JP2002360266A - Mutant type simian virus 40vp1 capsid protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new VP1 mutant forming viral protein particles. SOLUTION: This VP1 mutant has a mutation shown in, e.g. Fig. 1. The viral protein particles of mutants A-G have low dissociating properties into pentamers as compared with those of viral protein particles from a wild type VP1 and are promising as a carrier, etc., in drug introduction or gene therapy.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a mutated protein having a different virus-like protein particle forming ability as compared to a wild-type virus protein. Since this protein forms particles capable of containing other substances, it is promising as a drug administration system, a gene carrier in gene therapy, and the like.

[0002]

2. Description of the Related Art Simian virus 40 (SV4
0) is a type of simian polyomavirus belonging to the family Papovaviridae, which is a small, non-enveloped oncovirus whose genome has a 5243 bp double-stranded circular
DNA consists of three types of structural proteins (VP1,
VP2 and VP3), and two nonstructural proteins (large T antigen and small T antigen). Structural proteins are expressed late in infection, and these structural proteins form viral capsids in the nucleus of infected host cells (Tooze, J. (ed.), 1980, DNA Tumor Virus
2nd.ed.Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY).

[0003] The SV40 capsid has a size of about 45 to 50 nm in diameter, and its main component is VP1. One capsid is 7
Consists of two VP1 pentamers (pentamer), X
Line crystal analysis reveals that capsids are formed by three different interactions (α-α ′, β-β ′, and γ-γ) between VP1 pentamers (Liddi
ngton, RC et al., Nature, Vol. 354, p. 278-284 (1991); S
tehle, T. et al., Structure, Vol. 4, p. 165-182 (1996)).

[0004] Like the capsids of other polyomaviruses, the SV40 capsid is dissociated into VP1 pentamer by dithiothreitol (DTT) (which cleaves disulfide bonds by reduction) and EGPTA (calcium chelating agent). It is believed that the formation of capsids involves disulfide bonds between pentamers and calcium ion-mediated interactions (Brady, JN et al.
J. Virol. Vol. 23, p. 717-724 (1977); Brady, JN et al., J.
Virol. Vol. 27, p. 193-204 (1978); Brady, JN et al., J. Vi.
rol.Vol.32, p.640-647 (1979); Colomar, MC et al., J.Vi.
rol.Vol.67, p.2779-2786 (1993)).

It has been reported that the disulfide bond involves Cys at positions 9, 104 and 207 of the SV40VP1 capsid protein (SEQ ID NO: 1) (Jao, CC).
J. Gen. Virol. Vol. 80, p.2481-2489 (1999)). On the other hand,
Regarding calcium ions, X-ray analysis of SV40 virus particles shows that two calcium ions (calcium ions 1 and 2) are bound per VP molecule, and amino acid residues that interact with these calcium ions Have been identified.

[0006] That is, calcium ions 1
Ser and 219 at position 216 of the first VP1 molecule in the VP1 pentamer
Interact with Glu at position 49, Glu at position 49 and Glu at position 51 of the second VP1 molecule, and Glu at position 333 of the third VP1 molecule of the adjacent pentamer, and calcium ion 2 binds to the first VP1 molecule.
Interacts with Glu at position 160, Glu at position 163, Lys at position 217 and Glu at position 219, and Asp at position 348 of the third VP1 molecule (Liddington, RC et al., Nature, Vol. 354, p. .278-284
(1991); Stehle, T. et al., Structure, Vol. 4, p. 165-182.
(1996)).

[0007] However, no report has been made on these proteins in which the calcium ion interaction site is mutated, and no report has been made on the particle-forming properties of the mutant proteins.

When recombinant SV40VP1 protein is expressed in insect cells using the baculovirus expression system, SV40
Virus-like particles consisting only of PV1 protein (Virus-lik
e particle; VLP) (or virus-like protein particle) is formed. The virus-like protein particles differ from wild-type SV40 in that they do not contain VP2 protein, VP3 protein and T antigen protein, and viral genomic DNA, but cannot be distinguished morphologically from wild-type SV40 capsid, Dissociated into pentamers by DTT and EGTA (Ku
sukegawa, A. et al., Biochim. Biophys. Acta. Vol. 1290, p. 3
7-45 (1996)).

