JP2002345482A - New g protein-coupled receptor protein and dna thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To search for a new G protein-coupled receptor protein and to elucidate its function. SOLUTION: The new G protein-coupled receptor protein contains an amino acid sequence which is the same or substantially the same as an amino acid sequence represented by a specific human-derived sequence (refer to the specification) or its salt. A polynucleotide encoding the G protein-coupled receptor protein or its salt is obtained. The G protein-coupled receptor protein or its salt and the polynucleotide are used for medicines, or the like.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel G protein-coupled receptor protein derived from human spleen or a salt thereof, and a DNA encoding the same.

[0002]

2. Description of the Related Art Many physiologically active substances such as hormones and neurotransmitters regulate the functions of living organisms through specific receptor proteins present on cell membranes. Many of these receptor proteins are conjugated guanine nucleo
Intracellular signal transduction is performed through the activation of tide-binding protein (hereinafter sometimes abbreviated as G protein), and has a common structure having seven transmembrane regions. It is collectively called a receptor protein or a seven-transmembrane receptor protein (7TMR). G protein-coupled receptor proteins are present on the surface of various functional cells in living cells and organs, and are physiologically targeted as molecules that regulate the functions of those cells and organs, such as hormones, neurotransmitters and bioactive substances. Plays an important role. The receptor transmits a signal into a cell through binding to a physiologically active substance, and this signal causes various reactions such as activation and suppression of the cell. To clarify the relationship between substances that regulate complex functions in cells and organs of various organisms and their specific receptor proteins, especially G protein-coupled receptor proteins, it is necessary to clarify the functions of cells and organs in various organisms. And provide a very important means for drug development closely related to their functions.

For example, in various organs of a living body, physiological functions are regulated under the regulation by many hormones, hormone-like substances, neurotransmitters or physiologically active substances. In particular, physiologically active substances exist at various sites in a living body, and regulate their physiological functions through their corresponding receptor proteins. There are still many unknown hormones, neurotransmitters, and other physiologically active substances in living organisms, and the structures of their receptor proteins have not yet been reported. Furthermore, it is often unknown whether subtypes exist in known receptor proteins. Clarifying the relationship between a substance that regulates a complex function in a living body and its specific receptor protein is a very important means for drug development. In addition, in order to efficiently screen for agonists and antagonists for receptor proteins and to develop pharmaceuticals, it is necessary to elucidate the functions of receptor protein genes expressed in vivo and to express them in an appropriate expression system. Was needed. In recent years, as a means for analyzing genes expressed in vivo, cD
Research on the random analysis of NA sequences has been actively conducted.
It is registered and published as an Expressed Sequence Tag (EST) in a database. However, many ESTs have only sequence information, and it is difficult to estimate their functions.

[0004]

Heretofore, substances that inhibit the binding between a G protein-coupled receptor and a physiologically active substance (ie, a ligand), and signal transmission that binds to the same as a physiologically active substance (ie, a ligand) Have been utilized as specific antagonists or agonists of these receptors as pharmaceuticals that regulate biological functions. Therefore, it is important to newly discover a G protein-coupled receptor protein which is not only important in physiological expression in vivo but also a target of drug development and to clone its gene (eg, cDNA). This is a very important means for finding specific ligands, agonists and antagonists of G protein-coupled receptor proteins. However, not all G protein-coupled receptors have been found.
Even at present, there are a number of so-called orphan receptors for which unknown G protein-coupled receptors and corresponding ligands have not been identified, and there is a keen need to search for new G protein-coupled receptors and elucidate their functions. . The G protein-coupled receptor is useful for searching for a new physiologically active substance (that is, a ligand) and for searching for an agonist or antagonist for the receptor, using the signal transduction action as an index. On the other hand, even if a physiological ligand is not found, it is also possible to prepare an agonist or antagonist for the receptor by analyzing the physiological action of the receptor from an inactivation experiment (knockout animal) of the receptor. . These ligands, agonists or antagonists to the receptor can be expected to be used as preventive / therapeutic or diagnostic agents for diseases associated with dysfunction of G protein-coupled receptors. Furthermore, a decrease or increase in the function of a G protein-coupled receptor in a living body based on a gene mutation thereof often causes some disease. In this case, the present invention is applied not only to administration of an antagonist or agonist to the receptor, but also to gene therapy by introducing the receptor gene into a living body (or a specific organ) or by introducing an antisense nucleic acid to the receptor gene. You can also. In this case, the nucleotide sequence of the receptor is indispensable information for examining the presence or absence of a deletion or mutation in the gene. And diagnostics. The present invention provides a novel and useful G protein-coupled receptor protein as described above. That is, a novel G protein-coupled receptor protein or a partial peptide thereof or a salt thereof, a polynucleotide (DNA, RNA and a derivative thereof) encoding the G protein-coupled receptor protein or a partial peptide thereof (DNA, RNA and derivatives thereof), a recombinant vector containing the polynucleotide, a transformant carrying the recombinant vector, the G
A method for producing a protein-coupled receptor protein or a salt thereof,
An antibody against the G protein-coupled receptor protein or a partial peptide thereof or a salt thereof; a compound that changes the expression level of the G protein-coupled receptor protein; a method for determining a ligand for the G protein-coupled receptor; For screening for compounds (antagonists, agonists) or salts thereof that alter the binding to type G receptor proteins, ligands obtainable by using the screening kits, screening methods or screening kits, and G protein-coupled receptor proteins (Antagonists, agonists) or their salts, and compounds (antagonists, agonists) or G-protein-coupled compounds that change the binding between ligands and the G protein-coupled receptor proteins Scepter protein compound alters the expression level of or provides such pharmaceutical agent comprising a salt thereof.

[0005]

Means for Solving the Problems As a result of intensive studies, the present inventors have isolated a cDNA encoding a novel G protein-coupled receptor protein derived from human spleen, and analyzed the entire nucleotide sequence thereof. succeeded in. Then, when this base sequence was translated into an amino acid sequence, the first to seventh transmembrane regions were confirmed on the hydrophobicity plot, and these cDNs were identified.
It was confirmed that the protein encoded by A was a seven-transmembrane G protein-coupled receptor protein. The present inventors have further studied based on these findings, and as a result, have completed the present invention.

That is, the present invention relates to (1) SEQ ID NO: 1.
A G protein-coupled receptor protein or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by: (2) SEQ ID NO:
The G protein-coupled receptor protein according to claim 1, which comprises the amino acid sequence represented by 1. (3) a partial peptide of the G protein-coupled receptor protein described in the above (1) or a salt thereof; (4) a poly-polynucleotide comprising a polynucleotide having a base sequence encoding the G protein-coupled receptor protein described in the above (1). (5) a polynucleotide according to the above (4), which is a DNA; (6) a polynucleotide according to the above (4) having a base sequence represented by SEQ ID NO: 2, (7) a polynucleotide according to the above (4) A recombinant vector containing a polynucleotide, (8) a transformant transformed with the recombinant vector according to the above (7), (9)
The transformant according to (8) is cultured to produce the G protein-coupled receptor protein according to (1), wherein the G protein-coupled receptor protein according to (1) or a salt thereof is produced. (10) an antibody against the G protein-coupled receptor protein according to (1) or the partial peptide according to (3) or a salt thereof;
(11) The antibody according to (10), which is a neutralizing antibody that inactivates the signal transduction of the G protein-coupled receptor protein according to (1), and (12) the antibody according to (10). (13) The G protein-coupled receptor protein according to (1), which can be obtained by using the G protein-coupled receptor protein according to (1) or the partial peptide according to (3) or a salt thereof. Or a salt thereof, (14) a medicament comprising the G protein-coupled receptor ligand of (13), (15) a G protein-coupled receptor protein of (1) or (3). (1) A method for determining a ligand for a G protein-coupled receptor protein or a salt thereof according to the above (1), wherein a partial peptide or a salt thereof is used. (16) a ligand comprising using the G protein-coupled receptor protein according to (1) or the partial peptide according to (3) or a salt thereof, and a G protein-coupled receptor protein according to (1) or A method for screening a compound that changes the binding property to a salt thereof or a salt thereof, (17) comprising the G protein-coupled receptor protein described in the above (1), the partial peptide described in the above (3), or a salt thereof. (18) a screening kit for a compound or a salt thereof that alters the binding property of the ligand to the G protein-coupled receptor protein or a salt thereof according to the above (1), (18) a screening method according to the above (16), or )
A compound or a salt thereof that alters the binding property between the ligand obtainable by using the screening kit according to the above and the G protein-coupled receptor protein or the salt thereof according to the above (1), (19) the screening according to the above (16) A compound which changes the binding property between the ligand obtainable by the method or the screening kit according to (17) and the G protein-coupled receptor protein or salt thereof according to (1), or a salt thereof. Medicine, (20)
A polynucleotide that hybridizes with the polynucleotide according to the above (4) under conditions of high stringency,
(21) A polynucleotide comprising a nucleotide sequence complementary to the polynucleotide described in (4) or a part thereof, and (22) a polynucleotide comprising the polynucleotide described in (4) or a part thereof. G described in (1) above
Method for quantifying mRNA of protein-coupled receptor protein,
(23) The method for quantifying a G protein-coupled receptor protein according to (1), wherein the antibody according to (10) is used, (24) the method according to (22) or (23).
The diagnostic agent for a disease associated with the function of the G protein-coupled receptor according to the above (1), wherein the quantification method according to the above (22) is used. (1) a method for screening a compound or a salt thereof that changes the expression level of a G protein-coupled receptor protein according to (1); (26) a method according to (1) in a cell membrane, wherein the method according to (23) is used; A method for screening a compound or a salt thereof that alters the amount of the G protein-coupled receptor protein described in (2);
7) a compound or a salt thereof that alters the expression level of the G protein-coupled receptor protein according to (1), which can be obtained by using the screening method according to (25);
8) A compound or a salt thereof that alters the amount of the G protein-coupled receptor protein of the above (1) in a cell membrane obtainable by using the screening method of the above (26), or (29) the screening method of the above (25). A pharmaceutical comprising a compound or a salt thereof that alters the expression level of the G protein-coupled receptor protein according to the above (1), which can be obtained by using the method described in (26). A pharmaceutical comprising a compound or a salt thereof that alters the amount of the G protein-coupled receptor protein according to the above (1) in a cell membrane which can be obtained;
1) The medicament according to the above (19), (29) or (30), which is an agent for preventing or treating central diseases, inflammatory diseases, cardiovascular diseases, cancer, metabolic diseases, immune system diseases or digestive system diseases.
(32) A ligand obtainable by using the screening method according to (16) or the screening kit according to (17) and a G protein-coupled receptor protein or salt thereof according to (1) for a mammal. Central disease, inflammatory disease, circulatory disease, cancer, metabolic disease, immune system disease or digestive system disease characterized by administering an effective amount of a compound or a salt thereof that changes the binding to (33) The method described in (2) above for mammals.
5) Central disease, inflammatory disease characterized by administering an effective amount of a compound or a salt thereof that alters the expression level of the G protein-coupled receptor protein according to (1), which can be obtained by using the screening method according to (1). Diseases, cardiovascular diseases,
(34) a method for preventing or treating cancer, a metabolic disease, an immune system disease or a digestive system disease,
A central disease, an inflammatory disease, or a central inflammatory disease, comprising administering an effective amount of the compound or a salt thereof, which alters the amount of the G protein-coupled receptor protein described in (1) above in a cell membrane obtainable by the screening method described above; (35) Central disease, inflammatory disease, circulatory disease, cancer, metabolic disease, immune system disease, or digestive system; (35) cardiovascular disease, cancer, metabolic disease, immune system disease, or digestive system disease A ligand obtainable by using the screening method according to (16) or the screening kit according to (17) for producing a prophylactic / therapeutic agent for a systemic disease and the G protein-coupled receptor protein according to (1) Or use of a compound or a salt thereof that alters the binding to a salt thereof, (36) central disease, inflammatory disease, cardiovascular disease, cancer,
Expression of the G protein-coupled receptor protein according to (1), which can be obtained by using the screening method according to (25) for producing a prophylactic / therapeutic agent for a metabolic disease, an immune system disease, or a digestive system disease. Use of a compound or a salt thereof that changes the amount, (37) The above-mentioned method for producing a preventive / therapeutic agent for a central disease, an inflammatory disease, a cardiovascular disease, a cancer, a metabolic disease, an immune system disease or a digestive system disease. The present invention also relates to the use of a compound or a salt thereof that alters the G protein-coupled receptor protein of (1) in a cell membrane obtainable by using the screening method of (26).

[0007] Furthermore, (38) the amino acid sequence represented by SEQ ID NO: 1 or one or more (preferably about 1 to 30, more preferably 1) in the amino acid sequence represented by SEQ ID NO: 1; Is an amino acid sequence in which about 1 to 9, more preferably several (1 to 5) amino acids have been deleted, and one or more (preferably 1 to 30) in the amino acid sequence represented by SEQ ID NO: 1. Amino acid sequence to which about 1, more preferably about 1 to 10, and still more preferably several (1 to 5) amino acids have been added, and one or two or more (preferably Is about 1 to 30, more preferably about 1 to 10, and still more preferably several (1 to 5
G) protein-coupled receptor protein or a salt thereof according to the above (1), which is a protein containing an amino acid sequence in which the amino acid of (1) is replaced with another amino acid, or an amino acid sequence obtained by combining them. (14) The method according to (14), wherein the test compound is brought into contact with the G protein-coupled receptor protein or the salt thereof according to 1) or the partial peptide or the salt thereof according to (2).
The method for determining a ligand according to (40), wherein the ligand is, for example, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (eg, PACAP)
27, PACAP38), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, G
HRH, CRF, ACTH, GRP, PTH, VIP
(Vasoactive intestinal polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene-related peptide), leukotriene, pancreastatin, prostaglandin, thromboxane, adenosine, adrenaline, chemokine superfamily ( Example, IL-8, GROα, GROβ, GROγ, NA
P-2, ENA-78, GCP-2, PF4, IP-1
0, Mig, CXC chemokine subfamily such as PBSF / SDF-1; MCAF / MCP-1, MCP-
2, MCP-3, MCP-4, eotaxin, RAN
TES, MIP-1α, MIP-1β, HCC-1, M
IP-3α / LARC, MIP-3β / ELC, I-3
09, TARC, MIPF-1, MIPF-2 / eot
axin-2, MDC, DC-CK1 / PARC, SL
C chemokine subfamily such as C; lympho
C chemokine subfamily such as tactin; fr
(39), which is CX3C chemokine subfamily such as actalkine, endothelin, enterogastrine, histamine, neurotensin, TRH, pancreatic polypeptide, galanin, lysophosphatidic acid (LPA) or sphingosine 1-phosphate. How to determine the ligand,

(41) (i) contacting a G protein-coupled receptor protein or a salt thereof described in (1) or a partial peptide or a salt thereof described in (3) with a ligand; and (ii) A comparison is made between the case where the G protein-coupled receptor protein or the salt thereof according to the above (1) or the partial peptide or the salt thereof according to the above (3) is brought into contact with a ligand and a test compound. (16) the screening method described in (16), (42) (i) when the labeled ligand is brought into contact with the G protein-coupled receptor protein described in (1) or a salt thereof or the partial peptide described in (3) or a salt thereof. And (ii) labeling the labeled ligand and test compound with the G protein-coupled receptor protein described in (1) or a salt thereof, or (3) Binding of the labeled ligand to the G protein-coupled receptor protein or the salt thereof described in (1) above or the partial peptide or the salt thereof described in (3) above when brought into contact with the partial peptide or the salt thereof described in (3). (43) a method for screening a compound or a salt thereof that alters the binding property between the ligand and the G protein-coupled receptor protein or the salt thereof according to (1) above, wherein the amount is measured and compared;
(I) the case where the labeled ligand is brought into contact with the cells containing the G protein-coupled receptor protein described in the above (1); and (ii) the labeled ligand and the test compound are brought into contact with the G protein-coupled receptor protein described in the above (1). A ligand characterized by measuring and comparing the amount of a labeled ligand bound to a cell containing the receptor protein when the cell is brought into contact with the cell, and comparing the ligand with the G protein-coupled receptor protein or a salt thereof according to the above (1). (44) (i) when a labeled ligand is brought into contact with the membrane fraction of a cell containing the G protein-coupled receptor protein described in (1) above, And (ii) contacting the labeled ligand and the test compound with the membrane fraction of a cell containing the G protein-coupled receptor protein described in (1) above. In which the amount of the labeled ligand bound to the membrane fraction of the cell is measured and compared, and the binding between the ligand and the G protein-coupled receptor protein or a salt thereof according to (1) above. A method for screening a compound or a salt thereof that changes

