JP2002355058A - Tissue-specific new secretory polypeptide and its dna - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a tissue-specific new secretory polypeptide and its DNA. SOLUTION: The polypeptide of the present invention and the DNA encoding the polypeptide can be used for the diagnosis, treatment and prevention of e.g. cancer, immunologic disease, infectious disease, digestive tract disease, circulatory system disease and endocrine disease. The polypeptide of the invention is useful as a reagent for the screening of a compound or its salt effective for promoting or inhibiting the activity of the polypeptide of the present invention. Since the antibody against the polypeptide of the present invention can specifically recognize the polypeptide of the present invention, it can be used for the detection, determination, neutralization, etc., of the polypeptide in a test liquid.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel polypeptide for regulating a secretory biological function and its DNA, an antibody against the polypeptide, a screening method and a kit for a compound which promotes or inhibits the activity of the polypeptide, and the screening method. And a compound obtained by the kit,
Pharmaceuticals containing the compounds, their use, and the DN
A containing non-human transgenic animals.

[0002]

2. Description of the Related Art Cells are prokaryotic and eukaryotic in nature.
Secretes a wide variety of proteins through a unique mechanism.
In particular, multicellular organisms (living organisms)
Various information is exchanged between cells to maintain sex.
However, there are many humoral factors that play a central role there.
Is a secreted protein or its mature form and its structure
Hormones, neurotransmitters, sites
Classified as Cain, Growth Factor, etc. (Cytokine,
Growth Factor BIO Science Term Library Yodosha).
With the recent advances in recombinant DNA technology and cell culture technology,
Genes and proteins encoding these secreted proteins
The elucidation of the structure is steadily progressing. On the other hand,
The discovery skips the analysis of its receptor expressed on the cell surface.
Dramatically advances, and furthermore, the mechanism of information transmission within each cell
And elucidate its physiology.
(Receptors on cell membranes-from basic knowledge to the latest information)
At Nanzan-do). Many diseases or various diseases in humans
In the disease state of the diseased animal model, such homeostasis should be maintained.
Abnormal expression of some humoral factors
Often lead to exacerbation
Others, for example, specifically enhanced expression in cancer
So-called tumor markers (tumor markers Chugai medicine
There are some phenomena that can be applied in the field of diagnosis of various diseases.
Regulation mechanism is an important target in drug discovery research
Has become.

At present, analysis of the total DNA of one organism, that is, genomic DNA, is performed in several organisms ranging from prokaryotes to eukaryotes, and the analysis has been completed in Escherichia coli, yeast, nematodes, Drosophila, humans, and the like. ing. As a result of this analysis, the number of genes in the human genome was found to be 30,000 to 40,000 (Natur
e, Vol. 409, No. 6822 (2001); Scie
nce, Vol. 291, No. 5507 (2001)). Certainly, although genes encoding many secretory proteins or peptides have been isolated,
The number is not very comprehensive when viewed from the whole genome. In order to understand life phenomena at the individual level, it is necessary to be able to explain the exchange of information among all cells occurring in it, but unknown functional molecules other than these known genes are important There is a high possibility that the substance plays an important physiological role, and the discovery of such a substance has been strongly desired.

[0004]

SUMMARY OF THE INVENTION The present invention relates to a novel biological function-regulating secreted polypeptide or its amide or its ester or its salt (hereinafter sometimes referred to as DRL90 polypeptide or simply DRL90. Polypeptide "), its mature form or its amide or its ester or its salt (hereinafter sometimes simply referred to as" peptide of the present invention "), its partial peptide or its amide or its ester or A salt thereof (hereinafter sometimes simply referred to as “partial peptide of the present invention”), a polynucleotide encoding the polypeptide, peptide or partial peptide, DNA (hereinafter sometimes simply referred to as “DNA of the present invention”) ), Recombinant vector, transformant, said polypeptide, pep Preparation of de or the partial peptide, a pharmaceutical containing the polypeptide, peptide or partial peptide, or polynucleotide, an antibody against the polypeptide, peptide or partial peptide, the polypeptide,
It is intended to provide a screening method using a peptide or a partial peptide.

[0005]

Means for Solving the Problems Isolation of a secretory protein that regulates a new biological function gives new knowledge to mechanisms such as cell differentiation, proliferation, biological defense and canceration, and furthermore, the development and homeostasis of individuals. It is possible to further advance the elucidation of life phenomena such as maintenance and the like, and it is expected to develop new drugs that exert inhibitory or promoting activity on the protein and are useful for prevention, diagnosis, and treatment of various diseases. As a result of intensive studies, the present inventors have succeeded in cloning a cDNA having a novel nucleotide sequence from a human thymus cDNA library. The present inventors have found that the protein encoded by the obtained cDNA is mainly important for maintaining homeostasis such as thymus, spleen, liver, pancreas, lymph node, lymphocyte, leukocyte, testis, biological defense, and reproduction. Humoral factors produced in various organs, and useful as regulators of germ cell differentiation and function.
As a result of further study based on these findings, the present invention has been completed.

That is, the present invention relates to (1) SEQ ID NO: 4
A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by, or an amide or ester thereof, or a salt thereof,
(2) SEQ ID NO: 4, SEQ ID NO: 2 or SEQ ID NO: 1
The polypeptide according to the above (1), which comprises the amino acid sequence represented by No. 4, or an amide or ester thereof or a salt thereof, (3) SEQ ID NO: 6 or SEQ ID NO:
A peptide or an amide or an ester or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 8;
(4) The peptide according to the above (3), which contains the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8, or an amide or ester thereof, or a salt thereof, (5)
The polypeptide according to the above (1) or the partial peptide of the peptide according to the above (3) or an amide or an ester or a salt thereof, and (6) a polynucleotide having a base sequence encoding the polypeptide according to the above (1). Containing polynucleotide, (7) SEQ ID NO: 1,
The polynucleotide according to the above (6), comprising the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 15, (8) the above (6) or (7) which is DNA The polynucleotide of claim,
(9) a polynucleotide containing a polynucleotide having a nucleotide sequence encoding the peptide of (3), (10) containing a polynucleotide having a nucleotide sequence represented by SEQ ID NO: 7 or SEQ ID NO: 9 (9) the polynucleotide according to (9) or (10), which is a polynucleotide;
(12) a recombinant vector containing the polynucleotide of (6) or (9), (13) a transformant transformed with the recombinant vector of (12), (1)
4) The above-mentioned (1), wherein the transformant of (13) is cultured to produce and accumulate the polypeptide of (1) or the peptide of (3).
Or the method for producing the peptide or the amide or the ester or the salt thereof according to the above (3), (15) the polypeptide or the amide or the salt thereof according to the above (1). An antibody against the ester or a salt thereof, the peptide according to the above (3), an amide thereof, an ester thereof, or a salt thereof, or the partial peptide according to the above (5), an amide thereof, an ester thereof, or a salt thereof; The polypeptide according to 1) or its amide or its ester or its salt, or the peptide according to (3) or its amide or its ester or its salt, or the partial peptide as described in (5) or its amide or its ester Or a salt thereof, wherein the polypeptide or the amide or ester thereof or the salt thereof, or the peptide or the amide or ester thereof or the salt thereof according to the above (3), wherein (5) a method for screening a compound or a salt thereof that promotes or inhibits the activity of the partial peptide or amide or ester thereof or a salt thereof according to (5), (17) a polypeptide according to the above (1) or an amide or ester thereof or a salt thereof The salt according to the above (1), which comprises the salt, the peptide according to the above (3) or its amide or its ester or its salt, or the partial peptide according to the above (5) or its amide or its ester or its salt. Polypeptide or its polypeptide Promotes or inhibits the activity of the peptide or its ester or its salt, or the peptide or its amide or its ester or its salt as described in (3) above, or the partial peptide or its amide or its ester or its salt as described in (5) above. (18) The polypeptide or amide or amide thereof according to (1), which can be obtained using the screening kit for (18) the screening method according to (16) or the screening kit according to (17). A compound that promotes or inhibits the activity of the ester or a salt thereof, the peptide or the amide or the ester or the salt thereof, or the partial peptide or the amide or the ester or the salt thereof according to the above (5); The salt , (19) a medicament comprising the compound of (18) or a salt thereof, (20) the screening method of (16) or the screening kit of (17), The polypeptide described in (1) or its amide or its ester or its salt, the peptide described in (3) or its amide or its ester or its salt, or the partial peptide described in (5) or its amide or its ester or A compound that promotes the activity of a salt thereof or a cancer or immunological disease, an infectious disease, a gastrointestinal disease, a prophylactic or therapeutic agent for a cardiovascular disease or an endocrine disease, comprising the salt or
(21) The polypeptide according to (1) or an amide or ester thereof, or a salt thereof, which can be obtained by using the screening method according to (16) or the screening kit according to (17).
For preventing infertility comprising a peptide or an amide or an ester thereof or a salt thereof described above, or a compound or a salt thereof for promoting the activity of the partial peptide or an amide or an ester thereof or a salt thereof according to the above (5). Therapeutic agent, (22) the polypeptide according to (1) or an amide or ester thereof or a salt thereof, which can be obtained by using the screening method according to (16) or the screening kit according to (17). A germ cell containing the peptide described in (3) or an amide or ester thereof, or a salt thereof, or the partial peptide described in the above (5), a compound promoting the activity of the amide or ester thereof, or a salt thereof, or a germ cell comprising the salt Regulator of differentiation / function of
(23) The polypeptide according to (1) or an amide or ester thereof or a salt thereof, which can be obtained by using the screening method according to (16) or the screening kit according to (17).
The differentiation or differentiation of blood cells comprising the peptide or amide or ester thereof or a salt thereof described above, or the compound or salt thereof promoting the activity of the partial peptide or amide or ester or salt thereof described in (5) above. A growth regulator, (24) a polypeptide comprising the polypeptide of the above (1) or an amide or an ester thereof or a salt thereof, or a pharmaceutical comprising the peptide of the above (3) or an amide or an ester thereof or a salt thereof; 25) The medicament according to the above (24), which is a prophylactic / therapeutic agent for cancer, an immune disease, an infectious disease, a gastrointestinal tract disease, a cardiovascular disease, or an endocrine disease; The pharmaceutical according to (24), which is a regulator of germ cell differentiation / function.
(28) The above (2) which is an agent for regulating the differentiation and proliferation of blood cells.
4) the medicament, (29) a medicament comprising the polynucleotide according to (6) or (9), (30) cancer,
The medicament according to the above (29), which is an agent for preventing or treating an immune disease, an infectious disease, a gastrointestinal disease, a cardiovascular disease or an endocrine disease.
(31) the medicament according to (29), which is an agent for preventing or treating infertility; (32) the medicament according to (29), which is a regulator of germ cell differentiation / function; (33) differentiation / proliferation of blood cells (34) a medicament comprising the antibody according to (15), a pharmaceutical agent comprising the antibody according to (15), (36) a pharmaceutical comprising the antibody according to (15), It has a base sequence complementary to or substantially complementary to the DNA encoding the polypeptide described in (1) or the peptide described in (3) or a part thereof, and has an effect of suppressing the expression of the DNA. Antisense DNA having (37)
(38) A pharmaceutical comprising the antisense DNA according to (36), (38) a dimer of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4, or a dimer thereof. Amide or an ester or a salt thereof, (39) a dimer in which C-terminal cysteine residues of a polypeptide containing an amino acid sequence represented by SEQ ID NO: 4 are linked, or an amide or an ester thereof or a dimer thereof Salt, (40) SEQ ID NO: 6
(41) a dimer of a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by the following formula, or an amide or an ester or a salt thereof, (41) containing the amino acid sequence represented by SEQ ID NO: 6 A dimer in which the cysteine residues at the C-terminal of the peptide are linked to each other, an amide thereof, an ester thereof, or a salt thereof;
2) containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 6 with a polypeptide containing the same or substantially identical amino acid sequence as represented by SEQ ID NO: 4 (43) a polypeptide having an amino acid sequence represented by SEQ ID NO: 4 and an amino acid sequence represented by SEQ ID NO: 6 (44) A polypeptide according to (1) above, a amide thereof or an ester thereof, or a salt thereof, or a dimer with a peptide or an amide thereof or an ester thereof or a salt thereof with respect to a mammal. Cancer, an immune disease, which comprises administering an effective amount of the peptide or its amide or its ester or its salt (45) a method for preventing or treating infectious diseases, gastrointestinal diseases, cardiovascular diseases, or endocrine diseases; (45) a polypeptide described in the above (1), an amide thereof, an ester thereof, or a salt thereof; A) a method for preventing or treating infertility, which comprises administering an effective amount of the peptide or the amide or ester or the salt thereof according to the above-mentioned (46); The amide or the ester or the salt thereof, or the above (3)
A method for regulating germ cell differentiation / function, which comprises administering an effective amount of the peptide or the amide or ester or the salt thereof according to the above (47); The amide or the ester or the salt thereof, or the above (3)
(48) The method according to (6) or (9) above, which comprises administering an effective amount of the peptide or the amide or ester thereof or the salt thereof according to the above (48). Prevention of cancer, immune disease, infectious disease, gastrointestinal tract disease, cardiovascular disease or endocrine disease characterized by administering an effective amount of the polynucleotide of
A therapeutic method, (49) a method for preventing or treating infertility comprising administering an effective amount of the polynucleotide according to (6) or (9) to a mammal, and (50) a method for treating a mammal. And a method for regulating germ cell differentiation / function, which comprises administering an effective amount of the polynucleotide according to (6) or (9). ) A method for regulating the differentiation and proliferation of blood cells, which comprises administering an effective amount of the polynucleotide according to the above), (52) the screening method according to the above (16) or the screening according to the above (17) for mammals. The polypeptide according to the above (1) or its amide or its ester or its salt, the peptide according to the above (3) or its amide or its amide which can be obtained using a kit for Administering an effective amount of an ester or a salt thereof, or a partial peptide according to the above (5) or a compound or an amide thereof, or a compound that promotes the activity of the ester or a salt thereof, or an effective amount of a salt thereof, characterized by administering an effective amount of the compound or the salt thereof. A method for preventing or treating a gastrointestinal disease, a circulatory disease or an endocrine disease, (53) a method for screening a mammal according to the above (16) or a method according to the above (17).
The polypeptide according to the above (1) or an amide or an ester thereof or a salt thereof, the peptide according to the above (3) or an amide or an ester thereof or a salt thereof, which can be obtained using the screening kit described above. 5) A method for preventing or treating infertility, which comprises administering an effective amount of a compound or a salt thereof which promotes the activity of the partial peptide or amide or ester thereof or a salt thereof according to the above (54). The polypeptide according to (1) or an amide or ester thereof, or a salt thereof, which can be obtained using the screening method according to (16) or the screening kit according to (17). Peptide or its amide or its ester or its salt, or Compound or differentiation-functional regulation method germ cells, which comprises administering an effective amount of a salt promoting the (5), wherein the partial peptide or its amide or active ester thereof or a salt thereof, (5
5) The polypeptide according to (1) or an amide or ester thereof or a salt thereof, which can be obtained from a mammal using the screening method according to (16) or the screening kit according to (17). Administering an effective amount of the peptide or amide or ester thereof or salt thereof described in (3) above, or the compound or salt thereof promoting the activity of the partial peptide or amide or ester or salt thereof described in (5) above. (56) The above-mentioned (1) for producing a prophylactic / therapeutic agent for cancer, immune disease, infectious disease, gastrointestinal disease, cardiovascular disease, or endocrine disease. Or the amide or the ester or the salt thereof, or the peptide of the above (3). De or use of its amide or ester, or a salt thereof, (57) cancers, immune diseases,
Use of the polynucleotide according to the above (6) or (9) for producing a prophylactic / therapeutic agent for an infectious disease, a gastrointestinal disease, a circulatory disease or an endocrine disease;
Use of the polynucleotide according to the above (6) or (9) for producing a therapeutic agent, or (59) polynucleotide according to the above (6) or (9) for producing an agent for regulating a germ cell differentiation / function. (60) differentiation of blood cells
Use of the polynucleotide according to the above (6) or (9) for producing a growth regulator, (61) cancer, an immune disease,
The method for producing a prophylactic / therapeutic agent for an infectious disease, a gastrointestinal disease, a cardiovascular disease or an endocrine disease, which can be obtained by using the screening method according to (16) or the screening kit according to (17). The polypeptide described in (1) or its amide or its ester or its salt, the peptide described in (3) or its amide or its ester or its salt, or the partial peptide described in (5) or its amide or its ester or Use of a compound that promotes the activity of the salt or a salt thereof, (62) Use of the screening method described in the above (16) or the screening kit described in the above (17) for producing an agent for preventing or treating infertility. The polypeptide according to the above (1), its amide or its Ester or a salt thereof, peptide of the above (3) or amide or an ester thereof or a salt thereof, or partial peptide of the above (5) or a compound or a salt thereof which promotes the activity of the amide or an ester thereof or a salt thereof. use,
(63) The polypeptide according to (1), which can be obtained by using the screening method according to (16) or the screening kit according to (17) for producing an agent for regulating a germ cell differentiation / function. Alternatively, the activity of the amide or its ester or its salt, the peptide of the above (3) or its amide or its ester or its salt, or the partial peptide of the above (5) or its amide or its ester or its salt is promoted. Use of the compound or a salt thereof, (64) the above (1) for producing an agent for regulating blood cell differentiation / proliferation,
The polypeptide according to (1) or an amide or ester thereof or a salt thereof, the peptide according to (3) or a salt thereof, which can be obtained using the screening method according to 6) or the screening kit according to (17). Use of an amide or an ester or a salt thereof, or a partial peptide or an amide or an ester thereof or a compound or a salt thereof which promotes the activity of the above-mentioned (5), (65) a description of the above (7) or (10) Exogenous DNA or its mutant DN
(66) the animal according to (65), wherein the non-human animal is a rodent;
(67) The animal according to the above (66), wherein the rodent is a mouse or a rat, (68) the above (7) or (1)
And a recombinant vector containing the exogenous DNA or the mutant DNA thereof described in 0) and capable of being expressed in a non-human animal.

[0007] Further, the present invention provides (69) SEQ ID NO:
The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 4 is approximately 50%
Or more (preferably about 60% or more, more preferably about 7% or more).
0% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more). An ester or a salt thereof, and (70) an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 4;
1 or 2 or more (preferably about 1 to 30, more preferably about 1 to 20, more preferably about 1 to 10, particularly preferably about 1 to 5 in the amino acid sequence represented by 4) , Most preferably one or two amino acids deleted, and one or more (preferably 1 to 2) in the amino acid sequence represented by SEQ ID NO: 4
Amino acid sequence to which about 30 amino acids have been added, more preferably about 1 to 20, more preferably about 1 to 10, particularly preferably about 1 to 5, and most preferably 1 or 2 amino acids, SEQ ID NO: 1 or 2 or more (preferably about 1 to 30, more preferably about 1 to 20, more preferably about 1 to 10, particularly preferably about 1 to 5 in the amino acid sequence represented by 4) (Most preferably 1 or 2) amino acids in which the amino acid is replaced by another amino acid, or an amino acid sequence obtained by combining them, or the polypeptide according to the above (1), an amide thereof, an ester thereof, or a salt thereof. I will provide a. Further, the polypeptide of the present invention, the peptide of the present invention, the partial peptide of the present invention, the DNA of the present invention, etc. may be used for molecular weight markers, tissue markers, chromosome mapping, identification of genetic diseases, diagnosis of disease states, primers, probe design, etc. Can be used for basic research.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION A polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 of the present invention (hereinafter sometimes referred to as the polypeptide of the present invention. , A polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4, its amide or its ester or its salt may be collectively referred to as the polypeptide of the present invention. ) Are human or other warm-blooded animals (eg, guinea pigs, rats, mice, chickens, rabbits, pigs, sheep, cows, monkeys, etc.) (eg,
Hepatocytes, spleen cells, nerve cells, glial cells, pancreatic β cells,
Bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells,
Muscle cells, adipocytes, immune cells (eg, macrophages, T
Cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary gland Cells, or stromal cells, or precursor cells, stem cells, or cancer cells of these cells) or any tissue in which those cells are present, such as the brain, various parts of the brain (eg, olfactory bulb, amygdala, basal sphere, Hippocampus, thalamus, hypothalamus, cerebral cortex, medulla, cerebellum), spinal cord, pituitary, stomach, pancreas, kidney, liver, gonad, thyroid, gallbladder, bone marrow, adrenal, skin, muscle, lung,
Digestive tract (eg, large and small intestines), blood vessels, heart, thymus, spleen,
Salivary glands, peripheral blood, prostate, testicles, ovaries, placenta, uterus,
It may be a polypeptide derived from bone, cartilage, joint, skeletal muscle, or the like, a recombinant polypeptide, or a synthetic polypeptide.