Therefore, if the virus-like protein particles are used, a drug is encapsulated therein to form a drug administration system, and a specific gene is encapsulated therein to thereby provide a carrier for gene introduction in gene therapy. Various uses, such as use as, are expected. In these applications, improvements such as formation of virus-like protein particles having an ideal shape, improvement of stability of virus-like protein particles, and the like are desired. However, it is not known to modify the amino acid sequence of the VP1 protein to improve the shape and stability of virus-like protein particles formed thereby.

[0010]

Accordingly, the present invention relates to the SV40
By modifying the amino acid sequence of the VP1 capsid protein, a mutant VP1 protein capable of forming a virus-like protein particle having a different shape as compared to the wild-type protein, stable or hard (as compared to the wild-type protein) rigid) to provide mutant VP1 proteins that form virus-like protein particles.

[0011]

Means for Solving the Problems In order to solve the above problems, the present inventors substitute an amino acid residue in SV40VP1 protein known to interact with calcium ions with another amino acid residue. As a result, they found that the formability of virus-like protein particles was changed, and completed the present invention.

Accordingly, the present invention most commonly relates to SV40
In the amino acid sequence of the viral protein 1 (SV40 PV1) (SEQ ID NO: 1), Glu at position 49, Glu at position 51 and G at position 160
lu, Glu at 163, Ser at 216, Lys at 217, Gl at 219
u, Glu at position 332, Glu at position 333, and Asp at position 348, wherein at least one amino acid is substituted by another amino acid, thereby providing a protein having altered formability of virus-like protein particles. .

In one embodiment, the invention provides a Glu at position 160.
Is substituted with another amino acid to provide a protein (variant A; mtA) capable of forming a rigid or stable virus-like protein particle as compared to the wild type. Preferably, said Glu is replaced by Gln. In another embodiment, the present invention provides that the Glu at position 163 is replaced by another amino acid, resulting in a more rigid (ri)
gid) or a protein that forms stable virus-like protein particles (Variant B; mtB). Preferably, said Glu is replaced by Gln.

In another embodiment, the present invention provides an Asp at position 348.
Is replaced by another amino acid to provide a protein (variant C; mtC) that forms a hard or stable virus-like protein particle compared to the wild type. The Asp is preferably replaced by Asn. In another embodiment, the invention relates to a protein wherein the Glu at position 160 and the Glu at position 163 have been replaced by other amino acids to form a rigid virus-like protein particle compared to the wild type (Variant D;
mtD). The above Glu is preferably replaced by Gln.

In another embodiment, the present invention provides a Gl at position 160.
u, Glu at position 163 and Asp at position 348 have been replaced by other amino acids, providing a protein (variant E; mtE) that forms rigid or stable virus-like protein particles compared to the wild type I do. Glu is preferably Gln
And Asp is preferably replaced by Asn. In another embodiment, the invention provides a Glu at position 332, 33
Glu at position 3 and Asp at position 348 have been substituted with other amino acids, providing a protein (variant F; mtF) that can frequently form rod-like virus-like protein particles. The above Glu is preferably replaced by Gln and Asp is preferably replaced by Asn.

In another embodiment, the present invention is directed to a Glu at position 49.
And Glu at position 51 has been replaced with another amino acid,
A protein that forms a rigid or stable virus-like protein particle compared to the wild type (mutant G; mtG)
I will provide a. The Glu is preferably replaced by Gln.

In another embodiment, the present invention is directed to a Gl at position 49.
u, Glu at position 51, Glu at position 160, Glu at position 163, Ser at position 216,
Lys at position 217, Glu at position 219, Glu at position 332, Glu at position 333 and
It provides a protein (variant H; mtH) in which Asp at position 348 has been substituted with another amino acid, making it difficult to form virus-like protein particles as compared to the wild type. Glu is preferably replaced by Gln, Asp is preferably replaced by Asn, Ser is preferably replaced by Ala, and Lys is preferably replaced by Ala.

The present invention also provides nucleic acids, such as DNAs, encoding the various mutant proteins described above. The present invention also provides a vector, particularly an expression vector, comprising the above DNA. The present invention also provides a host cell, preferably an insect cell, into which the above-mentioned vector has been introduced.

The present invention also provides a method for culturing the above host cell,
A method for producing virus-like protein particles, comprising collecting virus-like protein particles from a culture. The present invention further comprises culturing the above host cells, recovering virus-like protein particles from the culture, dissociating the virus-like protein particles into VP1 pentamers, and reconstituting the virus-like protein particles from the VP1 pentamers. A method for producing a virus-like protein particle is provided.