(45) (i) contacting the labeled ligand with a G protein-coupled receptor protein expressed on the cell membrane of the transformant by culturing the transformant according to (8); ii) When the labeled ligand and the test compound are brought into contact with a G protein-coupled receptor protein expressed on the cell membrane of the transformant by culturing the transformant according to (8) above, Screening for a compound or a salt thereof that changes the binding between the ligand and the G protein-coupled receptor protein or the salt thereof according to the above (1), wherein the amount of binding to the G protein-coupled receptor protein is measured and compared. Method (46) (i) The above (1)
Contacting a compound that activates the G protein-coupled receptor protein described above or a salt thereof with a cell containing the G protein-coupled receptor protein described in (1) above;
(Ii) when a compound that activates the G protein-coupled receptor protein described in (1) or a salt thereof and a test compound are brought into contact with cells containing the G protein-coupled receptor protein described in (1), A compound that changes the binding property between a ligand and a G protein-coupled receptor protein or a salt thereof according to the above (1), wherein the cell stimulating activity via the G protein-coupled receptor protein is measured and compared. Salt screening method,
(47) G protein conjugate expressed on the cell membrane of the transformant by culturing the transformant according to (8) with a compound that activates the G protein-coupled receptor protein or a salt thereof according to (1). And a compound that activates the G protein-coupled receptor protein or a salt thereof described in (1) above and a test compound, by culturing the transformant described in (8) above. A ligand characterized by measuring and comparing the cell stimulating activity mediated by the G protein-coupled receptor protein when brought into contact with the G protein-coupled receptor protein expressed on the cell membrane of the transformant; A method for screening a compound or a salt thereof that changes the binding property to a G protein-coupled receptor protein or a salt thereof,

(48) The compound that activates the G protein-coupled receptor protein according to (1) is angiotensin, bombesin, cannabinoid, cholecystokinin,
Glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (eg, PACAP27, PACAP3)
8), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, GHRH, CRF, A
CTH, GRP, PTH, VIP (Vasoactive Intestinal polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGR
P (calcitonin gene relayed peptide), leukotriene, pancreastatin, prostaglandin, thromboxane, adenosine, adrenaline, chemokine superfamily (eg, IL-8, GROα,
GROβ, GROγ, NAP-2, ENA-78, GC
P-2, PF4, IP-10, Mig, PBSF / SD
CXC chemokine subfamily such as F-1; MCA
F / MCP-1, MCP-2, MCP-3, MCP-
4, eotaxin, RANTES, MIP-1α, M
IP-1β, HCC-1, MIP-3α / LARC, M
IP-3β / ELC, I-309, TARC, MIPF
-1, MIPF-2 / eotaxin-2, MDC, D
CC chemokine subfamily such as C-CK1 / PARC, SLC; C chemokine subfamily such as lymphotoactin; CX3C chemokine subfamily such as fractalkine etc.), endothelin, enterogastrin, histamine, neurotensin, TRH, pancreatic polypeptide, The screening method according to the above (46) or (47), which is galanin, lysophosphatidic acid (LPA) or sphingosine 1-phosphate, (49) the above (41) to (4)
8) A compound or a salt thereof that alters the binding property between the ligand obtainable by the screening method according to the above and the G protein-coupled receptor protein or a salt thereof according to the above (1);
(50) A compound or a salt thereof that changes the binding property between the ligand obtainable by the screening method according to (41) to (48) and the G protein-coupled receptor protein or salt thereof according to (1). A medicament, characterized in that

(51) The screening kit according to (17), which comprises a cell containing the G protein-coupled receptor protein according to (1).
(52) The screening kit according to (17), which comprises a membrane fraction of a cell containing the G protein-coupled receptor protein according to (1).
3) The above (17), which comprises a G protein-coupled receptor protein expressed on the cell membrane of the transformant by culturing the transformant according to (8).
(54) The above-mentioned (51)
To (53) a compound or a salt thereof that alters the binding property between the ligand and the G protein-coupled receptor protein or a salt thereof according to (1); 51) A compound or a salt thereof, which can be obtained by using the screening kit according to (53), which changes the binding property between the ligand and the G protein-coupled receptor protein or salt thereof according to (1) above. (56) A medicament characterized by contacting the antibody according to (10) with the G protein-coupled receptor protein according to (1) or the partial peptide according to (3) or a salt thereof. (1) a method for quantifying the G protein-coupled receptor protein or the partial peptide or a salt thereof according to (3);
7) The antibody of (10) is competitively reacted with a test solution and a labeled G protein-coupled receptor protein of (1) or a partial peptide of (3) or a salt thereof. Measuring the ratio of the labeled G protein-coupled receptor protein according to (1) or the partial peptide according to (3) or a salt thereof, which is bound to the antibody. The method for quantifying the G protein-coupled receptor protein described in (1) or the partial peptide described in (3) or a salt thereof, and (5)
8) After simultaneously or continuously reacting the test solution with the antibody of (10) insolubilized on the carrier and the labeled antibody of (10) above, the activity of the labeling agent on the insolubilized carrier And a method for quantifying the G protein-coupled receptor protein described in the above (1) or the partial peptide described in the above (3) or a salt thereof in a test solution.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION The G protein-coupled receptor protein of the present invention (hereinafter sometimes abbreviated as receptor protein) is identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 (FIG. 2). Is a receptor protein containing the amino acid sequence of The receptor protein of the present invention includes, for example, mammals (eg, human, guinea pig,
Rats, mice, rabbits, pigs, sheep, cows, monkeys, and any other cells (eg, spleen cells, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells) Cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes) , Megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, hepatocytes or stromal cells, or precursors of these cells, stem cells or cancer cells) and blood cells , Or any tissue in which those cells are present, for example, the brain, each part of the brain (eg, olfactory bulb, squamous nucleus, basal sphere, hippocampus, thalamus, hypothalamus, hypothalamus nucleus, cerebral cortex, medulla, cerebellum, Back of head , Frontal lobe, temporal lobe, putamen,
Caudate nucleus, brain stain, substantia nigra), spinal cord, pituitary, stomach, pancreas, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), Blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate,
It may be a protein derived from testis, testis, ovary, placenta, uterus, bone, joint, skeletal muscle, or the like, or may be a synthetic protein.

The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 is, for example, about 50% or more, preferably about 60% or more, and more preferably the amino acid sequence represented by SEQ ID NO: 1. About 70% or more, more preferably about 80% or more, particularly preferably about 9% or more.
Amino acid sequences having 0% or more, most preferably about 95% or more homology, and the like can be mentioned. SEQ ID NO:
As a protein containing an amino acid sequence substantially identical to the amino acid sequence represented by No. 1, for example, SEQ ID NO: 1
A protein having substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 and having substantially the same activity as the amino acid sequence represented by SEQ ID NO: 1 is preferred. Examples of substantially equivalent activities include, for example, ligand binding activity,
Signal signal transduction and the like. Substantially the same indicates that their activities are the same in nature.
Therefore, activities such as ligand binding activity and signal transduction activity are equivalent (eg, about 0.01 to 100 times, preferably about 0.5 to 20 times, more preferably about 0.5 to 2 times).
Fold), but the quantitative factors such as the degree of these activities and the molecular weight of the protein may be different. The activity such as the ligand binding activity and the signal information transduction can be measured according to a known method. For example, the activity can be measured according to a ligand determination method or a screening method described later.

[0014] The receptor protein of the present invention may be one or more (preferably about 1 to 30, more preferably about 1 to 10, more preferably about 1 or more) in the amino acid sequence represented by SEQ ID NO: 1. Are several (1-5
1) or two or more (preferably about 1 to 30, more preferably 1 to 1)
About 0, more preferably several (1 to 5) amino acids added, 1 or 2 or more (preferably, in the amino acid sequence represented by SEQ ID NO: 1)
It contains an amino acid sequence in which about 1 to 30, more preferably about 1 to 10, and still more preferably several (1 to 5) amino acids have been substituted with another amino acid, or an amino acid sequence obtained by combining them. Proteins and the like are also used.

[0015] In the receptor protein in the present specification, the left end is the N-terminus (amino terminus) and the right end is the C-terminus (carboxyl terminus) according to the convention of peptide labeling. SEQ ID NO: including receptor protein containing the amino acid sequence represented by 1, the receptor protein of the present invention, C-terminal, usually a carboxyl group (-COOH) or carboxylate (-COO ^-) is a, C-terminal, May be an amide (—CONH ₂ ) or an ester (—COOR). Here, as R in the ester, for example, a C _1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, for example, a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl, for example, phenyl A C _6-12 aryl group such as α-naphthyl, for example, a phenyl-C _1-2 alkyl group such as benzyl and phenethyl or a C _7- alkyl group such as α-naphthyl-C _1-2 alkyl group such as α-naphthylmethyl. _In addition to ₁₄ aralkyl groups, a pivaloyloxymethyl group commonly used as an oral ester is used. When the receptor protein of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the receptor protein of the present invention. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, the receptor protein of the present invention is the protein mentioned above, an amino group protecting group of the N-terminal methionine residue (e.g., formyl group, C _1-6 acyl group such as C _2-6 alkanoyl group such as acetyl ), A glutamyl group formed by cleavage of the N-terminal side in vivo and pyroglutamine oxidation, a substituent on the side chain of an amino acid in the molecule (eg, -OH, -SH, amino group) , An imidazole group, an indole group, a guanidino group, etc.) protected with a suitable protecting group (eg, a C _1-6 acyl group such as a C _2-6 alkanoyl group such as formyl group and acetyl), or a sugar Complex proteins such as so-called glycoproteins with linked chains are also included. Specific examples of the receptor protein of the present invention include, for example, SEQ ID NO:
A receptor protein containing the amino acid sequence represented by 1 is used.

The partial peptide of the receptor protein of the present invention (hereinafter sometimes abbreviated as a partial peptide) may be any partial peptide of the above-described receptor protein of the present invention. Among the receptor protein molecules of the present invention, those which are exposed outside the cell membrane and have receptor binding activity are used. Specifically, the partial peptide of the receptor protein having the amino acid sequence represented by SEQ ID NO: 1 includes a peptide containing a portion analyzed as an extracellular region (hydrophilic site) in a hydrophobic plot analysis. It is. Hydrophobic (Hydrophobi
c) A peptide partially containing a site can also be used. A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used. The number of amino acids of the partial peptide of the present invention is preferably a peptide having an amino acid sequence of at least 20 or more, preferably 50 or more, more preferably 100 or more of the above-mentioned constituent amino acid sequences of the receptor protein of the present invention. . Substantially the same amino acid sequence means about 50% or more, preferably about 60% or more, more preferably about 70% or more, further preferably about 80% or more, particularly preferably about 90% or more, of these amino acid sequences. , Most preferably about 95% or more homology. Here, “substantially the same activity” has the same meaning as described above. The “substantially equivalent activity” can be measured in the same manner as described above.

Further, the partial peptide of the present invention may comprise one or more (preferably 1 to 10)
About, more preferably several (1 to 5) amino acids are deleted, or one or more (preferably about 1 to 20, more preferably 1 to 2)
About 10 to 10, more preferably several (1 to 5) amino acids are added, or 1 or 2 or more (preferably about 1 to 10 and more preferably several) in the amino acid sequence. , More preferably about 1 to 5 amino acids) may be substituted with another amino acid. In the partial peptide of the present invention, the C-terminus usually has a carboxyl group (-C
OOH) or carboxylate (—COO ⁻ ), but the C-terminal may be amide (—CONH ₂ ) or ester (—COOR) as in the protein of the present invention described above. Further, the partial peptides of the present invention include those in which the amino group of the N-terminal methionine residue is protected with a protecting group,
Pyroglutamine oxidation of Gln produced by cleavage of the end side in vivo, those in which the substituent on the side chain of the amino acid in the molecule is protected with an appropriate protecting group, or so-called glycopeptides to which sugar chains are bound And the like. In the partial peptide of the present invention, the C-terminal usually has a carboxyl group (-COOH) or a carboxylate (-
COO ⁻ ), but the C-terminal may be an amide (—CONH ₂ ) or an ester (—COOR) as in the protein of the present invention described above. Examples of the salt of the receptor protein or its partial peptide of the present invention include a physiologically acceptable salt with an acid or a base, and a physiologically acceptable acid addition salt is particularly preferable. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid,
For example, salts with methanesulfonic acid and benzenesulfonic acid) are used.

The receptor protein of the present invention or a salt thereof can be produced from the above-mentioned mammalian cells or tissues by a known method for purifying a receptor protein. It can also be produced by culturing the containing transformant. Further, the protein can also be produced according to the protein synthesis method described later or according thereto. When produced from mammalian tissues or cells, the homogenized mammalian tissues or cells are extracted with an acid or the like, and the extract is subjected to a combination of chromatography such as reverse phase chromatography and ion exchange chromatography. It can be purified and isolated.

For the synthesis of the receptor protein of the present invention, its partial peptide, its salt or its amide, a commercially available resin for protein synthesis can be used. Such resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin,
PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4-
(2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin, and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target protein according to various known condensation methods. At the end of the reaction, the protein is cleaved from the resin, and at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target protein or an amide thereof. Regarding the condensation of the above protected amino acids, various activating reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. Carbodiimides include DCC, N,
N'-diisopropylcarbodiimide, N-ethyl-
N '-(3-dimethylaminoprolyl) carbodiimide and the like are used. For activation by these, the protected amino acid is directly added to the resin together with a racemization inhibitor additive (for example, HOBt, HOOBt), or the protected amino acid is previously activated as a symmetric acid anhydride or HOBt ester or HOOBt ester. After that, it can be added to the resin.

The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the protein condensation reaction. For example,
Acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, and sulfoxides such as dimethyl sulfoxide. For example, ethers such as pyridine, dioxane, and tetrahydrofuran; nitriles such as acetonitrile and propionitrile; esters such as methyl acetate and ethyl acetate; or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for a protein bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. Activated amino acid derivatives are usually 1.5 to
Used in 4-fold excess. As a result of the test using the ninhydrin reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even by repeating the reaction, unreacted amino acids can be acetylated using acetic anhydride or acetylimidazole.

Examples of the amino-protecting group for the starting material include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used.
The carboxyl group may be, for example, a linear, branched or cyclic alkyl ester such as an alkyl esterified ester (eg, methyl, ethyl, propyl, butyl, tertiary butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl). Aralkyl esterification (eg, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester)
4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide, tertiary butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl group of serine can be protected, for example, by esterification or etherification. As a group suitable for the esterification, for example, a lower alkanoyl group such as an acetyl group, an aroyl group such as a benzoyl group, a group derived from carbonic acid such as a benzyloxycarbonyl group and an ethoxycarbonyl group, and the like are used. Examples of the group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group.
As the protecting group for the phenolic hydroxyl group of tyrosine, for example, Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br-Z, tertiary butyl and the like are used. Examples of the protecting group for imidazole of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DN
P, benzyloxymethyl, Bum, Boc, Trt, Fmoc
Are used.

Examples of the activated carboxyl group of the raw material include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N
-Ester with hydroxyphthalimide, HOBt)]
Are used. As the activated amino group of the raw material, for example, a corresponding phosphoric amide is used. As a method for removing (eliminating) the protecting group, for example, Pd-
Catalytic reduction in a hydrogen stream in the presence of a catalyst such as black or Pd-carbon, or acid treatment with anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof Alternatively, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, or the like, reduction with sodium in liquid ammonia, or the like may be used. The elimination reaction by the above-mentioned acid treatment is generally performed at a temperature of about -20 ° C to 40 ° C. -Addition of a cation scavenger such as butanedithiol, 1,2-ethanedithiol and the like is effective. Further, the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tryptophan is the above 1,2-ethanedithiol, 1,4-butane. In addition to deprotection by acid treatment in the presence of dithiol,
It is also removed by an alkali treatment using a dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of the functional group which should not be involved in the reaction of the starting material, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining an amide form of a protein, for example, first, α
Amidating and protecting the carboxyl group, extending the peptide (protein) chain to the amino group side to a desired chain length, and removing the N-terminal α-amino group protecting group alone of the peptide chain. A protein from which only the protecting group for the carboxyl group at the C-terminus is removed is produced, and both proteins are condensed in a mixed solvent as described above. Details of the condensation reaction are the same as described above. After purifying the protected protein obtained by the condensation, all the protecting groups are removed by the above-mentioned method, and a desired crude protein can be obtained. The crude protein is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired protein. In order to obtain a protein ester, for example, after condensing the α-carboxyl group of the carboxy-terminal amino acid with a desired alcohol to form an amino acid ester, the desired protein ester is obtained in the same manner as the protein amide. be able to.

The partial peptide of the protein of the present invention or a salt thereof can be produced according to a known peptide synthesis method or by cleaving the protein of the present invention with an appropriate peptidase. As a method for peptide synthesis,
For example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the protein of the present invention with the remaining portion and, when the product has a protecting group, removing the protecting group. Known methods for condensation and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, NewYork (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory for Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten The partial peptide of the present invention can be purified and isolated by a combination of purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the partial peptide obtained by the above method is in a free form, it can be converted to an appropriate salt by a known method. Can be.