When the polypeptide of the present invention has a signal peptide (specifically, an amino acid having a signal sequence consisting of 20 amino acids at the N-terminus of SEQ ID NO: 4, such as SEQ ID NO: 2) A polypeptide characterized by containing the same or substantially the same amino acid sequence as the sequence) can efficiently secrete the polypeptide extracellularly.

The term "substantially the same" refers to the activity of a polypeptide, for example, a prophylactic / therapeutic activity (effect) of cancer, immune disease, infectious disease, gastrointestinal disease, cardiovascular disease, endocrine disease, infertility, etc., reproduction. It means that physiological properties such as cell differentiation / function regulating activity (action) and blood cell differentiation / proliferation regulating activity (action) are substantially the same. Amino acid substitutions, deletions, additions or insertions often do not result in a significant change in the physiological or chemical properties of the polypeptide, in which case the substituted, deleted, added or inserted polypeptide will Would be substantially identical to those without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine and the like. Polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like. Examples of (basic) amino acids having a positive charge include arginine, lysine, histidine and the like. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid. As the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 4, the polypeptide containing the amino acid sequence is substantially the same as the polypeptide containing the amino acid sequence represented by SEQ ID NO: 4. Same activity (property)
Is not particularly limited, as long as it has, for example, about 50% or more of the amino acid sequence represented by SEQ ID NO: 4,
Preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, particularly preferably about 9% or more.
Amino acid sequences having 0% or more, most preferably about 95% or more homology, and the like can be mentioned. More specifically, the amino acid sequence represented by SEQ ID NO: 2 and the amino acid sequence represented by SEQ ID NO: 14 can be mentioned.

[0011] Examples of the above-mentioned substantially equivalent activities (properties) include, for example, secretion and action as humoral factors. Substantially the same means that those properties are qualitatively the same. Therefore, it is preferable that properties such as secretory action and solubility are equivalent (eg, about 0.1 to 100 times, preferably about 0.5 to 10 times, more preferably 0.5 to 2 times). And the quantitative factors such as the molecular weight of the polypeptide may vary. Examples of the above-mentioned substantially equivalent activities (properties) include, for example, cancer, immunological disease, infectious disease, gastrointestinal disease, cardiovascular disease, endocrine secretion of a polypeptide containing the amino acid sequence represented by SEQ ID NO: 4. It shows that qualitatively the same preventive and therapeutic actions as diseases, infertility, etc., germ cell differentiation / function regulation, and blood cell differentiation / proliferation regulation.

[0012] More specifically, as a polypeptide containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 4, for example, one of the amino acids represented by SEQ ID NO: 4 Or two or more (preferably, about 1 to 30, more preferably about 1 to 20, more preferably about 1 to 10, particularly preferably 1 to
About 1 to 2 (most preferably 1 or 2) amino acids, or 1 or 2 or more (preferably 1 to 3) in the amino acid sequence represented by SEQ ID NO: 4
About 0, more preferably about 1 to 20, more preferably about 1 to 10, particularly preferably about 1 to 5,
Most preferably, 1 or 2 amino acids added, 1 or 2 or more (preferably about 1 to 30, more preferably 1 to 20) in the amino acid sequence represented by SEQ ID NO: 4 Degree, more preferably 1-1
A so-called polypeptide such as a polypeptide containing an amino acid sequence in which about 0, particularly preferably about 1 to 5, and most preferably 1 or 2) amino acids have been substituted with another amino acid, or an amino acid sequence combining them. Mutein is also included. When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited, but may be other than the basic amino acid pair of SEQ ID NO: 4 or a residue other than a cysteine residue. Position and the like.

[0013] SEQ ID NO: 6 or SEQ ID NO: 8 of the present invention
A peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by the following formula (hereinafter sometimes referred to as the peptide of the present invention. The amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8) Peptides containing the same or substantially the same amino acid sequence as above, or their amides or their esters or their salts, may be collectively referred to as the peptides of the present invention) are human or other warm-blooded animals (eg, , Guinea pig, rat, mouse,
Cells of chickens, rabbits, pigs, sheep, cows, monkeys, etc. (eg, hepatocytes, spleen cells, nerve cells, glial cells,
Pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killers) cell,
Mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, or stromal cells, or these Progenitor cells, stem cells or cancer cells, etc.) or any tissue in which those cells are present, for example, the brain, various parts of the brain (eg, olfactory bulb, amygdala, basal sphere, hippocampus, thalamus, hypothalamus, cerebral cortex) , Medulla, cerebellum), spinal cord, pituitary, stomach, pancreas, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus , Spleen, salivary gland, peripheral blood, prostate, testicle, ovary, placenta, uterus, bone, cartilage, joints, peptides derived from skeletal muscle, etc., may be a recombinant peptide, or a synthetic peptide. There may be. “Substantially the same” means the same as “substantially the same” in the description of the polypeptide of the present invention. As the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8, the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8 Is not particularly limited as long as it has substantially the same activity (property) as a peptide containing, for example, about 70% or more, preferably about 70% or more of the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8. Is an amino acid sequence having a homology of about 80% or more, more preferably about 90% or more, still more preferably about 95% or more, and most preferably about 98% or more. However, SEQ ID NO: 6
As the amino acid sequence substantially identical to the amino acid sequence represented by, it is preferable that the cysteine residue in SEQ ID NO: 6 is conserved. More specifically, SEQ ID NO: 6
And the amino acid sequence represented by SEQ ID NO: 8, and the like. Examples of the substantially equivalent activities (properties) include, for example, cancer, immunological disease, infectious disease, gastrointestinal disease, and circulation of a peptide having the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8. Organ diseases,
It shows that the preventive and therapeutic actions for endocrine diseases, infertility, etc., the action of regulating germ cell differentiation and function, and the action of regulating blood cell differentiation and proliferation are qualitatively equivalent.

More specifically, as a peptide containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8, for example, (1) represented by SEQ ID NO: 6 An amino acid sequence in which one or more (eg, about 1 to 10, preferably about 1 to 5, more preferably 1 or 2) amino acids in the amino acid sequence are deleted, represented by SEQ ID NO: 6 One or two or more amino acid sequences (eg, about 1 to 10
An amino acid sequence to which about 5 to 5, more preferably 1 or 2 amino acids have been added, 1 or 2 or more in the amino acid sequence represented by SEQ ID NO: 6 (eg, about 1 to 10, preferably 1 to 2) A peptide containing an amino acid sequence in which 5 or more, more preferably 1 or 2) amino acids are substituted with another amino acid, or an amino acid sequence obtained by combining them; (2) SEQ ID NO: 8 An amino acid sequence in which one or more (eg, about 1 to 5, preferably 1 or 2) amino acids have been deleted in the amino acid sequence, and 1 or 2 in the amino acid sequence represented by SEQ ID NO: 8 Above (eg, about 1 to 5, preferably 1 or 2
Amino acid sequence, SEQ ID NO:
8 or more in the amino acid sequence represented by 8 (eg,
So-called muteins, such as peptides containing an amino acid sequence in which about 1 to 5 (preferably 1 or 2) amino acids have been substituted with other amino acids, or an amino acid sequence combining them, are also included. When the amino acid sequence has been inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited, but in SEQ ID NO: 6 or SEQ ID NO: 8, SEQ ID NO:
And the position other than the 6 basic amino acid pairs and cysteine residue.

The polypeptide of the present invention or the partial peptide of the peptide of the present invention (the partial peptide of the present invention) may be any of the above-mentioned polypeptides of the present invention or partial peptides of the peptide of the present invention. For example, those having substantially the same activity as the polypeptide of the present invention or the peptide of the present invention ("substantially the same activity" has the same meaning as described above) are preferably used.
However, unlike the polypeptide of the present invention or the peptide of the present invention, the partial peptide of the present invention can be used as an antigen for producing an antibody, so that the activity of the polypeptide of the present invention or the peptide of the present invention is not necessarily required. No need to have. For example, at least five or more, preferably one, of the constituent amino acid sequences of the polypeptide of the present invention.
Peptides containing 0 or more amino acid sequences are used. In the partial peptide of the present invention, one or more (preferably, about 1 to 10, more preferably, about 1 to 5) amino acids in the amino acid sequence are deleted, or One or two or more amino acid sequences (preferably, about 1 to 20, more preferably 1 to 1)
About 0, more preferably number (1 to 5) amino acids are added, or 1 or 2 or more (preferably about 1 to 20, more preferably 1 to 2)
About 10 to 10, more preferably number (1 to 5) amino acids are inserted, or 1 or 2 or more (preferably about 1 to 10, more preferably several) in the amino acid sequence. (More preferably about 1 to 5 amino acids) may be substituted with another amino acid.

The polypeptide of the present invention, the peptide of the present invention, and the partial peptide of the present invention are those in which the substituent on the side chain of the amino acid in the molecule is protected by an appropriate protecting group, or the sugar chain is bound. Complex peptides such as so-called glycopeptides are also included.

Further, the polypeptide of the present invention and the peptide of the present invention may be a dimer, a trimer,
It may be present as a tetramer or the like. Specifically, when the monomer of the polypeptide of the present invention forms a dimer with the polypeptide of the present invention, the monomer of the peptide of the present invention In the case where a dimer is formed between the peptides of the present invention, a case where a dimer is formed between the polypeptide of the present invention and the peptide of the present invention is exemplified. In particular, as shown in Example 4 below, a dimer may be formed by a disulfide bond via a cysteine residue in SEQ ID NO: 4 or SEQ ID NO: 6. In addition, a disulfide bond may occur in the molecule via a cysteine residue in SEQ ID NO: 6 to form a monomer. Specifically, the polypeptide of the present invention and the dimer structure that can be taken by the peptide of the present invention include dimers of polypeptides consisting of the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 6 And a dimer of a polypeptide having the amino acid sequence represented by SEQ ID NO: 4 and a peptide having the amino acid sequence represented by SEQ ID NO: 6 Is raised. The structures of the polypeptide of the present invention and the monomer that can be taken by the peptide of the present invention include the monomer of the polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4, the amino acid sequence represented by SEQ ID NO: 6 And the like. Furthermore, the polypeptide of the present invention and the peptide of the present invention include any foreign peptide sequence (eg, FLAG, His tag, HA tag, HSV tag) which can be an epitope (antibody recognition site) at the N-terminus or C-terminus or the like. Etc.). Specific examples of such (poly) peptides include, for example, SEQ ID NO: 1
And a polypeptide containing the amino acid sequence represented by 4. The dimer can be obtained by linking the monomers by a chemical method or by a general genetic engineering method.

In the polypeptide of the present invention, the peptide of the present invention, and the partial peptide of the present invention, the left end is the N-terminal (amino terminal) and the right end is the C-terminal (carboxyl terminal) according to the convention of peptide description. The polypeptide of the present invention, including the polypeptide containing the amino acid sequence represented by SEQ ID NO: 4, the peptide of the present invention, and the partial peptide of the present invention have a carboxyl group (-COOH) carboxylate (C-terminal) ( —COO ⁻ ), but an amide (—CON
H ₂ ) or an ester (—COOR). Here, as R in the ester, for example, methyl, ethyl, n-propyl, isopropyl or n
A C _1-6 alkyl group such as -butyl, for example, a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl,
For example, a C _6-12 aryl group such as phenyl and α-naphthyl, for example, phenyl-C such as benzyl and phenethyl
Α- such as _1-2 alkyl group or α-naphthylmethyl
In addition to C _7-14 aralkyl groups such as naphthyl -C _{1 -2} alkyl group, pivaloyloxymethyl group which is generally used as an oral ester. When the polypeptide of the present invention or the partial peptide of the present invention has a carboxyl group (or carboxylate) other than at the C-terminus, those in which the carboxyl group is amidated or esterified include the polypeptide of the present invention, Included in the partial peptides of the invention. Examples of the ester in this case include the above-mentioned C
A terminal ester or the like is used. Furthermore, in the polypeptide of the present invention, the peptide of the present invention, and the partial peptide of the present invention, the amino group of the N-terminal amino acid residue (eg, methionine residue) has a protecting group (for example, formyl group, acetyl group, etc.). C _1-6 ones are protected by C _1-6 acyl group) alkanoyl such as those glutamine residue N-terminal region is cleaved in vivo to form pyroglutamic acid, the side chain of an amino acid in the molecule The above substituents (for example, -OH, -SH,
Amino group, imidazole group, indole group, guanidino group, etc. protected with a suitable protecting group (for example, C _1-6 acyl group such as C _1-6 alkanoyl group such as formyl group and acetyl group). Or a complex polypeptide such as a so-called sugar polypeptide to which a sugar chain is bonded.

Examples of salts of the polypeptide of the present invention, the peptide of the present invention, and the partial peptide of the present invention include physiologically acceptable acids (eg, inorganic acids and organic acids) and bases (eg, alkali metal salts). And especially preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used.
The polypeptide of the present invention, the peptide of the present invention, and the partial peptide of the present invention can be produced by a known polypeptide (protein) purification method from human or other warm-blooded animal cells or tissues described above, It can also be produced by culturing a transformant containing a DNA encoding the polypeptide of the present invention and the partial peptide of the present invention described below. Further, it can be produced according to the peptide synthesis method described later. When producing from human or mammalian tissues or cells, the homogenized human or mammalian tissues or cells are extracted with an acid or the like, and the resulting extract is subjected to reverse phase chromatography, ion exchange chromatography, etc. Purification and isolation can be achieved by combining chromatography.

For the synthesis of the polypeptide of the present invention, the peptide of the present invention or the partial peptide of the present invention or a salt thereof, or an amide thereof, a commercially available resin for polypeptide (protein) synthesis can be usually used. Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin,
-Methylbenzhydrylamine resin, PAM resin, 4-
Hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin,
4- (2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target polypeptide according to various known condensation methods. At the end of the reaction, the polypeptide is cleaved from the resin, and at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target polypeptide or an amide thereof. For the condensation of the above protected amino acids, various activating reagents that can be used for polypeptide synthesis can be used, and carbodiimides are particularly preferable. As carbodiimides, DC
C, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminoprolyl) carbodiimide and the like are used. Activation by these involves adding a protected amino acid directly to the resin along with a racemization inhibitor additive (eg, HOBt, HOOBt) or the corresponding acid anhydride or HOBt ester or HOOBt.
The ester can be added to the resin after activation of the protected amino acid in advance as an ester.

The solvent used for the activation of the protected amino acid and the condensation with the resin can be appropriately selected from solvents known to be usable for the polypeptide (protein) condensation reaction. For example, N, N-dimethylformamide,
Acid amides such as N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as methylene chloride and chloroform; alcohols such as trifluoroethanol; sulfoxides such as dimethylsulfoxide; pyridine; dioxane; Ethers, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for a polypeptide (protein) bond formation reaction, and is usually about -20 to -20.
The temperature is appropriately selected from the range of 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be carried out by repeating the condensation reaction without removing the protecting group. When a sufficient condensation cannot be obtained even by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole to prevent the subsequent reaction from being affected.

Examples of the protecting group for the amino group of the starting material include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used. The carboxyl group may be, for example, a linear, branched or cyclic alkyl ester such as an alkyl esterified ester (eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl). Aralkyl esterification (eg, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide,
It can be protected by t-butoxycarbonylhydrazide, tritylhydrazide or the like. The hydroxyl group of serine can be protected, for example, by esterification or etherification. Examples of groups suitable for the esterification include lower (C _1-6 ) alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbonic acid such as benzyloxycarbonyl group and ethoxycarbonyl group. Used. In addition, groups suitable for etherification include, for example, a benzyl group, a tetrahydropyranyl group, a t-butyl group and the like. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, Cl ₂ -Bz
1, 2-nitrobenzyl, Br-Z, t-butyl and the like are used. As the imidazole protecting group for histidine, for example, Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used. Examples of the activated carboxyl group of the raw material include, for example, a corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,2
4,5-trichlorophenol, 2,4-dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, ester with HOBt), and the like. As the activated amino group of the raw material,
For example, the corresponding phosphoric amide is used. As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, or hydrogen fluoride anhydride, methanesulfonic acid, trifluoromethane, etc. Acid treatment with dichloromethane, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., reduction with sodium in liquid ammonia, and the like are also used. The elimination reaction by the above-mentioned acid treatment is generally performed at a temperature of about -20 to 40 ° C. In the acid treatment, for example, anisole, phenol, thioanisole, meta-cresol, para-cresol, dimethyl sulfide, 1,4- Butanedithiol, 1,2-
The addition of a cation scavenger such as ethanedithiol is effective. Further, the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tryptophan is the above 1,2-ethanedithiol, 1,4-butane. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of the functional group which should not be involved in the reaction of the raw materials, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction and the like can be appropriately selected from known groups or known means. . As another method for obtaining the amide form of the polypeptide of the present invention, the peptide of the present invention, or the partial peptide of the present invention, for example, first, after amidating and protecting the α-carboxyl group of the carboxy terminal amino acid, the amino group side After extending the peptide (polypeptide) chain to a desired chain length, only the N-terminal α-amino group protecting group of the peptide chain was removed and only the C-terminal carboxyl group protecting group was removed. A polypeptide is produced, and both polypeptides are condensed in a mixed solvent as described above. Details of the condensation reaction are the same as described above. After purifying the protected polypeptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. The crude polypeptide is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired polypeptide, peptide or partial peptide. A polypeptide of the invention,
In order to obtain an ester of the peptide of the present invention or the partial peptide of the present invention, for example, after condensing the α-carboxyl group of the carboxy-terminal amino acid with a desired alcohol to form an amino acid ester, the polypeptide of the present invention or the present invention In the same manner as in the amide of the partial peptide, an ester of the desired polypeptide, peptide or partial peptide can be obtained.

The polypeptide of the present invention, the peptide of the present invention, and the partial peptide of the present invention can be produced according to a known peptide synthesis method. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, a partial peptide capable of constituting the partial peptide of the present invention (a partial peptide capable of constituting the partial peptide of the present invention) or an amino acid is condensed with the remaining portion, and when the product has a protecting group, the protecting group is eliminated. By doing so, the desired peptide can be produced. Known methods for condensation and elimination of the protecting group include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966), Schroeder and Luebke, The Peptid
e), Academic Press, New York (1965), Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975), Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1, Protein Chemistry IV, 205, (1977), and Supervision of Yajima Haruaki, Development of Continuing Pharmaceuticals, Vol. 14, Peptide Synthesis, Hirokawa Shoten . After the reaction, the polypeptide of the present invention and the partial peptide of the present invention can be purified and isolated by a combination of ordinary purification methods, for example, solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like. . When the polypeptide obtained by the above method is a free form, it can be converted into an appropriate salt by a known method or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, a known method or analogous method It can be converted into a free form or another salt by a method.

The polynucleotide encoding the polypeptide of the present invention, the peptide of the present invention, and the partial peptide of the present invention (hereinafter sometimes collectively referred to as the polynucleotide of the present invention) includes Any one may be used as long as it contains a nucleotide sequence encoding the polypeptide of the present invention, the peptide of the present invention, or the partial peptide of the present invention. Preferably, it is DNA (hereinafter, sometimes collectively referred to as DNA of the present invention). In addition, genomic DNA, c
It may be either DNA or synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like.
In addition, total RNA or mR is obtained from the above-mentioned cells and tissues.
Using the prepared NA fraction directly for Reverse Transcri
ptase Polymerase Chain Reaction (hereinafter RT-PC
R method).

The polynucleotide encoding the polypeptide of the present invention includes, for example, substantially the same activity (properties) as the polypeptide of the present invention (eg, immunogenicity; cancer, immune disease, infectious disease, gastrointestinal tract). A polypeptide having a prophylactic / therapeutic activity (action) for a disease, cardiovascular disease, endocrine disease or infertility; a germ cell differentiation / function regulating activity (action), a blood cell differentiation / proliferation regulating activity (action), etc. Any polynucleotide may be used as long as it has a polynucleotide or the like and encodes a polypeptide having substantially the same properties as the polypeptide of the present invention. As the polynucleotide encoding the polypeptide of the present invention, specifically, a polynucleotide containing a polynucleotide having a base sequence represented by SEQ ID NO: 5, a polynucleotide having a base sequence represented by SEQ ID NO: 3 A polynucleotide containing a nucleotide, a polynucleotide containing a polynucleotide having a base sequence represented by SEQ ID NO: 1, and a polynucleotide containing a polynucleotide having a base sequence represented by SEQ ID NO: 15. Is a “polynucleotide containing a polynucleotide having a base sequence represented by SEQ ID NO: 3”,
“Polynucleotide containing a polynucleotide having the base sequence represented by SEQ ID NO: 1” and “polynucleotide containing a polynucleotide having the base sequence represented by SEQ ID NO: 15” include “SEQ ID NO: 5 And a polynucleotide comprising a polynucleotide having a base sequence represented by SEQ ID NO: 5,
Polynucleotides that can hybridize with the nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 15 under high stringency conditions can also be mentioned as polynucleotides encoding the polypeptide of the present invention, For example, the nucleotide sequence represented by SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 15 and about 7
A polynucleotide containing a base sequence having 0% or more, preferably about 80% or more, more preferably about 90% or more homology is used. In addition, specific examples of the polynucleotide that can hybridize with the base sequence represented by SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 15 under high stringent conditions include:
It has a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 15, and substantially differs from the polypeptide of the present invention. Same nature (same meaning as above)
And a polynucleotide encoding a polypeptide having the formula:

Hybridization can be performed by a known method or a method analogous thereto, for example, Molecular Cloning 2nd (J. Sambrook et al.).
al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions.
High stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM.
At a temperature of about 50-70 ° C, preferably about 60-65 ° C
Are shown. As the polynucleotide encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 4, a polynucleotide having the base sequence represented by SEQ ID NO: 5 or the like is represented by SEQ ID NO: 2 Examples of the polynucleotide encoding the polypeptide of the present invention having an amino acid sequence include a polynucleotide having the base sequence of SEQ ID NO: 3 and a polynucleotide of the present invention having the amino acid sequence of SEQ ID NO: 14. As the DNA encoding the peptide, a polynucleotide having the base sequence represented by SEQ ID NO: 15 or the like is used. In addition, the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1, as described in Example 1 below,
It is a DNA containing a polynucleotide having the base sequence of SEQ ID NO: 3 as a polynucleotide encoding the polypeptide of the present invention having the amino acid sequence of SEQ ID NO: 2.