[0020]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Simian used in the present invention
Amino acid of virus 40 virus protein 1 (SV40 VP1)
The acid sequence has already been described in the literature cited above.
Glu in wild-type VP1 protein is replaced by another amino acid
Glu is an anion (-COO ^-) By Calciu
It is thought that it interacts with
Mutation to form virus-like protein particles
If you want to change it,^-A) without
Amino acids, i.e. amino acids other than Asp
Is preferred. Also, replace Asp with another amino acid
In the case, amino acids other than Glu are used for the same reason as above.
Substitution is preferred. However, only in terms of price
Different, the structure of the amino acids themselves should be as similar as possible
Are preferred, so that Glu is replaced by Gln and Asp is
Preferably, it is replaced by sn.

The substitution of Ser is not particularly limited as long as it is an amino acid other than Ser, but Ala is preferred because of the similarity in molecular size. Further, the substitution of Lys may be a neutral amino acid, but for example, Ala can be used. The structure of a specific mutant protein of the present invention is shown in FIG. The host cell used in the present invention may be an animal cell, but a cultured insect cell is particularly preferable. The control region of the expression vector, for example, the promoter may be any as long as it functions in the selected host cell. For example, a viral promoter, for example, a polyhedrin (polyhedron) promoter, a p10 promoter and the like are used.

[0022]

Next, the present invention will be described more specifically with reference to examples. Example 1 Preparation of Gene System Encoding Mutant Protein DNA encoding each variant protein was prepared by site-specific mutagenesis by PCR. Plasmid as template
pUCVP1 (Kusukegawa et al., Biochim.Biophys.Acta.Vol.129
0, p.37-45 (1996)).

The following primers were used as mutagenic primers. E49Q, E51Q (sense): CTT CAC T C A GGT G C A GTG CTT TTT
AAA TCC (SEQ ID NO: 2) E49Q, E51Q (antisense): AAA AAG CAC T G C ACC T G A G
TG AAG CTG TC (SEQ ID NO: 3) E160Q (sense): GTT GGT GGG C AA CCT TTG GAG C (SEQ ID NO: 4) E160Q (antisense): GCT CCA AAG GTT G CC CAC CAA C
(SEQ ID NO: 5) E163Q (sense): GGA ACC TTT G C A GCT GCA GGG ( SEQ ID NO: 6) E163Q (antisense): CCC TGC AGC T G C AAA GGT TCC ( SEQ ID NO: 7)

E160Q, E163Q (sense): GTT GGT GGG C AA C
CT TTG C AG CTG CAG GG (SEQ ID NO: 8) E160Q, E163Q (antisense): CCC TGC AGC T G C AAA GGT
T G C CCA CCA AC (SEQ ID NO: 9) S216A, K217A, E219Q (sense): CCT GAT CCA GC T GC A AA
T C AA AAC ACT AGA TAT TTT GGA ACC TAC (SEQ ID NO: 1
0) S216A, K217A, E219Q (antisense): GTG TTT T G A TTT
GC A GC T GGA TCA GGAACC CAG CAC TCC (SEQ ID NO: 11)

[0025] E332Q, E333Q (sense): CCT CTC AAG TA C A
G C AGG TTA GGG (SEQ ID NO: 12) E332Q, E333Q (antisense): CCC TAA CCT G CT G TA CTT
GAG AGG (SEQ ID NO: 13) D348N (sense): GGG GAT CCA A AC ATG ATA AGA TAC (SEQ ID NO: 14) D348N (antisense): GTA TCT TAT CAT GT T TGG ATC CC
C (SEQ ID NO: 15) WT5'T (sense): AAG GGT CGA CAT GAA GAT GGC CCC AAC
AAA AAG (SEQ ID NO: 16) WT3'T (antisense): CCG GCT CGA GTC ACT GCA TTC T
AG TTG TGG TTT G (SEQ ID NO: 17)

In the second round of PCR, the primer pair WT
5'T (sense) and WT3'T (antisense) were used. For subcloning, Sal was added to the 5 'end of the mutated DNA fragment.
An I restriction enzyme site was introduced. The amplified product was digested with SalI and the cloning vector pBluescriptII (S
(Commercially available from TRATAGENE) into the SalI and blunt-ended HindIII sites to yield plasmids pBSmtA-pBSmtH. The nucleotide sequence of the coding region of all variants was confirmed by dideoxynucleotide sequencing analysis.