The polynucleotide encoding the receptor protein of the present invention may be any polynucleotide as long as it contains the nucleotide sequence (DNA or RNA, preferably DNA) encoding the receptor protein of the present invention. Good. The polynucleotide is RNA such as DNA or mRNA encoding the receptor protein of the present invention, and may be double-stranded or single-stranded. In the case of double-stranded, it may be double-stranded DNA, double-stranded RNA or DNA: RNA hybrid. In the case of a single strand, it may be a sense strand (ie, a coding strand) or an antisense strand (ie, a non-coding strand). The polynucleotide encoding the receptor protein of the present invention can be used, for example, in the known experimental medicine special edition “New PC”.
R and its application ", 15 (7), 1997, or a method analogous thereto.
Can be determined. Examples of the DNA encoding the receptor protein of the present invention include genomic DNA and genomic DN.
A library, cDNA derived from the cells and tissues described above,
Any of the above-mentioned cDNA library derived from cells and tissues and synthetic DNA may be used. The vectors used for the library are bacteriophage, plasmid, cosmid,
Any of phagemid and the like may be used. In addition, reverse transcriptase polymerase was prepared directly by using a total RNA or mRNA fraction prepared from the cells and tissues described above.
It can also be amplified by the raseChain Reaction (hereinafter abbreviated as RT-PCR method). Specifically, the DNA encoding the receptor protein of the present invention includes, for example, a DNA containing the base sequence represented by SEQ ID NO: 2.
NA (including DNAs having a deletion of the 1006 to 1008th stop codon TGA of SEQ ID NO: 2, that is, DNAs containing a base sequence from the first base A to the 1005th T of SEQ ID NO: 2) Or a DNA that hybridizes under stringent conditions with the base sequence represented by SEQ ID NO: 2, and has substantially the same activity as the receptor protein of the present invention (eg, ligand binding activity, signal transduction activity) ) May be used as long as it encodes a receptor protein having Examples of the DNA that can hybridize with the DNA having the nucleotide sequence represented by SEQ ID NO: 2 under high stringency conditions include, for example, about 70% or more, and preferably about 80% or more with the nucleotide sequence represented by SEQ ID NO: 2. More preferably, DNA containing a nucleotide sequence having a homology of about 90% or more, most preferably about 95% or more is used.

Hybridization can be performed by a known method or a method analogous thereto, for example, Molecular Cloning 2nd (J. Sambrook et al.).
al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions. The high stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 2 mM.
At 0 mM, the temperature is about 50-70 ° C., preferably about 60-70 ° C.
The condition at 65 ° C. is shown. In particular, the sodium concentration is about 19m
Most preferred is a temperature of about 65 ° C at M. More specifically, as the DNA encoding the receptor protein containing the amino acid sequence represented by SEQ ID NO: 1, a DNA containing the base sequence represented by SEQ ID NO: 2 (1006 to 1008 of SEQ ID NO: 2) Th stop codon TG
A deficient DNA, that is, DNA containing a base sequence from the first base A to the 1005th T in SEQ ID NO: 2) and the like are used. A polynucleotide comprising a part of the base sequence of the DNA encoding the receptor protein of the present invention or a part of the base sequence complementary to the DNA is a DNA encoding the following partial peptide of the present invention. It is used to include not only RNA but also RNA. According to the present invention, an antisense polynucleotide (nucleic acid) capable of inhibiting the replication or expression of a G protein-coupled receptor protein gene is cloned or determined and encodes a G protein-coupled receptor protein. It can be designed and synthesized based on DNA base sequence information. Such a polynucleotide (nucleic acid) can hybridize with RNA of a G protein-coupled receptor protein gene,
It can inhibit the synthesis or function of A, or can regulate and control the expression of G protein-coupled receptor protein gene through interaction with RNA associated with G protein-coupled receptor protein. Polynucleotides complementary to a selected sequence of G protein-coupled receptor protein-related RNA, and polynucleotides capable of specifically hybridizing to G protein-coupled receptor protein-related RNA, are available in vivo and in vitro. It is useful for regulating and controlling the expression of a protein-coupled receptor protein gene, and is also useful for treating or diagnosing diseases and the like. The term "corresponding" means having homology or being complementary to a specific sequence of nucleotides, base sequences or nucleic acids including genes. "Corresponding" between a nucleotide, base sequence or nucleic acid and a peptide (protein) usually refers to the amino acid of the peptide (protein) as directed by the nucleotide (nucleic acid) sequence or its complement. . 5 'end hairpin loop of G protein-coupled receptor protein gene, 5' end 6
-Base pair repeats, 5 'untranslated region, polypeptide translation initiation codon, protein coding region, ORF translation initiation codon, 3' untranslated region, 3 'palindromic region, and 3' hairpin loop are preferred Although it can be selected as a target region, any region within the G protein-coupled receptor protein gene can be selected as a target.

The relationship between the target nucleic acid and the polynucleotide complementary to at least a part of the target region can be said to be that the relationship between the target nucleic acid and the polynucleotide capable of hybridizing with the target is "antisense". . Antisense polynucleotides are polydeoxynucleotides containing 2-deoxy-D-ribose, D-
Ribose-containing polydeoxynucleotides, other types of polynucleotides which are N-glycosides of purine or pyrimidine bases, or other polymers having a non-nucleotide backbone (e.g., commercially available protein nucleic acids and synthetic sequence specific nucleic acids) Polymer) or other polymer containing a special bond (provided that the polymer contains a nucleotide having a configuration that allows base pairing and base attachment as found in DNA and RNA) and the like. . They are double-stranded DN
A, which can be a single-stranded DNA, a double-stranded RNA, a single-stranded RNA, or a DNA: RNA hybrid, to which an unmodified polynucleotide (or an unmodified oligonucleotide) and further a known modification are added. Such as labeled, capped, methylated, substituted for one or more naturally occurring nucleotides with analogs, modified with intramolecular nucleotides, as known in the art, For example, those having an uncharged bond (for example, methylphosphonate, phosphotriester, phosphoramidate, carbamate, etc.), those having a charged bond or a sulfur-containing bond (for example, phosphorothioate, phosphorodithioate, etc.), for example, Proteins (nucleases, nuclease inhibitors, toxins, antibodies, signal probes) Plastid, poly -L- lysine, etc.)
Having side-chain groups such as sugars and sugars (eg, monosaccharides), those having interactive compounds (eg, acridine, psoralen, etc.), chelating compounds (eg, metals, radioactive metals, boron, etc.) , An oxidizing metal, etc.), an alkylating agent, or a compound having a modified bond (for example, α-anomeric nucleic acid). Here, "nucleoside", "nucleotide", and "nucleic acid" may include not only those containing purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleotides and modified nucleotides may also be modified at the sugar moiety, for example, one or more hydroxyl groups are replaced with halogens, aliphatic groups, or the like,
Alternatively, it may be converted to a functional group such as ether or amine.

The antisense polynucleotide (nucleic acid) of the present invention is RNA, DNA, or a modified nucleic acid (RNA, DNA). Specific examples of modified nucleic acids include, but are not limited to, sulfur derivatives and thiophosphate derivatives of nucleic acids, and those that are resistant to degradation of polynucleoside amides and oligonucleoside amides. The antisense nucleic acid of the present invention can be preferably designed according to the following policy. That is, to make the antisense nucleic acid more stable in the cell, to make the antisense nucleic acid more cell permeable, to have a greater affinity for the target sense strand, and to be more toxic if it is toxic. Minimize the toxicity of sense nucleic acids. Thus, many modifications are known in the art, for example, J. Kawakami et al., Pharm Tech Japan, Vo.
l. 8, pp. 247, 1992; Vol. 8, pp. 395, 1992; ST Cr
ooke et al. ed., Antisense Research and Applicatio
ns, CRC Press, 1993. The antisense nucleic acid of the present invention has an altered or modified sugar,
It may contain a base or a bond, and may be provided in a special form such as liposome or microsphere, applied by gene therapy, or provided in an added form. Thus, in the form of addition, polycations such as polylysine which acts to neutralize the charge of the phosphate skeleton, lipids which enhance the interaction with the cell membrane or increase the uptake of nucleic acids ( For example, crude water-based substances such as phospholipids and cholesterol are exemplified. Preferred lipids for addition include cholesterol and its derivatives (eg, cholesteryl chloroformate, cholic acid, etc.). These can be attached to the 3 'end or 5' end of the nucleic acid, and can be attached via a base, sugar, or intramolecular nucleoside bond. Other groups include:
A cap group specifically arranged at the 3 ′ end or 5 ′ end of a nucleic acid, for preventing degradation by a nuclease such as exonuclease and RNase. Such capping groups include, but are not limited to, hydroxyl-protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol. The inhibitory activity of an antisense nucleic acid can be examined using the transformant of the present invention, the in vivo or in vitro gene expression system of the present invention, or the in vivo or in vitro translation system of a G protein-coupled receptor protein. it can. The nucleic acid can be applied to cells by various known methods.

DNA encoding the partial peptide of the present invention
May be any as long as it contains a base sequence encoding the above-described partial peptide of the present invention. In addition, any of genomic DNA, genomic DNA library, cDNA derived from the above-mentioned cells / tissues, cDNA library derived from the above-mentioned cells / tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, using the mRNA fraction prepared from the cells and tissues described above,
Transcriptase Polymerase Chain Reaction (hereinafter, RT
-PCR method). Specifically, D encoding the partial peptide of the present invention
Examples of NA include, for example, (1) DN having a partial base sequence of DNA having a base sequence represented by SEQ ID NO: 2.
A, or (2) having a DNA that hybridizes under high stringent conditions with a DNA having the base sequence represented by SEQ ID NO: 2, and having substantially the same activity as the receptor protein of the present invention (eg, ligand) For example, a DNA having a partial nucleotide sequence of a DNA encoding a receptor protein having a binding activity, a signal transduction action, or the like is used. D having the base sequence represented by SEQ ID NO: 2
Examples of the DNA that hybridizes with NA under high stringency conditions include, for example, about 70% or more, preferably about 80% or more of the nucleotide sequence represented by SEQ ID NO: 2.
More preferably about 90% or more, most preferably about 95%
DNA containing a base sequence having the above homology is used.

As a means for cloning a DNA that completely encodes the receptor protein of the present invention or a partial peptide thereof (hereinafter, sometimes abbreviated as the receptor protein of the present invention), DNA of the DNA encoding the receptor protein of the present invention may be cloned. Synthetic DNA having partial nucleotide sequence of nucleotide sequence
Amplification by PCR using primers, or hybridization with DNA incorporated into an appropriate vector labeled with a DNA fragment or a synthetic DNA encoding a part or all of the receptor protein of the present invention. Can be sorted out. Hybridization methods include, for example, molecular
Cloning (Molecular Cloning) 2nd (J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual.

The DNA base sequence can be converted by ODA using PCR or a known kit such as Mutan ^™ -superExpress Km (Takara Shuzo) or Mutan ^™ -K (Takara Shuzo).
-It can be carried out according to a known method such as the LAPCR method, the Gupped duplex method, the Kunkel method, or a method analogous thereto. D encoding the cloned receptor protein
NA can be used as it is depending on the purpose, or as desired, after digestion with a restriction enzyme or adding a linker. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation start codon and translation stop codon
It can also be added using an appropriate synthetic DNA adapter. The expression vector for the receptor protein of the present invention is, for example, (A) a D encoding the receptor protein of the present invention.
The desired DNA fragment was cut out from NA, and (b) the D
It can be produced by ligating an NA fragment downstream of a promoter in an appropriate expression vector.

As a vector, a plasmid derived from Escherichia coli (eg, pCR4, pCR2.1, pBR322, pB
R325, pUC12, pUC13) and plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC19)
4), yeast-derived plasmids (eg, pSH19, pSH1
5), bacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., as well as pA1-11, pXT1, pR
c / CMV, pRc / RSV, pcDNAI / Neo, etc. are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when an animal cell is used as a host, the SRα promoter,
SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter and the like. Among them, it is preferable to use the CMV promoter, SRα promoter and the like. When the host is Escherichia, trp promoter, lac promoter, recA promoter, .lambda.P _L promoter,
When the host is a bacterium belonging to the genus Bacillus, an SPO1 promoter, an SPO2 promoter, a penP promoter, etc., and when the host is a yeast, a PHO5 promoter, a PGK promoter, a GA
P promoters and ADH promoters are preferred.
When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.

[0033] In addition to the above, the expression vector may optionally contain an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like. Can be used. As a selection marker, for example, dihydrofolate reductase (hereinafter, dhfr)
Gene (sometimes abbreviated as “methotrexate (M
TX) resistance], an ampicillin resistance gene (hereinafter referred to as Amp
^r ), a neomycin resistance gene (hereinafter sometimes abbreviated as Neo ^r , G418 resistance), and the like. In particular, when the dhfr gene is used as a selection marker using CHO (dhfr ⁻ ) cells, the target gene can be selected using a thymidine-free medium. Also, if necessary, a signal sequence suitable for the host is added to the N-terminal side of the receptor protein of the present invention. When the host is Escherichia, PhoA.
When the host is Bacillus, an α-amylase signal sequence, a subtilisin signal sequence, or the like is used. When the host is yeast, an MFα signal sequence, SUC2 When the host is an animal cell such as a sequence, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. can be used, respectively. A transformant can be produced using the vector containing the DNA encoding the receptor protein of the present invention thus constructed.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of Escherichia bacteria include
Escherichia coli K12 DH
1 [Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 160
(1968)], JM103 [Nukuilec Acids
Research, (Nucleic Acids Research), 9, 309
(1981)], JA221 [Journal of Molecular Biolog
y)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1, 459 (1969)], C600 [Genetics, 39, 440 (1954)], DH5
α (Inoue, H., Nojima, H. and Okayama, H., Gene, 96, 23-2
8 (1990)], DH10B [Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. US
A), Vol. 87, 4645-4649 (1990)]. Examples of Bacillus bacteria include, for example, Bacillus subtilis MI114 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemistry (Journal of Biochemistry).
emistry), Vol. 95, 87 (1984)]. Examples of yeast include, for example, Saccharomyces cerevisiae AH22, AH22
^{R -, NA87-11A, DKD-5D} , 20B-1
2. Schizosaccharomy
ces pombe) NCYC1913, NCYC2036, Pichia pastoris and the like are used.

As insect cells, for example, virus is A
In the case of cNPV, a cell line derived from night larvae of larvae (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from eggs of Trichoplusia ni
igh Five ^TM cells, cells derived from Mamestrabrassicae or
Estigmena acrea-derived cells are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mor
iN; BmN cells). Examples of the Sf cells include Sf9 cells (ATCC CRL1711), Sf21
Cells (Vaughn, JL et al., In Viv
o), 13, 213-217, (1977)). As insects, for example, silkworm larvae and the like are used [Maeda et al., Nature, 315, 592 (198).
5)]. As animal cells, for example, monkey cells COS-
7, Vero, Chinese hamster cell CHO (hereinafter referred to as
CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr ⁻ ) cells), mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, human FL cells, and the like.

For transforming Escherichia sp., For example, Procagings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69 , 21
10 (1972) and Gene, 17, 107 (1)
982). For transformation of Bacillus sp., For example, Molecular and General Genetics (Mole
cular & General Genetics), 168, 111 (19
79) and the like.
To transform yeast, see, for example, Methods in Enzymology, 194.
Vol. 182-187 (1991).
Proc. Natl. Acad. Sc of the National Academy of Sciences of the USA
USA), Vol. 75, 1929 (1978). Insect cells or insects can be transformed, for example, according to the method described in Bio / Technology, 6, 47-55 (1988). In order to transform animal cells, for example, Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 263-267 (1995) (published by Shujunsha),
Virology, 52, 456 (1973)
Can be performed according to the method described in (1). Thus, the D protein encoding the G protein-coupled receptor protein
A transformant transformed with the expression vector containing NA is obtained. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium to be used for the culture. Nitrogen sources, inorganic substances, etc. are contained. As the carbon source, for example, glucose,
As a nitrogen source such as dextrin, soluble starch, and sucrose, for example, inorganic or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, and inorganic substances For example, calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like can be mentioned. Also,
Yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. Here, in order to make the promoter work efficiently if necessary, for example, 3β-indolyl
An agent such as acrylic acid can be added. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually performed at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant in which the host is yeast, for example, Burkholder's minimum medium [Bostian, KL
Proc. Natl. Acad. Sci. USA, 77, 45, Proc. Of the National Academy of Sciences of the USA.
05 (1980)] or SD containing 0.5% casamino acid.
Medium [Bitter, GA, et al., "The Prossings of
The National Academy of Sciences
Of the USA (Proc. Natl. Acad. Sci. U
SA), 81, 5330 (1984)]. Preferably, the pH of the medium is adjusted to about 5-8. The cultivation is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours,
Vent and agitate as needed.

