulating activity is useful as a safe and low toxic drug for decreasing the physiological activity of the receptor protein of the present invention.

When a compound or a salt thereof obtained by using the screening method of the present invention is used as a pharmaceutical composition, it can be carried out according to a conventional method. For example,
Tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions, and the like can be prepared in the same manner as the above-mentioned pharmaceuticals containing the receptor protein of the present invention. Since the preparation thus obtained is safe and has low toxicity, it is administered to humans and other mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). can do.
The dose of the compound or a salt thereof varies depending on the administration subject, target organ, condition, administration method and the like, but in the case of oral administration, generally, for example, a cancer patient (as 60 kg)
, The amount is about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg per day. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, condition, administration method and the like.
kg) about 0.01 to 30 mg per day
It is convenient to administer the drug by intravenous injection, preferably of the order of about 0.1 to 20 mg, more preferably of the order of about 0.1 to 10 mg. In the case of other animals, the amount can be administered in terms of 60 kg.

(5) Preventive and / or therapeutic agent for various diseases containing a compound that alters the expression level of the receptor protein or its partial peptide of the present invention. It is thought to play some important role in the body. Therefore, the compound that changes the expression level of the receptor protein of the present invention or a partial peptide thereof can be used as an agent for preventing and / or treating a disease associated with dysfunction of the receptor protein of the present invention. When the compound is used as a prophylactic and / or therapeutic agent for a disease associated with dysfunction of the receptor protein of the present invention, it can be formulated according to conventional means. For example, the compound may be a sugar-coated tablet, capsule, elixir, microcapsule, or the like, as needed, orally, or aseptic solution with water or other pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the compound is mixed with known physiologically acceptable carriers, flavoring agents, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of pharmaceutical preparations. Can be manufactured by
The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. Use may be made of bulking agents such as, for example, magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (for example, D-sorbitol, D-mannitol, sodium chloride, and the like) and the like are used. For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate)
80 ^TM , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffering agents (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservative (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, it is administered to humans and other mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). can do. The dose of the compound or a salt thereof varies depending on the administration subject, the target organ, the condition, the administration method, and the like.
g) about 0.1 to 100 mg per day,
Preferably about 1.0-50 mg, more preferably about 1.0-20
mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, symptoms, administration method and the like. , About 0.01 per day
It is convenient to administer about -30 mg, preferably about 0.1-20 mg, more preferably about 0.1-10 mg by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(6) Method for Quantifying Ligands for G Protein-Coupled Receptor Proteins of the Present Invention Since the receptor proteins and the like of the present invention have binding properties to ligands, the ligand concentration in vivo can be determined with high sensitivity. can do. The quantification method of the present invention comprises:
For example, it can be used in combination with a competition method. That is, the ligand concentration in the subject can be measured by bringing the subject into contact with the receptor protein of the present invention or the like. Specifically, for example, it can be used according to the method described below or the like or a method analogous thereto. Edited by Hiro Irie "Radio Immunoassay" (Kodansha, Showa 49
Published by Hiroshi Irie, "Continuing Radio Immunoassay" (Kodansha, Showa)
(Issued in 1954)

(7) Screening method for compounds (agonists, antagonists, etc.) that alter the binding between the G protein-coupled receptor protein and the ligand of the present invention. And the like, and by using a receptor binding assay system using the expression system, a compound (e.g., peptide, protein, non-peptidic compound) that changes the binding property between the ligand and the receptor protein of the present invention. , Synthetic compounds, fermentation products, etc.) or salts thereof can be efficiently screened. Such compounds include (a) cell stimulating activities (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, intracellular cGMP generation, inositollin via G protein-coupled receptor A compound having an activity of promoting or suppressing acid production, fluctuation of cell membrane potential, phosphorylation of intracellular protein, activation of c-fos, reduction of pH, etc. (a so-called agonist for the receptor protein of the present invention), (B) a compound having no cell-stimulating activity (a so-called antagonist to the receptor protein of the present invention), (c) a compound that enhances the binding force between the ligand and the G protein-coupled receptor protein of the present invention, or (d) Binding between ligand and G protein-coupled receptor protein of the present invention Reducing the force, and the like compounds (the compound of the above (b) is preferably screened by the ligand determination methods described above). That is, the present invention relates to (i) a case where the receptor protein of the present invention or its partial peptide or a salt thereof is brought into contact with a ligand; and (ii) a case where the receptor protein of the present invention or its partial peptide or a salt thereof, a ligand and There is provided a method for screening a compound or a salt thereof which changes the binding property between a ligand and a receptor protein or a partial peptide thereof or a salt thereof of the present invention, which is characterized by comparing with the case of contacting with a test compound. In the screening method of the present invention, in the cases (i) and (ii),
For example, the amount of ligand binding to the receptor protein or the like, the cell stimulating activity, and the like are measured and compared.

More specifically, the present invention relates to the case where the labeled ligand is brought into contact with the receptor protein of the present invention, and the case where the labeled ligand and the test compound are brought into contact with the receptor protein of the present invention. Measuring the amount of binding of the labeled ligand to the receptor protein or the like, and comparing the measured amount, and a method for screening a compound or a salt thereof that changes the binding property between the ligand and the receptor protein or the like of the present invention. A cell containing the receptor protein or the like of the present invention or a membrane fraction of the cell, and a labeled ligand and a test compound are added to a cell or a membrane fraction of the cell containing the receptor protein or the like of the present invention. The labeled ligand, when contacted, against the cell or the membrane fraction A method for screening a compound or a salt thereof that changes the binding property between a ligand and a receptor protein or the like of the present invention, which comprises measuring and comparing the amounts of the ligands. The present invention is characterized in that, when a transformant containing the DNA of the present invention is expressed on a cell membrane by culturing a transformant containing the DNA of the present invention, the case where the cell is brought into contact with a receptor protein or the like expressed on the cell membrane by culturing the body. A compound that changes the binding between the ligand and the receptor protein of the present invention, which is characterized by measuring the amount of binding of the labeled ligand to the receptor protein or the like when contacted with the receptor protein or the like; Screening method for its salts,

A compound which activates the receptor protein of the present invention (eg, a ligand for the receptor protein of the present invention) is contacted with a cell containing the receptor protein of the present invention. Cell stimulating activity through the receptor (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release) when a compound that activates the like and a test compound are brought into contact with a cell containing the receptor protein or the like of the present invention. , Intracellular cAMP generation, intracellular c
GMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity to promote or suppress pH reduction, etc.) and compare them. A method for screening a compound or a salt thereof that alters the binding between a ligand that binds to the receptor protein or the like of the present invention, and a compound that activates the receptor protein or the like of the present invention (for example, a ligand for the receptor protein or the like of the present invention) The present invention relates to the case where the transformant containing the DNA of the present invention is cultured and then brought into contact with the receptor protein or the like of the present invention expressed on the cell membrane. Expression on cell membrane by culturing transformant containing DNA Receptor-mediated cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production,
Intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH reduction, etc. promoting or suppressing activities) are measured and compared. The present invention provides a method for screening a compound or a salt thereof, which alters the binding between a characteristic ligand and the receptor protein of the present invention.

Prior to obtaining the receptor protein or the like of the present invention, when screening for a G protein-coupled receptor agonist or antagonist, first, cells, tissues or cell membrane fractions containing the G protein-coupled receptor protein, such as rats, are used. To obtain a candidate compound (primary screening), and then a test (secondary screening) is required to confirm whether the candidate compound actually inhibits the binding of a human G protein-coupled receptor protein to a ligand. there were. If the cell, tissue, or cell membrane fraction is used as it is, other receptor proteins are also mixed, and it has been difficult to actually directly screen for an agonist or antagonist for the target receptor protein. However, for example, by using the human-derived receptor protein of the present invention, primary screening is not required, and a compound that inhibits binding between a ligand and a G protein-coupled receptor protein can be efficiently screened. Furthermore, it is possible to easily evaluate whether the screened compound is an agonist or an antagonist. The specific description of the screening method of the present invention is as follows. First, the receptor protein of the present invention used in the screening method of the present invention may be any as long as it contains the above-described receptor protein of the present invention. Cell membrane fractions of mammalian organs containing are preferred. However, since it is particularly difficult to obtain human-derived organs, human-derived receptor proteins and the like, which are expressed in large amounts using recombinants, are suitable for screening.