For expression as a baculovirus, pB
Each of SmtA-pBSmtH was digested with SalI and EcoRV and inserted into SalI and blunt-ended HindIII of pFastBac1 (commercially available from Gibco BRL). Furthermore, using this plasmid and the Bac-To-Bac system (commercially available from GibcoBRL), a recombinant baculovirus containing the mutant DNA was prepared.

Embodiment 2 FIG . Mutant protein expression and cells
Analysis of the formation of virus-like protein particles in spodoptera frugiperda
(Sf9) cells were streptomycin-penicillin and 0.3
Sf-900II medium supplemented with 10% heat-inactivated fetal bovine serum (Gib
(co BRL) at 27 ° C. in rotation culture flasks.

For protein expression, Sf9 cells were seeded in tissue culture blood at 2 × 10 ⁵ cells / cm ² and allowed to attach for at least 1 hour at room temperature. Recombinant baculovirus containing the mutant VP1 gene was attached to Sf9
Degree of superinfection (MOI) 5-1 in cells (5 × 10 ⁷ cells at the time of infection)
Infected at 0. 1 hour later TC-1 supplemented with streptomycin, penicillin and 10% heat-inactivated fetal bovine serum
00 medium (Gibco BRL) was added and cells were cultured at 27 ° C.

The infected cells were collected 72 hours after infection. After washing twice with phosphate buffer, the cells were washed with 1 ml
Sonication buffer (20 mM Tris-HCl [pH 7.9], 1%
Ultrasonication with sodium deoxycholate, 2 mM phenylmethylsulfonyl fluoride (PMSF), 1 μg / ml chymostatin, 1 μg / ml aprotinin, 1 μg / ml leupeptin, 1 μg / ml antipine, 1 μg / ml pepstatin) And centrifuged at 15,000 xg for 10 minutes at 4 ° C and the supernatant was collected.

The following tests were performed using the whole cell lysate prepared by the above method. The soluble fraction of the whole cell lysate was separated by SDS-PAGE and stained with CBB (Coomassie brilliant blue). The results are shown in FIG. 2A. Expression of VP1 (about 50 kDa) was observed in all mutants and wild type (WT). In the same gel as above A, anti-VP1
The result of immunoblotting with the antibody is shown in FIG. 2B. Proteins produced in all mutants and wild type reacted with anti-VP1 antibody.

The whole cell lysate was subjected to a 10-30% sucrose gradient centrifugation, the fractions were separated by SDS-PAGE and the anti-VP1
Immunoblotting was performed using the antibody. The result is shown in FIG.
Shown in Fractions 8-12 represent virus-like protein particles. The ratio (%) of the VP1 protein detected in the virus-like protein particle fraction to the total VP1 protein is shown on the right end. All mutant proteins except mutant H (mtH) formed virus-like protein particles in Sf9 cells at a higher rate than wild-type protein. The ability of mutant H to form virus-like protein particles was very low.

The sucrose density gradient centrifugation was performed as follows. 20 μl of the cell lysate diluted 10-fold with 20 mM Tris-HCl (pH 7.9) was added to a 5 × 41 mm open top tube (B
eckman) and gently overlaid on 0.6 ml of a 10-30% sucrose density gradient. Tube at 45,000rpm for 1 hour 4
Centrifuged at 55 ° C in a SW55Ti rotor. After centrifugation, 55 μl fractions were collected from the top of the tube, and the bottom of the tube was filled with 55 μl of sodium dodecyl sulfate (SDS) sample lysis buffer (62.5 mM (Tris-HCl (pH 6.8), 2.1% SDS, 10% % Glycerin, 144 mM 2-mercaptoethanol) From each fraction 7 μl were separated by SDS-PAGE and immunoblotted with an anti-SV40 VP1 polyclonal antibody.
ham).

Embodiment 3 FIG . Purification of VP1 and virus-like tamper
Analysis of formation of dendritic particles 400 μl of whole cell lysate was previously formed2
It was gently overlaid on 4 ml of a 0-50% (wt / vol) cesium chloride density gradient and centrifuged at 35,000 rpm for 3 hours at 4 ° C. in a SW55Ti rotor (Bechman). After centrifugation, fractions were collected from the top of the tube, and samples from each fraction were separated by sodium dodecyl sulfate-polyacrylamide-gel electrophoresis (SDS-PAGE). Proteins were visualized by Coomassie Brilliant Blue (CBB) staining.