When culturing an insect cell or a transformant whose host is an insect, Grace's Insect Mediu
m (Grace, TCC, Nature, 195,788 (196
Those to which an additive such as 10% bovine serum immobilized in 2)) is appropriately added are used. The pH of the medium is about 6.2-6.
Adjustment to 4 is preferred. Culture is usually performed at about 27 ° C for about 3
５5 days, with aeration and / or agitation as needed. When culturing a transformant in which the host is an animal cell, the medium may be, for example, MEM containing about 5 to 20% fetal bovine serum.
Medium [Science, Vol. 122, 501 (19)
52)], DMEM medium [Virology,
8, 396 (1959)], RPMI 1640 medium [The Journal of the American Medica
l Association) 199, 519 (1967)], 19
9 medium [Proceeding of the Society for the Biological Medicine (Proceeding o
fthe Society for the Biological Medicine), 73
Vol., 1 (1950)]. pH is about 6-8
It is preferred that The cultivation is usually performed at about 30 ° C. to 40 ° C. for about 15 to 60 hours, and if necessary, aeration or stirring is added. As described above, the G protein-coupled receptor protein of the present invention can be produced in the transformant, inside the cell membrane, or outside the cell.

The receptor protein of the present invention can be separated and purified from the above culture by, for example, the following method. When extracting the receptor protein of the present invention from cultured cells or cells, after culturing, cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to sonication, lysozyme and / or freeze-thawing. After the cells or cells are destroyed by such methods as mentioned above, a method of obtaining a crude extract of the receptor protein by centrifugation or filtration is used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the receptor protein is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a known method, and the supernatant is collected.
Purification of the receptor protein contained in the thus obtained culture supernatant or extract can be carried out by appropriately combining known separation and purification methods. These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific novelty such as affinity chromatography, use of difference in hydrophobicity such as reversed-phase high-performance liquid chromatography And a method utilizing the difference in isoelectric points such as isoelectric focusing.

When the thus obtained receptor protein is obtained in a free form, it can be converted into a salt by a known method or a method analogous thereto. It can be converted to a free form or another salt by an analogous method. The receptor protein produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification. As a protein modifying enzyme, for example,
Trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The activity of the receptor protein of the present invention or a salt thereof thus produced can be measured by a binding experiment with a labeled ligand, an enzyme immunoassay using a specific antibody, or the like.

The antibody against the receptor protein or its partial peptide or its salt of the present invention may be a polyclonal antibody or a monoclonal antibody as long as it can recognize the receptor protein or its partial peptide or its salt of the present invention. Is also good. An antibody against the receptor protein of the present invention or a partial peptide thereof or a salt thereof (hereinafter, sometimes abbreviated as the receptor protein of the present invention) may be prepared by using the receptor protein of the present invention as an antigen, and using a known antibody or antiserum. It can be manufactured according to the manufacturing method.

[Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody Producing Cell
Administered with diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually 2-
It is performed once every six weeks, for a total of about 2 to 10 times. Examples of the mammal used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, and goats, and mice and rats are preferably used.
When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization. By fusing the contained antibody-producing cells with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting a labeled receptor protein or the like described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody.
The fusion operation can be performed according to a known method, for example, the method of Kohler and Milstein [Nature, 256, 495 (1975)]. As the fusion promoter, for example, polyethylene glycol (PE
G) and Sendai virus, but PEG is preferably used. As myeloma cells, for example,
NS-1, P3U1, SP2 / 0, etc.
P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably P
EG1000-PEG6000) is added at a concentration of about 10-80%, and about 20-40 ° C., preferably about 30-80%.
By incubating at 37 ° C. for about 1 to 10 minutes, cell fusion can be carried out efficiently.

Various methods can be used to screen for monoclonal antibody-producing hybridomas. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which an antigen such as a receptor protein is adsorbed directly or together with a carrier. Then, an anti-immunoglobulin antibody labeled with a radioactive substance or an enzyme (an anti-mouse immunoglobulin antibody is used when the cells used for cell fusion are mice) or protein A is added, and the monoclonal antibody bound to the solid phase is added. Detection method, adding a hybridoma culture supernatant to a solid phase to which anti-immunoglobulin antibody or protein A is adsorbed, adding a receptor protein or the like labeled with a radioactive substance, an enzyme, or the like, and detecting a monoclonal antibody bound to the solid phase And the like. The selection of the monoclonal antibody can be carried out according to a known method or a method analogous thereto. Usually, it can be carried out in an animal cell culture medium to which HAT (hypoxanthine, aminopterin, thymidine) is added. As a selection and breeding medium, any medium can be used as long as a hybridoma can grow. For example, 1-20
%, Preferably 10-20% RPMF
GIT containing I1640 medium, 1-10% fetal calf serum
A culture medium (Wako Pure Chemical Industries, Ltd.) or a serum-free culture medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.) can be used. Culture temperature is usually 20 to 40
° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. Culture is
Usually, it can be performed under 5% carbon dioxide gas. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of a monoclonal antibody can be performed by the same method as in the separation and purification of an ordinary polyclonal antibody (eg, salting out, alcohol precipitation, isoelectric precipitation, etc.). , Electrophoresis, adsorption / desorption with an ion exchanger (eg, DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or an active adsorbent such as protein A or protein G to collect only antibodies and bind Specific Purification Method for Obtaining Antibody by Dissociation].

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced according to a known method or a method analogous thereto. For example, a complex of an immunizing antigen (an antigen such as the receptor protein of the present invention) and a carrier protein is formed, and a mammal is immunized in the same manner as in the above-described method for producing a monoclonal antibody. The antibody can be produced by collecting an antibody-containing substance against the antibody and the like and separating and purifying the antibody. Regarding a complex of an immunizing antigen and a carrier protein used to immunize a mammal, the type of the carrier protein and the mixing ratio of the carrier and the hapten should be such that the antibody can be efficiently produced against the hapten immunized by crosslinking the carrier. Any kind may be cross-linked at any ratio. For example, bovine serum albumin, bovine thyroglobulin, keyhole limpet hemocyanin, etc. may be used in a weight ratio of about 0.1 to 20 with respect to 1 hapten. Preferably, a method of coupling at a ratio of about 1 to 5 is used.
Various coupling agents can be used for coupling the hapten and the carrier. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithioviridyl group, or the like is used. The condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible. In order to enhance antibody production ability at the time of administration,
Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered. The administration can usually be performed once every about 2 to 6 weeks, for a total of about 3 to 10 times. The polyclonal antibody can be collected from blood, ascites, or the like, preferably from blood, of the mammal immunized by the above method. The measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the serum described above. The separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as the above-described separation and purification of the monoclonal antibody.

The receptor protein of the present invention or a salt thereof,
The partial peptide or a salt thereof, and the DNA encoding the receptor protein or the partial peptide thereof,
(1) determination of a ligand (agonist) for the G protein-coupled receptor protein of the present invention, (2) preventive and / or therapeutic agent for a disease associated with dysfunction of the G protein-coupled receptor protein of the present invention, (3) Genetic diagnostics,
(4) a method for screening a compound that changes the expression level of the receptor protein or a partial peptide thereof of the present invention,
(5) a prophylactic and / or therapeutic agent for various diseases containing a compound that alters the expression level of the receptor protein or its partial peptide of the present invention; (6) a method for quantifying a ligand for the G protein-coupled receptor protein of the present invention; (7)
A screening method for a compound (agonist, antagonist, etc.) that changes the binding property between the G protein-coupled receptor protein and the ligand of the present invention, (8) Changes the binding property between the G protein-coupled receptor protein and the ligand of the present invention A preventive and / or therapeutic agent for various diseases containing a compound (agonist, antagonist), (9) quantification of the receptor protein of the present invention or a partial peptide thereof or a salt thereof, (10) a receptor protein of the present invention or a portion thereof in a cell membrane A method for screening a compound that changes the amount of a peptide, (11) a preventive and / or therapeutic agent for various diseases containing a compound that changes the amount of the receptor protein of the present invention or a partial peptide thereof in a cell membrane, and (12) a method of the present invention. Receptor protein or partial peptide Or neutralization by antibodies to salts thereof, can be used for such production of non-human animal having a DNA encoding a G protein-coupled receptor protein of the present invention (13). In particular, by using a receptor binding assay system using the recombinant G protein-coupled receptor protein expression system of the present invention, a compound that changes the binding property of a ligand to a G protein-coupled receptor specific to a mammal ( For example, agonists, antagonists, etc.) can be screened, and the agonists or antagonists can be used as agents for preventing or treating various diseases. A receptor protein of the present invention or a partial peptide thereof or a salt thereof (hereinafter sometimes abbreviated as the receptor protein of the present invention), a DN encoding the receptor protein of the present invention or a partial peptide thereof
The use of A (hereinafter sometimes abbreviated as the DNA of the present invention) and an antibody against the receptor protein or the like of the present invention (hereinafter sometimes abbreviated as the antibody of the present invention) will be specifically described below.

(1) Determination of ligand (agonist) for G protein-coupled receptor protein of the present invention The receptor protein of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof is used for the receptor protein of the present invention or a salt thereof. It is useful as a reagent for searching or determining a ligand (agonist).
That is, the present invention provides a method for determining a ligand for the receptor protein of the present invention, which comprises contacting the receptor protein of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof with a test compound. Test compounds include known ligands (eg,
Angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (eg, PACAP27,
PACAP38), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, GHR
H, CRF, ACTH, GRP, PTH, VIP (Vasoactive Intestinal
Polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene-related peptide), leukotriene, pancreastatin, prostaglandin, thromboxane, adenosine, adrenaline, chemokine superfamily (eg, IL-8, GROα, GROβ, GRO
γ, NAP-2, ENA-78, GCP-2, PF4
CX such as IP-10, Mig, PBSF / SDF-1
C chemokine subfamily; MCAF / MCP-1,
MCP-2, MCP-3, MCP-4, eotaxi
n, RANTES, MIP-1α, MIP-1β, HC
C-1, MIP-3α / LARC, MIP-3β / EL
C, I-309, TARC, MIPF-1, MIPF-
2 / eotaxin-2, MDC, DC-CK1 / PA
CC chemokine subfamily such as RC and SLC; l
C chemokine subfamily such as ymphotoactin; CX3C chemokine subfamily such as fractionalkine), endothelin, enterogastrin, histamine, neurotensin, TRH, pancreatic polypeptide, galanin, lysophosphatidic acid (LPA), sphingosine 1-phosphate Such)
Besides, for example, tissue extracts of mammals (eg, human, mouse, rat, pig, cow, sheep, monkey, etc.),
Cell culture supernatant and the like are used. For example, the tissue extract, cell culture supernatant, or the like is added to the receptor protein of the present invention, and fractionated while measuring cell stimulating activity and the like, whereby a single ligand can be finally obtained.

Specifically, the ligand determination method of the present invention uses the receptor protein of the present invention or a partial peptide thereof or a salt thereof, or constructs a recombinant receptor protein expression system and uses the expression system. By using the receptor binding assay system, cell stimulating activity by binding to the receptor protein of the present invention (for example, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release,
Compounds having an activity of promoting or inhibiting intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH reduction, etc. (for example, , Peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, etc.) or salts thereof. In the ligand determination method of the present invention, when the test compound is brought into contact with the receptor protein of the present invention or a partial peptide thereof, for example, the amount of the test compound bound to the receptor protein or the partial peptide, the cell stimulating activity, etc. Is measured.

More specifically, the present invention relates to a method for preparing a labeled test compound, which comprises contacting the labeled test compound with the receptor protein of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof. Or a method for determining a ligand for a receptor protein or a salt thereof of the present invention, which comprises measuring the amount of binding to a salt thereof, or the partial peptide or a salt thereof, comprising a labeled test compound containing the receptor protein of the present invention. Determining a ligand for the receptor protein of the present invention or a salt thereof, which comprises measuring the amount of a labeled test compound bound to the cell or the membrane fraction when the cell is brought into contact with the cell or the membrane fraction of the cell. Method: The labeled test compound is transformed with the DNA encoding the receptor protein of the present invention. A receptor of the present invention characterized by measuring the amount of a labeled test compound bound to the receptor protein or a salt thereof when the transformant is brought into contact with the receptor protein expressed on the cell membrane by culturing the transformant. A method for determining a ligand for a protein,

When a test compound is brought into contact with a cell containing the receptor protein of the present invention, cell stimulating activity via the receptor protein (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c
Measuring the activity of promoting or suppressing the activation of fos, lowering of pH, etc.), a method for determining a ligand for the receptor protein of the present invention or a salt thereof, and a test compound of the present invention. Cell stimulating activity via the receptor protein (eg, arachidonic acid release, acetylcholine release, intracellular Activity to promote or suppress Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, fluctuation of cell membrane potential, phosphorylation of intracellular protein, activation of c-fos, decrease in pH, etc. ) Of the receptor protein of the present invention or a salt thereof. The present invention provides a method for determining a ligand. In particular, it is preferable to perform the above-mentioned tests after conducting the above-mentioned tests to confirm that the test compound binds to the receptor protein of the present invention.

First, the receptor protein used in the method for determining a ligand may be any receptor protein containing the above-mentioned receptor protein of the present invention or the partial peptide of the present invention. Receptor proteins expressed in large amounts are suitable. The above-mentioned expression method is used for producing the receptor protein of the present invention, and it is preferable to express the DNA encoding the receptor protein in mammalian cells or insect cells. Complementary DNA is usually used as the DNA fragment encoding the target protein portion, but is not necessarily limited thereto. For example, a gene fragment or a synthetic DNA may be used. In order to introduce a DNA fragment encoding the receptor protein of the present invention into a host animal cell and express them efficiently, the DNA fragment is converted into a nuclear polyhedrosis virus belonging to a baculovirus using an insect as a host. (NPV) polyhedrin promoter, SV40-derived promoter, retrovirus promoter, metallothionein promoter, human heat shock promoter, cytomegalovirus promoter, SRα promoter and the like. The amount and quality of the expressed receptor can be examined by a known method. For example, the literature [Nambi, P .; Et al., The Journal of Biological Chemistry (J. Biol. Chem.), 267, 19555-19
559, 1992].

Therefore, in the method for determining a ligand of the present invention, the receptor protein of the present invention or a partial peptide thereof or a salt thereof may be a receptor protein or a partial peptide thereof or a salt thereof purified according to a known method. Alternatively, a cell containing the receptor protein or a cell membrane fraction thereof may be used. When cells containing the receptor protein of the present invention are used in the ligand determination method of the present invention, the cells may be immobilized with glutaraldehyde, formalin, or the like. The immobilization method can be performed according to a known method. The cell containing the receptor protein of the present invention refers to a host cell expressing the receptor protein of the present invention. As the host cell, Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells and the like are used. The cell membrane fraction refers to a cell membrane-rich fraction obtained by crushing cells and then obtained by a known method. Methods for disrupting cells include a method of crushing cells with a Potter-Elvehjem homogenizer, a Waring blender and a polytron (Kinemati).
(manufactured by Ca Co.), crushing by ultrasonic waves, crushing by ejecting cells from a thin nozzle while applying pressure by a French press or the like. For cell membrane fractionation,
A fractionation method using centrifugal force such as a fractionation centrifugation method or a density gradient centrifugation method is mainly used. For example, the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (usually about 1 to 10 minutes), and the supernatant is further centrifuged at a high speed (15 to 15 minutes).
(3,000 rpm to 30,000 rpm) for 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction is rich in the expressed receptor protein and membrane components such as cell-derived phospholipids and membrane proteins.

The amount of the receptor protein in the cells containing the receptor protein and in the membrane fraction thereof is 10 per cell.
^It is preferably ³ to 10 ⁸ molecules, and more preferably 10 ⁵ to 10 ⁷ molecules. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which not only enables the construction of a highly sensitive screening system,
A large number of samples can be measured in the same lot. In order to carry out the above-mentioned methods (1) to (3) for determining a ligand for the receptor protein or a salt thereof of the present invention, an appropriate receptor protein fraction and a labeled test compound are required. As the receptor protein fraction, a natural receptor protein fraction or a recombinant receptor fraction having an activity equivalent thereto is desirable. Here, “equivalent activity” refers to equivalent ligand binding activity, signal transduction action, and the like. As the labeled test compound, [ ³
H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] and the like, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP (Eg, PACAP27,
PACAP38), secretin, glucagon, calcitonin, adrenomedullin, somatostatin, GHR
H, CRF, ACTH, GRP, PTH, VIP (Vasoactive Intestinal and Limited)
Polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene-related peptide), leukotriene, pancreastatin, prostaglandin, thromboxane, adenosine, adrenaline, chemokine superfamily (eg, IL-8, GROα, GROβ, GRO
γ, NAP-2, ENA-78, GCP-2, PF4
CX such as IP-10, Mig, PBSF / SDF-1
C chemokine subfamily; MCAF / MCP-1,
MCP-2, MCP-3, MCP-4, eotaxi
n, RANTES, MIP-1α, MIP-1β, HC
C-1, MIP-3α / LARC, MIP-3β / EL
C, I-309, TARC, MIPF-1, MIPF-
2 / eotaxin-2, MDC, DC-CK1 / PA
CC chemokine subfamily such as RC and SLC; l
C chemokine subfamily such as ymphotoactin; CX3C chemokine subfamily such as fractionalkine), endothelin, enterogastrin, histamine, neurotensin, TRH, pancreatic polypeptide, galanin, lysophosphatidic acid (LPA), sphingosine 1-phosphate And the like are preferred.