The above-mentioned method is used for producing the receptor protein and the like of the present invention, but it is preferable to carry out by expressing the DNA of the present invention in mammalian cells and insect cells. DN encoding the target protein part
Although cDNA is used for the A fragment, it is not necessarily limited thereto. For example, gene fragments or synthetic DN
A may be used. In order to introduce the DNA fragment encoding the receptor protein of the present invention into host animal cells and to express them efficiently, the DNA fragment is required to be converted into a nuclear polyhedrosis virus belonging to baculovirus using an insect as a host. (NPV) polyhedrin promoter, SV40-derived promoter, retrovirus promoter, metallothionein promoter, human heat shock promoter, cytomegalovirus promoter, SRα promoter and the like. The amount and quality of the expressed receptor can be examined by a known method. For example, the literature [Nambi, P .; Et al., The Journal of Biological Chemistry (J. Biol. Chem.), 267, 19555-1
9559, 1992]. Therefore, in the screening method of the present invention, the receptor protein or the like of the present invention may be a receptor protein or the like purified according to a known method, or a cell containing the receptor protein or the like may be used. Alternatively, a membrane fraction of a cell containing the receptor protein or the like may be used.

When cells containing the receptor protein or the like of the present invention are used in the screening method of the present invention, the cells may be immobilized with glutaraldehyde, formalin, or the like. The immobilization method can be performed according to a known method. The cell containing the receptor protein or the like of the present invention refers to a host cell that has expressed the receptor protein or the like, and the host cell is preferably Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, or the like. The cell membrane fraction refers to a cell membrane-rich fraction obtained by crushing cells and then obtained by a known method.
As a method for crushing cells, a method of crushing cells with a Potter-Elvehjem type homogenizer, crushing with a Waring blender or a polytron (manufactured by Kinematica), crushing with ultrasonic waves, spouting cells from a thin nozzle while applying pressure with a French press, etc. Crushing and the like. For the fractionation of cell membranes, fractionation by centrifugal force such as fractionation centrifugation or density gradient centrifugation is mainly used. For example, the cell lysate is centrifuged at a low speed (500-3000 rpm) for a short time (usually about 1-10 minutes), and the supernatant is further centrifuged at a high speed (15000-30,000 rpm) for usually 30 minutes-2 hours. The resulting precipitate is used as the membrane fraction. The membrane fraction contains a large amount of expressed receptor proteins and membrane components such as cell-derived phospholipids and membrane proteins. The amount of the receptor protein in the cell or membrane fraction containing the receptor protein or the like is preferably 10 ³ to 10 ⁸ molecules per cell, and more preferably 10 ⁵ to 10 ⁷ molecules per cell. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction
And a high-sensitivity screening system can be constructed, and a large number of samples can be measured in the same lot.

In order to carry out the above-mentioned (1) to screen for a compound that alters the binding property between the ligand and the receptor protein of the present invention, for example, an appropriate receptor protein fraction and a labeled ligand are required. The receptor protein fraction is preferably a natural receptor protein fraction or a recombinant receptor protein fraction having an activity equivalent thereto. Here, “equivalent activity” refers to equivalent ligand binding activity, signal transduction action, and the like. As the labeled ligand, a labeled ligand, a labeled ligand analog compound, or the like is used. For example, [ ³ H],
Ligands labeled with [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] and the like are used. Specifically, to screen for a compound that alters the binding between a ligand and the receptor protein of the present invention, a cell or a membrane fraction of the cell containing the receptor protein of the present invention is first suitable for screening. To prepare a receptor protein standard. The buffer may be any buffer such as a phosphate buffer having a pH of 4 to 10 (preferably pH 6 to 8) or a buffer such as Tris-HCl buffer which does not inhibit the binding between the ligand and the receptor protein. For the purpose of reducing non-specific binding, a surfactant such as CHAPS, Tween-80 ^™ (Kao-Atlas), digitonin, and deoxycholate can be added to the buffer. Furthermore, a protease inhibitor such as PMSF, leupeptin, E-64 (manufactured by Peptide Research Laboratories), pepstatin and the like can be added for the purpose of suppressing the degradation of the receptor or ligand by the protease. A fixed amount (5000 to 500,000 cpm) of the labeled ligand is added to 0.01 to 10 ml of the receptor solution, and 10 ^-4 to 10 ^-10 M of the test compound is allowed to coexist. A reaction tube containing a large excess of unlabeled ligand is also prepared to determine the amount of non-specific binding (NSB). The reaction is carried out at about 0 ° C. to 50 ° C., preferably at about 4 ° C. to 37 ° C., for about 20 minutes.
The reaction is carried out for a period from minutes to 24 hours, preferably from about 30 minutes to 3 hours. After the reaction, the mixture is filtered with a glass fiber filter or the like, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or a γ-counter. The count (B ₀ −) obtained by subtracting the non-specific binding amount (NSB) from the count (B ₀ ) when there is no antagonistic substance
NSB) as 100%, the specific binding amount (B-NS
For example, a test compound in which B) is 50% or less can be selected as a candidate substance having competitive inhibitory ability.

In order to carry out the above-mentioned methods (1) to (4) for screening for a compound that alters the binding between the ligand and the receptor protein of the present invention, for example, cell stimulating activity via the receptor protein (for example, arachidonic acid release, Promotes acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH reduction, etc. Activity or inhibitory activity) can be measured using a known method or a commercially available measurement kit.
Specifically, cells containing the receptor protein or the like of the present invention are first cultured in a multiwell plate or the like. When performing screening, the cells were exchanged with a fresh medium or an appropriate buffer that does not show toxicity for cells in advance, and test compounds were added and incubated for a certain period of time. The product is quantified according to the respective method. When the production of a substance (for example, arachidonic acid or the like) as an indicator of cell stimulating activity is difficult due to a degrading enzyme contained in a cell, an assay may be performed by adding an inhibitor against the degrading enzyme. In addition, the activity such as cAMP production suppression can be detected as a production suppression effect on cells whose basic production amount has been increased by forskolin or the like. In order to perform screening by measuring the cell stimulating activity, cells expressing an appropriate receptor protein are required. As the cells expressing the receptor protein of the present invention, a cell line having the natural receptor protein of the present invention, a cell line expressing the above-mentioned recombinant receptor protein or the like is desirable. As the test compound, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts and the like are used. Or a known compound.

The screening kit for a compound or a salt thereof that alters the binding property between the ligand and the receptor protein of the present invention includes cells containing the receptor protein of the present invention, cells containing the receptor protein of the present invention, etc.
Or those containing the membrane fraction of cells containing the receptor protein of the present invention. Examples of the screening kit of the present invention include the following. 1. Screening reagent Measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco)
5% bovine serum albumin (Sigma). The solution may be sterilized by filtration through a 0.45 μm filter and stored at 4 ° C., or may be prepared at use. G Protein-Coupled Receptor Standard CHO cells expressing the receptor protein of the present invention were subcultured on a 12-well plate at 5 × 10 ⁵ cells / well at 37 ° C., 5%
Cultured in CO ₂ , 95% air for 2 days. Labeled ligand A commercially available ligand aqueous solution labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], etc., is placed at 4 ° C. or −2
Store at 0 ° C and dilute to 1 μM with measurement buffer before use. Ligand standard solution Ligand is dissolved at 1 mM in PBS containing 0.1% bovine serum albumin (Sigma) and stored at -20 ° C.