In the fraction containing the virus-like protein particles, 35
% (Wt / vol) cesium chloride solution was added and centrifuged again at 4 ° C. for 20 hours at 50,000 rpm in an SS55Ti rotor. next,
Fractions were collected as described above. Next, the fractions containing the virus-like protein particles were added to a final concentration of 0.1% NP-10 and buffered several times in 20 mM Tris-HCl (pH 7.9), 0.1% NP-40 for at least 15 hours. The dialysis was performed while changing the dialysis. After dialysis, samples are collected and 4 minutes at 15,000 xg for 10 minutes.
Centrifuged at ℃ and stored the supernatant at -80 ℃.

The results of separation by SDS-PAGE and visualization by silver staining are shown in FIG. WT indicates wild type. All mutant proteins except mutant H were detected. For mutant H, no detectable purified protein was obtained due to poor formation of virus-like protein particles. An electron micrograph of the purified virus-like protein particles is shown in FIG. Mutant proteins A-G formed virus-like protein particles similar to the wild-type protein, while mutant F further formed rod-like virus-like protein particles.

[0037] Example 4. Testing virus-like protein particles
In vitro dissociated and purified virus-like protein particles (20 ng protein)
In 30 mM Tris-HCl (pH 7.9) containing ₂ mM CaCl ₂
Incubation with DTT (lanes 9-16) or without DTT (lanes 1-8) was performed at 37 ° C with DTT or 4 ° C without DTT for 1 hour.

Next, 5 μl of sample addition buffer (250 mM Tris-acetic acid [pH 8.1], 25% (vol / vol) glycerin, 0.125% bromophenol blue) was added to each sample, and 7 μl of the sample was added. 50mM Tri containing 2mM CaCl ₂
0.8% agarose gel electrophoresis in s-acetic acid (pH 8.1) was performed. Electrophoresis was performed at 4 ° C. in the same buffer as the buffer in the gel until the dye reached the edge of the gel (about 2 hours at 75 V). After electrophoresis, proteins were transferred to polyvinylidene difluoride membrane in 50 mM NaOH for 3-8 hours at room temperature by standard capillary transfer and
Immunoblotting was performed using the -VP1 antibody.

The results are shown in FIG. In the presence of calcium ions, mutants A, B,
C, F, G and wild type (WT) VP1 maintained the shape of the virus-like protein particles (lanes 1-4, 7, 8, 9).
~ 12, 15 and 16). Variant G virus-like protein particles migrate faster than other virus-like protein particles, which may be due to differences in surface charge on the virus-like protein particles. The relative mobilities of mutants D and E decreased, presumably due to the aggregation of virus-like protein particles in the presence of calcium ions.

A similar experiment as described above was performed in the absence of calcium ions. In this case, no calcium ion was added to the electrophoresis buffer. The results are shown in FIG. All mutant VP1 and wild-type VP in the absence of DTT
1 maintained the shape of the virus-like protein particles (lanes 1-8). In this case also, mutant G moved slightly faster.
In the presence of DTT (lanes 9-16), wild-type VP
1 (WT) dissociated into pentamers (lane 9), whereas all mutant VP1s behaved differently from wild-type VP1 (lanes 9-16).

That is, mutants A, D and E did not dissociate at all (lanes 10, 13 and 14) and mutants B, C, F and G
Virus-like protein particles dissociated, but the mobility of the dissociation product was lower than that of the VP1 pentamer, indicating incomplete dissociation (lanes 11, 12, 15, and 1).
6). In addition, portions of mutants B and C remained undissociated (lanes 11 and 12). From these results, wild-type VP
Compared to 1, all variants VP1 are more resistant to dissociation of virus-like protein particles and
It was shown that interacting amino acids, particularly Glu at position 160, contributed to the flexibility of the virus-like protein particles.

The same experiment as described above was performed, but without adding calcium ions, and using a calcium ion chelating agent, 1,2-bis (2-aminophenoxy) ethane-N,
N, N ', N'-tetraacetic acid (BAPTA) was added at a concentration of 25 mM,
Incubation was performed at 37 ° C. The results are shown in FIG.
Shown in No virus-like protein particles were dissociated in the absence of DTT (reducing agent for disulfide bonds) (lanes 1-8), but in the presence of DTT (therefore disulfide bonds were cleaved) and calcium ions Is BA
Under conditions completely blocked by PTA (lanes 9 to 16), the virus-like protein particles of the wild-type and all mutant VP1 were completely dissociated to pentamers (lane 17).