Specifically, the method for determining a ligand for the receptor protein of the present invention or a salt thereof is as follows.
First, a receptor preparation is prepared by suspending a cell or a membrane fraction of the cell containing the receptor protein of the present invention in a buffer suitable for the determination method. The buffer may be any buffer such as a phosphate buffer having a pH of 4 to 10 (preferably pH 6 to 8) or a buffer such as Tris-HCl buffer, which does not inhibit the binding between the ligand and the receptor protein. For the purpose of reducing non-specific binding, surfactants such as CHAPS, Tween-80 ^™ (Kao-Atlas), digitonin, deoxycholate and various proteins such as bovine serum albumin and gelatin may be added to the buffer. it can. Furthermore, to reduce the degradation of receptors and ligands by proteases, P
Protease inhibitors such as MSF, leupeptin, E-64 (manufactured by Peptide Research Laboratories), and pepstatin can also be added. 0.01 ml to 10 ml of the receptor solution is added to a certain amount (5,000 cpm to 500,000 cps).
m) A test compound labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] or the like coexists. Non-specific binding (N
A reaction tube containing a large excess of an unlabeled test compound is also prepared to determine SB). The reaction is carried out at about 0 ° C. to 50 ° C., preferably about 4 ° C. to 37 ° C., for about 20 minutes to 24 hours, preferably for about 30 minutes to 3 hours. After the reaction, the mixture is filtered with a glass fiber filter or the like, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or a γ-counter. A test compound whose count (B-NSB) obtained by subtracting the non-specific binding amount (NSB) from the total binding amount (B) exceeds 0 cpm can be selected as a ligand (agonist) for the receptor protein of the present invention or a salt thereof. .

In order to carry out the above-mentioned methods (1) to (4) for determining a ligand for the receptor protein or a salt thereof of the present invention, cell stimulating activity (for example, arachidonic acid release, acetylcholine release, intracellular Ca ^{2 +} Release, intracellular cAMP generation, intracellular cGMP
Production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH reduction, etc. promoting or inhibiting activities) by a known method or a commercially available measurement kit. It can be measured using: Specifically, first, cells containing the receptor protein are cultured in a multiwell plate or the like. Before performing ligand determination, replace the medium with a fresh medium or an appropriate buffer that is not toxic to cells, add test compounds, and incubate for a certain period of time.
The cells are extracted or the supernatant is collected, and the generated product is quantified according to each method. When the production of a substance (for example, arachidonic acid or the like) as an indicator of cell stimulating activity is difficult due to a degrading enzyme contained in a cell, an assay may be performed by adding an inhibitor against the degrading enzyme. For activities such as cAMP production suppression,
It can be detected as a production inhibitory effect on cells whose basic production has been increased with forskolin or the like.

The kit for determining a ligand that binds to the receptor protein of the present invention or a salt thereof comprises a receptor protein of the present invention or a salt thereof, a partial peptide of the present invention or a salt thereof, a cell containing the receptor protein of the present invention, or It contains a membrane fraction of cells containing the receptor protein of the present invention. Examples of the kit for determining a ligand of the present invention include the following. 1. Ligand determination reagent Measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco)
One containing 05% bovine serum albumin (manufactured by Sigma). Sterilized by filtration through a 0.45 μm filter, 4 ° C
Or may be prepared at the time of use. G Protein-Coupled Receptor Protein Preparation CHO cells expressing the receptor protein of the present invention
Passage into a 12-well plate at 5 × 10 ⁵ / well, 37 ° C.,
Cultured for 2 days in 5% CO ₂ and 95% air. Labeled test compound A commercially available compound labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], or the like, or labeled by an appropriate method. Store at ℃, and dilute to 1 μM with a measurement buffer before use. Test compounds that are poorly soluble in water are dissolved in dimethylformamide, DMSO, methanol and the like. Unlabeled test compound The same as the labeled compound is prepared at a concentration 100 to 1000 times higher.

2. Assay Method CHO cells expressing the receptor protein of the present invention cultured on a 12-well tissue culture plate are washed twice with 1 ml of assay buffer, and then 490 μl of assay buffer is added to each well. 5 μl of a labeled test compound is added and reacted at room temperature for 1 hour. To determine the amount of non-specific binding, add 5 μl of an unlabeled test compound. Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled test compound bound to the cells was 0.2N NaO
Dissolve in H-1% SDS and mix with 4 ml of liquid scintillator A (Wako Pure Chemical Industries). Liquid scintillation counter (Beckman)
The radioactivity is measured using.

The ligand capable of binding to the receptor protein of the present invention or a salt thereof includes, for example, brain,
Pituitary, pancreas, substances specifically present in the spleen and the like, specifically, angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, Oxytocin, PACA
P (eg, PACAP27, PACAP38), secretin, glucagon, calcitonin, adrenomedullin,
Somatostatin, GHRH, CRF, ACTH, GR
P, PTH, VIP (basoactive intestinal and related polypeptide), somatostatin, dopamine, motilin, amylin, bradykinin, CGRP (calcitonin gene relayed peptide), leukotriene, pancreatastatin, prostaglandin, thromboxane, adenosine , Adrenaline, chemokine superfamily (eg, IL-8,
GROα, GROβ, GROγ, NAP-2, ENA-
78, GCP-2, PF4, IP-10, Mig, PB
CXC chemokine subfamily such as SF / SDF-1; MCAF / MCP-1, MCP-2, MCP-3,
MCP-4, eotaxin, RANTES, MIP-
1α, MIP-1β, HCC-1, MIP-3α / LA
RC, MIP-3β / ELC, I-309, TARC,
MIPF-1, MIPF-2 / eotaxin-2, M
CC chemokine subfamily such as DC, DC-CK1 / PARC, SLC; C chemokine subfamily such as lymphotoactin;
e, such as CX3C chemokine subfamily), endothelin, enterogastrin, histamine, neurotensin, TRH, pancreatic polypeptide, galanin, lysophosphatidic acid (LPA), sphingosine 1-phosphate, and the like.

(2) Preventive and / or therapeutic agent for diseases associated with dysfunction of the G protein-coupled receptor protein of the present invention In the above method (1), if the ligand for the receptor protein of the present invention becomes clear, Use of the receptor protein of the present invention or DNA encoding the receptor protein as a medicament such as an agent for preventing and / or treating a disease associated with dysfunction of the receptor protein of the present invention, depending on the action of the ligand. Can be. For example, in the case where there is a patient who cannot expect the physiological action of the ligand due to a decrease in the receptor protein of the present invention in the living body (deficiency of the receptor protein),
Administering the receptor protein of the present invention to the patient to supplement the amount of the receptor protein, (a) administering the DNA encoding the receptor protein of the present invention to the patient and expressing the same, or After the DNA encoding the receptor protein of the present invention is inserted and expressed in a cell, the amount of the receptor protein in the patient's body is increased by transplanting the cell into the patient, and the effect of the ligand is sufficiently enhanced. Can be demonstrated. That is, DNA encoding the receptor protein of the present invention is useful as a safe and low-toxic agent for preventing and / or treating diseases associated with dysfunction of the receptor protein of the present invention. The receptor protein of the present invention is a novel seven-transmembrane receptor protein having approximately 20% homology at the amino acid sequence level to VIPR (Vasoactive Intestinal Polypeptide Receptor) which is a G protein-coupled receptor protein. It is. The receptor protein of the present invention or DN encoding the receptor protein
A is a central disease (eg, Alzheimer's disease, dementia, eating disorder, etc.), an inflammatory disease (eg, allergy, asthma, rheumatism, etc.), a cardiovascular disease (eg, hypertension, cardiac hypertrophy, angina, arteriosclerosis) Disease), cancer (eg, non-small cell lung cancer, ovarian cancer, prostate cancer, gastric cancer, bladder cancer, breast cancer, cervical cancer, colon cancer, rectal cancer, etc.), metabolic disease (eg, diabetes, diabetic complications) Prevention of obesity, arteriosclerosis, gout, cataracts, etc., immune system diseases (eg, autoimmune diseases), digestive system diseases (eg, gastric ulcer, duodenal ulcer, gastritis, reflux esophagitis, etc.) and / or the like. Or it is useful for treatment. When the receptor protein of the present invention is used as the above-mentioned prophylactic / therapeutic agent, it can be formulated according to conventional means. On the other hand, DNA encoding the receptor protein of the present invention (hereinafter sometimes abbreviated as DNA of the present invention)
When used as the above prophylactic / therapeutic agent, the D of the present invention
NA can be carried out by a conventional method alone or after inserting it into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like. DNA of the present invention
Can be administered as it is or together with adjuvants for promoting uptake by a catheter such as a gene gun or a hydrogel catheter. For example, the receptor protein of the present invention or D encoding the receptor protein
NA is a sugar-coated tablet, capsule,
It can be used orally as elixirs, microcapsules and the like, or parenterally in the form of injections such as sterile solutions or suspensions with water or other pharmaceutically acceptable liquids. For example, the receptor protein of the present invention or a DNA encoding the receptor protein
Known physiologically recognized carriers, flavoring agents, excipients,
It can be prepared by mixing with vehicles, preservatives, stabilizers, binders and the like in the unit dosage form generally required for the practice of formulations. The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. For example, a leavening agent such as sucrose, a lubricant such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.) and the like are used. For example, it may be used in combination with an alcohol (eg, ethanol), a polyalcohol (eg, propylene glycol, polyethylene glycol), a nonionic surfactant (eg, Polysorbate 80 ^™ , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservative (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Since the thus obtained preparation is safe and low toxic, it can be used, for example, in mammals (for example,
Human, rat, mouse, rabbit, sheep, pig, cow,
Cats, dogs, monkeys, etc.). The dose of the receptor protein of the present invention is,
Although there are differences depending on the target organ, symptoms, administration method and the like, in the case of oral administration, for example, in a cancer patient (as 60 kg), about 0.1 mg to 100 m per day is generally used.
g, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. If administered parenterally,
The single dose varies depending on the administration subject, target organ, symptom, administration method and the like. For example, usually in the form of an injection, for example, in a cancer patient (as 60 kg), about 0.01 to 30 mg per day Degree, preferably about 0.1 to
It is convenient to administer about 20 mg, more preferably about 0.1 to 10 mg, by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg. The dose of the DNA of the present invention varies depending on the administration subject, the target organ, the condition, the administration method, and the like. However, in the case of oral administration, generally, for example, a cancer patient (60 kg) is used.
Is about 0.1 mg to 100 mg per day, preferably about 1.0 to 50 mg, more preferably about 1.0 to 50 mg per day.
２０20 mg. When administered parenterally, 1
The dosage may vary depending on the administration subject, target organ, symptoms, administration method, and the like. For example, usually in the form of an injection, for example, in a cancer patient (as 60 kg), about 0.01 to 30 mg per day, Preferably about 0.1-20
It is convenient to administer about mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(3) Gene Diagnostic Agent The DNA of the present invention can be used as a probe to produce DNA in mammals (eg, human, rat, mouse, rabbit, sheep, pig, cow, cat, dog, monkey, etc.). Abnormality (genetic abnormality) of DNA or mRNA encoding the receptor protein of the present invention or a partial peptide thereof can be detected, for example, damage, mutation, or decreased expression of the DNA or mRNA, or increase of the DNA or mRNA. Alternatively, it is useful as a diagnostic agent for gene expression such as overexpression. The above-described genetic diagnosis using the DNA of the present invention can be performed, for example, by the known Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, pp. 874-879 (1989)).
Years), Proceedings of the National Academy of Sciences o
f the United States of America), Vol. 86, 276
6 to 2770 (1989)).

(4) Method for Screening a Compound That Alters the Expression of the Receptor Protein or Partial Peptide of the Present Invention The DNA of the present invention can be used as a probe to
It can be used for screening a compound that changes the expression level of the receptor protein of the present invention or its partial peptide. That is, the present invention provides, for example, the receptor protein of the present invention or a portion thereof contained in (i) blood of a non-human mammal, a specific organ, a tissue or cell isolated from an organ, or (ii) a transformant or the like. A method for screening a compound that changes the expression level of the receptor protein of the present invention or a partial peptide thereof by measuring the mRNA level of the peptide is provided.

The measurement of the amount of mRNA of the receptor protein of the present invention or its partial peptide is specifically carried out as follows. (I) Normal or disease model non-human mammals (eg, mice, rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc., more specifically, demented rats, obese mice, arteriosclerotic rabbits, cancer-bearing Mouse, etc.)
Drugs (eg, anti-dementia drugs, blood pressure lowering drugs, anti-cancer drugs, anti-obesity drugs, etc.) or physical stress (eg, flooding stress, electric shock, light, dark, low temperature, etc.) Obtain a specific organ (eg, brain, liver, kidney, etc.), or tissue or cells isolated from the organ. MRN of the receptor protein of the present invention or a partial peptide thereof contained in the obtained cells
A can be quantified by, for example, extracting mRNA from cells or the like by a usual method and using, for example, a technique such as TaqMan PCR, and can be analyzed by performing Northern blotting by a known means. (Ii) preparing a transformant expressing the receptor protein of the present invention or a partial peptide thereof according to the method described above,
The mRNA of the receptor protein of the present invention or its partial peptide contained in the transformant can be quantified and analyzed in the same manner.

The screening for a compound that alters the expression level of the receptor protein or its partial peptide of the present invention is carried out by (i) a predetermined time before a drug or physical stress is applied to a normal or disease model non-human mammal ( 30 minutes to 24 hours before, preferably 30 minutes to 1
2 hours before, more preferably 1 hour to 6 hours before) or after a certain time (30 minutes to 3 days, preferably 1 hour to 2 days, more preferably 1 hour to 24 hours), or drug Alternatively, the test compound is administered at the same time as the physical stress, and after a lapse of a predetermined time after the administration (30 minutes to 3 days, preferably 1 hour to 2 days, more preferably 1 hour to
(After 24 hours), it can be carried out by quantifying and analyzing the mRNA amount of the receptor protein of the present invention or its partial peptide contained in the cells, and (ii) the test compound when the transformant is cultured according to a conventional method. Mixed into the medium,
After culturing for a certain time (after 1 day to 7 days, preferably after 1 day)
After 3 days, more preferably 2 to 3 days), it can be carried out by quantifying and analyzing the mRNA amount of the receptor protein of the present invention or its partial peptide contained in the transformant.

The compound obtained by using the screening method of the present invention or a salt thereof is a compound having an action of changing the expression level of the receptor protein of the present invention or a partial peptide thereof. By increasing the expression level of the receptor protein of the present invention or its partial peptide, the cell stimulating activity via G protein-coupled receptor (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, IntracGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, p
Activity that promotes or suppresses H reduction, etc.)
And (b) a compound that reduces the cell stimulating activity by decreasing the expression level of the receptor protein of the present invention or its partial peptide. Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, and a fermentation product. These compounds may be a novel compound or a known compound. The compound that enhances the cell stimulating activity is useful as a safe and low toxic drug for enhancing the physiological activity of the receptor protein of the present invention. The compound that attenuates the cell stimulating activity is useful as a safe and low toxic drug for decreasing the physiological activity of the receptor protein of the present invention.