2. Measurement method The CHO cells expressing the receptor protein of the present invention cultured on a 12-well tissue culture plate were mixed with 1 m of a buffer solution for measurement.
After washing twice with 1 l, add 490 μl of measurement buffer to each well. After adding 5 μl of a test compound solution of 10 ⁻³ to 10 ⁻¹⁰ M, 5 μl of a labeled ligand is added, and the mixture is reacted at room temperature for 1 hour. To determine the amount of non-specific binding, 5 μl of 10 ⁻³ M ligand is added instead of the test compound. Remove the reaction solution and wash three times with 1 ml of washing buffer. The labeled ligand bound to the cells was 0.2N NaOH-
Dissolve in 1% SDS and add 4 ml of liquid scintillator A
(Made by Wako Pure Chemical Industries). The radioactivity was measured using a liquid scintillation counter (manufactured by Beckman Coulter, Inc.).
m Binding (PMB) is obtained by the following equation. PMB = [(B−NSB) / (B ₀ −NSB)] × 100 PMB: Percent Maximum Binding B: Value when a sample is added NSB: Non-specific Binding (non-specific binding amount) B ₀ : Maximum binding amount

The compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is a compound having an action of changing the binding between a ligand and the receptor protein of the present invention. (A) Cell stimulating activity via G protein-coupled receptors (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, A compound having an activity of promoting or inhibiting intracellular protein phosphorylation, activation of c-fos, lowering of pH, etc. (a so-called agonist for the receptor protein of the present invention); Having no (e.g., the so-called (Agonist)), (c) a compound that enhances the binding force between the ligand and the G protein-coupled receptor protein of the present invention, or (d) a compound that decreases the binding force between the ligand and the G protein-coupled receptor protein of the present invention. is there. Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, and a fermentation product. These compounds may be a novel compound or a known compound. Since the agonist for the receptor protein or the like of the present invention has the same activity as the physiological activity of the ligand for the receptor protein or the like of the present invention, it is useful as a safe and low-toxic drug according to the ligand activity. Since the antagonist to the receptor protein or the like of the present invention can suppress the physiological activity of the ligand to the receptor protein or the like of the present invention, it is useful as a safe and low-toxic drug for suppressing the ligand activity. A compound that enhances the binding force between the ligand and the G protein-coupled receptor protein of the present invention includes:
It is useful as a safe and low toxic drug for enhancing the physiological activity of the ligand for the receptor protein or the like of the present invention. The compound that decreases the binding force between the ligand and the G protein-coupled receptor protein of the present invention is useful as a safe and low toxic drug for reducing the physiological activity of the ligand for the receptor protein of the present invention.

When a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned pharmaceutical composition, it can be carried out according to a conventional method. For example, tablets, capsules, elixirs, microcapsules, tablets and capsules in the same manner as the above-mentioned drug containing the receptor protein of the present invention.
It can be a sterile solution, suspension or the like. The preparations obtained in this way are safe and have low toxicity. Can be. The dose of the compound or a salt thereof varies depending on the administration subject, the target organ, the condition, the administration method, and the like. About 0.1 ~
100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, condition, administration method and the like. It is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg per day by intravenous injection. 60k for other animals
The amount converted per g can be administered.

(8) Preventive and / or therapeutic agent for various diseases containing a compound (agonist, antagonist) that changes the binding property between the G protein-coupled receptor protein and the ligand of the present invention. As described above, for example, it is considered that they play some important roles in vivo such as central function, circulatory function, digestive function, and cardiac function. Therefore, compounds (agonists, antagonists) that alter the binding between the receptor protein of the present invention and the ligand
And ligands for the receptor protein of the present invention,
It can be used as a prophylactic and / or therapeutic agent for diseases associated with dysfunction of the receptor protein of the present invention. When the compound or ligand is used as a prophylactic and / or therapeutic agent for a disease associated with dysfunction of the receptor protein of the present invention, it can be formulated according to conventional means. For example, the compound or ligand may be sugar-coated tablets, capsules, elixirs,
It can be used orally as microcapsules or the like, or parenterally in the form of injections such as sterile solutions or suspensions with water or other pharmaceutically acceptable liquids. For example, the compound may be a known physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer,
It can be manufactured by mixing with a binder and the like in a unit dosage form generally required for the practice of a pharmaceutical preparation. The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. For example, a leavening agent such as sucrose, a lubricant such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (for example, D-sorbitol, D-mannitol, sodium chloride, and the like) and the like are used. For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate)
80 ^TM , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservatives (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Furthermore, the above-mentioned prophylactic / therapeutic agent can be used in combination with an appropriate drug, for example, as a DDS preparation specifically targeting an organ or tissue in which the receptor protein of the present invention is highly expressed. Since the preparation thus obtained is safe and has low toxicity, it is administered to humans and other mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). can do. The dose of the compound or a salt thereof varies depending on the administration subject, the target organ, the condition, the administration method, and the like. It is about 0.1-100 mg, preferably about 1.0-50 mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose depends on the subject, target organ, symptoms,
For example, in the form of an injection, it is usually about 0.01 to 30 mg, preferably about 0.1 to 30 mg per day for a cancer patient (as 60 kg).
It is convenient to administer about 20 mg, more preferably about 0.1-10 mg, by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(9) Quantification of the Receptor Protein of the Present Invention or its Partial Peptide or Its Salt Since the antibody of the present invention can specifically recognize the receptor protein or the like of the present invention, Can be used for quantification of receptor protein and the like, particularly quantification by sandwich immunoassay. That is, the present invention provides, for example, (i) reacting the antibody of the present invention with a test solution and a labeled receptor protein in a competitive manner, and measuring the ratio of the labeled receptor protein bound to the antibody. A method for quantifying the receptor protein or the like of the present invention in a test solution, and (ii) simultaneously or sequentially using the test solution and the antibody of the present invention and the labeled antibody of the present invention insolubilized on a carrier. And then measuring the activity of the labeling agent on the insolubilized carrier, thereby providing a method for quantifying the receptor protein of the present invention in a test solution. In the above (ii), it is preferable that one antibody is an antibody that recognizes the N-terminal of the receptor protein or the like of the present invention, and the other antibody is an antibody that reacts with the C-terminal of the receptor protein or the like of the present invention. .

The receptor protein and the like of the present invention can be measured using a monoclonal antibody against the receptor protein and the like of the present invention (hereinafter, sometimes referred to as the monoclonal antibody of the present invention). it can. For these purposes, the antibody molecule itself may be used, and F (ab ') ₂ , Fa
The b ′ or Fab fraction may be used. The assay method using an antibody against the receptor protein or the like of the present invention is not particularly limited, and may be an antibody, an antigen, or an antibody-antigen complex corresponding to the amount of an antigen (eg, the amount of a receptor protein) in a test solution. Any measurement method may be used as long as the amount is detected by chemical or physical means and the amount is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephelometry, competition method, immunometric method and sandwich method are suitably used, but it is particularly preferable to use the sandwich method described later in terms of sensitivity and specificity. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. As the radioisotope, for example, [ ¹²⁵
I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like. As the above enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, a luminol derivative, luciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing or immobilizing proteins or enzymes may be used. As the carrier, for example, insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, and glass are used. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with the labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity, the amount of the receptor protein of the present invention in the test solution can be determined. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times. The labeling agent and the method of insolubilization can be based on those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. In the method for measuring a receptor protein or the like by the sandwich method of the present invention, the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction is preferably an antibody having a different binding site to the receptor protein or the like. That is, the antibody used in the primary reaction and the secondary reaction, for example, the antibody used in the secondary reaction,
In the case of recognizing the C-terminal of the receptor protein, an antibody used in the primary reaction is preferably an antibody which recognizes other than the C-terminal, for example, an N-terminal.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, a nephelometry and the like. In the competitive method, the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, and then the unreacted labeled antigen is reacted with the antigen.
(F) and the labeled antigen (B) bound to the antibody are separated (B / F
Separation), the amount of any of B and F is measured, and the amount of antigen in the test solution is quantified. In this reaction method, a soluble antibody is used as an antibody, B / F separation is performed using polyethylene glycol, a liquid phase method using a second antibody to the above antibody, or a solid-phased antibody is used as the first antibody, or A solid-phase method using a soluble first antibody and a solid-phased antibody as the second antibody is used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. Is reacted with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In the nephelometry, the amount of insoluble precipitate generated as a result of the antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephelometry utilizing laser scattering is preferably used.

In applying these individual immunological measurement methods to the measurement method of the present invention, no special conditions, operations, and the like need to be set. The measuring system for the receptor protein of the present invention or a salt thereof may be constructed by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operating methods in each method. For details of these general technical means, it is possible to refer to reviews, books, etc. [for example,
Edited by Hiro Irie "Radio Immunoassay" (Kodansha, Showa 49)
Ed., Edited by Hiro Irie, "Continuing Radio Immunoassay" (Kodansha, published in 1979), Eiji Ishikawa et al., "Enzyme Immunoassay" (Medical Publishing, published in 1978), Eiji Ishikawa, et al., "Enzyme Immunoassay" (2nd edition) (Medical Shoin, published in 1982),
Ed. Eiji Ishikawa et al., “Enzyme Immunoassay” (3rd edition) (Medical Publishing, published in 1987), “Methods in ENZYMOLOGY” Vol. 70 (Immunochem)
ical Techniques (Part A)), ibid.Vol. 73 (Immunoch
emicalTechniques (Part B)), ibid.Vol. 74 (Immunoc
chemical Techniques (Part C)), ibid.Vol. 84 (Immuno
chemical Techniques (Part D: Selected Immunoassay
s)), ibid.Vol. 92 (Immunochemical Techniques (Par
t E: Monoclonal Antibodies and General Immunoassay
Methods)), Ibid.Vol. 121 (Immunochemical Techniqu
es (Part I: Hybridoma Technology and Monoclonal Ant
ibodies)) (see Academic Press). As described above, the receptor protein of the present invention or a salt thereof can be quantified with high sensitivity by using the antibody of the present invention. Furthermore, by quantifying the receptor protein of the present invention or a salt thereof in a living body using the antibody of the present invention, various diseases associated with dysfunction of the receptor protein of the present invention can be diagnosed. Further, the antibody of the present invention can be used for specifically detecting the receptor protein or the like of the present invention present in a subject such as a body fluid or a tissue. In addition, preparation of an antibody column used for purifying the receptor protein of the present invention, detection of the receptor protein of the present invention in each fraction at the time of purification, behavior of the receptor protein of the present invention in the test cells. Can be used for analysis and the like.