The polynucleotide encoding the peptide of the present invention may be any polynucleotide that encodes the peptide of the present invention. As the polynucleotide encoding the peptide of the present invention, specifically, a polynucleotide containing a polynucleotide having a base sequence represented by SEQ ID NO: 7 and a polynucleotide having a base sequence represented by SEQ ID NO: 9 And the like. In addition, a polynucleotide that can hybridize with the nucleotide sequence represented by SEQ ID NO: 7 or SEQ ID NO: 9 under high stringency conditions can also be mentioned as a polynucleotide encoding the partial peptide of the present invention,
For example, a polynucleotide containing a base sequence having a homology of about 70% or more, preferably about 80% or more, more preferably about 90% or more with the base sequence represented by SEQ ID NO: 7 or SEQ ID NO: 9, etc. Is used. Hybridization can be performed by a known method or a method analogous thereto, for example, molecular cloning (Molecular cloning).
Cloning) 2nd (J. Sambrook et al., Cold Spring Harb
or Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions. The high stringent conditions are, for example, a sodium concentration of about 19 to 40 m.
M, preferably about 19-20 mM and a temperature of about 50-7
0 ° C, preferably about 60 to 65 ° C. The polynucleotide encoding the peptide of the present invention having the amino acid sequence represented by SEQ ID NO: 6 includes SEQ ID NO:
A polynucleotide having a base sequence represented by 7,
As the polynucleotide encoding the peptide of the present invention having the amino acid sequence represented by SEQ ID NO: 8, a polynucleotide having the base sequence represented by SEQ ID NO: 9 or the like is used. The polynucleotide encoding the partial peptide of the present invention may be any polynucleotide as long as it encodes the partial peptide of the present invention.

The polypeptide of the present invention, the peptide of the present invention (hereinafter, the polypeptide of the present invention and the peptide of the present invention may be abbreviated to the polypeptide of the present invention in some cases) or the partial peptide of the present invention are completely D to code
The cloning of NA is performed by synthesizing a synthetic DNA having a partial base sequence of the polypeptide of the present invention or the partial peptide of the present invention.
Genomic DNA or c by PCR using primers
A target DNA fragment is amplified from DNA, or a DNA (library) incorporated into an appropriate vector is converted into a DNA fragment encoding a polypeptide of the present invention or a partial or entire region of a partial peptide of the present invention, or a synthetic DN.
Using A, a target DNA fragment is selected by hybridization with a radioisotope or an enzyme-labeled DNA probe (DNA probe), the DNA fragment is incorporated into a recombinant vector or the like, and Escherichia coli or the like is transformed using the DNA fragment. It is done by doing. Hybridization methods include, for example, molecular cloning (Molecular cloning).
Cloning) 2nd (J. Sambrooket al., Cold Spring Harb
or Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. The DNA base sequence can be replaced by ODA-LA using PCR, a known kit, for example, Mutan ^™ -superExpress Km (Takara Shuzo), Mutan ^™ -K (Takara Shuzo) or the like.
PCR, Gapped Duplex, Kunke
It can be carried out according to a known method such as the l method or a method analogous thereto. The DNA encoding the cloned polypeptide can be used as it is depending on the purpose, or can be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA has ATG as a translation initiation codon at its 5 'end and TAA, TGA or TA at its 3' end as a translation stop codon.
It may have G. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. The expression vector for the polypeptide of the present invention or the partial peptide of the present invention can be prepared, for example, by (A) DNA (for example, cDNA) encoding the polypeptide of the present invention or the partial peptide of the present invention to a desired DN.
A fragment can be prepared by cutting out the A fragment and (ii) ligating the DNA fragment downstream of a promoter in an appropriate expression vector.

As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pUC12)
UC13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., and pA1
-11, pXT1, pRc / CMV, pRc / RSV,
pcDNAI / Neo or the like is used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when using animal cells as a host,
SRα promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter, β-actin and the like. Of these,
CMV (cytomegalovirus) promoter, SRα
It is preferable to use a promoter or the like. When the host is Escherichia, trp promoter, lac promoter, recA promoter, .lambda.P _L promoter, lpp promoter, T7 promoter etc. When the host is Bacillus, SPO1 promoter,
When the host is yeast, such as SPO2 promoter and penP promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.

[0031] In addition to the above, an expression vector optionally containing an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like may be used. Can be used. As a selectable marker, for example, dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MT
X) resistance], an ampicillin resistance gene (hereinafter, Amp ^r
Sometimes abbreviated as), neomycin resistant gene (hereinafter sometimes abbreviated as Neo ^r, Genetici
n (G418) resistance). In particular, dhfr
Dhf using gene-deficient Chinese hamster cells
When the r gene is used as a selection marker, recombinant cells can also be selected on a thymidine-free medium.
Further, if necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide of the present invention. When the host is Escherichia, a PhoA signal sequence;
When the host is a bacterium belonging to the genus Bacillus, the α-amylase signal sequence, the subtilisin signal sequence, and the like are MF.
When the host is an animal cell, such as an α signal sequence and a SUC2 signal sequence, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule,
A signal sequence or the like can be used. A transformant can be produced using the thus constructed vector containing the DNA encoding the polypeptide of the present invention or the partial peptide of the present invention.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of the genus Escherichia include, for example, Escherichia coli K12
・ DH1 [Procedings of the National
Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 16
0 (1968)], JM103 [Nucleic Acids Research, (Nucleic Acids Research), 9, 30]
9 (1981)], JA221 [Journal of MolecularBiolog
y), 120, 517 (1978)], HB101 [Journal of Molecular Biology, 41]
Vol., 459 (1969)], C600 [Genetics, 39, 440 (1954)], and the like. Examples of the Bacillus genus include Bacillus subtilis MI114 [Gene, 2
4, 255 (1983)], 207-21 [Journal of Biochemistr
y), 95, 87 (1984)]. As yeast, for example, Saccharomyces cerevisiae (Sa
ccharomyces cerevisiae) AH22, AH22R ⁻ , N
A87-11A, DKD-5D, 20B-12, Schizosaccharomyces pomb
e) NCYC1913, NCYC2036, Pichia pastoris KM71 and the like are used.

As insect cells, for example, virus is A
In the case of cNPV, a cell line derived from night larvae of larvae (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
For example, MG1 cells derived from the midgut, High Five ^™ cells derived from Trichoplusia ni eggs, cells derived from Mamestra brassicae, cells derived from Estigmena acrea, and the like are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N cell; BmN cell) or the like is used.
As the Sf cells, for example, Sf9 cells (ATCC
CRL 1711), Sf21 cells (Vaughn, JL
Et al., In Vivo, 13, 213-21
7, (1977)) and the like. As insects, for example, silkworm larvae and the like are used [Maeda et al., Nature, 315, 592, (1985)]. As animal cells, for example, monkey cells COS-7, Ver
o, Chinese hamster cell CHO (hereinafter CHO)
Dhfr gene-deficient Chinese hamster cell CHO (hereinafter abbreviated as CHO (dhfr ⁻ ) cell), mouse L cell, mouse AtT-20, mouse myeloma cell, rat GH3, human FL cell and the like. In order to transform Escherichia, for example, Processings of the National Academy
Of Sciences of the USA (Pro
Natl. Acad. Sci. USA), 69, 2110 (19).
72) and Gene, 17, 107 (198)
It can be performed according to the method described in 2) and the like. To transform Bacillus, for example, molecular
And General Genetics (Molecular &
General Genetics), 168, 111 (1979)
And the like. For transforming yeast, for example, Methods in Enzymology, 194, 182
-187 (1991), Prossings of the
National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA),
75, 1929 (1978). To transform insect cells or insects, for example, use Bio / Technolo
gy), 6, 47-55 (1988) and the like. To transform animal cells, for example, Cell Engineering Separate Volume 8, New Cell Engineering Experimental Protocol, 263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973)
Can be performed according to the method described in (1). Thus, a transformant transformed with the expression vector containing the DNA encoding the polypeptide can be obtained. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium to be used for the culture. Nitrogen sources, inorganic substances, etc. are contained. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc., as a nitrogen source, for example,
Inorganic or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, yeast extract, meat extract, soybean meal, potato extract, and inorganic substances such as calcium chloride, sodium dihydrogen phosphate, chloride Magnesium and the like. Further, yeast, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually performed at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant in which the host is yeast, as a medium, for example, Burkholder minimum medium [Bostian, KL et al.
Prossings of the National Academy of Sciences of the USA (Pr
Natl. Acad. Sci. USA), 77, 4505 (19
80)] and SD medium containing 0.5% casamino acid [Bit
ter, GA et al., The Prossings of the National Academy of Sciences of the
USA (Proc. Natl. Acad. Sci. USA), 81
Vol. 5330 (1984)]. Medium pH
Is preferably adjusted to about 5 to 8. Culture is usually about 20
Perform at ~ 35 ° C for about 24-72 hours, adding aeration and agitation as needed. When culturing a transformant whose host is an insect cell or an insect, the medium used is Grace's Insect M
edium (Grace, TCC, Nature, 19
5, 788 (1962)) to which an additive such as immobilized 10% bovine serum is appropriately added. Medium p
H is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and aeration and / or agitation are added as necessary. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Science
e), 122, 501 (1952)], DMEM medium [Virology, 8, 396 (195)
9)], RPMI 1640 medium [Journal of
The American Medical Association (The
Journal of the American Medical Association), 1
99, 519 (1967)], 199 medium [Proceeding of the Society fo
r the Biological Medicine), 73, 1 (195
0)] and the like. Preferably, the pH is between about 6 and 8. The cultivation is usually performed at about 30 to 40 ° C. for about 15 to 60 hours, and if necessary, aeration or stirring is added. As described above, the polypeptide of the present invention or the partial peptide of the present invention can be produced in the transformant, inside the cell membrane, or outside the cell (preferably outside the cell).

In order to separate and purify the polypeptide of the present invention or the partial peptide of the present invention from the above culture, for example,
It can be performed by the following method. When extracting the polypeptide of the present invention or the partial peptide of the present invention from cultured cells or cells, after culturing, the cells or cells are collected by a known method and suspended in an appropriate buffer.
After disrupting the cells or cells by ultrasonication, lysozyme and / or freeze-thawing, a method of obtaining a crude extract of the polypeptide by centrifugation or filtration is used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the polypeptide is secreted into the culture solution, after culturing, the supernatant is separated from the cells or cells by a known method, and the supernatant is collected. Purification of the polypeptide of the present invention or the partial peptide of the present invention contained in the culture supernatant or the extract thus obtained can be performed by appropriately combining known separation and purification methods. These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. How to take advantage of the difference between
A method using a difference in charge such as ion exchange chromatography, a method using a specific affinity such as affinity chromatography, a method using a difference in hydrophobicity such as reverse phase high performance liquid chromatography, isoelectric focusing A method utilizing the difference between isoelectric points, such as a method, is used.

When the thus obtained polypeptide of the present invention or the partial peptide of the present invention is obtained in a free form, it can be converted to a salt by a known method or a method analogous thereto, and conversely, Can be converted to a free form or another salt by a known method or a method analogous thereto. The polypeptide of the present invention or the partial peptide of the present invention produced by the recombinant is reacted with a suitable protein-modifying enzyme or proteolytic enzyme or the like before or after purification.
Modification may be arbitrarily made, or the polypeptide of the present invention or the partial peptide of the present invention may be partially removed.
As these enzymes, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence of the polypeptide of the present invention or the partial peptide of the present invention thus generated can be measured by an enzyme immunoassay using a specific antibody, Western blot analysis, or the like. Further, as described above, any foreign peptide sequence (eg, FL) which can be an epitope (antibody recognition site) at the N-terminus or C-terminus of the polypeptide of the present invention.
AG, HIS tag, myc tag, HA tag, HSV tag, etc.) and detecting the presence of the polypeptide of the present invention by detecting chemiluminescence or the like using an antibody that recognizes the peptide sequence. Is also possible. For example,
A polypeptide containing the amino acid sequence represented by SEQ ID NO: 14 is prepared, and the presence of the polypeptide of the present invention can be measured by the method described in Example 4 described below or a method analogous thereto. is there.

An antibody against the polypeptide of the present invention or the partial peptide of the present invention (hereinafter sometimes referred to as the antibody of the present invention) may be any antibody capable of recognizing the polypeptide of the present invention or the partial peptide of the present invention. , A polyclonal antibody (hereinafter, sometimes referred to as the polyclonal antibody of the present invention) or a monoclonal antibody (hereinafter, the monoclonal antibody of the present invention). The antibody of the present invention can be produced using the polypeptide of the present invention or the partial peptide of the present invention as an antigen according to a known antibody or antiserum production method. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The polypeptide of the present invention or the partial peptide of the present invention comprises:
It is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where the antibody can be produced by administration. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually performed once every 2 to 6 weeks, for a total of about 2 to 10 times. As the warm-blooded animal used, for example,
Examples include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats, and chickens, with mice and rats being preferred. When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization and contained in the spleen or lymph node. By fusing the antibody-producing cells thus obtained with myeloma cells of the same or different species, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting a labeled polypeptide described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion procedure is known in the art, for example, the method of Kohler and Milstein [Nature, 256, 495 (197).
5)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, but PEG is preferably used.

Examples of myeloma cells include NS-1,
Myeloma cells of warm-blooded animals such as P3U1, SP2 / 0, and AP-1 can be mentioned, but P3U1 is preferably used.
The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1.
G (preferably PEG1000 to PEG6000) is 1
Cell fusion can be carried out efficiently by adding at a concentration of about 0 to 80% and incubating at about 20 to 40 ° C, preferably about 30 to 37 ° C for about 1 to 10 minutes. Various methods can be used to screen for monoclonal antibody-producing hybridomas. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) in which a polypeptide antigen is directly or adsorbed together with a carrier,
Next, an anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used if the cell used for cell fusion is a mouse) or protein A labeled with a radioactive substance or an enzyme is added, and the monoclonal antibody bound to the solid phase is detected. A method of adding a hybridoma culture supernatant to a solid phase to which an anti-immunoglobulin antibody or protein A is adsorbed, adding a polypeptide labeled with a radioactive substance, an enzyme, or the like, and detecting a monoclonal antibody bound to the solid phase. Is mentioned. The selection of the monoclonal antibody can be performed according to a known method or a method analogous thereto. Normal HAT
(Hypoxanthine, aminopterin, thymidine) in an animal cell culture medium. As a selection and breeding medium, any medium can be used as long as a hybridoma can grow. For example, about 1
RPMI 1640 medium containing 20%, preferably about 10 to 20% fetal bovine serum, GIT medium containing about 1 to 10% fetal bovine serum (Wako Pure Chemical Industries) or serum-free medium for hybridoma culture (SFM-101) And Nissui Pharmaceutical Co., Ltd.). The culture temperature is usually about 20 to 40
° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. Culture is
Usually, it can be performed under 5% carbon dioxide gas. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of monoclonal antibody Monoclonal antibodies can be separated and purified by known methods, for example, immunoglobulin separation and purification methods (eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis method, etc.). Absorption / desorption method using ion exchanger (eg DEAE), ultracentrifugation method, gel filtration method, antigen-bound solid phase or only antibody is collected using an active adsorbent such as protein A or protein G, and the bond is dissociated to release the antibody. Specific Purification Method Obtained].

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced according to known methods or modifications thereof. For example, an immunizing antigen (polypeptide antigen) itself or a complex thereof with a carrier protein is formed, and a warm-blooded animal is immunized in the same manner as in the above-described method for producing a monoclonal antibody. The antibody can be produced by collecting the substance containing the antibody against the partial peptide of the present invention and separating and purifying the antibody. Regarding the complex of an immunizing antigen and a carrier protein used to immunize a warm-blooded animal, the type of the carrier protein and the mixing ratio of the carrier and the hapten are such that the antibody is efficiently cross-linked to the hapten immunized by crosslinking the carrier. if you can,
Whatever may be crosslinked at any ratio, for example, bovine serum albumin, bovine thyroglobulin, hemocyanin, etc. in a weight ratio of about 0.1 to
A method of coupling at a ratio of 20, preferably about 1 to 5 is used. Various coupling agents can be used for coupling the hapten and the carrier. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithioviridyl group, or the like is used. Condensation product is itself or a carrier at a site where antibody production is possible for a warm-blooded animal,
Administered with diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody can be collected from the blood, ascites, etc., preferably from the blood of a warm-blooded animal immunized by the above method. The measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the antiserum described above. The separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as the above-described separation and purification of the monoclonal antibody.

The antisense DNA having a base sequence complementary to or substantially complementary to the DNA of the present invention includes a base sequence complementary or substantially complementary to the DNA of the present invention. Any antisense DNA may be used as long as it has an effect of suppressing the expression of the DNA. The nucleotide sequence substantially complementary to the DNA of the present invention is, for example, about 70% of the total nucleotide sequence or a partial nucleotide sequence of the nucleotide sequence complementary to the DNA of the present invention (that is, the complementary strand of the DNA of the present invention). % Or more, preferably about 80%
% Or more, more preferably about 90% or more, and most preferably about 95% or more. In particular, of the entire base sequence of the complementary strand of the DNA of the present invention,
About 70% or more, preferably about 80% or more, more preferably about 90% or more of the complementary strand of the base sequence (for example, the base sequence near the start codon) of the portion encoding the N-terminal portion of the polypeptide of the present invention. Antisense DNAs having a homology of about 95% or more are most preferred. These antisense DNAs can be produced using a known DNA synthesizer or the like.

When the polypeptide of the present invention has a signal peptide, it is efficiently secreted extracellularly and exerts an important biological activity as a humoral factor for signal transmission, self-defense, and the like. Hereinafter, the polypeptide of the present invention, the partial peptide of the present invention (hereinafter, the polypeptide of the present invention and the partial peptide of the present invention may be abbreviated as the polypeptide of the present invention in some cases), the polynucleotide of the present invention, The use of the antibody and antisense DNA of the present invention will be described.