When a compound or a salt thereof obtained by using the screening method of the present invention is used as a pharmaceutical composition, it can be carried out according to a conventional method. For example,
Tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions, and the like can be prepared in the same manner as the above-mentioned pharmaceuticals containing the receptor protein of the present invention. Since the preparation thus obtained is safe and has low toxicity, it can be administered to mammals (eg, human, rat, mouse, rabbit, sheep, pig, cow, cat, dog, monkey, etc.). Can be. The dose of the compound or a salt thereof varies depending on the administration subject, target organ, condition, administration method, and the like. However, in the case of oral administration, for example, in a cancer patient (as 60 kg), for example, per day, About 0.1 to 100 mg, preferably about 1.0 to
It is 50 mg, more preferably about 1.0 to 20 mg.
In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, symptom, administration method and the like.
kg) as about 0.01 to 30 per day
It is convenient to administer about mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(5) Preventive and / or therapeutic agent for various diseases containing a compound that alters the expression level of the receptor protein or its partial peptide of the present invention. It is thought to play some important role in the body. Therefore, the compound that alters the expression level of the receptor protein of the present invention or its partial peptide can be used as a preventive and / or therapeutic agent for a disease associated with dysfunction of the receptor protein of the present invention. When the compound is used as a preventive and / or therapeutic agent for a disease associated with dysfunction of the receptor protein of the present invention, it can be formulated according to a conventional method.
For example, the compound is a sugar-coated tablet, if necessary,
Used orally as capsules, elixirs, microcapsules, etc., or parenterally in the form of injections such as sterile solutions or suspensions with water or other pharmaceutically acceptable liquids it can. For example, the compound is mixed with known physiologically acceptable carriers, flavoring agents, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of pharmaceutical preparations. Can be manufactured by The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. Use may be made of bulking agents such as, for example, magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.) and the like are used. For example, it may be used in combination with an alcohol (eg, ethanol), a polyalcohol (eg, propylene glycol, polyethylene glycol), a nonionic surfactant (eg, Polysorbate 80 ^™ , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffering agents (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservative (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Since the thus obtained preparation is safe and low toxic, it can be used, for example, in mammals (for example,
Human, rat, mouse, rabbit, sheep, pig, cow,
Cats, dogs, monkeys, etc.). The dose of the compound or a salt thereof varies depending on the administration subject, target organ, condition, administration method and the like, but in the case of oral administration, it is generally, for example, a cancer patient (60 kg).
Is about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 2 mg per day.
0 mg. When administered parenterally, the single dose varies depending on the administration subject, target organ, condition, administration method, and the like. For example, in the case of an injection, usually, for example, in a cancer patient (as 60 kg), About 0.01 to 30 mg per day, preferably about 0.1 to 20 m
Conveniently, about g, more preferably about 0.1 to 10 mg, will be administered by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(6) Method for Quantifying Ligands for G Protein-Coupled Receptor Proteins of the Present Invention Since the receptor proteins and the like of the present invention have binding properties for ligands, the concentration of ligand in vivo can be determined with high sensitivity. can do. The quantification method of the present invention can be used, for example, by combining it with a competition method. That is, the ligand concentration in the test sample can be measured by bringing the test sample into contact with the receptor protein of the present invention. Specifically, for example, it can be used according to the method described below or the like or a method analogous thereto. Edited by Hiro Irie "Radio Immunoassay" (Kodansha, Showa 4)
(Published in 1995) Hiroshi Irie, "Continuing Radio Immunoassay" (Kodansha, published in 1979)

(7) Method for Screening Compounds (Agonists, Antagonists, etc.) that Change the Binding Property of the G Protein-Coupled Receptor Protein of the Present Invention to a Ligand Using the Receptor Protein of the Present Invention or Recombinant Receptor Protein By constructing an expression system such as, and using a receptor binding assay system using the expression system,
Compounds (eg, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, etc.) or their salts that change the binding between the ligand and the receptor protein of the present invention can be efficiently screened. Such compounds include (a) cell stimulating activities (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, intracellular cGMP generation, inositol phosphorus A compound having an activity of promoting or suppressing acid production, fluctuation of cell membrane potential, phosphorylation of intracellular protein, activation of c-fos, reduction of pH, etc. (a so-called agonist for the receptor protein of the present invention), (B) a compound having no cell-stimulating activity (a so-called antagonist to the receptor protein of the present invention), (c) a compound that enhances the binding force between the ligand and the G protein-coupled receptor protein of the present invention, or (d) Includes compounds that reduce the binding force between the ligand and the G protein-coupled receptor protein of the present invention. That (the compound of the above (b) is preferably screened by the ligand determination methods described above). That is, the present invention relates to (i) the case where the receptor protein of the present invention or its partial peptide or a salt thereof is brought into contact with a ligand; and (ii) the case where the receptor protein of the present invention or its partial peptide or a salt thereof, a ligand and There is provided a method for screening a compound or a salt thereof which changes the binding property between a ligand and a receptor protein of the present invention or a partial peptide thereof or a salt thereof, which is characterized by comparing with a case where the test compound is brought into contact with the test compound. The screening method of the present invention is characterized in that, for example, in the cases (i) and (ii), for example, the amount of a ligand bound to the receptor protein or the like, the cell stimulating activity, and the like are measured and compared.

More specifically, the present invention relates to the case where a labeled ligand is brought into contact with the receptor protein of the present invention, and the case where a labeled ligand and a test compound are brought into contact with the receptor protein of the present invention. Measuring the amount of binding of the labeled ligand to the receptor protein or the like, and comparing the measured amount, and a method for screening a compound or a salt thereof that changes the binding property between the ligand and the receptor protein or the like of the present invention. A cell containing the receptor protein of the present invention or a membrane fraction of the cell, and a method wherein the labeled ligand and the test compound are added to the cell containing the receptor protein of the present invention or the membrane fraction of the cell. The amount of the labeled ligand bound to the cell or the membrane fraction when contacted is measured and compared A method for screening a compound or a salt thereof that alters the binding property between a ligand and a receptor protein of the present invention or the like, comprising: culturing a labeled ligand on a cell membrane by culturing a transformant containing the DNA of the present invention; And the labeled ligand and test compound were brought into contact with the receptor protein of the present invention expressed on the cell membrane by culturing a transformant containing the DNA of the present invention. In this case, the amount of binding of the labeled ligand to the receptor protein or the like is measured and compared, and a method for screening a compound or a salt thereof that changes the binding property between the ligand and the receptor protein or the like of the present invention,

Activates the receptor protein and the like of the present invention
Compound (for example, for the receptor protein of the present invention)
Containing the receptor protein of the present invention, etc.
And the receptor protein of the present invention.
A compound that activates a substance or the like and a test compound
When it is brought into contact with cells containing
Receptor-mediated cell stimulating activity (eg,
Chidonic acid release, acetylcholine release, intracellular Ca²⁺Play
Release, intracellular cAMP generation, intracellular cGMP generation, wild boar
Toll phosphate production, fluctuations in cell membrane potential,
Promotes oxidation, activation of c-fos, lowering of pH, etc.
Activity or inhibitory activity) and compare
And the receptor protein of the present invention, etc.
Of a compound or its salt that alters the binding to
And a compound that activates the receptor protein of the present invention (eg,
For example, a ligand for the receptor protein or the like of the present invention.
Culturing a transformant containing the DNA of the present invention
The receptor protein of the present invention expressed on the cell membrane
When contacted with white matter etc., the receptor protein of the present invention
Activating compound and the like and the test compound of the present invention
A cell membrane obtained by culturing a transformant containing A
Contacted with the receptor protein of the present invention expressed above
In some cases, receptor-mediated cell stimulating activity (eg,
Arachidonic acid release, acetylcholine release, intracellular C
a ²⁺Release, intracellular cAMP production, intracellular cGMP production,
Inositol phosphate production, cell membrane potential fluctuation, intracellular protein
Phosphorylation, activation of c-fos, lowering of pH, etc.
Activity to promote or suppress) and compare
And a receptor protein of the present invention.
A compound or its salt that changes the binding to white matter, etc.
Provide a cleaning method.

Prior to obtaining the receptor protein or the like of the present invention, when screening for a G protein-coupled receptor agonist or antagonist, cells, tissues or cell membrane fractions containing the G protein-coupled receptor protein, such as rats, are first used. To obtain candidate compounds (primary screening), and then confirm whether the candidate compounds actually inhibit the binding of human G protein-coupled receptor protein to ligand (secondary screening)
Was needed. If the cell, tissue or cell membrane fraction is used as it is, other receptor proteins will be mixed, and it has been difficult to actually screen for an agonist or antagonist for the target receptor protein. However, for example, by using the human-derived receptor protein of the present invention, primary screening is not required, and a compound that inhibits binding between a ligand and a G protein-coupled receptor protein can be efficiently screened. Furthermore, it is possible to easily evaluate whether the screened compound is an agonist or an antagonist. The specific description of the screening method of the present invention is as follows. First, as the receptor protein of the present invention used in the screening method of the present invention,
Any one may be used as long as it contains the above-described receptor protein of the present invention, but a cell membrane fraction of a mammalian organ containing the receptor protein, etc. of the present invention is preferable. However, since human-derived organs are particularly difficult to obtain, human-derived receptor proteins and the like which are expressed in large amounts using recombinants are suitable for screening.

The above-mentioned method is used for producing the receptor protein and the like of the present invention, but it is preferably carried out by expressing the DNA of the present invention in mammalian cells and insect cells. A complementary DNA is used as the DNA fragment encoding the target protein portion, but is not necessarily limited thereto. For example, a gene fragment or a synthetic DNA may be used. D encoding the receptor protein of the present invention
In order to introduce the NA fragment into host animal cells and express them efficiently, the DNA fragment is converted into a nuclear polyhedrosis virus (nuclear) belonging to baculovirus using an insect as a host.
It is preferably incorporated into the downstream of polyhedrosis virus (NPV) polyhedrin promoter, SV40-derived promoter, retrovirus promoter, metallothionein promoter, human heat shock promoter, cytomegalovirus promoter, SRα promoter and the like. The amount and quality of the expressed receptor can be examined by a known method. For example, the literature [Nambi, P .;
Et al., The Journal of Biological Chemistry (J. Biol. Chem.), 267, 19555-19559, 1992.
Year]. Therefore, in the screening method of the present invention, those containing the receptor protein or the like of the present invention may be a receptor protein or the like purified according to a known method, or a cell containing the receptor protein or the like may be used. Alternatively, a membrane fraction of cells containing the receptor protein or the like may be used.

When cells containing the receptor protein or the like of the present invention are used in the screening method of the present invention, the cells may be immobilized with glutaraldehyde, formalin, or the like. The immobilization method can be performed according to a known method. Cells containing the receptor protein or the like of the present invention refer to host cells that have expressed the receptor protein or the like. Examples of the host cell include Escherichia coli, Bacillus subtilis,
Yeast, insect cells, animal cells and the like are preferred. The cell membrane fraction refers to a cell membrane-rich fraction obtained by crushing cells and then obtained by a known method. Methods for disrupting cells include a method of crushing cells with a Potter-Elvehjem type homogenizer, a Waring blender and a polytron (Ki
nematica), crushing by ultrasonic waves, crushing by ejecting cells from a fine nozzle while applying pressure with a French press or the like. For the fractionation of cell membranes, fractionation by centrifugal force such as fractionation centrifugation or density gradient centrifugation is mainly used. For example, the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (generally about 1 minute to 10 minutes), and the supernatant is further centrifuged at a high speed (15000 rpm to 30000 rpm) for usually 30 minutes to 2 hours. The precipitate is the membrane fraction. The membrane fraction is rich in expressed receptor proteins and membrane components such as cell-derived phospholipids and membrane proteins. The amount of the receptor protein in the cell or membrane fraction containing the receptor protein or the like is preferably 10 ³ to 10 ⁸ molecules per cell, and more preferably 10 ⁵ to 10 ⁷ molecules per cell.
The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which makes it possible not only to construct a highly sensitive screening system, but also to measure a large number of samples in the same lot. .

In order to carry out the above (1) to screen for a compound that alters the binding property between the ligand and the receptor protein of the present invention, for example, an appropriate receptor protein fraction and a labeled ligand are required. As the receptor protein fraction, a natural receptor protein fraction or a recombinant receptor protein fraction having an activity equivalent thereto is desirable. Here, “equivalent activity” refers to equivalent ligand binding activity, signal transduction action, and the like. As the labeled ligand, a labeled ligand, a labeled ligand analog compound, or the like is used. For example, ligands labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] and the like are used. Specifically, to screen for a compound that alters the binding between the ligand and the receptor protein of the present invention, a cell or a membrane fraction of the cell containing the receptor protein of the present invention is first suitable for screening. To prepare a receptor protein standard. The buffer has a pH of 4 to 10 (preferably pH 6 to 8).
Any buffer may be used as long as it does not inhibit the binding between the ligand and the receptor protein, such as a phosphate buffer and Tris-HCl buffer. Further, in order to reduce non-specific binding, CHAPS, Tween-80 ^™ (Kao-
Surfactants such as Atlas, digitonin and deoxycholate can also be added to the buffer. further,
A protease inhibitor such as PMSF, leupeptin, E-64 (manufactured by Peptide Research Laboratories) and pepstatin can also be added for the purpose of suppressing the degradation of the receptor or ligand by the protease. A certain amount (5,000 cpm to 50,000) is added to 0.01 to 10 ml of the receptor solution.
0 cpm) of labeled ligand, and at the same time 10 ^-4
M to ^{10 -10} M test compounds are allowed to coexist. A reaction tube containing a large excess of unlabeled ligand is also prepared to determine the amount of non-specific binding (NSB). The reaction is performed at about 0 ° C to 5
0 ° C., preferably about 4 ° C. to 37 ° C., for about 20 minutes to 2
It is carried out for 4 hours, preferably about 30 minutes to 3 hours. After the reaction,
After filtration with a glass fiber filter or the like and washing with an appropriate amount of the same buffer, the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or a γ-counter. Count (B ₀ −NS) obtained by subtracting the non-specific binding amount (NSB) from the count (B ₀ ) when there is no antagonistic substance
Specific binding amount (B-NSB) assuming that B) is 100%
However, for example, a test compound having 50% or less can be selected as a candidate substance having a competitive inhibitory ability.

In order to carry out the above-mentioned methods (1) to (4) for screening a compound that alters the binding property between a ligand and the receptor protein of the present invention, for example, a cell stimulating activity via the receptor protein (eg, arachidonic acid release, acetylcholine Release, intracellular Ca ²⁺ release, intracellular c
AMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-
The activity of promoting or suppressing the activation of fos, the decrease of pH, etc.) can be measured using a known method or a commercially available measurement kit. Specifically, first, cells containing the receptor protein or the like of the present invention are cultured in a multiwell plate or the like. When performing screening, the cells were exchanged with a fresh medium or an appropriate buffer that does not show toxicity for cells in advance, and test compounds were added and incubated for a certain period of time. The product is quantified according to the respective method. When the production of a substance (for example, arachidonic acid or the like) as an indicator of cell stimulating activity is difficult due to a degrading enzyme contained in a cell, an assay may be performed by adding an inhibitor against the degrading enzyme. In addition, the activity such as cAMP production suppression can be detected as a production suppression effect on cells whose basic production amount has been increased by forskolin or the like.
To perform screening by measuring cell stimulating activity,
Cells that express the appropriate receptor protein are required.
Cells expressing the receptor protein or the like of the present invention include:
A cell line having a naturally occurring receptor protein of the present invention,
Cell lines expressing the above-mentioned recombinant receptor proteins and the like are desirable. As the test compound, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like are used. Or a known compound.

A screening kit for a compound or a salt thereof that alters the binding between a ligand and the receptor protein of the present invention or the like can be obtained from cells containing the receptor protein or the like of the present invention, cells containing the receptor protein or the like of the present invention, or cells of the present invention. And those containing a membrane fraction of cells containing a receptor protein and the like. Examples of the screening kit of the present invention include the following. 1. Screening reagent Measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco)
One containing 05% bovine serum albumin (manufactured by Sigma). Sterilized by filtration through a 0.45 μm filter, 4 ° C
Or may be prepared at the time of use. G Protein-Coupled Receptor Preparation CHO cells expressing the receptor protein of the present invention
Passage into a 12-well plate at 5 × 10 ⁵ / well, 37 ° C.,
Cultured for 2 days in 5% CO ₂ and 95% air. Labeled ligand Commercially available aqueous solution of ligand labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], etc. Store at 4 ° C. or −20 ° C. Dilute the solution to 1 μM. Ligand standard solution 0.1% bovine serum albumin (Sigma)
Dissolve to 1 mM in PBS containing and store at -20 ° C.

2. Assay Method CHO cells expressing the receptor protein of the present invention cultured on a 12-well tissue culture plate are washed twice with 1 ml of assay buffer, and then 490 μl of assay buffer is added to each well. After adding 5 μl of a test compound solution of 10 ⁻³ to 10 ⁻¹⁰ M, 5 μl of a labeled ligand is added, and the mixture is reacted at room temperature for 1 hour. To determine the amount of non-specific binding, 5 μl of 10 ⁻³ M ligand is added instead of the test compound. Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled ligand bound to the cells was 0.2N NaOH
1% SDS, 4 ml of liquid scintillator A
(Made by Wako Pure Chemical Industries). Liquid scintillation counter (Beckman)
Radioactivity was measured using Percent Maximum Binding
(PMB) is obtained by the following equation. PMB = [(B−NSB) / (B ₀ −NSB)] × 10
0 PMB: Percent Maximum Binding B: Value when a sample is added NSB: Non-specific Binding (Non-specific binding amount) B ₀ : Maximum binding amount

The compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is a compound having an effect of changing the binding property between a ligand and the receptor protein of the present invention.
(A) Cell stimulating activity via G protein-coupled receptor (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, intracellular cGMP
(A so-called receptor protein of the present invention) having activity of promoting or inhibiting the production, inositol phosphate production, fluctuation of cell membrane potential, phosphorylation of intracellular protein, activation of c-fos, reduction of pH, etc. (B) compounds having no cell-stimulating activity (so-called antagonists to the receptor protein of the present invention), (c) compounds that enhance the binding force between the ligand and the G protein-coupled receptor protein of the present invention Alternatively, (d) a compound that decreases the binding force between the ligand and the G protein-coupled receptor protein of the present invention. Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, and a fermentation product. These compounds may be a novel compound or a known compound. Since the agonist for the receptor protein or the like of the present invention has the same activity as the physiological activity of the ligand for the receptor protein or the like of the present invention, it is useful as a safe and low-toxic drug according to the ligand activity.
Since the antagonist to the receptor protein or the like of the present invention can suppress the physiological activity of the ligand to the receptor protein or the like of the present invention, it is useful as a safe and low-toxic drug for suppressing the ligand activity.
The compound that enhances the binding force between the ligand and the G protein-coupled receptor protein of the present invention is useful as a safe and low-toxic drug for enhancing the physiological activity of the ligand for the receptor protein of the present invention. The compound that decreases the binding force between the ligand and the G protein-coupled receptor protein of the present invention is useful as a safe and low-toxic drug for reducing the physiological activity of the ligand for the receptor protein of the present invention.