(10) Method for Screening Compound That Changes the Amount of the Receptor Protein of the Present Invention or Its Partial Peptide in Cell Membrane The antibody of the present invention specifically recognizes the receptor protein of the present invention or its partial peptide or a salt thereof. Therefore, it can be used for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane. That is, the present invention relates to, for example, (i) the present invention, wherein the cell membrane fraction is isolated after disrupting the blood of a non-human mammal, a specific organ, tissues or cells isolated from the organ, and the like, and isolating the cell membrane fraction. A method for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane by quantifying the receptor protein or its partial peptide, (ii) a trait that expresses the receptor protein or its partial peptide of the present invention After disrupting the transformant, etc., the cell membrane fraction is isolated, and the amount of the receptor protein of the present invention or its partial peptide in the cell membrane is determined by quantifying the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction. A method for screening a compound to be changed, (ii
i) Quantifying the degree of staining of the receptor protein on the cell surface by using immunostaining after sectioning blood, non-human mammal blood, specific organs, tissues or cells isolated from the organs, etc. A method for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane by confirming the protein on the cell membrane, and (iv) the method of screening the receptor protein or its partial peptide of the present invention. After the transformants or the like to be expressed are sectioned, the degree of staining of the receptor protein on the cell surface is quantified by using an immunostaining method, thereby confirming the protein on the cell membrane. Of a compound that changes the amount of the receptor protein of the present invention or its partial peptide in To provide a cleaning method.

The quantitative determination of the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction is specifically carried out as follows. (I) a normal or disease model non-human mammal (eg, mouse, rat, rabbit,
For a sheep, a pig, a cow, a cat, a dog, a monkey, etc., more specifically, a dementia rat, an obese mouse, an arteriosclerotic rabbit, a tumor-bearing mouse, etc .; Blood, or specific organs (eg, brain, lungs, large intestine, etc.) after a certain period of time after applying a physical stress (eg, flooding stress, electric shock, light / dark, low temperature, etc.) Or a tissue or cell isolated from an organ. The obtained organ, tissue or cell is suspended in, for example, an appropriate buffer (eg, Tris-HCl buffer, phosphate buffer, Hepes buffer, etc.), and the organ, tissue or cell is destroyed.
Surfactants (for example, Triton X-100 ^™ , Tween-20 ^™
And the like, and a cell membrane fraction is obtained by a technique such as centrifugation, filtration, or column fractionation.

The cell membrane fraction was obtained by disrupting the cells,
It refers to a fraction containing a large amount of cell membrane obtained by a known method. As a method for crushing cells, a method of crushing cells with a Potter-Elvehjem type homogenizer, crushing with a Waring blender or a polytron (manufactured by Kinematica), crushing with ultrasonic waves, spouting cells from a thin nozzle while applying pressure with a French press, etc. Crushing and the like. For the fractionation of cell membranes, fractionation by centrifugal force such as fractionation centrifugation or density gradient centrifugation is mainly used. For example, reduce cell lysate at low speed (500-3000 rpm)
, And the supernatant is further centrifuged at a high speed (15,000 to 30,000 rpm) for usually 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction contains a large amount of expressed receptor proteins and membrane components such as cell-derived phospholipids and membrane proteins.

The receptor protein of the present invention or its partial peptide contained in the cell membrane fraction can be quantified by, for example, sandwich immunoassay using the antibody of the present invention, Western blot analysis and the like. Such a sandwich immunoassay can be performed in the same manner as described above, and the Western blot can be performed by known means.

(Ii) A transformant expressing the receptor protein of the present invention or its partial peptide is prepared according to the above method, and the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction can be quantified. .

Screening for a compound that alters the amount of the receptor protein of the present invention or its partial peptide in the cell membrane is carried out by (i) a predetermined time before a drug or physical stress is applied to a normal or disease model non-human mammal. (30 minutes to 24 hours ago, preferably 30 minutes
Minutes to 12 hours ago, more preferably 1 hour to 6 hours ago)
Or after a certain time (after 30 minutes to 3 days, preferably after 1 hour to 2 days, more preferably after 1 hour to 24 hours),
Alternatively, a test compound is administered simultaneously with a drug or physical stress, and after a lapse of a certain period of time after administration (30 minutes to 3 days, preferably 1 hour to 2 days, more preferably 1 hour to
24 hours), by quantifying the amount of the receptor protein of the present invention or its partial peptide in the cell membrane, and (ii) mixing the test compound in the medium when culturing the transformant according to a conventional method. After culturing for a certain period of time (after 1 day to 7 days, preferably after 1 day to 3 days, more preferably after 2 days to 3 days), the amount is determined by quantifying the amount of the receptor protein of the present invention or its partial peptide in the cell membrane. be able to.

The confirmation of the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction is specifically performed as follows. (Iii) Normal or disease model non-human mammals (eg, mice, rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, and more specifically, demented rats, obese mice, arteriosclerotic rabbits,
Drugs (eg, anti-dementia drugs,
Blood pressure lowering drugs, anti-cancer drugs, anti-obesity drugs etc.) or physical stress (for example, flooding stress, electric shock, light / dark,
Low temperature, etc.), and after a certain time, blood,
Or specific organs (eg, heart, placenta, lung, etc.),
Alternatively, a tissue or cell isolated from an organ is obtained. The obtained organ, tissue or cell is cut into a tissue section according to a conventional method, and immunostaining is performed using the antibody of the present invention. By quantifying the degree of staining of the receptor protein on the cell surface and confirming the protein on the cell membrane, the amount of the receptor protein of the present invention or its partial peptide in the cell membrane can be quantitatively or qualitatively determined. You can check. (Iv) It can also be confirmed by using a transformant that expresses the receptor protein of the present invention or a partial peptide thereof and the like, and performing the same procedure.

The compound or a salt thereof obtained by using the screening method of the present invention is a compound having an effect of changing the amount of the receptor protein of the present invention or a partial peptide thereof in a cell membrane.
By increasing the amount of the receptor protein of the present invention or its partial peptide in the cell membrane, the cell stimulating activity via the G protein-coupled receptor (for example,
Arachidonic acid release, acetylcholine release, intracellular Ca ²⁺
Release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity to promote or suppress pH reduction, etc.) (B) A compound that reduces the cell stimulating activity by decreasing the amount of the receptor protein of the present invention or its partial peptide in the cell membrane. Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, and a fermentation product. These compounds may be a novel compound or a known compound. The compound that enhances the cell stimulating activity is
It is useful as a safe and low toxic drug for enhancing the physiological activity of the receptor protein of the present invention. The compound that attenuates the cell stimulating activity is useful as a safe and low toxic drug for decreasing the physiological activity of the receptor protein of the present invention.

When a compound or a salt thereof obtained by using the screening method of the present invention is used as a pharmaceutical composition, it can be carried out according to a conventional method. For example,
Tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions, and the like can be prepared in the same manner as the above-mentioned pharmaceuticals containing the receptor protein of the present invention. Since the preparation thus obtained is safe and has low toxicity, it is administered to humans and other mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). can do.
The dose of the compound or a salt thereof varies depending on the administration subject, the target organ, the condition, the administration method, and the like. In the case of oral administration, for example, in a cancer patient (as 60 kg), for example, per day About 0.1-100 mg, preferably about
1.0 to 50 mg, more preferably about 1.0 to 20 mg.
In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, condition, administration method and the like.
kg) about 0.01 to 30 mg per day
It is convenient to administer intravenously, about 0.1 to 20 mg, more preferably about 0.1 to 10 mg. In the case of other animals, the dose can be administered in terms of 60 kg.