(1) The polypeptide of the present invention can be obtained from tissues such as thymus, spleen, liver, pancreas, lymph nodes, lymphocytes, leukocytes and testis, especially thymus and testis, as is apparent from Example 2 described later. Can be used as these tissue markers. That is, it is useful as a marker for detecting tissue function, disease state, metastasis of cancer, infectious disease, infertility and the like. It can also be used for sorting corresponding receptors, binding polypeptides and the like. Furthermore, it can be used as a panel for known high-throughput screening to examine biological activity. It can also be used for genetic disease research by performing chromosome mapping. (2) Agent for treating or preventing various diseases involving the polypeptide of the present invention Since the polypeptide of the present invention exists as a humoral factor in a living body, it is abnormal in the polypeptide of the present invention or the polynucleotide of the present invention. When there is, or when the expression level is abnormally decreased or enhanced, for example, cancer, immune disease, infectious disease, gastrointestinal tract disease, cardiovascular disease,
Various diseases such as endocrine diseases and infertility develop. When the polypeptide of the present invention or the polynucleotide of the present invention is abnormal or defective, or when the expression level is abnormally decreased or enhanced, the normal function of the germ cells themselves or sex hormone secreting cells Since expression is inhibited, various disorders occur. Specifically, that the polypeptide of the present invention is expressed in the cells of the male germ cells with a high differentiation stage in the testis, and that the epididymis exports the testis export tube at the stage where the sperm moves from the testis to the epididymis. , And high expression in the head of the epididymis, the polypeptides of the present invention are used to control the differentiation of sperm cells, transfer sperm to the epididymis, confer sperm fertility, etc. Is one of the most important competencies for physiologic activity, which is directly related to the preservation of certain species. Since the testis contains Leydig cells that produce sex hormones (androgens) and is an important source of sex hormones, the polypeptide of the present invention maintains the normal function of Leydig cells. It also has an effect. Accordingly, the polypeptide of the present invention and the DNA of the present invention can be used for, for example, cancer, immune diseases, infectious diseases (eg, influenza, tuberculosis, gonococcal infection, viral hepatitis, vancomycin-resistant infection, methicillin-resistant infection, herpes). , Chlamydial, sexually transmitted diseases (STD), etc., gastrointestinal diseases, cardiovascular diseases, endocrine diseases (eg, secondary sexual dysfunction, feminization syndrome, etc.), infertility (eg, spermatogenetic dysfunction, epididymitis) , Such as therapeutic and preventive agents for various diseases such as decreased sperm motility, tubal edema, etc., germ cell differentiation / function regulators, blood cell differentiation / proliferation regulators, and the like. . For example, because the polypeptide of the present invention is reduced or deficient in the living body, if there is a patient who does not sufficiently exert the signal transmission in cells, or normal,
(A) administering the DNA of the present invention to the patient and expressing the polypeptide of the present invention in vivo, (b) inserting the DNA of the present invention into cells to express the polypeptide of the present invention. Thereafter, the role of the polypeptide of the present invention in the patient is fully or normally exerted by transplanting the cells into the patient, or (c) administering the polypeptide of the present invention to the patient. be able to. When the DNA of the present invention is used as the above-mentioned therapeutic / prophylactic agent, the DNA is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, etc. It can be administered to humans or warm-blooded animals. The DNA of the present invention can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an auxiliary agent for promoting uptake, using a gene gun or a catheter such as a hydrogel catheter.
When the polypeptide of the present invention is used as the above therapeutic / prophylactic agent, it is at least 90%, preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more.
% Or more is preferably used.

The polypeptides of the present invention include, for example, sugar-coated tablets, capsules, elixirs,
As a microcapsule orally, or aseptic solution with water or other pharmaceutically acceptable liquid,
Alternatively, they can be used parenterally in the form of injections such as suspensions. For example, the polypeptide of the present invention is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, and the like, in a unit dosage form generally required for the practice of formulations. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained.
Examples of additives that can be incorporated into tablets, capsules, and the like include binders such as gelatin, corn starch, tragacanth, and acacia, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Suitable leavening agents, lubricating agents such as magnesium stearate, sweetening agents such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, reddish oil or cherry are used. When the preparation unit form is a capsule, a liquid carrier such as fats and oils can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice, such as by dissolving or suspending the active substance in vehicles, such as water for injection, or naturally occurring vegetable oils such as sesame oil, coconut oil, and the like.
Examples of the aqueous liquid for injection include physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, and the like), and a suitable solubilizing agent. For example, alcohols (eg, ethanol, etc.), polyalcohols (eg, propylene glycol, polyethylene glycol, etc.), nonionic surfactants (eg, Polysorbate 80 ^™ , H
CO-50). As an oily liquid,
For example, sesame oil, soybean oil and the like can be mentioned, and they may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent. A buffer (eg, phosphate buffer, sodium acetate buffer, etc.), a soothing agent (eg, benzalkonium chloride, procaine hydrochloride, etc.), a stabilizer (eg, human serum albumin, polyethylene glycol, etc.), You may mix | blend with a preservative (for example, benzyl alcohol, phenol, etc.), an antioxidant, etc. The prepared injection is usually filled in a suitable ampoule. The vector into which the DNA of the present invention has been inserted is also formulated in the same manner as described above, and is usually used parenterally.

The preparations thus obtained are safe and have low toxicity, and are therefore useful, for example, in mammals (eg, humans, rats, mice, guinea pigs, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys). Etc.). The dosage of the polypeptide of the present invention may vary depending on the target disease, the administration subject, the administration route, and the like. )
About 1 mg to 1000 mg of the polypeptide of the present invention per day
mg, preferably about 10-500 mg, more preferably about 10-200 mg. In the case of parenteral administration, the single dose of the polypeptide of the present invention may vary depending on the administration subject, target disease and the like. (Weight 60k
g)), the polypeptide is administered in an amount of about 1-1000 mg, preferably about 1-200 mg per day.
It is convenient to administer by injecting about g, more preferably about 10 to 100 mg, to the affected area. In the case of other animals, the amount can be administered in terms of 60 kg.

(2) Screening of drug candidate compounds for diseases The polypeptide of the present invention is present as a humoral factor in vivo (particularly in thymus, spleen, liver, pancreas, lymph node, testis, blood, etc.). Compounds or salts thereof that promote the function of the polypeptide of the present invention include, for example, immunological diseases, infectious diseases (eg, influenza, tuberculosis, gonococcal infection, viral hepatitis, vancomycin-resistant infection, methicillin-resistant infection, herpes) , Chlamydial, sexually transmitted diseases (STD), etc., gastrointestinal diseases, cardiovascular diseases, endocrine diseases (eg, secondary sexual dysfunction, feminization syndrome, etc.), infertility (eg, spermatogenetic dysfunction, epididymitis) , Decreased sperm motility, hydrosalpinx, etc.)
And medicaments such as therapeutic / prophylactic agents for various diseases such as germ cell differentiation / function regulators and blood cell differentiation / proliferation regulators. On the other hand, a compound or a salt thereof that inhibits the function of the polypeptide of the present invention can be used as a drug such as an agent for treating or preventing a disease caused by excessive production of the polypeptide of the present invention. Therefore, the polypeptide of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the function of the polypeptide of the present invention. That is, the present invention relates to (1) a compound or a salt thereof which promotes the function of the polypeptide of the present invention or a salt thereof characterized by using the polypeptide of the present invention or a salt thereof (hereinafter referred to as a promoter) Or a compound that inhibits the function of the polypeptide of the present invention or a salt thereof (hereinafter may be abbreviated as an inhibitor). The screening kit of the present invention contains the polypeptide of the present invention or a salt thereof.

Compounds or salts thereof obtained using the screening method or screening kit of the present invention include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, and animals. A compound selected from tissue extracts, plasma, and the like, which promotes or inhibits the function of the polypeptide of the present invention. As the salt of the compound, those similar to the aforementioned salts of the polypeptide of the present invention are used.

When a compound obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out according to conventional means. For example, tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions, and the like can be prepared in the same manner as in the above-mentioned drug containing the polypeptide of the present invention. Since the preparation thus obtained is safe and has low toxicity, it is administered to mammals (eg, human, mouse, rat, rabbit, sheep, pig, cow, horse, cat, dog, monkey, etc.) can do. The dose of the compound or a salt thereof varies depending on its action, target disease, administration subject, administration route and the like.For example, a compound that promotes the function of the polypeptide of the present invention for the purpose of treating cancer is orally administered. In general, for an adult (assuming a body weight of 60 kg), the compound is used in an amount of about 0.1 to 100 mg, preferably about 1.0 to 100 mg per day.
The dose is 50 mg, more preferably about 1.0 to 20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like.
When a compound that promotes the function of the polypeptide of the present invention for the purpose of treating cancer is usually administered to an adult (as 60 kg) in the form of an injection, the compound is administered in an amount of about 0.01 to 30 per day.
It is convenient to administer about mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg. On the other hand, when a compound that inhibits the function of the polypeptide of the present invention is orally administered, generally, in an adult (with a body weight of 60 kg), the compound is used in an amount of about 0.1 to 100 mg, preferably about 1.0 mg per day. ~ 50mg, more preferably about 1.0 ~
Administer 20 mg. When administered parenterally, the dosage of the compound varies depending on the subject of administration, the target disease, etc., but the compound that inhibits the function of the polypeptide of the present invention is usually administered in the form of an injection to an adult (60 kg). )), About 0.01 to 30 mg of the compound per day,
It is convenient to administer preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(3) Quantification of the polypeptide of the present invention or a salt thereof Since the antibody of the present invention can specifically recognize the polypeptide of the present invention, the quantification of the polypeptide of the present invention in a test solution In particular, it can be used for quantification by a sandwich immunoassay and the like. That is, the present invention provides (i) a reaction of an antibody of the present invention with a test solution and a labeled polypeptide of the present invention in a competitive manner, and binding of the labeled polypeptide of the present invention to the antibody. A method for quantifying the polypeptide of the present invention in a test solution, comprising measuring the ratio of
And (ii) reacting the test solution with the antibody of the present invention insolubilized on the carrier and another labeled antibody of the present invention simultaneously or continuously, and then measuring the activity of the labeling agent on the insolubilized carrier. And a method for quantifying the polypeptide of the present invention in a test solution.

The polypeptide of the present invention can be quantified using the monoclonal antibody of the present invention, and can also be detected by tissue staining or the like. For these purposes, the antibody molecule itself may be used, or F (ab ') ₂ , Fab', or Fab fraction of the antibody molecule may be used. The method for quantifying the polypeptide of the present invention using the antibody of the present invention is not particularly limited. Any method may be used to detect the amount of the antigen complex by chemical or physical means, and to calculate this from a standard curve prepared using a standard solution containing a known amount of antigen. Is also good. For example, nephelometry, competition method, immunometric method and sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use the sandwich method described later. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. Examples of radioisotopes include [ ¹²⁵ I], [ ¹³¹ I], [ ³ H],
[ ¹⁴ C] and the like are used. As the above enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used.
Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For insolubilization of antigen or antibody,
Physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing a polypeptide or an enzyme may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of the polypeptide of the present invention in the test solution can be determined. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. In the method for measuring the polypeptide of the present invention by the sandwich method of the present invention, the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction is preferably an antibody having a different binding site to the polypeptide of the present invention. Can be That is, the antibody used in the primary reaction and the secondary reaction is preferably used, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the polypeptide of the present invention. Is an antibody that recognizes other than the C-terminal, for example, the N-terminal.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, a nephelometry and the like. In the competitive method, an antigen in a test solution and a labeled antigen are allowed to react competitively with an antibody, and then the unreacted labeled antigen is reacted.
(F) and the labeled antigen (B) bound to the antibody are separated (B / F separation), the amount of labeling of either B or F is measured, and the amount of antigen in the test solution is quantified. In this reaction method, a soluble antibody is used as an antibody, B / F separation is performed using polyethylene glycol, a liquid phase method using a second antibody or the like to the antibody, or an immobilized antibody is used as the first antibody, or
A solid-phase method using a soluble first antibody and a solid-phased antibody as the second antibody is used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. Is reacted with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephelometry utilizing laser scattering is preferably used.

In applying these individual immunoassays to the quantification method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measuring system of the polypeptide of this invention, adding the usual technical consideration of those skilled in the art to the usual conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews and books. For example, Hiroe Irie, “Radio Immunoassay” (Kodansha, published in 1974), Hiroshi Irie, “Sequence Radioimmunoassay” (Kodansha, published in 1979), Eiji Ishikawa et al., “Enzyme Immunoassay” (Medical Shoin, Showa Ed. Ishikawa et al., “Enzyme Immunoassay” (2nd edition) (Issue Shoin, 1982), Eiji Ishikawa et al. “Enzyme Immunoassay” (Third Edition), 3rd Ed. Published in 1962, "Methods in ENZYMOLOGY" Vol. 70 (Immunoch
emical Techniques (Part A)), ibid.Vol. 73 (Immunoch
emical Techniques (Part B)), ibid.Vol. 74 (Immunoch
emical Techniques (Part C)), ibid.Vol. 84 (Immunoch
emical Techniques (Part D: Selected Immunoassay
s)), Ibid.Vol. 92 (Immunochemical Techniques (Part
E: Monoclonal Antibodies and General Immunoassay M
ethods)), ibid.Vol. 121 (Immunochemical Techniques)
(Part I: Hybridoma Technology and Monoclonal Antib
odies)) (above, published by Academic Press). As described above, the polypeptide of the present invention can be quantified with high sensitivity by using the antibody of the present invention. Furthermore, by quantifying the concentration of the polypeptide of the present invention using the antibody of the present invention, (1) when an increase or decrease in the concentration of the polypeptide of the present invention is detected, for example, cancer or an immune disease ,Infection,
Diseases such as gastrointestinal diseases, cardiovascular diseases, endocrine diseases,
Alternatively, it can be diagnosed that the possibility of illness is high in the future. Further, the antibody of the present invention can be used for detecting the polypeptide of the present invention present in a subject such as a body fluid or a tissue. In addition, preparation of an antibody column used for purifying the polypeptide of the present invention, detection of the polypeptide of the present invention in each fraction at the time of purification, analysis of the behavior of the polypeptide of the present invention in test cells, etc. Can be used for

(4) Gene Diagnostic Agent The DNA of the present invention can be used, for example, in mammals (eg, human, rat, mouse,
Since abnormalities (genetic abnormalities) of DNA or mRNA encoding the polypeptide of the present invention in guinea pigs, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, etc.) can be detected, for example, m
RNA damage, mutation or reduced expression,
Alternatively, it is useful as a gene diagnostic agent for increasing or overexpressing mRNA. The above-described genetic diagnosis using the DNA of the present invention can be performed, for example, by the known Northern hybridization or PCR-SSCP method (Genomics (Genomics)).
mics), Vol. 5, pp. 874-879 (1989).
Proceedings of the National Academy of Sciences
86, 2766-2770 (19).
1989)). For example, when a decrease in expression is detected by Northern hybridization or a mutation in DNA is detected by the PCR-SSCP method, for example, cancer, an immune disease, an infectious disease,
It can be diagnosed that there is a high possibility that the disease is a gastrointestinal disease, a circulatory disease, an endocrine disease, or an infertility disease.

(5) Pharmaceuticals Containing Antisense DNA The antisense DNA capable of binding to the DNA of the present invention complementarily and suppressing the expression of the DNA is a polypeptide of the present invention in vivo or the present invention. Can be used as, for example, an agent for treating or preventing a disease caused by excessive expression of the polypeptide of the present invention. The above-mentioned antisense DNA can be used as the above-mentioned therapeutic / prophylactic agent in the same manner as the aforementioned therapeutic / prophylactic agent for various diseases containing the DNA of the present invention. For example, the antisense DNA can be administered alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like, and then used in a conventional manner. The antisense DNA can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and then administered using a gene gun or a catheter such as a hydrogel catheter. Furthermore, the antisense DNA can also be used as a diagnostic oligonucleotide probe for examining the presence or expression of the DNA of the present invention in tissues or cells.

(6) Pharmaceuticals Containing Antibody of the Present Invention Antibodies of the present invention having an activity of neutralizing the activity of the polypeptide of the present invention can be used, for example, for treating diseases caused by overexpression of the polypeptide of the present invention. -It can be used as a medicine such as a prophylactic agent. The therapeutic / prophylactic agent for the above-mentioned diseases containing the antibody of the present invention can be used as a liquid as it is or as a pharmaceutical composition in an appropriate dosage form, in mammals (eg, human, rat, rabbit, sheep, pig, cow, cat, Dogs, monkeys, etc.) orally or parenterally. The dose varies depending on the administration subject, target disease, symptom, administration route and the like. / Kg body weight, more preferably about 0.1 to 5 mg / kg body weight about 1 to 5 times a day,
It is convenient to administer by intravenous injection preferably about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If the symptoms are particularly severe, the dose may be increased according to the symptoms. The antibodies of the present invention can be administered as such or as a suitable pharmaceutical composition. The pharmaceutical composition used for the administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such compositions are provided in dosage forms suitable for oral or parenteral administration. That is, for example, compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft capsules and the like). Syrup, emulsion, suspension and the like. Such a composition is produced by a known method and contains a carrier, diluent or excipient usually used in the field of pharmaceuticals. For example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets.

Examples of the composition for parenteral administration include injections, suppositories, etc.
It includes dosage forms such as subcutaneous injections, intradermal injections, intramuscular injections, and infusions. Such injections are prepared according to known methods, for example, by dissolving, suspending or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid commonly used for injections. Examples of the aqueous liquid for injection include, for example, physiological saline, isotonic solution containing glucose and other auxiliary agents, and a suitable solubilizing agent, for example,
Alcohol (eg, ethanol), polyalcohol (eg,
Propylene glycol, polyethylene glycol), nonionic surfactant [eg, polysorbate 80, HCO-
50 (polyoxyethylene (50mol) adduct of hydrogen
ated castoroil)). As the oily liquid, for example, sesame oil, soybean oil, and the like are used, and benzyl benzoate, benzyl alcohol, and the like may be used in combination as a solubilizing agent. The prepared injection is usually filled in a suitable ampoule. A suppository for rectal administration is prepared by mixing the above antibody or a salt thereof with a usual suppository base. The above-mentioned oral or parenteral pharmaceutical composition is conveniently prepared in a unit dosage form so as to be compatible with the dosage of the active ingredient. Examples of such dosage unit dosage forms include tablets, pills, capsules, injections (ampoules), suppositories and the like.
It is preferable that the above antibody is contained in about 100 mg, and about 10 to 250 mg in other dosage forms. Each of the above-mentioned compositions may contain another active ingredient as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.

(7) DNA-Introduced Animal The present invention relates to a DNA encoding an exogenous polypeptide of the present invention (hereinafter abbreviated as an exogenous DNA of the present invention) or a mutant DNA thereof (an exogenous mutant DNA of the present invention) Which may be abbreviated as such). That is, the present invention provides (1) a non-human mammal having the exogenous DNA of the present invention or a mutant DNA thereof, (2) the animal according to (1), wherein the non-human mammal is a rodent, (3) No. 2 wherein the rodent is a mouse or rat
And (4) a recombinant vector containing the exogenous DNA of the present invention or its mutant DNA and capable of being expressed in mammals. Non-human mammals having the exogenous DNA of the present invention or the mutant DNA thereof (hereinafter, abbreviated as the DNA-transfected animal of the present invention) can be used for non-fertilized eggs, fertilized eggs, germ cells including spermatozoa and their progenitor cells, and the like. And preferably at the stage of embryonic development in non-human mammal development (more preferably at the stage of single cells or fertilized eggs and generally before the 8-cell stage), the calcium phosphate method, the electric pulse method, the lipofection method, the agglutination method, Target DN by microinjection method, particle gun method, DEAE-dextran method, etc.
A can be created by introducing A. Further, by the DNA introduction method, the exogenous DNA of the present invention is introduced into somatic cells, organs of a living body, tissue cells, and the like,
It can be used for cell culture, tissue culture, etc.
The DNA-transfected animal of the present invention can also be produced by fusing these cells with the above-mentioned germ cells by a known cell fusion method.

Non-human mammals include, for example, bovine,
Pigs, sheep, goats, rabbits, dogs, cats, guinea pigs, hamsters, mice, rats and the like are used. Above all, rodents, which are relatively short in ontogeny and biological cycle in terms of preparation of disease animal model systems, and are easy to breed, especially mice (for example, C57B as a pure strain,
As a hybrid line such as L / 6 line and DBA2 line, B6C3
F1 system, BDF1 system, B6D2F1 system, BALB
/ C strain, ICR strain, etc.) or rat (eg, Wi
star, SD, etc.). Exogenous DN of the present invention
A is the DN of the present invention originally possessed by a non-human mammal.
Rather than A, it refers to the DNA of the present invention once isolated and extracted from mammals. As the mutant DNA of the present invention, those having a mutation (for example, mutation) in the base sequence of the original DNA of the present invention, specifically, base addition, deletion, substitution with another base, etc. The resulting DNA or the like is used,
Abnormal DNA is also included. The abnormal DNA refers to a DNA that expresses an abnormal polypeptide of the present invention, and for example, a DNA that expresses a polypeptide that suppresses the function of the normal polypeptide of the present invention and the like are used. The exogenous DNA of the present invention may be derived from a mammal which is the same or different from the animal of interest. When introducing the DNA of the present invention into a target animal, the DNA
It is generally advantageous to use as a DNA construct linked downstream of a promoter capable of being expressed in animal cells. For example, when the human DNA of the present invention is introduced, DNA derived from various mammals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, mice, etc.) having the DNA of the present invention having high homology thereto is expressed. Highly expressing the DNA of the present invention by microinjecting a DNA construct (eg, a vector, etc.) in which the human DNA of the present invention is bound downstream of various promoters that can be made into a fertilized egg of a target mammal, for example, a mouse fertilized egg. DNA-introduced mammals can be created.