When a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned pharmaceutical composition, it can be carried out according to a conventional method. For example, in the same manner as the above-mentioned drug containing the receptor protein of the present invention, tablets,
Capsules, elixirs, microcapsules, sterile solutions, suspensions and the like can be used. Since the preparations obtained in this way are safe and low toxic,
It can be administered to mammals (eg, human, rat, mouse, rabbit, sheep, pig, cow, cat, dog, monkey, etc.). The dose of the compound or a salt thereof varies depending on the administration subject, target organ, condition, administration method, and the like. However, in the case of oral administration, for example, in a cancer patient (as 60 kg), it is generally about 0.1-
100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. When administered parenterally, the single dose depends on the subject, target organ, symptoms,
Although it differs depending on the administration method and the like, for example, in the form of an injection, for example, in a cancer patient (as 60 kg), about 0.01 to 30 mg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg per day Is about 0.1-1
It is convenient to administer about 0 mg by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(8) Preventive and / or therapeutic agent for various diseases containing a compound (agonist, antagonist) that changes the binding property between the G protein-coupled receptor protein and the ligand of the present invention. As described above, for example, it is considered that it plays some important role in vivo such as central function. Therefore, the compounds (agonists, antagonists) that change the binding property between the receptor protein of the present invention and the ligand can be used as agents for preventing and / or treating diseases associated with dysfunction of the receptor protein of the present invention. When the compound is used as a preventive and / or therapeutic agent for a disease associated with dysfunction of the receptor protein of the present invention, it can be formulated according to a conventional method. For example, the compound may be a sugar-coated tablet, capsule, elixir, microcapsule, or the like, as needed, orally, or aseptic solution with water or other pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the compound is mixed with known physiologically acceptable carriers, flavoring agents, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of pharmaceutical preparations. Can be manufactured by The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. For example, a leavening agent such as sucrose, a lubricant such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.) and the like are used. For example, it may be used in combination with an alcohol (eg, ethanol), a polyalcohol (eg, propylene glycol, polyethylene glycol), a nonionic surfactant (eg, Polysorbate 80 ^™ , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservatives (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Since the thus obtained preparation is safe and low toxic, it can be used, for example, in mammals (for example,
Human, rat, mouse, rabbit, sheep, pig, cow,
Cats, dogs, monkeys, etc.). The dose of the compound or a salt thereof varies depending on the administration subject, target organ, condition, administration method and the like, but in the case of oral administration, it is generally, for example, a cancer patient (60 kg).
Is about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 2 mg per day.
0 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, condition, administration method and the like. About 0. 0 per day.
It is convenient to administer about 01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. For other animals,
The amount converted per 60 kg can be administered.

(9) Quantification of the Receptor Protein of the Present Invention or a Partial Peptide or a Salt Thereof Since the antibody of the present invention can specifically recognize the receptor protein of the present invention and the like, the antibody of the present invention in a test solution Can be used for quantification of the receptor protein and the like, particularly quantification by sandwich immunoassay. That is, the present invention provides, for example, (i) reacting the antibody of the present invention with a test solution and a labeled receptor protein in a competitive manner, and measuring the ratio of the labeled receptor protein or the like bound to the antibody. A method for quantifying the receptor protein or the like of the present invention in a test solution, and (ii) simultaneously or sequentially using the test solution and the antibody of the present invention and the labeled antibody of the present invention insolubilized on a carrier. And then measuring the activity of the labeling agent on the insolubilized carrier. In the above (ii), it is preferable that one antibody is an antibody that recognizes the N-terminal of the receptor protein or the like of the present invention and the other antibody is an antibody that reacts with the C-terminal of the receptor protein or the like of the present invention. .

The receptor protein of the present invention can be measured using a monoclonal antibody against the receptor protein of the present invention (hereinafter sometimes referred to as the monoclonal antibody of the present invention), and the detection can be performed by tissue staining or the like. Can also. For these purposes, the antibody molecule itself may be used, and F (ab ′) ₂ , Fa
b ′ or Fab fraction may be used. The measurement method using an antibody against the receptor protein or the like of the present invention is not particularly limited, and may be an antibody, an antigen, or an antibody-antigen complex corresponding to the amount of an antigen (for example, the amount of the receptor protein) in a test solution. Any measurement method may be used as long as the amount is detected by chemical or physical means and the amount is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephelometry, competition method, immunometric method and sandwich method are suitably used, but it is particularly preferable to use the sandwich method described later in terms of sensitivity and specificity. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. Examples of radioisotopes include [ ¹²⁵ I], [
¹³¹ I], [ ³ H], [ ¹⁴ C] and the like. As the above enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, a luminol derivative, luciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. As the carrier, for example, agarose,
Dextran, insoluble polysaccharides such as cellulose, polystyrene, polyacrylamide, synthetic resins such as silicon,
Alternatively, glass or the like is used. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with the labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity of, the amount of the receptor protein of the present invention in the test solution can be determined. 1
The next reaction and the secondary reaction may be performed in the reverse order, simultaneously, or at a different time. The labeling agent and the method of insolubilization can be based on those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. In the method for measuring a receptor protein or the like by the sandwich method of the present invention, the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction is preferably an antibody having a different binding site to the receptor protein or the like. That is, the antibody used in the primary reaction and the secondary reaction is preferably, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the receptor protein, the antibody used in the primary reaction is preferably the C-terminal. For example, an antibody that recognizes an N-terminal portion other than the N-terminal portion is used.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, a nephelometry and the like. In the competitive method, the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, and then the unreacted labeled antigen is reacted with the antigen.
(F) and the labeled antigen (B) bound to the antibody are separated (B
/ F separation), the amount of any of B and F is measured, and the amount of antigen in the test solution is quantified. In this reaction method, a soluble antibody was used as an antibody, B / F separation was performed using polyethylene glycol,
A liquid phase method using a second antibody or the like to the above antibody, or using an immobilized antibody as the first antibody, or
A solid-phase method using a soluble first antibody and a solid-phased antibody as the second antibody is used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. Is reacted with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In the nephelometry, the amount of insoluble precipitate generated as a result of the antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephelometry utilizing laser scattering is preferably used.

In applying these individual immunological measurement methods to the measurement method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measuring system of the receptor protein or its salt of the present invention by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For more information on these common technical means,
Review articles, books, etc. can be referred to [for example, Hiroe Irie, "Radio Immunoassay" (Kodansha, published in 1974), Hiroshi Irie, "Continuing Radio Immunoassay" (Kodansha, published in 1974), Eiji Ishikawa et al. "Enzyme immunoassay" (ed. Medical Shoin, published in 1978), Eiji Ishikawa et al., "Enzyme immunoassay" (second edition) (ed.), Eiji Ishikawa et. Law (3rd edition) (Medical Shoin, published in 1987), "Methods in ENZYMOLOGY" Vol. 70 (Immunoch)
emical Techniques (Part A)), ibid.Vol. 73 (Immunoch
emical Techniques (Part B)), ibid.Vol. 74 (Immunoch
emical Techniques (Part C)), ibid.Vol. 84 (Immunoch
emical Techniques (Part D: Selected Immunoassays)),
Ibid. Vol. 92 (Immunochemical Techniques (Part E: Mon
oclonal Antibodies and General Immunoassay Method
s)), ibid.Vol. 121 (Immunochemical Techniques (Part
I: Hybridoma Technology and Monoclonal Antibodie
s)) (see Academic Press). As described above, the receptor protein of the present invention or a salt thereof can be quantified with high sensitivity by using the antibody of the present invention. Furthermore, by quantifying the receptor protein of the present invention or a salt thereof in a living body using the antibody of the present invention, it is possible to diagnose various diseases associated with dysfunction of the receptor protein of the present invention. Further, the antibody of the present invention can be used for specifically detecting the receptor protein of the present invention or the like present in a subject such as a body fluid or a tissue. Further, preparation of an antibody column used for purifying the receptor protein of the present invention, detection of the receptor protein of the present invention in each fraction at the time of purification, behavior of the receptor protein of the present invention in the test cells. Can be used for analysis and the like.

(10) Method for Screening a Compound That Changes the Amount of the Receptor Protein of the Present Invention or Its Partial Peptide in Cell Membrane The antibody of the present invention specifically recognizes the receptor protein of the present invention or its partial peptide or a salt thereof. Therefore, it can be used for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane. That is, the present invention
For example, (i) after disrupting the blood of a non-human mammal, a specific organ, tissues or cells isolated from an organ, or the like, isolating a cell membrane fraction, and containing the receptor protein of the present invention contained in the cell membrane fraction or a receptor protein thereof. A method for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane by quantifying the partial peptide, (ii) destroying a transformant expressing the receptor protein or its partial peptide of the present invention, etc. After that, the cell membrane fraction is isolated, and the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction is quantified, thereby screening for a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane The method, (iii) blood of the non-human mammal,
A specific organ, a tissue or a cell isolated from an organ is sectioned, and then, by using an immunostaining method, by quantifying the degree of staining of the receptor protein on the cell surface, the protein on the cell membrane is quantified. And a method for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane by confirming the following. (Iv) Quantifying the degree of staining of the receptor protein on the cell surface by using immunostaining after transformants or the like expressing the receptor protein or its partial peptide of the present invention are sectioned. And a method for screening a compound that changes the amount of the receptor protein of the present invention or its partial peptide in the cell membrane by confirming the protein on the cell membrane.

The quantitative determination of the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction is specifically performed as follows. (I) Normal or disease model non-human mammals (eg, mice, rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc., more specifically, demented rats, obese mice, arteriosclerotic rabbits, cancer-bearing Mouse, etc.)
Drugs (eg, anti-dementia drugs, blood pressure lowering drugs, anti-cancer drugs, anti-obesity drugs, etc.) or physical stress (eg, flooding stress, electric shock, light, dark, low temperature, etc.) Obtain a specific organ (eg, brain, liver, kidney, etc.), or tissue or cells isolated from the organ. The obtained organ, tissue or cell is suspended in, for example, an appropriate buffer (eg, Tris-HCl buffer, phosphate buffer, Hepes buffer, etc.),
An organ, tissue or cell is destroyed, and a cell membrane fraction is obtained by using a surfactant (eg, Triton X100 ^™ , Tween 20 ^™, etc.), and further using a method such as centrifugation, filtration, or column fractionation.

The cell membrane fraction was obtained by disrupting the cells,
It refers to a fraction containing a large amount of cell membrane obtained by a known method. The cells can be crushed by crushing the cells with a Potter-Elvehjem homogenizer, crushing with a Waring blender or polytron (Kinematica), crushing by ultrasonic waves, or squirting the cells from a thin nozzle while applying pressure with a French press. Crushing, etc. For the fractionation of cell membranes, fractionation by centrifugal force such as fractionation centrifugation or density gradient centrifugation is mainly used. For example, the cell lysate is supplied at a low speed (500 rpm to
000 rpm) for a short time (usually about 1 minute to 10 minutes), and the supernatant is further centrifuged at a high speed (15000 rpm to 30000 rpm).
(rpm) for 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction is rich in expressed receptor proteins and membrane components such as cell-derived phospholipids and membrane proteins.

The receptor protein of the present invention or its partial peptide contained in the cell membrane fraction can be quantified by, for example, sandwich immunoassay using the antibody of the present invention, Western blot analysis and the like. Such a sandwich immunoassay can be performed in the same manner as described above, and the Western blot can be performed by known means.

(Ii) A transformant expressing the receptor protein of the present invention or its partial peptide is prepared according to the above method, and the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction can be quantified. .

Screening for a compound that alters the amount of the receptor protein of the present invention or its partial peptide in the cell membrane is carried out by (i) a predetermined time before a drug or physical stress is applied to a normal or disease model non-human mammal. (30 minutes to 24 hours ago, preferably 3 minutes
0 minutes to 12 hours before, more preferably 1 hour to 6 hours before, or after a certain time (30 minutes to 3 days, preferably 1 hour to 2 days, more preferably 1 hour to 24 hours) ) Or a test compound is administered at the same time as the drug or physical stress, and after a certain period of time from the administration (30 minutes to
3 days, preferably 1 hour to 2 days, more preferably 1 hour to 24 hours), by quantifying the amount of the receptor protein of the present invention or its partial peptide in the cell membrane, (ii) When culturing the transformant according to a conventional method, the test compound is mixed in the medium, and after culturing for a certain period of time (after 1 day to 7 days, preferably after 1 day to 3 days, more preferably after 2 days to 3 days), It can be carried out by quantifying the amount of the receptor protein of the present invention or its partial peptide in the cell membrane.

The confirmation of the receptor protein of the present invention or its partial peptide contained in the cell membrane fraction is specifically performed as follows. (Iii) Normal or disease model non-human mammals (eg, mice, rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc., more specifically, dementia rats, obese mice, arteriosclerotic rabbits, cancer-bearing A drug (eg, an anti-dementia drug, a blood pressure lowering drug, an anti-cancer drug, an anti-obesity drug, etc.) or a physical stress (eg, flooding stress, electric shock, light / dark, low temperature, etc.) is given to a mouse, etc. for a certain period of time. After that time, blood or certain organs (eg brain, liver, kidney, spleen, etc.)
Alternatively, a tissue or cell isolated from an organ is obtained. The obtained organ, tissue or cell is cut into a tissue section according to a conventional method, and immunostaining is performed using the antibody of the present invention. By quantifying the degree of staining of the receptor protein on the cell surface and confirming the protein on the cell membrane, the amount of the receptor protein of the present invention or its partial peptide in the cell membrane can be quantitatively or qualitatively determined. You can check. (Iv) It can also be confirmed by using a transformant expressing the receptor protein of the present invention or a partial peptide thereof and the like, and performing the same procedure.

The compound or a salt thereof obtained by using the screening method of the present invention is a compound having an action of changing the amount of the receptor protein of the present invention or a partial peptide thereof in a cell membrane. By increasing the amount of the receptor protein of the present invention or its partial peptide in the cell membrane, the cell stimulating activity via the G protein-coupled receptor (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production) , Intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c
(B) a compound that enhances the activity of promoting or suppressing the activation of fos, a decrease in pH, etc.), and (b) reducing the amount of the receptor protein of the present invention or its partial peptide in the cell membrane to stimulate the cell. A compound that reduces activity. Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, and a fermentation product. These compounds may be a novel compound or a known compound. The compound that enhances the cell stimulating activity is useful as a safe and low toxic drug for enhancing the physiological activity of the receptor protein of the present invention. The compound that reduces the cell stimulating activity is
It is useful as a safe and low-toxicity drug for reducing the physiological activity of the receptor protein and the like of the present invention.

When a compound or a salt thereof obtained by using the screening method of the present invention is used as a pharmaceutical composition, it can be carried out according to a conventional method. For example,
Tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions, and the like can be prepared in the same manner as the above-mentioned pharmaceuticals containing the receptor protein of the present invention. Since the preparation thus obtained is safe and has low toxicity, it can be administered to mammals (eg, human, rat, mouse, rabbit, sheep, pig, cow, cat, dog, monkey, etc.). Can be. The dose of the compound or a salt thereof varies depending on the administration subject, target organ, condition, administration method, and the like. However, in the case of oral administration, for example, in a cancer patient (as 60 kg), it is generally about 0.1 to 100 mg, preferably about 1.0 to 50
mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose varies depending on the administration subject, target organ, condition, administration method, and the like. For example, usually in the form of injection, for example, in a cancer patient (60 kg), It is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg per day by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

(11) Preventive and / or therapeutic agent for various diseases containing a compound that alters the amount of the receptor protein of the present invention or its partial peptide in the cell membrane The receptor protein of the present invention is, as described above, for example, a central function. It is thought to play some important role in vivo. Therefore, a compound that alters the amount of the receptor protein of the present invention or its partial peptide in the cell membrane can be used as an agent for preventing and / or treating a disease associated with dysfunction of the receptor protein of the present invention. When the compound is used as a preventive and / or therapeutic agent for a disease associated with dysfunction of the receptor protein of the present invention, it can be formulated according to a conventional method. For example, the compound may be a sugar-coated tablet, capsule, elixir, microcapsule, or the like, as needed, orally, or aseptic solution with water or other pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the compound is mixed with known physiologically acceptable carriers, flavoring agents, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of pharmaceutical preparations. Can be manufactured by The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives which can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. Use may be made of bulking agents such as, for example, magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry. When the preparation unit form is a capsule, the above type of material can further contain a liquid carrier such as oil and fat. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.) and the like are used. For example, it may be used in combination with an alcohol (eg, ethanol), a polyalcohol (eg, propylene glycol, polyethylene glycol), a nonionic surfactant (eg, Polysorbate 80 ^™ , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

The prophylactic / therapeutic agents include, for example, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, For example, human serum albumin, polyethylene glycol, etc.), preservatives (eg,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. Since the thus obtained preparation is safe and low toxic, it can be used, for example, in mammals (for example,
Human, rat, mouse, rabbit, sheep, pig, cow,
Cats, dogs, monkeys, etc.). The dose of the compound or a salt thereof varies depending on the administration subject, target organ, condition, administration method and the like, but in the case of oral administration, it is generally, for example, a cancer patient (60 kg).
Is about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 2 mg per day.
0 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, condition, administration method and the like. About 0. 0 per day.
It is convenient to administer about 01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. For other animals,
The amount converted per 60 kg can be administered.