(11) Preventive and / or therapeutic agent for various diseases containing a compound that alters the amount of the receptor protein of the present invention or its partial peptide in the cell membrane The receptor protein of the present invention may be, for example, a heart or a central nervous system as described above. It is thought to play some important role in vivo, such as function. Therefore, a compound that changes the amount of the receptor protein of the present invention or a partial peptide thereof in the cell membrane can be used as an agent for preventing and / or treating a disease associated with dysfunction of the receptor protein of the present invention. When the compound is used as a prophylactic and / or therapeutic agent for a disease associated with dysfunction of the receptor protein of the present invention, it can be formulated according to conventional means. For example, the compound is orally administered as a sugar-coated tablet, capsule, elixir, microcapsule, or the like, if necessary.
Alternatively, it can be used parenterally in the form of an injection such as a sterile solution with water or another pharmaceutically acceptable liquid, or a suspension. For example, the compound is mixed with known physiologically acceptable carriers, flavoring agents, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of pharmaceutical preparations. Can be manufactured by The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives which can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. Use may be made of bulking agents such as, for example, magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (for example, D-sorbitol, D-mannitol, sodium chloride, and the like) and the like are used. For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate)
80 ^TM , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservatives (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, it is administered to humans and other mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). can do. The dose of the compound or a salt thereof varies depending on the administration subject, the target organ, the condition, the administration method, and the like.
g) about 0.1 to 100 mg per day,
Preferably about 1.0-50 mg, more preferably about 1.0-20
mg. When administered parenterally, the single dose varies depending on the administration subject, target organ, symptoms, administration method, and the like. , About 0.01-3 per day
It is convenient to administer about 0 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(12) Neutralization by an antibody against the receptor protein of the present invention, its partial peptide, or a salt thereof The neutralizing activity of the antibody against the receptor protein of the present invention, its partial peptide, or a salt thereof against the receptor protein and the like That is, it means an activity of inactivating a signaling function involving the receptor protein. Therefore, when the antibody has neutralizing activity, signal transduction involving the receptor protein, for example, cell stimulating activity via the receptor protein (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, cell Intracellular cAMP generation, intracellular c
GMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity for promoting or suppressing pH reduction, etc.) can be inactivated. Therefore, it can be used for prevention and / or treatment of diseases caused by overexpression of the receptor protein and the like.

(13) Production of Transgenic Animal Having DNA Encoding G Protein-Coupled Receptor Protein of the Present Invention Using DNA of the present invention to produce transgenic animal expressing the receptor protein of the present invention, etc. Can be. Animals include mammals (eg, rats,
Mouse, rabbit, sheep, pig, cow, cat, dog, monkey, and the like (hereinafter sometimes abbreviated as animal), and mouse and rabbit are particularly preferable.
When the DNA of the present invention is introduced into a target animal, it is generally advantageous to use the DNA as a gene construct linked downstream of a promoter capable of being expressed in animal cells. For example, when the DNA of the present invention derived from a rabbit is introduced, the DNA of the present invention derived from an animal having a high homology to the DNA is introduced.
A DNA-transferred animal that highly produces the receptor protein or the like of the present invention can be produced by microinjecting a gene construct linked to a downstream of various promoters capable of expressing NA in animal cells, for example, into a fertilized rabbit egg. As this promoter, for example,
A ubiquitous expression promoter such as a virus-derived promoter or metallothionein may be used, but a promoter of a gene specifically expressed in the heart is preferably used.

The introduction of the DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target animal. The presence of the receptor protein or the like of the present invention in the germinal cells of the produced animal after DNA introduction means that all the offspring of the produced animal have the receptor protein or the like of the present invention in all of its germinal and somatic cells. The progeny of this type of animal that has inherited the gene has the receptor protein of the present invention in all of its germinal and somatic cells. The DNA-introduced animal of the present invention can be bred in a normal breeding environment as a DNA-bearing animal after confirming that the gene is stably maintained by mating. Furthermore, by crossing male and female animals having the target DNA, homozygous animals having the transgene on both homologous chromosomes are obtained, and by crossing the male and female animals, all the offspring have the DNA. Breeding can be subcultured. The DN of the present invention
Since the animal into which A has been introduced expresses the receptor protein of the present invention at a high level, it is useful as an animal for screening for an agonist or antagonist for the receptor protein of the present invention. The DNA-introduced animal of the present invention can also be used as a cell source for tissue culture. For example, directly analyzing DNA or RNA in the tissue of the DNA-introduced mouse of the present invention,
Alternatively, by analyzing a tissue in which the receptor protein of the present invention expressed by a gene is present, the receptor protein of the present invention can be analyzed. Culturing cells of a tissue having the receptor protein or the like of the present invention by standard tissue culture techniques, and using them to study the function of cells from a generally difficult-to-culture tissue such as, for example, from brain or peripheral tissues Can be. In addition, by using the cells, for example, a drug that enhances the function of various tissues can be selected. Further, if there is a high expression cell line, the receptor protein of the present invention can be isolated and purified therefrom.

(14) Pharmaceutical Containing Antisense Polynucleotide (Nucleic Acid) It can complementarily bind to the polynucleotide (eg, DNA) of the present invention and suppress the expression of the polynucleotide (eg, DNA). The antisense polynucleotide of the present invention has low toxicity and can suppress the function of the protein of the present invention or the polynucleotide of the present invention (eg, DNA) in a living body. It can be used as an agent for preventing and / or treating a disease associated with insufficiency. When the antisense polynucleotide is used as the therapeutic or prophylactic agent, it can be formulated and administered according to a known method. For example, when the antisense polynucleotide is used, the antisense polynucleotide is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like. Or mammals (eg, rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.) can be administered orally or parenterally. The antisense polynucleotide can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and can be administered using a gene gun or a catheter such as a hydrogel catheter. The dose of the antisense polynucleotide varies depending on the target disease, the administration subject, the administration route, and the like. In the case of topical administration to the kidney, etc., generally, in an adult (body weight 60 kg), the antisense polynucleotide is administered in an amount of about 0.1 to 100 m / day.
g. Further, the antisense polynucleotide can also be used as a diagnostic oligonucleotide probe for examining the presence of the DNA of the present invention in tissues or cells and the state of expression thereof.

In the present specification and drawings, when bases, amino acids and the like are indicated by abbreviations, the indications are based on IUPAC-IU
This is based on the abbreviation by the B Commission on Biochemical Nomenclature or the abbreviation commonly used in this field. An example is shown below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified.

Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thr: threonine Cys: cysteine Met: methionine Glu: glutamic acid Asp: aspartic acid Lys: lysine Arg: arginine His: histidine Phe yr : Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine pGlu: Pyroglutamic acid Me: Methyl group Et: Ethyl group Bu: Butyl group Ph: Phenyl group TC: Thiazolidine-4 (R) -carboxamide group

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ Bzl: 2,6-dichlorobenzyl Bom: benzyloxymethyl Z: benzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Br-Z: 2-bromobenzyl Oxycarbonyl Boc: t-butoxycarbonyl DNP: dinitrophenol Trt: trityl Bum: t-butoxymethyl Fmoc: N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy -4-oxo-1,2,3-benzotriazine HONB: 1-hydroxy-5-norbornene-2,3-dicarboxyimide DCC: N, N'-dicyclohexylcarbodiimide

[0111] The sequence numbers in the sequence listing in the present specification indicate the following sequences. SEQ ID NO: 1 shows the amino acid sequence of the novel human-derived G protein-coupled receptor protein TGR36 of the present invention. SEQ ID NO: 2 This shows the base sequence of DNA encoding novel human-derived G protein-coupled receptor protein TGR36 of the present invention. SEQ ID NO: 3 This shows the base sequence of primer 1 used for PCR in EXAMPLE 1 below. SEQ ID NO: 4 This shows the base sequence of primer 2 used for PCR in EXAMPLE 1 below. SEQ ID NO: 5 This shows the base sequence of the PCR reaction product obtained by PCR in EXAMPLE 1 below. SEQ ID NO: 6 This shows the base sequence of the 5 ′ untranslated region of DNA encoding novel human-derived G protein-coupled receptor protein TGR36 of the present invention. SEQ ID NO: 7 This shows the base sequence of the 3 ′ untranslated region of the DNA encoding novel human G protein-coupled receptor protein TGR36 of the present invention. SEQ ID NO: 8 This shows the base sequence of primer 3 used for PCR in EXAMPLE 3 below. SEQ ID NO: 9 This shows the base sequence of primer 4 used for PCR in EXAMPLE 3 below. SEQ ID NO: 10 This shows the base sequence of primer 5 used in TaqMan PCR reaction in Example 4 below. SEQ ID NO: 11 This shows the base sequence of primer 6 used in TaqMan PCR reaction in Example 4 below. SEQ ID NO: 12 This shows the base sequence of probe 1 used in TaqMan PCR reaction in Example 4 below.