Examples of the expression vector of the polypeptide of the present invention include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a bacteriophage such as λ phage, a retrovirus such as Moloney leukemia virus, a vaccinia virus or a baculovirus. And other animal viruses. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used. Examples of the promoter for controlling the DNA expression include, for example, promoters of DNAs derived from viruses (eg, simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.);
Promoters derived from various mammals (human, rabbit, dog, cat, guinea pig, hamster, rat, mouse, etc.), for example, albumin, insulin II, uroplakin II, elastase, erythropoietin, endothelin, muscle creatine kinase, glial fibrillary acidic protein Glutathione S-transferase, platelet-derived growth factor β, keratins K1, K10 and K14, collagen types I and II, cyclic AMP-dependent protein kinase β I subunit, dystrophin, tartrate-resistant alkaline phosphatase, atrial natriuretic factor, Endothelial receptor tyrosine kinase (generally abbreviated as Tie2), sodium potassium adenosine 3 kinase (Na, K-ATPase), neurofilament light chain, Tarothionine I and IIA,
Metalloproteinase 1 tissue inhibitor, MHC class I antigen (H-2L), H-ras, renin, dopamine β-hydroxylase, thyroid peroxidase (TP
O), polypeptide elongation factor 1α (EF-1α), β
Actin, α and β myosin heavy chains, myosin light chains 1 and 2, myelin basic protein, thyroglobulin, T
hy-1, immunoglobulin, heavy chain variable region (VNP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin, promoter such as preproenkephalin A, vasopressin and the like are used. Among them, a cytomegalovirus promoter capable of high expression throughout the body, human polypeptide chain elongation factor 1α
(EF-1α) promoter, human and chicken β
Actin promoters and the like are preferred.

The above-described vector preferably has a sequence (generally called a terminator) that terminates transcription of the messenger RNA of interest in the mammal into which the DNA has been introduced. And preferably a Simian virus SV40 terminator or the like. In addition, a splicing signal of each DNA for the purpose of further expressing the desired foreign DNA,
It is also possible to link an enhancer region, a part of an intron of eukaryotic DNA, or the like 5 ′ upstream of the promoter region, between the promoter region and the translation region, or 3 ′ downstream of the translation region. The translation region can be prepared as a DNA construct that can be expressed in a DNA-transduced animal by a conventional DNA engineering technique in which it is ligated to the downstream of the aforementioned promoter and, if desired, to the upstream of the transcription termination site. Exogenous D of the invention at the fertilized egg cell stage
The introduction of NA is ensured to be present in all germ cells and somatic cells of the target mammal. The presence of the exogenous DNA of the present invention in the germinal cells of the produced animal after the introduction of the DNA means that all the progeny of the produced animal will retain the exogenous DNA of the present invention in all of the germ cells and somatic cells. means. The progeny of such animals that have inherited the foreign DNA of the present invention have the foreign DNA of the present invention in all of their germinal and somatic cells.

The non-human mammal into which the exogenous normal DNA of the present invention has been introduced should be stably bred in a normal breeding environment as a DNA-carrying animal after confirming that the exogenous DNA is stably maintained by mating. Can be done. Introduction of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in excess in all germ cells and somatic cells of the target mammal. Excessive presence of the exogenous DNA of the present invention in the germ cells of the produced animal after DNA introduction means that all the offspring of the produced animal have the exogenous DNA of the present invention in all of the germ cells and somatic cells. Means Progeny of such animals that have inherited the exogenous DNA of the present invention have an excess of the exogenous DNA of the present invention in all of their germinal and somatic cells. By obtaining a homozygous animal having the introduced DNA on both homologous chromosomes and mating the male and female animals, all offspring can be bred to have the DNA in excess. The non-human mammal having the normal DNA of the present invention has a high level of expression of the normal DNA of the present invention, and eventually promotes the function of the endogenous normal DNA, so that the hyperactivity of the polypeptide of the present invention is finally increased. May develop and can be used as a disease state animal model. For example, using the normal DNA-transfected animal of the present invention, elucidation of the hyperfunction of the polypeptide of the present invention and the pathological mechanism of a disease associated with the polypeptide of the present invention, and examination of a method for treating these diseases. It is possible. In addition, since the mammal into which the exogenous normal DNA of the present invention has been introduced has an increased symptom of the released polypeptide of the present invention, it can be used for screening tests for therapeutic drugs for diseases related to the polypeptide of the present invention. It is.

On the other hand, the non-human mammal having the exogenous abnormal DNA of the present invention is confirmed to stably maintain the exogenous DNA by mating, and is to be subcultured as an animal having the DNA in a normal breeding environment. Can be done. Furthermore, the desired foreign DNA can be incorporated into the above-described plasmid and used as a source material. A DNA construct with a promoter can be prepared by a usual DNA engineering technique. Abnormal D of the present invention at the fertilized egg cell stage
The introduction of NA is ensured to be present in all germ cells and somatic cells of the target mammal. The presence of the abnormal DNA of the present invention in the germinal cells of the produced animal after DNA introduction means that all the offspring of the produced animal have the abnormal DNA of the present invention in all of its germinal and somatic cells. The offspring of such animals that have inherited the exogenous DNA of the present invention have the abnormal DNA of the present invention in all of their germinal and somatic cells. A homozygous animal having the introduced DNA on both homologous chromosomes is obtained, and by crossing these male and female animals, it is possible to breed so that all offspring have the DNA. The non-human mammal having the abnormal DNA of the present invention has a high level of expression of the abnormal DNA of the present invention, and eventually inhibits the function of the polypeptide of the present invention by inhibiting the function of endogenous normal DNA. It can be a type refractory disease and can be used as a disease state animal model. For example, by using the abnormal DNA-introduced animal of the present invention, it is possible to elucidate the pathological mechanism of the function-inactive refractory of the polypeptide of the present invention and to examine a method for treating this disease. Also, as a specific possibility, the abnormal DNA highly expressing animal of the present invention can inhibit the function of the normal polypeptide by the abnormal polypeptide of the present invention (domi
nant negative effect). Also,
Since the mammal into which the foreign abnormal DNA of the present invention has been introduced has an increased symptom of the released polypeptide of the present invention,
The polypeptide of the present invention can also be used for a therapeutic drug screening test for inactive refractory disease.

Other possible uses of the above two kinds of the DNA-introduced animals of the present invention include, for example, use as a cell source for tissue culture, and DNA or R in the tissue of the DNA-introduced animal of the present invention.
NA is compared with that of non-introduced animals (control group)
Alternatively, analysis of genes and polypeptides specifically expressed, activated or inactivated by the polypeptide of the present invention by comparative analysis of the polypeptide composition, and culturing cells of a tissue having DNA by standard tissue culture techniques. These are used to study the function of cells from tissues that are generally difficult to culture, to screen for drugs that enhance the function of cells by using the cells described above, and to isolate and purify the mutant polypeptide of the present invention. And antibody production thereof. Furthermore, using the DNA-introduced animal of the present invention, it is possible to examine the clinical symptoms of diseases related to the polypeptide of the present invention, including the inactive refractory type of the polypeptide of the present invention, and the like. More detailed pathological findings in each organ of a disease model related to the polypeptide of the present invention can be obtained, which can contribute to the development of a new treatment method, and further to the study and treatment of a secondary disease caused by the disease. In addition, each organ is taken out from the DNA-introduced animal of the present invention, and after minced,
By using a polypeptide (protein) degrading enzyme such as trypsin, it is possible to obtain the released DNA-introduced cells, culture them, or systematize the cultured cells. Furthermore, it is possible to examine the specificity of the polypeptide-producing cell of the present invention, its relationship with apoptosis, differentiation or proliferation, or the signal transduction mechanism thereof, and to investigate the abnormalities thereof. It is an effective research material for elucidation. Further, the DN of the present invention
In order to develop a therapeutic agent for a disease associated with the polypeptide of the present invention, including a functionally inactive refractory type of the polypeptide of the present invention, using an A-introduced animal, It can be used to provide an effective and rapid method for screening for a therapeutic agent for the disease. In addition, using the DNA-introduced animal of the present invention or the exogenous DNA expression vector of the present invention, it is possible to examine and develop a DNA treatment method for a disease associated with the polypeptide of the present invention.

(8) Knockout Animal The present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated and a non-human mammal deficient in expression of the DNA of the present invention. That is, the present invention provides (1) a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated,
(2) the embryonic stem cell according to (1), wherein the DNA is inactivated by introducing a reporter gene (eg, a β-galactosidase gene derived from Escherichia coli); (4) The embryonic stem cell according to (1), wherein the non-human mammal is a rodent, (5) the embryonic stem cell according to (4), wherein the rodent is a mouse, 6) a non-human mammal deficient in expression of the DNA in which the DNA of the present invention is inactivated; (7) the DNA is inactivated by introducing a reporter gene (eg, a β-galactosidase gene derived from Escherichia coli); The non-human mammal according to (6), wherein the reporter gene can be expressed under the control of a promoter for the DNA of the present invention,
(8) The non-human mammal according to (6), wherein the non-human mammal is a rodent, (9) the non-human mammal according to (8), wherein the rodent is a mouse, and (10) D) administering the test compound to the animal described in (7) and detecting the expression of the reporter gene;
A method for screening a compound or a salt thereof that promotes or inhibits a promoter activity for NA is provided.

A non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated is defined as a DNA obtained by artificially mutating the DNA of the present invention in the non-human mammal to suppress the expression ability of the DNA. Alternatively, the DNA substantially does not have the ability to express the polypeptide of the present invention by substantially eliminating the activity of the polypeptide of the present invention encoded by the DNA (hereinafter referred to as the knockout DNA of the present invention). Non-human mammalian embryonic stem cells (may be referred to as
(Abbreviated as ES cell). As the non-human mammal, the same one as described above is used. Examples of a method for artificially mutating the DNA of the present invention include, for example, deletion of part or all of the DNA sequence by genetic engineering,
It can be carried out by inserting or substituting another DNA. By these mutations, for example, the knockout DN of the present invention is shifted by shifting the codon reading frame or disrupting the function of the promoter or exon.
A may be prepared. Specific examples of the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated (hereinafter abbreviated as the DNA-inactivated ES cells of the present invention or the knockout ES cells of the present invention) include, for example, The DNA of the present invention possessed by a non-human mammal is isolated, and a drug resistance gene represented by a neomycin resistance gene, a hygromycin resistance gene, or lacZ
Inserting a reporter gene such as (β-galactosidase gene) or cat (chloramphenicol acetyltransferase gene), etc., destroys the function of exons, or terminates the transcription of genes in the introns between exons. Insert a DNA sequence (eg, polyA addition signal) and complete mRNA
By introducing a DNA strand having a DNA sequence constructed so as to result in the disruption of the gene (hereinafter, abbreviated as a targeting vector) into the chromosome of the animal by, for example, homologous recombination, DNA on the Southern hybridization analysis or targeting vector using the DNA sequence of or near the DNA of the present invention as a probe for the obtained ES cells
It can be obtained by analyzing the sequence and the DNA sequence of the neighboring region other than the DNA of the present invention used for the preparation of the targeting vector by PCR using primers, and selecting the knockout ES cells of the present invention.

Further, the DN of the present invention can be obtained by the homologous recombination method or the like.
As the original ES cells for inactivating A, for example, those already established as described above may be used, or newly established ES cells according to the known method of Evans and Kaufman may be used. For example, in the case of mouse ES cells, currently, 129 line ES cells are generally used. However, since the immunological background is not clear, a pure line which substitutes the immunological genetic background is used. For example, C57BL / 6 mice or C57BL /
BDF1 mouse (C57BL / 6 and DBA / 2 F
Those established using 1) can also be used favorably. BDF
In addition to the advantage that one mouse has a large number of eggs collected and the eggs are robust, the C57BL / 6 mouse is used as a background. By backcrossing with C57BL / 6 mice (backcross), the genetic background was changed to C57BL / 6 mice.
It can be used advantageously in that it can be replaced with 6 mice. In addition, when ES cells are established, blastocysts 3.5 days after fertilization are generally used. In addition, a large number of blastocysts can be obtained efficiently by collecting 8-cell stage embryos and culturing them up to blastocysts. Early embryos can be obtained. Either male or female ES cells may be used, but generally male ES cells are more convenient for producing a germline chimera. Also,
It is desirable to discriminate between males and females as soon as possible in order to reduce the troublesome culture time. As a method for determining the sex of ES cells, for example, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR can be mentioned. Using this method, conventionally, for example G-banding method, requires about 10 ⁶ cells to the karyotyping, ES cell number of about 1 colony (about 50
), The primary selection of ES cells in the early stage of culture can be performed by discriminating between male and female, and the early stage of culture can be greatly reduced by enabling selection of male cells at an early stage.

The second selection can be performed by, for example, confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, when it is difficult due to physical operations or the like at the time of establishment, after knocking out the gene of the ES cells, the cells can be knocked out of normal cells (for example, chromosome in mice). Number is 2n
= Cells). The embryonic stem cell line obtained in this way usually has very good growth properties, but must be carefully subcultured because it tends to lose its ontogenetic ability. For example, on a suitable feeder cell such as STO fibroblast, in the presence of LIF (1-10000 U / ml) in a carbon dioxide incubator (preferably about 5% carbon dioxide, about 95% air or about 5% oxygen). , About 5% carbon dioxide, about 90% air) at about 37 ° C., and at the time of subculture, for example, trypsin / EDTA solution (usually about 0.001-
A single cell is obtained by treating with 0.5% trypsin / about 0.1-5 mM EDTA (preferably about 0.1% trypsin / about 1 mM EDTA), and the cells are seeded on newly prepared feeder cells. Such passage is usually 1
Every three days, the cells are observed at this time, and if morphologically abnormal cells are found, it is desired that the cultured cells be discarded. ES cells are differentiated into various types of cells such as parietal muscle, visceral muscle, myocardium, etc. under appropriate conditions by monolayer culture up to high density or suspension culture until cell clumps are formed. [MJ Evans and MH Kaufman, Nature, 292, 154, 1981.
Year: GRMartin, Proceedings of National Academy of Science USA, Proc. Natl. Acad. Sci. USA, 78, 76
34, 1981; TC Doetschman et al., Journal of Embryology and Experimental Morphology, Vol. 87, p. 27, 1985.
The cells deficient in expressing the DNA of the present invention obtained by differentiating the ES cells of the present invention are useful in the cell biology of the polypeptide of the present invention in vitro. The non-human mammal deficient in DNA expression of the present invention may comprise an mR of the animal.
By measuring the amount of NA using a known method and indirectly comparing the expression level, it is possible to distinguish the animal from a normal animal. As the non-human mammal, those similar to the aforementioned can be used.

The non-human mammal deficient in DNA expression of the present invention may be prepared, for example, by introducing the targeting vector prepared as described above into mouse embryonic stem cells or mouse egg cells,
By knocking out the DNA of the present invention, the DNA sequence in which NA has been inactivated is replaced with the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination. it can. A cell in which the DNA of the present invention has been knocked out is a DNA sequence of the present invention derived from the mouse used in the targeting vector, the DNA sequence of the DNA of the present invention or a DNA sequence of the targeting vector, or a DNA sequence on or near the DNA of the present invention. It can be determined by analysis by PCR using a DNA sequence of a nearby region other than DNA as a primer. When a non-human mammalian embryonic stem cell is used, a cell line in which the DNA of the present invention has been inactivated by gene homologous recombination is cloned, and the cell is cultured at an appropriate time, for example, at the 8-cell stage of a non-human mammalian stem cell. The chimeric embryo is injected into an animal embryo or a blastocyst, and the produced chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal. The produced animal is a chimeric animal comprising both cells having the normal DNA locus of the present invention and cells having the artificially mutated DNA locus of the present invention. When a part of the germ cells of the chimeric animal has a mutated DNA locus of the present invention, all tissues are artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual. D of the present invention added
It can be obtained by selecting individuals composed of cells having NA loci, for example, by judging coat color or the like. The individual thus obtained is usually an individual heterozygously deficient in expression of the polypeptide of the present invention, and mated with an individual heterozygously deficient in expression of the polypeptide of the present invention. Can be obtained. When using an egg cell, for example, a transgenic non-human mammal having a targeting vector introduced into a chromosome can be obtained by injecting a DNA solution into a nucleus of an egg cell by a microinjection method, and these transgenic non-human mammals can be obtained. Compared to mammals, they can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination.

In the individual knocked out of the DNA of the present invention as described above, it is necessary to confirm that the DNA of the animal obtained by the crossing is also knocked out, and to carry out rearing in an ordinary breeding environment. Can be. further,
The germline can be obtained and maintained in accordance with a conventional method. That is, by crossing male and female animals having the inactivated DNA, homozygous animals having the inactivated DNA on both homologous chromosomes can be obtained. The obtained homozygous animals were compared to normal animals 1
It can be obtained efficiently by breeding in a state where a plurality of homozygotes are formed. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred and passaged. The non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing a non-human mammal deficient in expressing the DNA of the present invention. In addition, the DN of the present invention
Since a non-human mammal deficient in A expression lacks various biological activities that can be induced by the polypeptide of the present invention, it can serve as a model for a disease caused by inactivation of the biological activity of the polypeptide of the present invention. It is useful for investigating the causes of these diseases and studying treatment methods.

(8a) A method for screening a compound having a therapeutic / preventive effect against diseases caused by DNA deficiency or damage of the present invention The non-human mammal deficient in DNA expression of the present invention
It can be used for screening for a compound having a therapeutic / preventive effect against diseases caused by NA deficiency or damage (cancer, immune disease, infectious disease, gastrointestinal disease, cardiovascular disease, endocrine disease, etc.). That is, the present invention relates to the DN of the present invention.
A test compound is administered to a non-human mammal deficient in A expression, and changes in the animal are observed and measured. And a method for screening a compound having the compound or a salt thereof. Examples of the non-human mammal deficient in expressing DNA of the present invention used in the screening method include the same ones as described above. Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma, etc., and these compounds are novel compounds. Or a known compound. Specifically, a non-human mammal deficient in expression of the DNA of the present invention is treated with a test compound, compared with an untreated control animal, and tested using changes in organs, tissues, disease symptoms, etc. of the animal as indices. The therapeutic / preventive effects of the compounds can be tested. Methods for treating test animals with test compounds include:
For example, oral administration, intravenous injection and the like are used, and can be appropriately selected according to the condition of the test animal, the properties of the test compound, and the like. The dose of the test compound can be appropriately selected according to the administration method, properties of the test compound, and the like.

The compound obtained by using the screening method of the present invention is a compound selected from the test compounds described above, and is a disease (cancer, immune disease, infectious disease, etc.) caused by deficiency or damage of the polypeptide of the present invention. , Gastrointestinal diseases, cardiovascular diseases, endocrine diseases, etc.), so that safe and low-toxic treatments
It can be used as a medicament such as a prophylactic agent. further,
Compounds derived from the compounds obtained in the above screening can also be used. The compound obtained by the screening method may form a salt, and the salt of the compound may include a physiologically acceptable acid (eg, an inorganic acid, an organic acid) and a base (eg, an alkali metal). Are used, and especially preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. A medicament containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the aforementioned medicament containing the polypeptide of the present invention. Since the preparation thus obtained is safe and has low toxicity, it can be used, for example, in mammals (eg, human, rat, mouse, guinea pig, rabbit, sheep, pig, cow, horse, cat, dog, monkey, etc.). Can be administered. The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like.
For example, when the compound is orally administered for the purpose of treating cancer,
Generally, in an adult (assuming a body weight of 60 kg), the compound is used in an amount of about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg per day.
Administer. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like. When administered, about 0.01 to 30 mg, preferably about 0.1 to 30 mg of the compound per day.
It is convenient to administer about 20 mg, more preferably about 0.1 to 10 mg, by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(8b) Method for Screening for a Compound that Promotes or Inhibits the Activity of the Promoter for DNA of the Present Invention The present invention relates to a non-human mammal deficient in expressing the DNA of the present invention.
The present invention provides a method for screening a compound or a salt thereof which promotes or inhibits the activity of a promoter for DNA of the present invention, which comprises administering a test compound and detecting the expression of a reporter gene. In the above-mentioned screening method, the non-human mammal deficient in expression of DNA of the present invention may be a non-human mammal deficient in expressing DNA of the present invention in which the DNA of the present invention is inactivated by introducing a reporter gene, A reporter gene that can be expressed under the control of a promoter for the DNA of the present invention is used. Examples of the test compound include the same compounds as described above. As the reporter gene, the same one as described above is used, and a β-galactosidase gene (lacZ), a soluble alkaline phosphatase gene, a luciferase gene and the like are preferable. DNA of the present invention in which the DNA of the present invention is replaced with a reporter gene
In a non-human mammal deficient in expression, since the reporter gene is under the control of the promoter for the DNA of the present invention, the activity of the promoter can be detected by tracing the expression of the substance encoded by the reporter gene.