[0043]

EFFECT OF THE INVENTION The mutant VP1 of the present invention makes it difficult to dissociate virus-like protein particles into pentamers as compared with wild-type VP1, and improves the stability of protein particles.
Furthermore, in the mutant F, rod-like virus-like protein particles are formed. Therefore, the mutant VP1 of the present invention forms virus-like protein particles, encapsulates drugs and genes therein, and as a drug administration system in drug therapy,
Alternatively, it is useful as a means for gene transfer in gene therapy.

[0044]

[Sequence List] <110> Hiroshi Handa <120> <130> <160> <210> 1 <211> 364 <212> PRT <213> Simian Virus 40 <223> Amino arid Sequence of SV40 VP1 <400> 1 Met Lys Met Ala Pro Thr Lys Arg Lys Gly Ser Cys Pro Gly Ala Ala 1 5 10 15 Pro Lys Lys Pro Lys Glu Pro Val Gln Val Pro Lys Leu Val Ile Lys 20 25 30 Gly Gly Ile Glu Val Leu Gly Val Lys Thr Gly Val Asp Ser Phe Thr 35 40 45 Glu Val Glu Cys Phe Leu Asn Pro Gln Met Gly Asn Pro Asp Glu His 50 55 60 Gln Lys Gly Leu Ser Lys Ser Leu Ala Ala Glu Lys Gln Phe Thr Asp 65 70 75 80 Asp Ser Pro Asp Lys Glu Gln Leu Pro Cys Tyr Ser Val Ala Arg Ile 85 90 95 Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met 100 105 110 Typ Glu Ala Val Thr Val Val Lys Thr Glu Val Ile Gly Val Thr Ala Met 115 120 125 Leu Asn Leu His Ser Gly Thr Gln Lys Thr His Glu Asn Gly Ala Gly 130 135 140 Lys Pro Ile Gln Gly Ser Asn Phe His Phe Phe Ala Val Gly Gly Glu 145 150 155 160 Pro Leu Glu Leu Gln Gly Val Leu Ala Asn Tyr Arg Thr Lys Tyr Pro 165 170 175 Ala Gln Thr Val Thr Pro Lys Asn Ala Thr Val Asp Ser Gln Gln Met 180 185 190 Asn Thr Asp His Lys Ala Val Leu Asp Lys Asp Asn Ala Tyr Pro Val 195 200 205 Glu Cys Trp Val Pro Asp Pro Ser Lys Asn Glu Asn Thr Arg Tyr Phe 210 215 220 Gly Thr Tyr Thr Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr 225 230 235 240 Asn Thr Ala Thr Thr Val Leu Leu Asp Glu Gln Gly Val Gly Pro Leu 245 250 255 Cys Lys Ala Asp Ser Leu Tyr Val Ser Ala Val Asp Ile Cys Gly Leu 260 265 270 Phe Thr Asn Thr Ser Gly Thr Gln Gln Trp Lys Gly Leu Pro Arg Tyr 275 280 285 Phe Lys Ile Thr Leu Arg Lys Arg Ser Val Lys Asn Pro Tyr Pro Ile 290 295 300 Ser Phe Leu Leu Ser Asp Leu Ile Asn Arg Arg Thr Gln Arg Val Asp 305 310 315 320 Gly Gln Pro Met Ile Gly Met Ser Ser Gln Val Glu Glu Val Arg Val 325 330 335 Tyr Glu Asp Thr Glu Glu Leu Pro Gly Asp Pro Asp Met Ile Arg Tyr 340 345 350 Ile Asp Glu Phe Gly Gln Thr Thr Thr Arg Met Gln 355 360

<210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> E49Q, E51Q double mutation sense primer <400> 2 cttcactcag gtgcagtgct ttttaaatcc 30

<210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> E49Q, E51Q double mutation antisense primer <400> 3 aaaaagcact gcacctgagt gaagctgtc 29

<210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> E160Q sense primer <400> 4 gttggtgggc aacctttgga gc 22

<210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> E160Q antisense primer <400> 5 gctccaaagg ttgcccacca ac 22

<210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> E163Q sense primer <400> 6 ggaacctttg cagctgcagg g 21

<210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> E163Q antisense primer <400> 7 ccctgcagct gcaaaggttc c 21

<210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> E160Q, E163Q double mutation sense primer <400> 8 gttggtgggc aacctttgca gctgcaggg 29

<210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> E160Q, E163Q double mutation autisense primer <400> 9 ccctgcagct gcaaaggttg cccaccaac 29

<210> 10 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> S216A, K217A, E219Q, triple mutation sense primer <400> 10 cctgatccag ctgcaaatca aaacactaga tattttggaa cctac 45