The transformant obtained in the following Example 2, Escherichia coli DH5α / pTB2223
Is from March 21, 2001 (Heisei 13), 1-1 1-1 Higashi, Tsukuba City, Ibaraki Prefecture, Chuo No. 6 (Postal Code 305-
8566) National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary Center (formerly Ministry of Economy, Trade and Industry, National Institute of Advanced Industrial Science and Technology)
As BP-7519, 2001 (Heisei 13) 3
From March 8th 2-17-8 Jusanhoncho, Yodogawa-ku, Osaka-shi, Osaka
No. 5 (zip code 532-8686) and deposited at the Fermentation Research Institute (IFO) under the accession number IFO 16583.

[0113]

The present invention will be described in more detail with reference to the following Examples, which do not limit the scope of the present invention.

Example 1 Cloning of DNA Encoding G Protein-Coupled Receptor Protein Derived from Human Genomic DNA and Determination of Base Sequence Using human genomic DNA (CLONTECH) as a template, two primers, primer 1 (SEQ ID NO: 3) and A PCR reaction was performed using Primer 2 (SEQ ID NO: 4).
The composition of the reaction solution in the reaction is 10 n of the above genomic DNA.
g as a template, 0.25 μl of ExTaq DNA Polymerase (Takara Shuzo), primer 1 and primer 2
0.5 μM, 200 μM of dNTPs, and 5 μl of the buffer attached to the enzyme were added to make a liquid volume of 50 μl. The PCR reaction was performed at 96 ° C for 1 minute, followed by 5 cycles of 96 ° C for 15 seconds and 70 ° C for 2 minutes, then 96 ° C for 15 seconds, 65 ° C for 20 seconds, and 72 ° C for 1 minute 30
The second cycle was repeated 35 times, and finally an extension reaction was performed at 72 ° C. for 7 minutes. Further, as a result of analyzing the sequence of the PCR reaction product, a DNA sequence (SEQ ID NO: 5) encoding a novel G protein-coupled receptor protein was obtained. The DNA sequence in the open reading frame of this DNA sequence (SEQ ID NO: 5) is shown in SEQ ID NO: 2. A novel G protein-coupled receptor protein containing the amino acid sequence (SEQ ID NO: 1) encoded by this DNA sequence (SEQ ID NO: 2) was designated as TGR36. The hydrophobicity plot of TGR36 is shown in FIG.

Example 2 Cloning of DNA Encoding a G Protein-Coupled Receptor Protein Derived from Human Genomic DNA and Determination of Base Sequence Using human genomic DNA (CLONTECH) as a template, two primers, primer 1 (SEQ ID NO: 3) and A PCR reaction was performed using Primer 2 (SEQ ID NO: 4).
The composition of the reaction solution in the reaction is 10 n of the above genomic DNA.
g as a template, 0.25 μl of ExTaq DNA Polymerase (Takara Shuzo), primer 1 and primer 2
0.5 μM, 200 μM of dNTPs, and 5 μl of the buffer attached to the enzyme were added to make a liquid volume of 50 μl. The PCR reaction was performed at 96 ° C for 1 minute, followed by 5 cycles of 96 ° C for 15 seconds and 70 ° C for 2 minutes, then 96 ° C for 15 seconds, 65 ° C for 20 seconds, and 72 ° C for 1 minute 30
The second cycle was repeated 35 times, and finally an extension reaction was performed at 72 ° C. for 7 minutes. The PCR reaction product was converted to DNA Ligat.
ion Kit Ver. According to the prescription of 2 (Takara Shuzo),
Plasmid vector pCR2.1 (Invitroge
n company). This is E. coli DH5α
And clones carrying the cDNA were selected on LB agar medium containing ampicillin. As a result of analyzing the sequence of each clone, a DNA sequence (SEQ ID NO: 5) encoding a novel G protein-coupled receptor protein was obtained. A plasmid vector pCR2.1 obtained by subcloning this DNA sequence (SEQ ID NO: 5) was used as a pTB22
23. This pTB2223 was transformed into Escherichia coli (Escher
(Escherichia coli) DH5α / pTB2223.

Example 3 Cloning of DNA Encoding Human Kidney-Derived G Protein-Coupled Receptor Protein and Determination of Base Sequence Using human kidney cDNA (CLONTECH) as a template,
A PCR reaction was performed using two primers, Primer 1 (SEQ ID NO: 3) and Primer 3 (SEQ ID NO: 8). The composition of the reaction solution in the reaction is the above cDNA1
μl as template and use ExTaq DNA Pol
ymerase (Takara Shuzo) 0.1 μl volume, primer 1 (SEQ ID NO: 3) and primer 3 (SEQ ID NO:
8) was added to each of 0.5 μM, 200 μM of dNTPs, and 2 μl of the buffer attached to the enzyme to make a liquid volume of 20 μl. The PCR reaction was performed at 96 ° C for 1 minute, and then at 96 ° C for 1 minute.
5 cycles of 5 seconds at 68 ° C for 3 minutes, then 96 ° C for 1 minute
A cycle of 5 seconds, 55 ° C for 30 seconds and 68 ° C for 2 minutes is 30
This was repeated twice, and finally an extension reaction was performed at 68 ° C. for 7 minutes.
Next, the PCR reaction product was diluted 1/50 with distilled water, and this diluted PCR reaction product was used as a template to prepare two primers, primer 4 (SEQ ID NO: 9) and primer 3
(SEQ ID NO: 8) was used to perform a second PCR reaction. The composition of the reaction solution in the reaction was determined using PfuTurbo using 1.25 μl of the diluted PCR reaction product solution as a template.
DNA Polymerase (STRATAGE
NE) 1 μl volume, 0.5 μM each of primer 4 (SEQ ID NO: 9) and primer 3 (SEQ ID NO: 8), dNT
200 μM of Ps, and 5 of the buffer attached to the enzyme
μl was added to make a liquid volume of 50 μl. The 2nd PCR reaction is performed at 96 ° C. for 1 minute, 96 ° C. for 15 seconds, 68 ° C. for 3 minutes five times, and then at 96 ° C. for 15 seconds and 55 ° C. for 30 minutes.
A cycle at 68 ° C. for 2 minutes was repeated 25 times, and an extension reaction was finally performed at 68 ° C. for 7 minutes. Furthermore, the 2nd
As a result of analyzing the sequence of the PCR reaction product,
A: A DNA sequence having the same reading frame as TGR36 (SEQ ID NO: 2) was obtained.

Example 4 Investigation of TGR36 Expression in Human Tissue and Its Tissue Specificity For TaqMan PCR analysis, two primers [primer 5 (SEQ ID NO: 10) and primer 6 (SEQ ID NO: 11)] and 1 Probes [probe 1 (SEQ ID NO: 12)] were used. Probe 1 has a 5 '
M, label 3 'side was labeled with TAMRA. The template cDNA in the analysis was Human MTC panel.
I (CLONTECH), Human MTC p
anelI (CLONTECH) and Human
Marathon-Ready cDNA (kidney,
Lung and brain (CLONTECH) were used. The composition of the reaction solution in the reaction was determined using TaqManUniversal PCR using 1 μl of the above cDNA as a template.
Master Mix (Applied Biosy
(Stem) 25 μl, primer 6 (SEQ ID NO: 1)
1) and primer 7 (SEQ ID NO: 12)
μM, and probe 1 (SEQ ID NO: 12)
M was added to make a liquid volume of 50 μl. TaqMan PCR
The reaction is carried out at 50 ° C for 2 minutes, at 95 ° C for 10 minutes, and then at 95 ° C for
A cycle of 60 seconds at 60 ° C. for 15 seconds was repeated 40 times.
After completion of the TaqMan PCR reaction, according to a predetermined method,
The TGR36 concentration in the cDNA solution was calculated. TGR36
As a standard for the concentration, the aforementioned pTB2223 was used. The results are shown in FIG. TaqMan PCR analysis revealed that it was specifically expressed in the kidney.