For example, when a part of the DNA region encoding the polypeptide of the present invention is replaced with the β-galactosidase gene (lacZ) derived from Escherichia coli, the tissue expressing the polypeptide of the present invention should Β-galactosidase is expressed instead of the polypeptide of the invention. Therefore, for example, by staining with a reagent that serves as a substrate for β-galactosidase such as 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal), it is easy to perform the staining. The expression state of the polypeptide of the present invention in an animal body can be observed. Specifically, the polypeptide-deficient mouse of the present invention or a tissue section thereof is fixed with glutaraldehyde or the like, washed with phosphate buffered saline (PBS), and then stained with X-gal,
After reacting at room temperature or around 37 ° C. for about 30 minutes to 1 hour, the β-galactosidase reaction may be stopped by washing the tissue sample with a 1 mM EDTA / PBS solution, and coloration may be observed. In addition, according to a conventional method, la
The mRNA encoding cZ may be detected.

The compound or a salt thereof obtained by the above screening method is a compound selected from the test compounds described above, and is a compound that promotes or inhibits the promoter activity for the DNA of the present invention. The compound obtained by the screening method may form a salt,
Salts of the compound include physiologically acceptable acids (eg,
Salts with inorganic acids) and bases (eg, organic acids) are used, and physiologically acceptable acid addition salts are particularly preferable. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The compound or its salt that promotes the promoter activity for the DNA of the present invention can promote the expression of the polypeptide of the present invention and promote the function of the polypeptide. It is useful as a medicament such as a safe and low toxic therapeutic / prophylactic agent for diseases such as gastrointestinal diseases, cardiovascular diseases and endocrine diseases. Furthermore, compounds derived from the compounds obtained by the above screening can be used in the same manner.

A drug containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the above drug containing the polypeptide of the present invention or a salt thereof. Since the preparation thus obtained is safe and has low toxicity, it can be used, for example, in mammals (eg, rat, human, mouse, guinea pig, rabbit, sheep, pig, cow, horse, cat, dog, monkey, etc.). Can be administered. The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like.
For example, when a compound that promotes the promoter activity of the DNA of the present invention is orally administered for the purpose of treating cancer, generally, in an adult (with a body weight of 60 kg), the compound is used in an amount of about 0.1 to 100 mg, preferably 100 mg per day. Is about 1.
0 to 50 mg, more preferably about 1.0 to 20 mg is administered. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like. For example, a compound that promotes the promoter activity of the DNA of the present invention for the purpose of treating cancer may be used as an injection. Usually in adult form (60
kg)), the compound may be administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg per day.
Conveniently, about g, more preferably about 0.1 to 10 mg, will be administered by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg. On the other hand, for example, when the compound of the present invention that inhibits the promoter activity for DNA is orally administered, generally, in an adult (assuming a body weight of 60 kg) cancer patient, the compound is used in an amount of about 0.1 to 100 mg per day, preferably Is about 1.0-50 mg, more preferably about 1.0-20 mg
Administer. When administered parenterally, a single dose of the compound varies depending on the administration subject, target disease and the like, but the compound of the present invention that inhibits promoter activity on DNA is usually administered in the form of an injection to an adult (60 kg). )), The compound is administered in an amount of about 0.01 to 3 per day.
It is convenient to administer about 0 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. 60 kg for other animals
Per-converted amounts can be administered.

As described above, the non-human mammal deficient in expression of the DNA of the present invention is extremely useful for screening for a compound or a salt thereof that promotes or inhibits the activity of the promoter for the DNA of the present invention. It can greatly contribute to investigating the cause of various diseases caused by expression deficiency or developing preventive and therapeutic drugs. Furthermore, since the gene encoding the polypeptide of the present invention is specifically expressed in humans, particularly in the thymus, spleen, liver, pancreas, lymph nodes, testis, etc., the promoter sequence of the gene may It is convenient as a promoter for expressing a large amount of (such as any useful gene product) in these tissues of non-human warm-blooded animals. Examples of the non-human warm-blooded animal include those similar to those exemplified above as the warm-blooded animal. That is, the present invention
A target protein (arbitrarily useful gene product, etc.) is ligated downstream (3 ′ end) of a promoter region of a gene encoding a polypeptide characterized by containing the amino acid sequence represented by SEQ ID NO: 2. , Target protein (any useful gene product, etc.) by introduction into non-human animals
Is provided in a thymus, spleen, liver, pancreas, lymph node, testis and the like of a non-human warm-blooded animal. Examples of the target protein (eg, any useful gene product) include cytokines (eg, interleukins, interferons, chemokines, hematopoietic factors), growth factors (eg, E
GF (epidermal growth factor) or a substance having substantially the same activity as that (eg, EGF, hallegulin (HER2 ligand), etc.), insulin or a substance having substantially the same activity as that (eg, insulin, IGF (insulin) -like growth factor) -1, I
GF-2, etc.), FGF (fibroblast growth factor) or those having substantially the same activity as it (for example,
aFGF, bFGF, KGF (Keratindcyte Growth Fa
ctor), HGF (Hepatocyte Growth Factor), FGF
-10), other cell growth factors (eg, CSF
(Colony stimulating factor), EPO (erythropoie
tin), IL-2 (interleukin-2), NGF (nerve gr
owth factor), platelet-derived growth f
actor), TGFβ (transforming growth factor)
β)))), hormones (eg, luteinizing hormone releasing hormone (LH-RH), growth hormone, growth hormone releasing hormone (GH-RH), prolactin, melanocyte stimulating hormone, thyroid hormone releasing hormone, thyroid stimulating hormone, luteinizing hormone Morphogen, progestin, follicle-stimulating hormone, gastrin, motilin, somatostatin,
Secretin, glucagon, PACAP, VIP, etc., digestive enzymes (eg, amylase, pepsinogen, lipase, etc.), antibodies against pathogens (eg, antibodies against pathogenic bacteria such as pathogenic Salmonella, antibodies against pathogenic viruses such as influenza, echinocox, etc.) And useful gene products such as antibacterial polypeptides (eg, cecropin, histatin, indolicidin, protegrin, defensin, lysozyme, etc.). By specifically expressing the cytokines in the thymus and spleen among the above target proteins, for example, enhancement and regulation of immune activity in non-human warm-blooded animals can be achieved, and liver-specific expression of growth factors By
For example, growth promotion of a non-human warm-blooded animal can be achieved.

The target protein (any useful gene) is located downstream (3 'end) of the promoter region of the gene encoding the polypeptide characterized by containing the amino acid sequence represented by SEQ ID NO: 2. Product or the like) and ligated with DNA or RNA, and introduced into a non-human animal to introduce the target protein (any useful gene product or the like)
Is specifically described in a thymus, spleen, liver, pancreas, lymph node, testis and the like of a non-human warm-blooded animal. First, a promoter of a gene encoding a polypeptide characterized by containing the amino acid sequence represented by SEQ ID NO: 2 is obtained by colony hybridization, plaque hybridization or PCR.
And other known methods (eg, Molecular Cloning 2nd (J. Sambrook et al., Col.)
dSpring Harbor Lab. Press, 1989)). The region having promoter activity can be identified by a known method such as a reporter assay (for example, Analytical Biochemistry (Analy
tical Biochemistry), 188, 245 (1990).
Year)). Next, downstream (3 ′) of the promoter obtained by the above method.
Target protein at the end) (any useful gene product, etc.)
Can be ligated by a known method for constructing a plasmid using T4 DNA ligase (for example, Molecular Cloning 2nd (J. Sa).
mbrook et al., Cold Spring Harbor Lab. Press, 198
The objective can be achieved by the method described in 9)). In order to introduce a DNA encoding the target protein (any useful gene product or the like) downstream (3 ′ end) of the promoter into a non-human warm-blooded animal, a method using electroporation, A method using a gun, a method using a retroviral vector (for example,
Blood Cells, Vol. 17, p. 407 (1991) and the like, and methods using adenovirus vectors (for example, pathology (Patholog)
y), Vol. 30, p. 335 (1998)).

In the present specification and drawings, when bases, amino acids and the like are represented by abbreviations, the IUPAC-IUB Commission o
n This is based on the abbreviation by Biochemical Nomenclature or the abbreviation commonly used in the relevant field, examples of which are described below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate Phosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate

Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thr: threonine Cys: cysteine Met: methionine Glu: glutamic acid Asp: aspartic acid Lysine arginine arginine : Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine pGlu: Pyroglutamic acid

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine -4 (R) - carboxamide group Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ -Bzl: 2,6-dichlorobenzyl Bom: benzyloxymethyl Z: benzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Boc: t-butoxycarbonyl DNP: dinitrophenyl Trt: trityl Bum: t-butoxymethyl Fmoc : N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine HONB: 1-h Proxy-5-norbornene-2,3-Jikaruboki Shiimido DCC: N, N'- dicyclohexylcarbodiimide

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] Novel human cDNA obtained in Example 1
Shows the nucleotide sequence of the fragment. [SEQ ID NO: 2] This shows the amino acid sequence of the precursor polypeptide. [SEQ ID NO: 3] DN encoding precursor polypeptide
1 shows the nucleotide sequence of A. [SEQ ID NO: 4] This shows the amino acid sequence of the polypeptide of the present invention. [SEQ ID NO: 5] D encoding polypeptide of the present invention
Shows the base sequence of NA. [SEQ ID NO: 6] This shows the amino acid sequence of mature peptide 1. [SEQ ID NO: 7] This shows the base sequence of DNA encoding mature peptide 1. [SEQ ID NO: 8] This shows the amino acid sequence of mature peptide 2. [SEQ ID NO: 9] This shows the base sequence of DNA encoding mature peptide 2. [SEQ ID NO: 10] This shows the base sequence of primer (sense strand) used in Example 1. [SEQ ID NO: 11] This shows the base sequence of the primer (antisense strand) used in Example 1. [SEQ ID NO: 12] This shows the base sequence of the primer (sense strand) used in Example 3. [SEQ ID NO: 13] This shows the base sequence of the primer (antisense strand) used in Example 3. [SEQ ID NO: 14] This shows the amino acid sequence of the polypeptide encoded by the expression vector constructed in Example 3. [SEQ ID NO: 15] This shows the base sequence of the polypeptide encoded by the expression vector constructed in Example 3. [SEQ ID NO: 16] This shows the base sequence of the primer (antisense strand) used in Example 6. [SEQ ID NO: 17] Synthetic peptide CPP1 used in Example 8
1 shows the amino acid sequence of -1. [SEQ ID NO: 18] Synthetic peptide CPP1 used in Example 8
2 shows the amino acid sequence of -2. [SEQ ID NO: 19] This shows the base sequence of the primer (antisense strand) used in Example 9. [SEQ ID NO: 20] This shows the base sequence of the primer (sense strand) used in Example 11. [SEQ ID NO: 21] This shows the base sequence of the primer (antisense strand) used in Example 11. [SEQ ID NO: 22] This shows the amino acid sequence of the mouse precursor polypeptide obtained in Example 11. [SEQ ID NO: 23] This shows the base sequence of DNA encoding the mouse precursor polypeptide obtained in Example 11.

The transformant Escherichia coli XL10-Gol obtained in Example 1 described later was used.
d / pDRL90h has been deposited with the Fermentation Research Institute (IFO) from September 7, 2000 under the deposit number IFO 1647.
No.4, and since September 25, 2000, 1-1 1-1 Higashi, Tsukuba City, Ibaraki Prefecture, Central Research Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center (formerly Ministry of International Trade and Industry, Technology Research Institute (NIB
H)) and deposit number FERM BP-7307.

EXAMPLES The present invention will be described below in detail with reference to examples, but the present invention is not limited thereto.
In addition, genetic manipulation using E. coli
The method described in Molecular cloning was followed.

Example 1 c encoding human DRL90
DNA cloning Search the human genetic information database and find a signal sequence for secretion and a basic amino acid pair (Arg-Ar) in the same open reading frame (ORF).
g, Lys-Arg), a sequence derived from chromosome 17 was found in the human gene sequence. Whether the mRNA containing the present gene sequence is actually transcribed and the expected ORF
To check if the cDN is correct,
The A fragment was obtained. CDNA from human thymus (Multiple
Tissue cDNA Panel, CLONTECH K1421-1) 3 μl each
In addition, oligo DNA GGAACCAAGGCAGGATGAAGAC (SEQ ID NO: 10) 10 pmol, oligo DNA GGTCCTGATCCCC
CTTACACAG (SEQ ID NO: 11) 10 pmol, distilled water 1
0μl, Premix Taq (Ex Taq Version, Takara Shuzo) 20μ
l to make a total volume of 40 μl, and heat cycler (Ge
neAmp PCR System Model 9700, PerkinElmer)
After 96 minutes at 96 ° C., 35 cycle reactions (9
(4 ° C.-30 seconds, 65 ° C.-1 minute).
The kb PCR fragment was amplified. Next, this DNA fragment was purified by agarose gel electrophoresis, cloned using pCR2.1-TOPO (Invitrogen) to determine the nucleotide sequence, and the plasmid was cloned into E. coli XL10
-Introduced into Gold competent cells (STRATAGENE). From the colonies of the ampicillin-resistant transformant appearing on the ampicillin-containing LB agar medium, a clone holding the plasmid into which the 0.3 kb DNA fragment was inserted was selected, and the plasmid DNA (pDRL90h) was prepared. To determine the base sequence of the inserted DNA, pDR
L90h was used as template DNA and two types of primer DNA (PR
M-007, PRM-008, Toyobo) as sequence primers and ABI PRISM (registered trademark) BigDye Terminat.
or Cycle SequencingFS A sequencing reaction was performed using a FS Ready Reaction Kit (Perkin Elmer), and the DNA was decoded using a DNA sequencer ABI PRISM (registered trademark) 377 (Perkin Elmer). As a result, it was found that a novel cDNA fragment consisting of 301 nucleotides shown in SEQ ID NO: 1 having no homology to a known nucleotide sequence was inserted into pDRL90h. This cDNA includes a novel protein consisting of 90 amino acid residues represented by SEQ ID NO: 2 (hereinafter, “DRL90h polypeptide” or “DR
L90h) (SEQ ID NO: 3).
reading frame). From the above results, it was confirmed that the present gene was transcribed and translated. In addition, since an open reading frame encoding a polypeptide having no homology to a known amino acid sequence was confirmed, it was clarified that the cDNA was a novel polypeptide containing a signal sequence.

Example 2 Analysis of Expression Site in Human The inserted DNA fragment described in Example 1 (EcoRI-Eco
20 ng of [0.3 kb fragment of RI) and [α- ³² P] dC
TP (Amersham: 6000 Ci / mmol) 5
Use the Multiprime DNA labeling system (Amersh
am: RPN.1601Y) to prepare a DNA probe.
Using this probe, MTN Blot (CLONTECH
: # 7780-1) and Human Multiple Tissue Expr
Hybridization was performed on an ession Array (CLONTECH: # 7775-1). Hybridization and washing conditions were in accordance with the attached manual.
This was performed using S-2000 (Fuji Film). As a result, the mRNA of this clone was expressed in the thymus (adult and fetal),
It was found to be expressed in limited tissues such as spleen, liver, pancreas, lymph node, and testis, and it was revealed that it was specifically expressed in organs. The size of the mRNA was about 1.3 kb (FIGS. 1 and 2).

Example 3 Construction of Human DRL90 Expression Vector A DNA fragment encoding human DRL90 was obtained by the following PCR method. That is, SEQ ID NO: 12
(5'-CTAGAATTCCACCATGAAGACATTGCCTGTGCTCGTGCTGTCT
No. 13 (5′-GATCCGTCGACCACAGG) using the oligo DNA represented by CTTA-3 ′) as a sense strand primer
Oligo D represented by ATG AATCCTGTTCCTGTCACAGT-3 ')
NA was used as an antisense strand primer at 20 pmo each.
l, 10 x Advantage (registered trademark) 2 PCR Buffer (CLONTE
CH) 5 μl, 50 x dNTP mix (CLONTECH) 1 μl, 50 x
50 μl of a mixture containing 1 μl of Advantage 2 Polymerase Mix (CLONTECH) and 1 ng of the 0.3 kb fragment described in Example 1 as a template DNA was prepared, and a thermal cycler (Ge
neAmp® PCR system model 9700 (AppliedBio
systems)) at 96 ° C. for 1 minute, followed by 96 ° C., 5
The cycle was repeated for 20 cycles of seconds → 66 ° C., 5 seconds → 72 ° C., and 30 seconds, and a PCR reaction was carried out by a program at 72 ° C. for 1 minute. After the reaction, the reaction mixture was used
I, Double digestion with SalI (Takara Shuzo), followed by Chiaquick Gel PCR Purification Kit (QIAGE)
N) was used to remove unreacted primers and short DNA fragments generated by restriction enzyme digestion. The obtained fragment (0.2
8 kb) with pCAN618. Subcloned into the FLAG vector, and the plasmid was transformed into E. coli Epicuria.
It was introduced into competent cells of nColi (registered trademark) XL10-Gold (registered trademark) strain (STRATAGENE).
From the colonies of the ampicillin-resistant transformant appearing on the ampicillin-containing LB agar medium, a clone retaining the plasmid into which the foreign DNA fragment was inserted was selected, and the plasmid DNA, pDRL90h-FLA, was selected.
G was prepared. pDRL90h-FLAG is the CRL of DRL90h polypeptide as shown in SEQ ID NO: 14.
A Val residue at the end, followed by the FLAG sequence Asp-
Tyr-Lys-Asp-Asp-Asp-Asp-L
It contains a 300 base pair DNA fragment of SEQ ID NO: 15 encoding a human DRL90h-FLAG fusion protein followed by ys. The FLAG sequence has a role as an epitope (antibody recognition site) for detecting a gene product.

Example 4 Expression in COS-7 cells Whether it is a human DRL90h-FLAG fusion protein,
Expression experiments were performed using COS-7 cells to determine whether they would undergo processing (limited degradation) and form multimers. One day before transfection of the expression vector, COS-7 cells were
Sow 10 so that it becomes × 10 ⁵ cells / well
% FBS (JRH) in DMEM medium (Gibco
(BRL) for 24 hours in a CO ₂ incubator. PDRL90h-FLAG D constructed in Example 3
NA of 1 μg / well and Effectene (QIA
GEN), followed by transfection.
Four hours later, the medium was replaced with a serum-free DMEM medium supplemented with 1 ml of 0.1 mM pABSF (Wako Pure Chemical Industries) and 0.05% CHAPS (Dojindo), and the culture was continued for another 48 hours. Culture supernatant is Eppendor
f After transferring to a sample tube and centrifuging to remove floating cells, the cells were concentrated to about 1/10 volume using Centricon YM-3 ultrafiltration membrane (Millipore). An equal volume of Tricine S is added to the obtained concentrated culture supernatant.
DS-PAGE sample buffer (TEFCO) was added. In addition, cells were used in 1 ml of PBS (GibcoBR).
L) and washed twice with 500 μl of Tricine
SDS-PAGE sample buffer was added. DRL
Since 90 polypeptide has two cysteine residues, electrophoresis is performed in a non-reduced state and a reduced state, so that only an electrophoresis sample in a reduced state has an additional 10% (w / v).
DTT was added. These samples were heat-treated at 95 ° C. for 5 minutes, and then subjected to 16% Peptide-PAG.
Electrophoresis was carried out by E mini (TEFCO), and the polypeptide migrated from the gel was transferred onto a nitrocellulose filter. Next, after blocking the nitrocellulose filter with PBS containing 0.1% Tween-20 and 50% Block Ace (Snow Brand Milk Products),
Detection of human DRL90h-FLAG fusion protein was performed using the antibody. Anti-FLAG M2 mouse IgG monoclonal antibody (1/2000 dilution, Sig
ma), HRP-labeled anti-mouse IgG sheep antibody (1/2000 dilution, Amersham Pharmacia Biotech) as the secondary antibody
The reaction was performed using ECL Western Blotting Kit for light emission
(Amersham Pharmacia Biotech) using Hyperfilm EC
Chemiluminescence was detected by L (Amersham Pharmacia Biotech). As a result, the human DRL90-FLAG fusion protein was mostly secreted into the cell culture supernatant, and its molecular weight was about 7.1 kDa and 9.2 kDa in the reduced state, about 7.4 kDa and 9.5 kDa in the non-reduced state. 16.5k
Da, 19 kDa and 21 kDa were found (FIG. 3). The cell fraction had a reduced state of about 9.2 kD.
a, In a non-reducing state, it was detected as a polypeptide having a molecular weight of about 21 kDa. From the above, human DRL90
The h-FLAG fusion protein was found to not only exist as a monomer, but also to form a dimer via a cysteine residue in the polypeptide. In addition, during the process of secretion outside the cell, a polypeptide having a molecular weight of about 9 kDa as a monomer undergoes limited degradation (processing) by proteolytic enzymes to form a polypeptide of about 7 kDa and a polypeptide of about 2 kDa. The separation suggested that the dimer had three molecular species. In addition, the limited digestion was carried out by using a cleavage sequence (Arg-Ser-A) of furin, which is a protein processing enzyme.
rg-Arg ↓) (FIG. 4).