<210> 11 <211> 39 <212> DNA <220> <223> S216A, K217A, E219Q, triple mutation antisense primer <400> 11 gtgttttgat ttgcagctgg atcaggaacc cagcactcc 39

<210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> E332Q, E333Q, double mutation sense primer <400> 12 cctctcaagt acagcaggtt aggg 24

<210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> E332Q, E333Q, double mutation antisense primer <400> 13 ccctaacctg ctgtacttga gagg 24

<210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> D348N sense primer <400> 14 ggggatccaa acatgataag atac 24

<210> 15 <211> 24 <212> DNA <213> Artifical Sequence <220> <223> D348N antisense primer <400> 15 gtatcttatc atgtttggat cccc 24

<210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> WT5'T sense primer <400> 16 aagggtcgac atgaagatgg ccccaacaaa aag 33

<210> 17 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> WT3'T antisense primer <400> 17 ccggctcgag tcactgcatt ctagttgtgg tttg 34

<210> 18 <211> 1092 <212> DNA <213> Simian Virus 40 <223> Nucleatide sequence encoding SV40 VP1 <400> 18 atgaagatgg ccccaacaaa aagaaaagga agttgtccag gggcagctcc caaaaaacca 60 aaggaaccag tgcaagtgcc aaagctcgatagag taggagtagatagag tagcagtagatagagtagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagag gagtgctttt taaatcctca aatgggcaat 180 cctgatgaac atcaaaaagg cttaagtaaa agcttagcag ctgaaaaaca gtttacagat 240 gactctccag acaaagaaca actgccttgc tacagtgtgg ctagaattcc tttgcctaat 300 ttaaatgagg acttaacctg tggaaatatt ttgatgtggg aagctgttac tgttaaaact 360 gaggttattg gggtaactgc tatgttaaac ttgcattcag ggacacaaaa aactcatgaa 420 aatggtgctg gaaaacccat tcaagggtca aattttcatt tttttgctgt tggtggggaa 480 cctttggagc tgcagggtgt gttagcaaac tacaggacca aatatcctgc tcaaactgta 540 accccaaaaa atgctacagt tgacagtcag cagatgaaca ctgaccacaa ggctgttttg 600 gataaggata atgcttatcc agtggagtgc tgggttcctg atccaagtaa aaatgaaaac 660 actagatatt ttggaaccta cacaggtggg gaaaatgtgc ctcctgtttt gcacattact 720 aacacagcaa ctacagtg ctacagtg gtgttg ggcccttgtg caaagctgac 780 agcttgtatg tttctgctgt tgacatttgt gggctgttta ccaacacttc tggaacacag 840 cagtggaagg gacttcccag atattttaaa attaccctta gaaagcggtc tgtgaaaaac 900 ccctacccaa tttccttttt gttaagtgac ctaattaaca ggaggacaca gagggtggat 960 gggcagccta tgattggaat gtcctctcaa gtagaggagg ttagggttta tgaggacaca 1020 gaggagcttc ctggggatcc agacatgata agatacattg atgagtttgg acaaaccaca 1080 actagaatgc ag 1092

[Brief description of the drawings]

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows VP1 mutants A to H (mtA to mt) of the present invention.
H) is a diagram showing the mutation site, wherein the upper numeral indicates the mutation site in the amino acid sequence of SEQ ID NO: 1, and the one-letter designation of the amino acid in the upper frame indicates the mutation in the amino acid sequence of wild type VP1 Indicates the amino acid targeted for

FIG. 2. In FIG. 2, A shows that the soluble fraction of the cell lysate of Sf9 cells infected with the baculovirus containing the gene encoding the VP1 mutant was separated by SDS-PAGE and analyzed by Coomassie Brilliant Blue. It is an electrophoretogram showing the result of staining. B is an electrophoretogram showing the results of detection of the protein separated in A using an anti-VP1 antibody. C: Whole cell lysate was fractionated by 10-30% sucrose density gradient centrifugation, and the protein in each fraction was analyzed by SDS-PAGE.
FIG. 4 is an electrophoretogram showing the results of separation by immunoblotting and detection by immunoblotting.

FIG. 3A is an electrophoretogram showing the results of purification of each mutant protein and wild-type protein from a cell lysate, separation by SDS-PAGE, and visualization by silver staining. B is an electron micrograph of the purified virus-like protein particles, which is a drawing substitute photograph showing the morphology of an organism.