[0118]

The G protein-coupled receptor protein of the present invention or a partial peptide thereof or a salt thereof, and a polynucleotide (eg, DNA, RNA and a derivative thereof) encoding the receptor protein or a partial peptide thereof may be a ligand (agonist) ), Obtaining antibodies and antisera, constructing a recombinant receptor protein expression system, developing a receptor binding assay system using the expression system and screening drug candidate compounds, and examining structurally similar ligands / receptors. Can be used as a reagent for preparing a probe or PCR primer in gene diagnosis, producing a transgenic animal or a gene therapy drug, etc.

[0119]

[Sequence List] <110> Takeda Chemical Industries, Ltd. <120> Novel G Protein-Coupled Receptor Protein and its DNA <130> P02-0010 <150> JP 2001-25037 <151> 2001-02-01 <150> JP 2001-102559 <151> 2001-03-30 <150> JP 2001-105435 <151> 2001-04-04 <160> 12 <210> 1 <211> 345 <212> PRT <213> Human <400> 1 Met Ser Ser Asn Ser Ser Leu Leu Val Ala Val Gln Leu Cys Tyr Ala 5 10 15 Asn Val Asn Gly Ser Cys Val Lys Ile Pro Phe Ser Pro Gly Ser Arg 20 25 30 Val Ile Leu Tyr Ile Val Phe Gly Phe Gly Ala Val Leu Ala Val Phe 35 40 45 Gly Asn Leu Leu Val Met Ile Ser Ile Leu His Phe Lys Gln Leu His 50 55 60 Ser Pro Thr Asn Phe Leu Val Ala Ser Leu Ala Cys Ala Asp Phe Leu 65 70 75 80 Val Gly Val Thr Val Met Pro Phe Ser Met Val Arg Thr Val Glu Ser 85 90 95 Cys Trp Tyr Phe Gly Arg Ser Phe Cys Thr Phe His Thr Cys Cys Asp 100 105 110 Val Ala Phe Cys Tyr Ser Ser Leu Phe His Leu Cys Phe Ile Ser Ile 115 120 125 Asp Arg Tyr Ile Ala Val Thr Asp Pro Leu Val Tyr Pro Thr Lys Phe 130 135 140 Thr Val Ser Val Ser Gly Ile Cys I le Ser Val Ser Trp Ile Leu Pro 145 150 155 160 Leu Met Tyr Ser Gly Ala Val Phe Tyr Thr Gly Val Tyr Asp Asp Gly 165 170 175 Leu Glu Glu Leu Ser Asp Ala Leu Asn Cys Ile Gly Gly Cys Gln Thr 180 185 190 Val Val Asn Gln Asn Trp Val Leu Thr Asp Phe Leu Ser Phe Phe Ile 195 200 205 Pro Thr Phe Ile Met Ile Ile Leu Tyr Gly Asn Ile Phe Leu Val Ala 210 215 220 Arg Arg Gln Ala Lys Lys Ile Glu Asn Thr Gly Ser Lys Thr Glu Ser 225 230 235 240 Ser Ser Glu Ser Tyr Lys Ala Arg Val Ala Arg Arg Glu Arg Lys Ala 245 250 255 Ala Lys Thr Leu Gly Val Thr Val Val Ala Phe Met Ile Ser Trp Leu 260 265 270 Pro Tyr Ser Ile Asp Ser Leu Ile Asp Ala Phe Met Gly Phe Ile Thr 275 280 285 Pro Ala Cys Ile Tyr Glu Ile Cys Cys Trp Cys Ala Tyr Tyr Asn Ser 290 295 300 Ala Met Asn Pro Leu Ile Tyr Ala Leu Phe Tyr Pro Trp Phe Arg Lys 305 310 315 320 Ala Ile Lys Val Ile Val Thr Gly Gln Val Leu Lys Asn Ser Ser Ala 325 330 335 Thr Met Asn Leu Phe Ser Glu His Ile 340 345 <210> 2 <211> 1035 <212> DNA <213> Human <400> 2 atgagcagca attca tccct gctggtggct gtgcagctgt gctacgcgaa cgtgaatggg 60 tcctgtgtga aaatcccctt ctcgccggga tcccgggtga ttctgtacat agtgtttggc 120 tttggggctg tgctggctgt gtttggaaac ctcctggtga tgatttcaat cctccatttc 180 aagcagctgc actctccgac caattttctc gttgcctctc tggcctgcgc tgatttcttg 240 gtgggtgtga ctgtgatgcc cttcagcatg gtcaggacgg tggagagctg ctggtatttt 300 gggaggagtt tttgtacttt ccacacctgc tgtgatgtgg cattttgtta ctcttctctc 360 tttcacttgt gcttcatctc catcgacagg tacattgcgg ttactgaccc cctggtctat 420 cctaccaagt tcaccgtatc tgtgtcagga atttgcatca gcgtgtcctg gatcctgccc 480 ctcatgtaca gcggtgctgt gttctacaca ggtgtctatg acgatgggct ggaggaatta 540 tctgatgccc taaactgtat aggaggttgt cagaccgttg taaatcaaaa ctgggtgttg 600 acagattttc tatccttctt tatacctacc tttattatga taattctgta tggtaacata 660 tttcttgtgg ctagacgaca ggcgaaaaag atagaaaata ctggtagcaa gacagaatca 720 tcctcagaga gttacaaagc cagagtggcc aggagagaga gaaaagcagc taaaaccctg 780 ggggtcacag tggtagcatt tatgatttca tggttaccat atagcattga ttcattaatt 840 gatgccttta tgggctttat aacccctgcc tgta tttatg agatttgctg ttggtgtgct 900 tattataact cagccatgaa tcctttgatt tatgctttat tttacccatg gtttaggaaa 960 gcaataaaag ttattgtaac tggtcaggtt ttaaagaaca gttcagcaac catgaatttg 1020 ttttctgaac atata <primary> DNA sequence <10> encoding TGR36 <400> 3 ctgttgcaca gagaaactca aaagg 25 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA encoding TGR36 <400> 4 gcagaaggga caggaaagtg cac 23 < 210> 5 <211> 1552 <212> DNA <213> Human <400> 5 ctgttgcaca gagaaactca aaaggtaaaa ataaaatatg aaaggatatt taaaatcaaa 60 aggaatttta tcaaattaag agcatgagac atttatcagt tgaaacaatc tccaataatc 120 ttgtgcaata taatttttgt caaattttat tttgtcataa acatttggga tttataataa 180 aaatggaaac ttgaaaaatt atattagaga taatatctga tcatttcctc tggcatcctg 240 gtgaatatgt gtttttttcc gcaggagcac tgaaaatcag gaacaatcct gtattttttg 300 tgataatcaa caaggacaaa acttctccat atgtaaataa cagcgttatg agcagcaatt 360 catccc tgct ggtggctgtg cagctgtgct acgcgaacgt gaatgggtcc tgtgtgaaaa 420 tccccttctc gccgggatcc cgggtgattc tgtacatagt gtttggcttt ggggctgtgc 480 tggctgtgtt tggaaacctc ctggtgatga tttcaatcct ccatttcaag cagctgcact 540 ctccgaccaa ttttctcgtt gcctctctgg cctgcgctga tttcttggtg ggtgtgactg 600 tgatgccctt cagcatggtc aggacggtgg agagctgctg gtattttggg aggagttttt 660 gtactttcca cacctgctgt gatgtggcat tttgttactc ttctctcttt cacttgtgct 720 tcatctccat cgacaggtac attgcggtta ctgaccccct ggtctatcct accaagttca 780 ccgtatctgt gtcaggaatt tgcatcagcg tgtcctggat cctgcccctc atgtacagcg 840 gtgctgtgtt ctacacaggt gtctatgacg atgggctgga ggaattatct gatgccctaa 900 actgtatagg aggttgtcag accgttgtaa atcaaaactg ggtgttgaca gattttctat 960 ccttctttat acctaccttt attatgataa ttctgtatgg taacatattt cttgtggcta 1020 gacgacaggc gaaaaagata gaaaatactg gtagcaagac agaatcatcc tcagagagtt 1080 acaaagccag agtggccagg agagagagaa aagcagctaa aaccctgggg gtcacagtgg 1140 tagcatttat gatttcatgg ttaccatata gcattgattc attaattgat gcctttatgg 1200 gctttataac ccctgcctgtatttatgaga tttgctgttg gtgtgcttat tataactcag 1260 ccatgaatcc tttgatttat gctttatttt acccatggtt taggaaagca ataaaagtta 1320 ttgtaactgg tcaggtttta aagaacagtt cagcaaccat gaatttgttt tctgaacata 1380 tataagcagt tgtatagacg aagttcagga tacctttaaa attaccaagc gaaatgagtt 1440 tttaaaaatc aagtaagact atgaatgaat agcaaataaa ttgctcttca aatgaaaaac 1500 aaatcaatgt ttttcagtct tgttaagatg tgcactttcc tgtcccttct gc 1552 <210> 6 <211> 347 <212 > DNA <213> Human <400> 6 ctgttgcaca gagaaactca aaaggtaaaa ataaaatatg aaaggatatt taaaatcaaa 60 aggaatttta tcaaattaag agcatgagac atttatcagt tgaaacaatc tccaataatc 120 ttgtgcaata taatttttgt caaattttat tttgtcataa acatttggga tttataataa 180 aaatggaaac ttgaaaaatt atattagaga taatatctga tcatttcctc tggcatcctg 240 gtgaatatgt gtttttttcc gcaggagcac tgaaaatcag gaacaatcct gtattttttg 300 tgataatcaa caaggacaaa acttctccat atgtaaataa cagcgtt 347 <210> 7 <211> 167 <212> DNA <213> Human <400> 7 gcagttgtat agacgaagtt caggatacct ttaaaattac caagcgaaat gagtttttaa 60 aaatcaagta agactatgaa tgaatagcaa a taaattgct cttcaaatga aaaacaaatc 120 aatgtttttc agtcttgtta agatgtgcac tttcctgtcc cttctgc 167 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA encoding TGR36 <400> gcattgag 210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA encoding TGR36 <400> 9 gagacattta tcagttgaaa caatctcc 28 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA encoding TGR36 <400> 10 gtcctggatc ctgcccctc 19 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA encoding TGR36 <400> 11 cctccagccc atcgtcatag 20 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide probe to quantify DNA encoding TGR36 <400> 12 acagcggtgc tgtgttctac acaggtg 27