Example 5 Expression in CHO Cells Chinese Hamster Ovary Cells
ary Cell, CHO-K1) with 10% fetal bovine serum (FBS)
), And cultured in a Ham F-12 medium containing 1 μm of the expression plasmid (pDRL90h-FLAG) constructed in Example 3.
g is introduced using Effectene (QIAGEN). Thereafter, 500 μg / ml of G418 was added to the same culture solution.
And cells that survive (transformed cells in which the above-described plasmid has been introduced into expression cells) are selected. A double culture supernatant in which a gene product (human polypeptide) is produced by culturing in the obtained G418-resistant CHO culture medium or ham F-12 medium transiently containing no fetal bovine serum (FBS). To get.

Example 6 Construction of Human DRL90 Expression Vector (Part 2) A DNA fragment encoding human DRL90 was obtained by the following PCR method. That is, the oligo DNA represented by SEQ ID NO: 12 was used as a sense strand primer, and the oligo DNA represented by SEQ ID NO: 16 was used as an antisense strand primer, each at 20 pmol and 10 × Advantage.
(Registered trademark) 2 PCR Buffer (CLONTECH) 5μl, 50x
dNTP mix (CLONTECH) 1μl, 50x Advantage 2 Poly
50 μl of a mixed solution containing 1 μl of a merase mix (CLONTECH) and 5 μl of a human pancreatic cDNA solution as a template DNA was prepared, and a thermal cycler (GeneAmp (registered trademark) PCR sys.
96 ° C. using temmodel 9700 (PE Biosystems)
1 minute, then 96 ° C, 5 seconds → 66 ° C, 5 seconds → 72 ° C, 3
A cycle of 0 seconds was repeated 30 cycles, and a PCR reaction was further performed by a program for performing an extension reaction at 72 ° C. for 1 minute. After the reaction solution was double digested with restriction enzymes EcoRI and SalI (Takara Shuzo), unreacted primers and short DNA fragments generated by restriction enzyme digestion were removed using a chia gel gel PCR purification kit (QIAGEN). . The obtained fragment was expressed in an animal cell expression vector pCAN61.
8 (WO 00/14226)
The plasmid was transferred to E. coli Epicurian Coli.
(Registered trademark) XL10-Gold (registered trademark) strain (STRA
(TAGENE). From the colonies of the ampicillin-resistant transformant appearing on the ampicillin-containing LB agar medium, a clone retaining the plasmid into which the foreign DNA fragment was inserted was selected, and the plasmid DNA, pCAN618 / hCPP1, was prepared. As a result of the nucleotide sequence analysis, pCAN618 / hCPP1
Contained a DNA fragment of 270 base pairs shown in SEQ ID NO: 3 which codes for a precursor polypeptide consisting of 90 amino acids shown in SEQ ID NO: 2.

Example 7 Expression of human DRL90 CHO-
Establishment of K1 cell line 3.3 × 10 ⁴ CHO-K1 cells were cultured in a 10 cm diameter Petri dish using F containing 10% fetal bovine serum (FBS).
Cultured in -12 medium (Gibco BRL) for 24 hours,
In this cell, the expression plasmid pCAN618 / hCPP1 was added.
(1.5 μg per petri dish) was introduced using the calcium phosphate method (CellPhect Transfection Kit / Pharmacia). 12 hours after introduction, F-12 without FBS
After washing twice with medium, isotonic HE containing 15% glycerol
Glycerol shock was given for 3 minutes using 3 ml of PES solution (pH 7.5). After washing twice with F-12 medium without FBS, the cells were further washed with F-12 medium containing FBS for another 1 hour.
After 2 hours of culture, Geneticine (GibcoBR)
Company L) 500 mg / L, F-12 containing 10% FBS
The medium was replaced with a selection medium (hereinafter, selection medium). After 10 days, each colony formed in the petri dish was transferred to a 24-well plate and cultured in a selective medium for 3 days. Cells grown in the selection medium were transferred to a 6-well plate,
After culturing for days, 0.02% CHAPS, 0.1 mM
Opti-MEM containing pABSF (Wako Pure Chemical Industries)
(Gibco BRL) Change the medium to 1 ml, and
After culturing for 8 hours, the culture supernatant was collected. The obtained culture supernatant was concentrated using a Centricon YM-3 ultrafiltration membrane (Millipore), and then the same volume of Tris-Tricine SD was used.
Mixed with S sample buffer. This sample at 95 ° C,
After heat treatment for 5 minutes, 16% Peptide
-Electrophoresed on PAGE mini (TEFCO) and transferred from the gel onto a nylon membrane. Next, the nylon membrane was blocked with Block Ace (Snow Brand Milk Products) for 1 hour, and PBS containing 0.05% Tween 20 was used.
Anti-human DRL9 prepared in Example 8 in (PBS-T)
Reaction with 0 antibody (TAL-100108-S, 1/2000 dilution) for 1 hour. After washing 5 times with PBS-T, P
HRP-labeled anti-rabbit IgG sheep antibody (1
/ 2000 dilution, Amersham Pharmacia Biotech) and 1
Reacted for hours. After washing 5 times with PBS-T, ECL color development kit (Amersham Pharmacia Biotech) and Hyp
erfilm ECL (Amersham Pharmacia Biotech
Was used to detect chemiluminescence. As a result, recombinant products of about 6 kDa and 8 kDa were detected in the cell culture supernatant. As a result, CHO-K expressing human DRL90
It was confirmed that one cell line could be established.

Example 8 Preparation of Anti-Human DRL90 Antibody To detect anti-human DRL90, rabbits were immunized with two kinds of synthetic peptides to obtain antisera against them. That is, two types of synthetic peptides CPP1-1 (N-QDRPSKPGFPC, SEQ ID NO: 1) into which cysteine was introduced.
7), CPP1-2 (N-CSPILTEKQAK, SEQ ID NO: 1)
8) was prepared, and rabbits were immunized with an antigen conjugated to a carrier protein (keyhole limpet hemocyanin: KLH) by the maleimide method, and antiserum T
AL-100108-S and TAL-100107-S were obtained. Next, using the obtained antiserum, the human DRL90h-FLAG fusion protein expressed in COS-7 described in Example 4 was detected by Western blot analysis. As a result, part of the synthetic peptide C of the amino acid at the N-terminal side of the furin cleavage site inherent in human DRL90
Antiserum TAL-1001 obtained by immunizing PP1-2
07-S is not cleaved at the furin cleavage site 9.2
Only kDa molecules were detected. In addition, a synthetic peptide CPP of a part of amino acids on the C-terminal side of the furin cleavage site
Antiserum TAL-100108 obtained by immunizing 1-1
-S detected both molecular species of a 7.1 kDa molecule cleaved at the furin cleavage site and a 9.2 kDa molecule that was not cleaved. In addition, these molecular species are human DRL90h
FLAG present at the C-terminus of FLAG fusion protein
Detection was also possible using an anti-FLAG antibody recognizing the tag. As a result, it was found that anti-human DRL90 can be detected by using the obtained rabbit antiserum.

Example 9 Identification of Cell Line Expressing DRL90 As described in Example 2, human DRL90 mRNA was restricted to thymus (adult and fetus), spleen, liver, pancreas, lymph node, testis, etc. Expressed in tissues. Therefore, the expression of DRL90 in a blood cell line was first determined by RT.
-Analyzed using the PCR method. For analysis, K-562,
HL-60, THP-1, U937 DF-4, MEG
-01, EoL-1, KU812, BALL-1, U2
66BL, CCRF-HSB-2, Molt-4, H9
Using 12 kinds of leukemia cell lines. First,
Total RNA was prepared from each cell line using TRIzol reagent (GibcoBRL). MRNA from the obtained total RNA
Poly (A) ⁺ RNA was prepared using Purification Kit (Amersham Pharmacia Biotech). The obtained poly (A) ⁺ RNA was converted to DNaseI (GibcoBRL).
After the ^{_{treatment, S UPER S CRIPT TM First-}} Strand Synthsis System
What was made into cDNA using for RT-PCR (GibcoBRL) was used as a template for the following RT-PCR. That is, using oligo DNA represented by SEQ ID NO: 10 as a sense strand primer, oligo D represented by SEQ ID NO: 19
NA was used as an antisense strand primer at 20 pmo each.
l, 10x Advantage (registered trademark) 2 PCR Buffer (CLONTEC
H company) 5μl, 50x dNTP (CLONTECH) 1μl, 50x Adv
Prepare 50 µl of a mixed solution containing 1 µl of antage 2 Polymerase Mix (CLONTECH) and 5 µl of a template DNA solution, and use a thermal cycler (GeneAmp (registered trademark) PCR system mode).
l 9700 (PE Biosystems)) at 96 ° C for 1 minute.
Subsequently, a cycle of 96 ° C., 5 seconds → 68 ° C., 30 seconds was repeated for 30 cycles, and further, a PCR reaction was carried out at 68 ° C. for 1 minute by an extension reaction program. As a result, DRL90 expression was confirmed in all the analyzed cell lines. Among them, U937 DF-4, MEG-01, Eo
L-1 and all analyzed lymphoid cell lines B
ALL-1, U266BL, CCRF-HSB-2, M
lt-4 and H9 showed relatively high expression.

Example 10 Identification of cells expressing DRL90 in testis and epididymis As described in Example 2, the results of Northern analysis were
L90 was found to be highly expressed in testis and epididymis. So, to clarify the function of DRL90,
Using the rabbit antiserum prepared in Example 8, the expression of DRL90 in normal mouse epididymis and testis was examined by immunostaining. Eleven week old normal male ICR mice were perfused and fixed with 4% paraformaldehyde under ether anesthesia. After removing the testis and epididymis, both tissues were further fixed with 4% paraformaldehyde at 4 ° C. overnight. Thereafter, the tissue was washed with water, and a paraffin-embedded block was prepared according to a standard method. (Histology, Yutaka Sano, Nanzando, 198
5 years) The manufactured block is rotated with a rotary microtome.
The slices were cut to a thickness of μm. After slicing, the sections were spread in a warm bath, mounted on a slide glass, and sufficiently dried with a 37 ° C. drier. The prepared section was deparaffinized, stained with hematoxylin and eosin according to a standard method, and sealed.
(Histology research method, Yutaka Sano, Nanzando, 1985) Further prepared sections were subjected to immunostaining using rabbit antiserum against DRL90 (TAL-100108-S). After deparaffinization of the mounted slide glass, immunostaining was performed. Immunostaining was performed using a Vectastain ABC kit (peroxidase method, Vector). DAB was used as a chromogenic substrate. Specific experimental procedures were performed according to the manual attached to the kit. DRL90 expression was found in sperm cells and sperm in testis. Moreover, it was found that the expression in epididymis was restricted to epithelial cells of testicular export tract and epithelial cells without cilia at the head of epididymis. This gene is involved in sperm differentiation because DRL90 is expressed in testicular testicular cells in the higher differentiation stages of male germ cells, and was not found in Sertoli cells or Leydig cells constituting testicular parenchyma. It was inferred that In the epididymis, expression was found in the testicular export tube at the stage where sperm migrated from the testis to the epididymis, and in the head of the epididymal tube, so that sperm transfer to the epididymis and reproductive function It was presumed to be involved in the grant.

Example 11 Preparation of Transgenic Mouse A DNA fragment encoding mouse DRL90 was obtained by the following PCR method. That is, SEQ ID NO: 20
With the oligo DNA represented by as a sense strand primer,
The oligo DNA represented by SEQ ID NO: 21 was used as an antisense strand primer in an amount of 20 pmol and 10 × Advantage, respectively.
(Registered trademark) 2 PCR Buffer (CLONTECH) 5μl, 50x
dNTP mix (CLONTECH) 1μl, 50x Advantage 2 Poly
50 μl of a mixed solution containing 1 μl of a merase mix (CLONTECH) and 5 μl of a mouse testis cDNA solution as a template DNA was prepared, and a thermal cycler (GeneAmp® PCR s) was prepared.
96 using ystemmodel 9700 (PE Biosystems).
° C, 1 minute, then 96 ° C, 5 seconds → 60 ° C, 5 seconds → 72
30 ° C, 30 cycles, and then 72 ° C, 2
The PCR reaction was carried out by a program for performing an extension reaction in minutes.
After the reaction, the reaction solution is subjected to restriction enzymes EcoRI and SalI (Takara Shuzo).
After double digestion, unreacted primers and a short DNA fragment generated by restriction enzyme digestion were removed using a Qiaquick Gel PCR Purification Kit (QIAGEN). The obtained fragment was expressed in an animal cell expression vector pCAN.
618 (WO 00/14226) and the plasmid is cloned into E. coli Epicurian Col.
i (registered trademark) XL10-Gold (registered trademark) strain (ST
(RATAGENE). From the colonies of the ampicillin-resistant transformant appearing on the ampicillin-containing LB agar medium, a clone holding the plasmid into which the foreign DNA fragment was inserted was selected, and the plasmid DNA, pCAN616 / mCPP1, was prepared. As a result of the nucleotide sequence analysis, pCAN616 / mCPP1
Contained a DNA fragment of 270 base pairs represented by SEQ ID NO: 23 encoding mouse DRL90 consisting of 90 amino acids represented by SEQ ID NO: 22. A mouse DRL90 gene fragment containing a promoter sequence and a terminator sequence, which is a gene fragment for injection for producing a transgenic mouse, was prepared as follows. That is, pCAN616 / mCPP1 was double-digested with restriction enzymes BamHI and HindIII (Takara Shuzo), subjected to protein removal treatment twice using an equi-soluble phenol / chloroform solution, and a DNA fragment was recovered by ethanol precipitation. Next, electrophoresis (TAE electrophoresis buffer) was performed on a 1% SeaKem GTG agarose gel (Takara Shuzo) to separate a DNA fragment of about 2.3 kb. After this fragment was cut out from the electrophoresis gel, a DNA fragment was recovered using a Qiaquick Gel Extraction Kit (QIAGEN). The obtained DNA solution was treated with an equal volume of phenol / chloroform, washed three times with 70% ethanol, and then the target fragment was recovered by ethanol precipitation. After air drying, 1 mM Tris-0.1 mM
It was resuspended in an EDTA (pH 8.0) solution to obtain a mouse DRL90 gene fragment for producing a transgenic mouse. A solution obtained by diluting this solution to 5 ng / μl is microinjected into a mouse fertilized egg, and a transgenic mouse is produced according to a conventional method.

Example 12 Secreted Produced Human DRL9
Physicochemical analysis of the 0 gene product Human DRL90 derived from COS-7 cells as described in Example 4
The h-FLAG fusion protein was purified and subjected to physicochemical analysis of molecular species. For purification, 80 ml of the culture supernatant was 0.1 ml.
TBS containing mM pABSF, 0.05% CHAPS
(50 mM Tris-HCl, 150 mM NaCl,
After dialysis against pH 7.4), the mixture was applied to an anti-FLAG M2 antibody column (Sigma). 0.1 mM antibody column
TBS 4 containing pABSF, 0.05% CHAPS
After washing with 0 ml, glycine hydrochloride (pH 3.0) 12
eluted in ml. Then C18 Bioselect S
Desalting and concentration were performed using a PE cartridge (VYDAC). Washed with 30% acetonitrile, 0.1% TFA and eluted with 50% acetonitrile, 0.1% TFA. Finally, HPLC (ODS-80TS column, A
Solution 30% acetonitrile, 0.1% TFA, Solution B 50
% Acetonitrile, 0.1% TFA, B for 60 minutes
The solution was changed from 0% to 100%) to obtain a purified sample as a single peak fraction. As a result of mass spectrometry by the LC / MS method, the measured molecular weight was 7552.0, which was the theoretical molecular weight (7551) of a molecular species in which glutamine at the N-terminal was converted to pyroglutamic acid and a pair of intramolecular disulfide bonds were formed. .4) were almost the same. Accordingly, the main component of the secreted and produced human DRL90 gene product is a molecular species having a 53 amino acid residue represented by SEQ ID NO: 6 having pyroglutamic acid at the N-terminus and having a pair of intramolecular disulfide bonds. It has been found.

[0096]

The polypeptide of the present invention and the DNA encoding the same can be used, for example, for the diagnosis, treatment and prevention of cancer, immune diseases, infectious diseases, gastrointestinal diseases, cardiovascular diseases and endocrine diseases. . Further, the polypeptide of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention. Furthermore, since an antibody against the polypeptide of the present invention can specifically recognize the polypeptide of the present invention, it can be used for detection, quantification, neutralization, etc. of the polypeptide of the present invention in a test solution. it can.

[0097]

[Sequence Listing] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Tissue specific novel secretory polypeptide and its DNA <130> P2001-218 <150> JP 2000-293985 <151> 2000-09-22 < 150> JP 2000-302839 <151> 2000-09-29 <160> 23 <210> 1 <211> 301 <212> DNA <213> Human <400> 1 GGAACCAAGG CAGGATGAAG ACATTGCCTG TGCTCGTGCT GTCTCTTACC TTACTGACTG 60 TCTTCTCAGA GACCTCCCCG ATTTTGACAG AGAAGCAGGC CAAACATC CTAAGATCTC 120 GGCGACAGGA TAGACCAAGC AAACCCGGAT TCCCCGATGA GCCAATGCGG GAATACATGC 180 ACCACCTGCT CGCCCTGGAG CATCGCGCTG AGGAGCAGTT CCTGGAGCAC TGGCTGAACC 240 CTCACTGCAA <ACC> ACTGT GACAGG <CA> Val Leu Val Leu Ser Leu Thr Leu Leu Thr Val 1 5 10 15 Phe Ser Glu Thr Ser Pro Ile Leu Thr Glu Lys Gln Ala Lys Gln Leu 20 25 30 Leu Arg Ser Arg Arg Gln Asp Arg Pro Ser Lys Pro Gly Phe Pro Asp 35 40 45 Glu Pro Met Arg Glu Tyr Met His His Leu Leu Ala Leu Glu His Arg 50 55 60 Ala Glu Glu Gln Phe Leu Glu His Trp Leu Asn Pro His Cys Lys Pro 65 70 75 80 His Cys Asp Arg Asn Arg Ile His Pro Val 85 90 <210> 3 <211> 270 <212> DNA <213> Human <400> 3 atgaagacat tgcctgtgct cgtgctgtct cttaccttac tgactgtctt ctcagagacc 60 tccccgattt tgacagagaa gcaggccaaa cagctcctaa gatctcggcg acaggataga 120 ccaagcaaac ccggattccc cgatgagcca atgcgggaat acatgcacca cctgctcgcc 180 ctggagcatc gcgctgagga gcagttcctg gagcactggc tgaaccctca ctgcaaaccc 240 cactgtgaca ggaacaggat tcatcctgtg 270 <210> 4 <211> 70 <212> PRT <213> Human <400> 4 Ser Pro Ile Leu Thr Glu Lys Gln Ala Lys Gln Leu Leu Arg Ser Arg 1 5 10 15 Arg Gln Asp Arg Pro Ser Lys Pro Gly Phe Pro Asp Glu Pro Met Arg 20 25 30 Glu Tyr Met His His Leu Leu Ala Leu Glu His Arg Ala Glu Glu Gln 35 40 45 Phe Leu Glu His Trp Leu Asn Pro His Cys Lys Pro His Cys Asp Arg 50 55 60 Asn Arg Ile His Pro Val 65 70 <210> 5 <211> 210 <212> DNA <213> Human <400> 5 tccccgattt tgacagagaa gcaggccaaa cagctcctaa gatctcggcg acaggataga 60 ccaagcaaac ccggattccc cgatgagcca atgcgggaat aca tgcacca cctgctcgcc 120 ctggagcatc gcgctgagga gcagttcctg gagcactggc tgaaccctca ctgcaaaccc 180 cactgtgaca ggaacaggat tcatcctgtg 210 <210> 6 <211> 53 <212> PRT <213> Human <400> 6 Gln Asp ProGlu Asp Arg Pro 1 5 10 15 Tyr Met His His Leu Leu Ala Leu Glu His Arg Ala Glu Glu Gln Phe 20 25 30 Leu Glu His Trp Leu Asn Pro His Cys Lys Pro His Cys Asp Arg Asn 35 40 45 Arg Ile His Pro Val 50 53 < 210> 7 <211> 159 <212> DNA <213> Human <400> 7 caggatagac caagcaaacc cggattcccc gatgagccaa tgcgggaata catgcaccac 60 ctgctcgccc tggagcatcg cgctgaggag cagttcctgg agcactggct gaaccctccc 120 tgcagca tgtcaca tgtcaca tgtcacag <213> Human <400> 8 Ser Pro Ile Leu Thr Glu Lys Gln Ala Lys Gln Leu Leu Arg Ser 1 5 10 15 <210> 9 <211> 45 <212> DNA <213> Human <400> 9 tccccgattt tgacagagaa gcaggccaaa cagctcctaa gatct 45 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> Primer <223> <400> 10 ggaaccaagg caggatgaag ac 22 <210> 11 <211> 2 2 <212> DNA <213> Artificial Sequence <220> Primer <223> <400> 11 ggtcctgatc ccccttacac ag 22 <210> 12 <211> 47 <212> DNA <213> Artificial Sequence <220> Primer <223> < 400> 12 ctagaattcc accatgaaga cattgcctgt gctcgtgctg tctctta 47 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> Primer <223> <400> 13 gatccgtcga ccacaggatg aatcctgttc ctgtcacagt 40 <210> 14 <211> <212> PRT <213> Artificial Sequence <220> <223> <400> 14 Met Lys Thr Leu Pro Val Leu Val Leu Ser Leu Thr Leu Leu Thr Val 5 10 15 Phe Ser Glu Thr Ser Pro Ile Leu Thr Glu Lys Gln Ala Lys Gln Leu 20 25 30 Leu Arg Ser Arg Arg Gln Asp Arg Pro Ser Lys Pro Gly Phe Pro Asp 35 40 45 Glu Pro Met Arg Glu Tyr Met His His Leu Leu Ala Leu Glu His Arg 50 55 60 Ala Glu Glu Gln Phe Leu Glu His Trp Leu Asn Pro His Cys Lys Pro 65 70 75 80 His Cys Asp Arg Asn Arg Ile His Pro Val Val Asp Tyr Lys Asp Asp 85 90 95 Asp Asp Lys 99 <210> 15 <211> 297 <212> DNA <213> Artificial Sequence <220> <223> DNA fragment encoding DRL90h-FLAG fused pro tein <400> 15 atgaagacat tgcctgtgct cgtgctgtct cttaccttac tgactgtctt ctcagagacc 60 tccccgattt tgacagagaa gcaggccaaa cagctcctaa gatctcggcg acaggataga 120 ccaagcaaac ccggattccc cgatgagcca atgcgggaat acatgcacca cctgctcgcc 180 ctggagcatc gcgctgagga gcagttcctg gagcactggc tgaaccctca ctgcaaaccc 240 cactgtgaca ggaacaggat tcatcctgtg gtcgactaca aggacgacga tgacaag 297 <210> 16 <211> 43 <212 > DNA <213> Artificial Sequence <220> <223> Primer <400> 16 tcctggtcga cttacacagg atgaatcctg ttcctgtcac agt 43 <210> 17 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Peptide CPP1 -1 <400> 17 Gln Asp Arg Pro Ser Lys Pro Gly Phe Pro Cys 1 5 10 <210> 18 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Peptide CPP1-2 <400 > 18 Cys Ser Pro Ile Leu Thr Glu Lys Gln Ala Lys 1 5 10 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 ggtcctgatc cccttacac 19 <210> 20 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 aggagaattc caccat ggag aagctgttt 29 <210> 21 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 21 ccccagtcga ctcacacagg atggacaa 28 <210> 22 <211> 90 <212> PRT <213> Mouse <400> 22 Met Glu Lys Leu Phe Val Leu Val Phe Ala Leu Ala Leu Leu Ala Phe 5 10 15 Ser Ser Asp Ala Ser Pro Ile Leu Thr Glu Lys Gln Ala Lys Gln Leu 20 25 30 Leu Arg Ser Arg Arg Gln Asp Arg Pro Asn Lys Pro Gly Phe Pro Asp 35 40 45 Glu Pro Met Arg Glu Tyr Met His His Leu Leu Ala Leu Glu His Arg 50 55 60 Ala Glu Glu Gln Phe Leu Glu His Trp Leu Asn Pro His Cys Lys Pro 65 70 75 80 His Cys Asp Arg Asn Ile Val His Pro Val 85 90 <210> 23 <211> 270 <212> DNA <213> Mouse <400> 23 atggagaagc tgtttgtctt ggtctttgct ctcgccctgc tggctttctc ctcagatgcc 60 tccccgattc tgacagaaaa gcaggcaaaa cagctcctga ggtccaggcg acaggacagg 120 cccaacaaac ctggattccc ggacgagccc atgcgggagt atatgcatca tctcctggcc 180 ctggagcacc gtgctgagga gcagtttctg gagcactggc tgaatcctca ctgcaagccg 240 cactgtgaca ggaacattgt ccatcctgtg 270