In FIG. 4, A shows that purified virus-like protein particles were obtained in the presence of calcium ions and in the presence (lanes 9 to 16) or absence (lanes 1 to 8) of DTT.
FIG. 9 is an electrophoretogram showing the results of separation by agarose gel electrophoresis after incubation in step (1) and detection with an anti-VP1 antibody. B is an electrophoretogram showing the result of performing the same experiment as in A without adding calcium ions.
C is an electrophoretogram showing the results of performing the same experiment as in A without adding calcium ions and adding a calcium ion chelating agent BAPTA.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 48/00 C12N 5/00 B 4H045 (72) Inventor Hajime Watanabe 2-3-3 Tatsumi Minami, Okazaki City, Aichi Prefecture 1-4-304 (72) Inventor Korea Matsui 1838-21 Tsuruma, Machida-shi, Tokyo Eclair Minami Machida 506 (72) Inventor Shinnosuke Kanesashi 6-11-19 Minami-Rinma, Yamato-shi, Kanagawa 103 Corp. Minami-Rinma 103 (72) Inventor Maynur Hock United States, New Jersey, Kearney, Liberty Street, 52, apartment number 49 (72) Inventor Hiroaki Yajima 6-35-5-101 Nomidai, Kanazawa-ku, Yokohama, Kanagawa Prefecture (72) Inventor Kosuke Kataoka Nerima-ku, Tokyo Nerima 1-26-9-401 (72) Inventor Hiroshi Handa 1-17-16 F-ter, Sakurajosui, Setagaya-ku, Tokyo (Reference) 4B024 AA01 BA80 CA04 DA02 GA11 HA12 4B064 AG01 CA10 CA19 CC24 DA01 4B065 AA90X AA95Y AB01 AC14 BA02 CA24 CA44 4C076 CC03 EE41A FF02 4C084 AA13 NA14 ZB011 4H045 AA10 BA10 CA01 EA34 FA74

Claims (15)

[Claims] 1. Glu at position 49 and G at position 51 of simian virus 40 virus protein 1 (SU40VP1) capsid protein
lu, Glu at 160, Glu at 163, Ser at 216, Ly at 217
s, Glu at position 219, Glu at position 332, Glu at position 333 and As at position 348
A protein in which at least one amino acid of p has been replaced by another amino acid, and the ability to form virus-like protein particles in cells has been altered. 2. Glu is replaced by Gln, Ser is replaced by Ala, Lys is replaced by Ala, and Asp is replaced by Asn.
2. The protein of claim 1, wherein the protein is replaced by 3. The protein according to claim 1, wherein Glu at position 160 has been substituted with another amino acid (variant A) to form a hard or stable virus-like protein particle as compared to the wild type. 4. The protein according to claim 1, wherein Glu at position 163 is substituted with another amino acid (variant B) to form a virus-like protein particle which is harder or more stable than wild type. 5. The protein according to claim 1, wherein Asp at position 348 is substituted with another amino acid (variant C) to form a virus-like protein particle which is harder or more stable than the wild type. 6. Glu at position 160 and Glu at position 163 are substituted with another amino acid (variant D) to form a hard or stable virus-like protein particle as compared to the wild type. A protein according to claim 1. 7. Glu at position 160, Glu at position 163 and Asp at position 348
3. The protein according to claim 1, wherein is replaced by another amino acid (variant E) to form a virus-like protein particle that is harder or more stable than the wild type. 8. Glu at position 332, Glu at position 333 and Asp at position 348.
Is substituted with another amino acid (variant F), and is capable of forming rod-like virus-like protein particles at high frequency. 9. Glu at position 49 and Glu at position 51 have been substituted with another amino acid (variant G) to form a virus-like protein particle which is harder or more stable than the wild type. A protein according to claim 1. 10. Glu at position 49, Glu at position 51, Glu at position 160,
Glu at position 163, Ser at position 216, Lys at position 217, Glu at position 219, 33
The Glu at position 2, Glu at position 333 and Asp at position 348 are substituted by other amino acids (variant H), and are less likely to form virus-like protein particles as compared to the wild type. protein. 11. A nucleic acid encoding the protein according to any one of claims 1 to 10. 12. An expression vector comprising the nucleic acid according to claim 1. A host cell into which the expression vector according to claim 12 has been introduced. 14. The host cell according to claim 13, which is an insect cell. 15. A method for producing virus-like protein particles, comprising culturing the host cell according to claim 14 or 15 and collecting virus-like protein particles.