[Brief description of the drawings]

FIG. 1 is a hydrophobicity plot of TGR36.

FIG. 2 shows the amino acid sequence of TGR36 in single letter code.

FIG. 3 is a diagram showing TaqMan PCR analysis of TGR36.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 5/00 A61P 9/00 4C084 9/00 11/00 4C085 11/00 25/00 4H045 25/00 29 / 00 29/00 31/00 31/00 35/00 35/00 37/00 37/00 C07K 14/705 C07K 14/705 16/28 16/28 C12N 1/15 C12N 1/15 1/19 1 / 19 1/21 1/21 C12P 21/02 C 5/10 C12Q 1/68 A C12P 21/02 G01N 33/15 Z C12Q 1/68 33/50 Z G01N 33/15 33/53 D 33/50 M 33 / 53 33/566 C12N 15/00 ZNAA 33/566 5/00 A (72) Inventor Yasushi Shintani 6-14-8-606 Shindaka, Yodogawa-ku, Osaka-shi, Osaka 4-16-4 Azuma Preview Azuma 403 F-term (reference) 2G045 AA40 DA12 DA13 DA14 DA36 FB02 FB03 4B024 AA01 AA11 BA63 CA04 CA09 HA01 HA14 HA15 HA17 4B063 QA01 QA19 QQ03 QQ43 QQ53 QR32. 4C085 AA14 BB11 CC23 EE01 4H045 AA10 AA11 AA20 AA30 BA09 CA40 DA50 DA75 EA21 EA22 EA23 EA25 EA27 EA28 EA29 EA50 FA74

Claims (34)

[Claims] 1. A G protein-coupled receptor protein or a salt thereof, comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. 2. The G protein-coupled receptor protein according to claim 1, which comprises the amino acid sequence represented by SEQ ID NO: 1. 3. A partial peptide of the G protein-coupled receptor protein according to claim 1, or a salt thereof. 4. A polynucleotide comprising a polynucleotide encoding the G protein-coupled receptor protein according to claim 1. 5. The polynucleotide according to claim 4, which is a DNA. 6. The DNA according to claim 5, comprising the base sequence represented by SEQ ID NO: 2. 7. A recombinant vector containing the polynucleotide according to claim 4. A transformant transformed with the recombinant vector according to claim 7. 9. A method according to claim 1, wherein the transformant according to claim 8 is cultured to produce the G protein-coupled receptor protein according to claim 1 or a salt thereof.
A method for producing the G protein-coupled receptor protein or a salt thereof according to the above. 10. An antibody against the G protein-coupled receptor protein according to claim 1, or the partial peptide according to claim 3, or a salt thereof. 11. The antibody according to claim 10, which is a neutralizing antibody that inactivates signal transduction of the G protein-coupled receptor protein according to claim 1. 12. A diagnostic agent comprising the antibody according to claim 10. A pharmaceutical comprising the antibody according to claim 10. [14] The present invention can be obtained by using the G protein-coupled receptor protein according to [1], the partial peptide according to [3], or a salt thereof.
A ligand for the described G protein-coupled receptor protein or a salt thereof. A pharmaceutical comprising the ligand of the G protein-coupled receptor according to claim 14. 16. A ligand for the G protein-coupled receptor protein of claim 1 or a salt thereof, wherein the G protein-coupled receptor protein of claim 1 or the partial peptide of claim 3 or a salt thereof is used. How to determine. 17. A ligand comprising the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3 or a salt thereof, and a G protein-coupled receptor protein according to claim 1 or a salt thereof. A method for screening a compound or a salt thereof that changes the binding property to a compound. 18. A ligand comprising the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3 or a salt thereof, and a G protein-coupled receptor protein according to claim 1 or a salt thereof. A kit for screening a compound or a salt thereof that changes the binding property to a salt. (19) The binding property between a ligand obtainable by the screening method according to (17) or the screening kit according to (18) and a G protein-coupled receptor protein or a salt thereof according to (1). Compound or salt thereof. 20. A pharmaceutical comprising the compound according to claim 19 or a salt thereof. 21. A polynucleotide that hybridizes with the polynucleotide of claim 4 under high stringency conditions. 22. A polynucleotide comprising a nucleotide sequence complementary to the polynucleotide according to claim 4 or a part thereof. 23. The polynucleotide according to claim 1, wherein the polynucleotide according to claim 4 or a part thereof is used.
A method for quantifying mRNA of a protein-coupled receptor protein. 24. The method for quantifying a G protein-coupled receptor protein according to claim 1, wherein the antibody according to claim 10 is used. 25. The method for diagnosing a disease associated with the function of a G protein-coupled receptor according to claim 1, wherein the quantification method according to claim 23 or 24 is used. 26. A method for screening a compound or a salt thereof that alters the expression level of a G protein-coupled receptor protein according to claim 1, wherein the method according to claim 23 is used. 27. A method for screening a compound or a salt thereof that changes the amount of the G protein-coupled receptor protein according to claim 1 in a cell membrane, wherein the method uses the quantification method according to claim 24. 28. A compound or a salt thereof, which alters the expression level of the G protein-coupled receptor protein according to claim 1, which can be obtained by using the screening method according to claim 26. 29. A compound or a salt thereof, which alters the amount of the G protein-coupled receptor protein according to claim 1 in a cell membrane obtainable by using the screening method according to claim 27. A pharmaceutical comprising the compound according to claim 28 or a salt thereof. A pharmaceutical comprising the compound according to claim 29 or a salt thereof. 32. A central disease, an inflammatory disease, an endocrine disease,
The preventive or therapeutic agent for a metabolic disease, cancer, cardiovascular disease, respiratory disease, digestive disease, immune system disease or infectious disease, claim 13, claim 20, claim 20, claim 30, or claim 30 Item 34. The medicament according to Item 31, 33. A central disease, an inflammatory disease, an endocrine disease, metabolism, which comprises administering to a mammal an effective amount of the compound according to claim 19, 28 or 29 or a salt thereof. A method for preventing or treating a disease, cancer, circulatory disease, respiratory disease, digestive disease, immune system disease or infectious disease. 34. central disease, inflammatory disease, endocrine disease,
30. The compound according to claim 19, 28 or 29 for producing a prophylactic / therapeutic agent for a metabolic disease, cancer, circulatory disease, respiratory disease, digestive system disease, immune system disease or infectious disease. Or use of its salts.