[Brief description of the drawings]

Figure 1: Northern blot performed for analysis of expression tissues
The result of ing is shown. In the figure, PBL indicates peripheral leukocytes.

FIG. 2 shows the results of dot blotting performed for analysis of expression tissues. In the figure, A1 is the brain, B1 is the cerebral cortex, C1 is the frontal lobe, D1 is the parietal lobe, E1 is the occipital lobe, F1 is the temporal lobe,
G1 is cerebral cortex, H1 is pons, A2 is left / cerebellum, B2 is right / cerebellum, C2 is corpus callosum, D2 is tonsillar, E2 is caudate nucleus, F
2 is hippocampus, G2 is medullary, H2 is putamen, A3 is substantia nigra, B3
Is septum lateral, C3 is thalamus, D3 is pituitary, E3 is spinal cord, A4 is heart, B4 is aorta, C4 is left atrium, D4 is right atrium, E4 is left ventricle, F4 is right ventricle, G4 is Interventricular septum, H4 is the tip of the heart, A5 is the esophagus, B5 is the stomach, C5 is the duodenum, D5 is the jejunum, E5 is the ileum, F5 is the ileum, G
5 is appendix, H5 is ascending colon, A6 is transverse colon, B6 is descending colon, C6 is rectum, A7 is kidney, B7 is skeletal muscle, C7
Is spleen, D7 is thymus, E7 is peripheral blood leukocytes, F7 is lymph node, G7 is bone marrow, H7 is trachea, A8 is lung, B8 is placenta, C8 is bladder, D8 is uterus, E8 is prostate, F8 is testis, G8 is ovary, A9 is liver, B9 is pancreas, C9 is adrenal gland, D9 is thyroid, E9 is salivary gland, F9 is mammary gland, A10
Is leukemia HL-60 cell, B10 is HeLa cell, C1
0 is leukemia K-562 cell, D10 is leukemia MOLT-
4 cells, E10 are Burkitt's lymphoma Raji cells, F
10 is a Burkitt's lymphoma Dauji cell, G10 is an adenocarcinoma AW480 cell, H10 is a lung cancer A549 cell, A11
Is fetal brain, B11 is fetal heart, C11 is fetal kidney, D1
1 is fetal liver, E11 is fetal spleen, F11 is fetal thymus,
G11 is fetal lung, A12 is total yeast RNA, B12
Is yeast total RNA, C12 is Escherichia coli ribosomal R
NA and D12 are E. coli DNA, G12 is human DNA, H
12 indicates human DNA.

FIG. 3 Western blotti performed for analysis of expression products
ng results are shown.

FIG. 4 shows a schematic diagram of an expression product.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 39/395 A61K 48/00 4C085 45/00 A61P 1/00 4C086 48/00 5/00 4H045 A61P 1 / 00 9/00 5/00 15/08 9/00 31/00 15/08 35/00 31/00 37/00 35/00 43/00 105 37/00 C07K 14/47 43/00 105 16/18 C07K 14/47 C12N 1/15 16/18 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 G01N 33/15 Z 5/10 33/50 Z C12P 21/02 C12N 15 / 00ZNAA G01N 33/15 5/00 A 33/50 A61K 37/02 (72) Inventor Kazuhiro Ogi 2-16-1 Umezono, Tsukuba-shi, Ibaraki Lun Vini Umezono 206 F-term (reference) 2G045 AA40 DA12 DA13 DA36 FB03 FB07 4B024 AA11 BA80 CA04 CA12 DA02 HA17 4B064 AG01 BA12 CA19 CE06 CE12 DA01 4B065 AA90X AA91X AA94Y AB01 CA24 CA44 4C084 AA02 AA07 AA13 AA17 BA01 BA08 BA20 CA17 NA14 ZA36 ZA66 ZB02 ZB05 ZB21 ZB31 ZB35 4C085 AA13 AA14 BB11 CC21 CC23 CC32. AA11 AA20 BA10 CA40 DA75 EA20 FA74

Claims (68)

[Claims] 1. A polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4, a amide thereof, an ester thereof, or a salt thereof. 2. The method according to claim 1, which comprises the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 2, or SEQ ID NO: 14.
Or the amide or ester thereof or the salt thereof. 3. A peptide having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8, a amide thereof, an ester thereof, or a salt thereof. 4. The peptide according to claim 3, which comprises the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 8, or an amide or ester thereof or a salt thereof. 5. A polypeptide according to claim 1, or a partial peptide of the peptide according to claim 3, or an amide or ester thereof or a salt thereof. 6. A polynucleotide comprising a polynucleotide having a nucleotide sequence encoding the polypeptide according to claim 1. 7. The polynucleotide according to claim 6, comprising a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 15. 8. The polynucleotide according to claim 6, which is DNA. A polynucleotide comprising a polynucleotide having a nucleotide sequence encoding the peptide according to claim 3. 10. The polynucleotide according to claim 9, which comprises a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 7 or SEQ ID NO: 9. 11. The polynucleotide according to claim 9 or 10, which is DNA. 12. A recombinant vector comprising the polynucleotide according to claim 6 or 9. 13. A transformant transformed with the recombinant vector according to claim 12. 14. The polypeptide according to claim 1, wherein the transformant according to claim 13 is cultured to produce and accumulate the polypeptide according to claim 1 or the peptide according to claim 3. The method for producing an amide or an ester or a salt thereof, or the peptide according to claim 3, or an amide or an ester thereof or a salt thereof. 15. The polypeptide according to claim 1 or an amide or ester thereof or a salt thereof, the peptide of claim 3 or an amide or ester thereof or a salt thereof, or the partial peptide of claim 5 or an amide thereof or An antibody against the ester or a salt thereof. 16. The polypeptide according to claim 1, or an amide or ester thereof, or a salt thereof, the peptide of claim 3, or an amide or ester thereof, or a salt thereof, the partial peptide of claim 5, or an amide thereof, or a salt thereof. The polypeptide according to claim 1, or an amide or ester thereof or a salt thereof, the peptide according to claim 3, an amide or ester thereof or a salt thereof, or an ester or a salt thereof. A method for screening for a compound or a salt thereof that promotes or inhibits the activity of the partial peptide or amide or ester thereof or a salt thereof. 17. The polypeptide according to claim 1 or an amide or ester thereof or a salt thereof, the peptide of claim 3 or an amide or ester thereof or a salt thereof, or the partial peptide of claim 5 or an amide thereof or The polypeptide according to claim 1, which comprises an ester or a salt thereof, an amide thereof or an ester or a salt thereof, a peptide according to claim 3, or an amide or an ester thereof or a salt thereof, the portion according to claim 5. A kit for screening a compound or a salt thereof which promotes or inhibits the activity of the peptide or its amide or its ester or its salt. 18. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17, an amide thereof, an ester thereof, or a salt thereof.
A compound or salt thereof which promotes or inhibits the activity of the peptide or amide or ester thereof or salt thereof according to claim 5, or the partial peptide or amide or ester thereof or salt thereof according to claim 5. (19) a medicament comprising the compound according to (18) or a salt thereof; 20. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17, or an amide or ester thereof or a salt thereof.
A cancer comprising a peptide or an amide or an ester thereof or a salt thereof according to claim 5, or a compound or a salt thereof which promotes the activity of the partial peptide or an amide or ester thereof or a salt thereof according to claim 5.
A preventive or therapeutic agent for immune diseases, infectious diseases, gastrointestinal diseases, cardiovascular diseases or endocrine diseases. 21. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17, amide or ester thereof, or salt thereof.
Prevention and treatment of infertility comprising a peptide or an amide or ester thereof or a salt thereof according to claim 5, or a compound or a salt thereof which promotes the activity of the partial peptide or amide or ester or salt thereof according to claim 5. Agent. 22. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17, amide or ester thereof, or salt thereof.
A differentiation or function of a germ cell comprising the peptide or the amide or ester thereof or the salt thereof according to claim 5, or the compound or the salt thereof which promotes the activity of the partial peptide or the amide or ester thereof or the salt thereof according to claim 5. Regulator. 23. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17, or an amide or ester thereof, or a salt thereof.
Differentiation / proliferation of blood cells comprising a peptide or an amide or ester thereof or a salt thereof according to claim 5, or a compound or a salt thereof which promotes the activity of the partial peptide or amide or ester or salt thereof according to claim 5. Regulator. 24. A medicament comprising the polypeptide according to claim 1 or an amide or ester thereof or a salt thereof, or a pharmaceutical comprising the peptide of claim 3 or an amide or ester thereof or a salt thereof. 25. Cancer, immune disease, infectious disease, gastrointestinal disease,
The medicament according to claim 24, which is an agent for preventing or treating cardiovascular diseases or endocrine diseases. 26. The method according to claim 2, which is an agent for preventing or treating infertility.
4. The medicament according to 4. 27. The medicament according to claim 24, which is an agent for regulating germ cell differentiation / function. 28. The medicament according to claim 24, which is a regulator of blood cell differentiation / proliferation. (29) a pharmaceutical comprising the polynucleotide according to (6) or (9); 30. Cancer, immune disease, infectious disease, gastrointestinal disease,
The medicament according to claim 29, which is a prophylactic / therapeutic agent for a cardiovascular disease or an endocrine disease. 31. The method according to claim 2, which is an agent for preventing or treating infertility.
9. The medicament according to 9. 32. The medicament according to claim 29, which is an agent for regulating germ cell differentiation / function. 33. The medicament according to claim 29, which is a regulator of blood cell differentiation / proliferation. 34. A diagnostic agent comprising the antibody according to claim 15. A pharmaceutical comprising the antibody according to claim 15. 36. A polynucleotide having a base sequence complementary to or substantially complementary to a DNA encoding the polypeptide according to claim 1 or the peptide according to claim 3, or a part thereof, and suppressing expression of the DNA. Antisense D having an effect
NA. 37. The antisense DNA according to claim 36.
A medicament comprising: 38. A dimer of a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4, or an amide or ester thereof or a salt thereof. 39. A dimer in which C-terminal cysteine residues of a polypeptide containing the amino acid sequence represented by SEQ ID NO: 4 are linked to each other, an amide thereof, an ester thereof, or a salt thereof. 40. A dimer of a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 6, or an amide or ester thereof or a salt thereof. 41. A dimer in which C-terminal cysteine residues of a peptide containing the amino acid sequence represented by SEQ ID NO: 6 are linked to each other, an amide thereof, an ester thereof, or a salt thereof. 42. An amino acid identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 6 with a polypeptide containing the same or substantially identical amino acid sequence represented by SEQ ID NO: 4 A dimer with a peptide containing a sequence or an amide or ester thereof or a salt thereof. 43. A dimer in which C-terminal cysteine residues of a polypeptide having the amino acid sequence represented by SEQ ID NO: 4 and a peptide having the amino acid sequence represented by SEQ ID NO: 6 are linked to each other. Or its amide or its ester substance or its salt. 44. An effective amount of a polypeptide according to claim 1 or an amide or ester thereof or a salt thereof, or an effective amount of the peptide according to claim 3 or an amide or ester thereof or a salt thereof, to a mammal. A method for preventing or treating cancer, an immune disease, an infectious disease, a gastrointestinal tract disease, a cardiovascular disease, or an endocrine disease, which is characterized in that 45. An effective amount of the polypeptide according to claim 1 or an amide or ester thereof or a salt thereof, or the peptide according to claim 3 or an amide or ester thereof or a salt thereof to a mammal. A method for preventing or treating infertility, characterized in that: 46. An effective amount of the polypeptide according to claim 1 or an amide or ester thereof or a salt thereof, or an effective amount of the peptide according to claim 3 or an amide or ester thereof or a salt thereof, to a mammal. A method for regulating germ cell differentiation / function. 47. An effective amount of the polypeptide according to claim 1 or an amide or ester thereof or a salt thereof, or the peptide according to claim 3 or an amide or ester thereof or a salt thereof to a mammal. Method for regulating differentiation and proliferation of blood cells 48. A cancer, an immune disease, an infectious disease, a gastrointestinal disease, a cardiovascular disease or an endocrine, which comprises administering an effective amount of the polynucleotide according to claim 6 or 9 to a mammal. Disease prevention and treatment methods. 49. A method for preventing or treating infertility, which comprises administering an effective amount of the polynucleotide according to claim 6 or 9 to a mammal. 50. A method for regulating germ cell differentiation / function, which comprises administering an effective amount of the polynucleotide according to claim 6 or 9 to a mammal. 51. A method for regulating germ cell blood cell differentiation / proliferation, which comprises administering an effective amount of the polynucleotide according to claim 6 or 9 to a mammal. 52. The polypeptide according to claim 1, which can be obtained from a mammal using the screening method according to claim 16 or the screening kit according to claim 17, or an amide or ester thereof or a salt thereof. Administering an effective amount of the peptide of claim 3 or its amide or its ester or its salt, or the compound or its salt that promotes the activity of the partial peptide or its amide or its ester or its salt of claim 5. A method for preventing or treating cancer, immunological disease, infectious disease, gastrointestinal tract disease, cardiovascular disease or endocrine disease, characterized by the following. 53. The polypeptide according to claim 1, or an amide or ester thereof or a salt thereof, which can be obtained from a mammal using the screening method according to claim 16 or the screening kit according to claim 17. Administering an effective amount of the peptide of claim 3 or its amide or its ester or its salt, or the compound or its salt that promotes the activity of the partial peptide or its amide or its ester or its salt of claim 5. A method for preventing and treating infertility characterized by the following. 54. The polypeptide according to claim 1, which can be obtained from a mammal using the screening method according to claim 16 or the screening kit according to claim 17, or an amide or ester thereof or a salt thereof. Administering an effective amount of the peptide of claim 3 or its amide or its ester or its salt, or the compound or its salt that promotes the activity of the partial peptide or its amide or its ester or its salt of claim 5. Germ cell differentiation characterized by
Function adjustment method. 55. The polypeptide according to claim 1, which can be obtained from a mammal using the screening method according to claim 16 or the screening kit according to claim 17, or an amide or ester thereof or a salt thereof. Administering an effective amount of the peptide of claim 3 or its amide or its ester or its salt, or the compound or its salt that promotes the activity of the partial peptide or its amide or its ester or its salt of claim 5. Differentiation of blood cells characterized by
Growth control method. 56. A cancer, an immune disease, an infectious disease, a gastrointestinal tract disease,
The polypeptide of claim 1 or an amide or ester thereof or a salt thereof, or the peptide of claim 3 or an amide or ester thereof or a salt thereof for producing a prophylactic / therapeutic agent for a cardiovascular disease or an endocrine disease. use. 57. A cancer, an immune disease, an infectious disease, a gastrointestinal tract disease,
Use of the polynucleotide according to claim 6 or 9 for producing a prophylactic / therapeutic agent for a cardiovascular disease or an endocrine disease. 58. Use of the polynucleotide according to claim 6 or 9 for producing an agent for preventing or treating infertility. 59. Use of the polynucleotide according to claim 6 or 9 for producing an agent for regulating germ cell differentiation / function. 60. Use of the polynucleotide according to claim 6 or 9 for producing an agent for regulating blood cell differentiation / proliferation. 61. A cancer, an immune disease, an infectious disease, a gastrointestinal tract disease,
The polypeptide or amide thereof according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17 for producing a prophylactic / therapeutic agent for a cardiovascular disease or an endocrine disease. Or an ester or a salt thereof, a peptide or an amide or an ester or a salt thereof according to claim 3, or a compound or a salt thereof that promotes the activity of the partial peptide or an amide or an ester or a salt thereof according to claim 5. use. 62. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17 for producing an agent for preventing or treating infertility. An amide or an ester thereof or a salt thereof, the peptide according to claim 3, an amide or an ester thereof or a salt thereof, or a compound or a salt thereof which promotes the activity of the partial peptide or an amide or an ester thereof or the salt thereof Use of. 63. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17 for producing an agent for regulating germ cell differentiation / function. A compound which promotes the activity of the amide or its ester or its salt, the peptide of claim 3, its amide or its ester or its salt, or the partial peptide of claim 5 or its amide or its ester or its salt, Use of salt. 64. The polypeptide according to claim 1, which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17 for producing an agent for regulating blood cell differentiation / proliferation. A compound which promotes the activity of the amide or its ester or its salt, the peptide of claim 3, its amide or its ester or its salt, or the partial peptide of claim 5 or its amide or its ester or its salt, Use of salt. 65. A non-human transgenic animal having the exogenous DNA of claim 7 or 10 or a mutant DNA thereof. 66. The animal of claim 65, wherein the non-human animal is a rodent. 67. The animal according to claim 66, wherein the rodent is a mouse or a rat. 68. A recombinant vector containing the exogenous DNA according to claim 7 or 10 or a mutant DNA thereof and capable of being expressed in a non-human animal.