(12) Neutralization by an antibody against the receptor protein of the present invention, its partial peptide or a salt thereof The neutralizing activity of the antibody against the receptor protein of the present invention, its partial peptide or a salt thereof against the receptor protein and the like That is, it means an activity of inactivating a signaling function involving the receptor protein. Therefore, when the antibody has a neutralizing activity, signal transduction involving the receptor protein, for example, cell stimulating activity via the receptor protein (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, Inactivation of intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, pH reduction, etc. can do. Therefore, it can be used for prevention and / or treatment of diseases caused by overexpression of the receptor protein and the like.

(13) Preparation of Animal Having DNA Encoding the G Protein-Coupled Receptor Protein of the Present Invention Using the DNA of the present invention, a transgenic animal expressing the receptor protein or the like of the present invention can be prepared. . Examples of animals include mammals (for example, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.) (hereinafter sometimes abbreviated as animals), and in particular, mice and rabbits. And the like are preferred. When transferring the DNA of the present invention to a target animal, the DN
It is generally advantageous to use A as a gene construct linked downstream of a promoter capable of being expressed in animal cells. For example, when the DNA of the present invention derived from a rabbit is transferred, the DN of the present invention derived from an animal having high homology to the DNA is transferred.
A DNA transgenic animal that highly produces the receptor protein or the like of the present invention can be produced by microinjecting a gene construct in which A is expressed downstream of various promoters capable of expressing the same in animal cells, for example, into a fertilized rabbit egg. As this promoter, for example, a ubiquitous expression promoter such as a virus-derived promoter or metallothionein may be used, but an NGF gene promoter or an enolase gene promoter that is specifically expressed in the brain is preferably used.

The transfer of the DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target animal. The presence of the receptor protein or the like of the present invention in the germ cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the receptor protein or the like of the present invention in all of the germ cells and somatic cells. The progeny of this type of animal that has inherited the gene have the receptor protein of the present invention in all of its germinal and somatic cells. After confirming that the DNA-transferred animal of the present invention stably retains the gene by breeding, it can be reared in a normal breeding environment as the DNA-bearing animal. Furthermore, by crossing male and female animals having the target DNA, homozygous animals having the transgene on both homologous chromosomes are obtained, and by crossing the male and female animals, all the offspring have the DNA. Breeding can be subcultured. Since the animal into which the DNA of the present invention has been transferred has high expression of the receptor protein of the present invention, it is useful as an animal for screening for an agonist or antagonist for the receptor protein of the present invention. The transgenic animal of the present invention can also be used as a cell source for tissue culture. For example, the receptor protein of the present invention can be analyzed by directly analyzing DNA or RNA in the tissue of the DNA-transferred mouse of the present invention or by analyzing the tissue in which the receptor protein of the present invention expressed by a gene is present. can do. Culturing cells of a tissue having the receptor protein or the like of the present invention by standard tissue culture techniques, and using them to study the function of cells from generally difficult-to-culture tissues such as those derived from brain or peripheral tissues. Can be. Also, by using the cells, for example,
It is also possible to select drugs that enhance the function of various tissues. In addition, if there is a high expression cell line, the receptor protein of the present invention can be isolated and purified therefrom.

In the present specification and drawings, when bases, amino acids and the like are represented by abbreviations, IUPAC-IUB
It is based on the abbreviation by the Commission on Biochemical Nomenclature or the abbreviation commonly used in the relevant field. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate Phosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate

Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thr: threonine Cys: cysteine Met: methionine Glu: glutamic acid Asp: aspartic acid Lysine arginine arginine : Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine pGlu: Pyroglutamic acid *: Corresponding to the stop codon Me: Methyl group Et: Ethyl group Bu: Butyl group Ph: Phenyl group TC: Thiazolidine-4 (R) Carboxamide group

Further, substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ Bzl: 2,6-dichlorobenzyl Bom: benzyloxymethyl Z: benzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Br-Z: 2-bromobenzyl Oxycarbonyl Boc: t-butoxycarbonyl DNP: dinitrophenol Trt: trityl Bum: t-butoxymethyl Fmoc: N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy -4-oxo-1,2,3-benzotriazine HONB: 1-hydroxy-5-norbornene-2,3-
Dicarboximide DCC: N, N'-dicyclohexylcarbodiimide

[0110] The sequence numbers in the sequence listing in the present specification indicate the following sequences. SEQ ID NO: 1 shows the amino acid sequence of the human-derived novel G protein-coupled receptor protein hTGR9 of the present invention. SEQ ID NO: 2 This shows the base sequence of cDNA encoding novel human-derived G protein-coupled receptor protein hTGR9 of the present invention. SEQ ID NO: 3 This shows the base sequence of primer 1 used for PCR in EXAMPLE 1 below. SEQ ID NO: 4 This shows the base sequence of primer 2 used for PCR in EXAMPLE 1 below. SEQ ID NO: 5 This shows the base sequence of primer 1 used for PCR in EXAMPLE 2 below. SEQ ID NO: 6 This shows the base sequence of primer 2 used for PCR in EXAMPLE 2 below. SEQ ID NO: 7 This shows the base sequence of probe used for TaqMan PCR in EXAMPLE 2 below.

The transformant Escherichia coli TOP10 / pCR4-hTGR9 obtained in Example 1 below
Has been deposited with the National Institute of Advanced Industrial Science and Technology (NIBH) of the Ministry of International Trade and Industry of 1-3-1 Higashi (Tsukuba 305-8566), Tsukuba City, Ibaraki Prefecture since June 19, 2000 as the deposit number FERM BP-7192. , June 6, 2000
Fermentation Research Institute (I) of 2-17-85, Jusanhoncho, Yodogawa-ku, Osaka-shi (Osaka)
FO) and a deposit number of IFO 16442.

[0112]

The present invention will be described in more detail with reference to the following Examples, which do not limit the scope of the present invention. In addition, the gene using Escherichia coli followed the method described in Molecular cloning. Example 1 Cloning of cDNA encoding human spleen G protein-coupled receptor protein and determination of nucleotide sequence Using human spleen cDNA (CLONTECH) as a template, two primers, primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 4) was used to carry out a PCR reaction.
The composition of the reaction solution in the reaction was 1/10 of the above cDNA.
Advantage-GC2 Polymerase Mix
(CLONTECH) 1/50 volume, primer 1 (SEQ ID NO:
3) and primer 2 (SEQ ID NO: 4)
M, 200 µM of dNTPs, 1/5 volume of the buffer attached to the enzyme, and 1/5 volume of GC Melt were added to make a liquid volume of 20 µl. After 5 minutes at 94 ° C, the PCR reaction was performed at 94 ° C for 30 minutes.
A cycle of 30 seconds at 60 ° C. for 30 seconds and 68 ° C. for 2 minutes was repeated 35 times. The PCR reaction product is transferred to a TA cloning kit (Invitrogen
Plasmid vector pCR4 (Invitrogen)
Was subcloned. This was introduced into Escherichia coli TOP10, and the clone containing cDNA was cloned into LB containing ampicillin.
Selected in agar medium. As a result of analyzing the sequence of each clone, a cDNA sequence (SEQ ID NO: 2) encoding a novel G protein-coupled receptor protein was obtained. A novel G protein-coupled receptor protein containing these amino acid sequences (SEQ ID NO: 1) was designated as hTGR9. Also, transformants were transformed into Escherichiacoli TOP10 / pCR4-hTGR
Named 9 The hydrophobicity plot of hTGR9 is shown in FIG.

Example 2 Analysis of Expression Distribution of hTGR9 in Human Tissues The expression distribution of hTGR9 in human tissues was analyzed using TaqMan P.
It was investigated by using the CR method. As a template, Human
Using Multiple Tissue cDNA Panel (Clontech), TaqMan PCR was performed using primers 1 (SEQ ID NO: 5) and 2 (SEQ ID NO: 6) as primers for PCR and a probe having SEQ ID NO: 7 Was. The composition of the reaction solution in the reaction is TaqMan Universal
12.5 µl of PCR MasterMix (Applied Biosystems Japan), 10 µM of primer 1 and primer 2
0.5 μl each, 5 μM probe 1 μl, template 2 μl, distilled water 8.5 μl, total 25 μl, PCR reaction, 50 ℃
After holding at 95 ° C for 10 minutes for 2 minutes, a cycle of 95 ° C for 15 seconds and 60 ° C for 1 minute was repeated 40 times. Based on the results obtained, the cD
FIG. 3 shows the result calculated as the number of copies per 1 μl of NA.
Shown in This indicates that the expression level of hTGR9 is high in the prostate, placenta, and spleen.

[0114]

The G protein-coupled receptor protein of the present invention or its partial peptide or a salt thereof, and a polynucleotide (eg, DNA, RNA and their derivatives) encoding the receptor protein or its partial peptide may be a ligand (agonist) ), Obtaining antibodies and antisera, constructing a recombinant receptor protein expression system, developing a receptor binding assay system using the expression system and screening drug candidate compounds, and examining structurally similar ligands / receptors. Can be used as a reagent for preparing a probe or PCR primer in gene diagnosis, producing a transgenic animal or a gene preventive / therapeutic agent, etc.

[0115]

[Sequence List] SEQUENCE LISTING <110> Takeda Chemical Industries, Ltd. <120> Novel G Protein-Coupled Receptor and its DNA <130> P2001-123 <150> JP 2000-184550 <151> 2000-06-14 <150 > JP 2000-222404 <151> 2000-07-18 <160> 7 <210> 1 <211> 335 <212> PRT <213> Human <400> 1 Met Gln Pro Ser Pro Pro Pro Thr Glu Leu Val Pro Ser Glu Arg Ala 5 10 15 Val Val Leu Leu Ser Cys Ala Leu Ser Ala Leu Gly Ser Gly Leu Leu 20 25 30 Val Ala Thr His Ala Leu Trp Pro Asp Leu Arg Ser Arg Ala Arg Arg 35 40 45 Leu Leu Leu Phe Leu Ser Leu Ala Asp Leu Leu Ser Ala Ala Ser Tyr 50 55 60 Phe Tyr Gly Val Leu Gln Asn Phe Ala Gly Pro Ser Trp Asp Cys Val 65 70 75 80 Leu Gln Gly Ala Leu Ser Thr Phe Ala Asn Thr Ser Ser Phe Phe Trp 85 90 95 Thr Val Ala Ile Ala Leu Tyr Leu Tyr Leu Ser Ile Val Arg Ala Ala 100 105 110 Arg Gly Pro Arg Thr Asp Arg Leu Leu Trp Ala Phe His Val Val Ser 115 120 125 Trp Gly Val Pro Leu Val Ile Thr Val Ala Ala Val Ala Leu Lys Lys 130 135 140 Ile Gly Tyr Asp Ala Ser Asp Val Ser Val Gly Trp Cys Trp Ile Asp 145 150 155 160 Leu Glu Ala Lys Asp His Val Leu Trp Met Leu Leu Thr Gly Lys Leu 165 170 175 Trp Glu Met Leu Ala Tyr Val Leu Leu Pro Leu Leu Tyr Leu Leu Val 180 185 190 Arg Lys His Ile Asn Arg Ala His Thr Ala Leu Ser Glu Tyr Arg Pro 195 200 205 Ile Leu Ser Gln Glu His Arg Leu Leu Arg His Ser Ser Met Ala Asp 210 215 220 Lys Lys Leu Val Leu Ile Pro Leu Ile Phe Ile Gly Leu Arg Val Trp 225 230 235 240 Ser Thr Val Arg Phe Val Leu Thr Leu Cys Gly Ser Pro Ala Val Gln 245 250 255 Thr Pro Val Leu Val Val Leu His Gly Ile Gly Asn Thr Phe Gln Gly 260 265 270 Gly Ala Asn Cys Ile Met Phe Val Leu Cys Thr Arg Ala Val Arg Thr 275 280 285 Arg Leu Phe Ser Leu Cys Cys Cys Cys Cys Ser Ser Gln Pro Pro Thr 290 295 300 Lys Ser Pro Ala Gly Thr Pro Lys Ala Pro Ala Pro Ser Lys Pro Gly 305 310 315 320 Glu Ser Gln Glu Ser Gln Gly Thr Pro Gly Glu Leu Pro Ser Thr 325 330 335 <210> 2 <211> 1008 <212> DNA <213> Human <400> 2 ATGCAGCCGT CCCCGCCGCCCCCACCGAGCTG GTGCCGTCGG AGCGCGCCGT GGTGCTGCTG 60 TCGTGCGCAC TCTCCGCGCT CGGCTCGGGC CTGCTGGTGG CCACGCACGC CCTGTGGCCC 120 GACCTGCGCA GCCGGGCACG GCGCCTGCTG CTCTTCCTGT CGCTGGCCGA CCTGCTCTCG 180 GCCGCCTCCT ACTTCTACGG AGTGCTGCAG AACTTCGCGG GCCCGTCGTG GGACTGCGTG 240 CTGCAGGGCG CGCTGTCCAC CTTCGCCAAC ACCAGCTCCT TCTTCTGGAC CGTGGCCATT 300 GCGCTCTACT TGTACCTCAG CATCGTCCGC GCCGCGCGCG GGCCTCGCAC AGATCGCCTG 360 CTTTGGGCCT TCCATGTCGT CAGCTGGGGG GTCCCGTTGG TCATCACTGT GGCAGCCGTC 420 GCCCTGAAGA AGATTGGCTA TGACGCCTCG GACGTGTCTG TGGGCTGGTG CTGGATCGAC 480 CTGGAGGCCA AGGACCATGT CCTGTGGATG CTGCTGACGG GGAAGCTGTG GGAGATGCTG 540 GCATATGTGC TGCTGCCTCT GCTGTACCTC CTGGTCCGGA AGCACATCAA CAGAGCGCAC 600 ACGGCACTCT CTGAGTACCG GCCCATCCTC TCCCAGGAGC ACCGCCTGCT GCGCCACTCC 660 TCCATGGCGG ACAAGAAGCT GGTGCTCATC CCGCTCATCT TCATCGGCCT CAGGGTCTGG 720 AGCACCGTGC GGTTCGTGCT GACCCTCTGT GGCTCCCCGG CCGTGCAGAC GCCGGTGCTG 780 GTGGTTCTGC ATGGTATCGG GAACACGTTT CAGGGAGGTG CCAACTGCAT CATGTTCGTC 840 CTCTGCACCC GCGCCGTCCG AACTCGGCTC TTCTCTCTCT GTTGCTGCTG CTGCTCTTCT 900 CAGCCTCCCA CCAAGAGCCC GGCTGGCACT CCCAAGGCT C CCGCGCCTTC CAAGCCAGGA 960 GAATCTCAGG AATCCCAAGG GACCCCAGGG GAACTTCCAA GCACTTGA 1008 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <223> Designed oligonucleotide primer to amplify DNA encoding hTGR9 <400> 3 GTCGACATGC AGCCGTCCCC GCCGCCCACCGA 4 <211> 36 <212> DNA <213> Artificial Sequence <223> Designed oligonucleotide primer to amplify DNA encoding hTGR9 <400> 4 CACTAGTTCA AGTGCTTGGA AGTTCCCCTG GGGTCC 36 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <223> Designed oligonucleotide primer to amplify DNA encoding hTGR9 <400> 5 CCCGTTGGTC ATCACTGTGG 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <223> Designed oligonucleotide primer to amplify DNA encoding hTGR9 <400> 6 ACACGTCCGA GGCGTCATA 19 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <223> Designed oligonucleotide probe for TaqMan PCR <400> 7 AGCCGTCGCC CTGAAGAAGA TTGG 24

[0116]

[Brief description of the drawings]

FIG. 1 is a hydrophobicity plot of hTGR9.

FIG. 2 shows the amino acid sequence of hTGR9 in one-letter code.

FIG. 3 is a view showing the expression level of hTGR9.

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission Date] June 19, 2001 (2001.6.1)
9)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0111

[Correction method] Change

[Correction contents]

The transformant Escherichia coli TOP10 / pCR4-hTGR9 obtained in Example 1 below
Is an independent administrative corporation from June 19, 2000 Higashi, Tsukuba, Ibaraki 1 chome No. 1 (zip code 305-8566)
Incorporated by the National Institute of Advanced Industrial Science and Technology (AIST) under the deposit number FERM BP-7192 from June 6, 2000, 2-17-85, Jusanhoncho, Yodogawa-ku, Osaka-shi, Osaka (postal code 532-8686).・ Fermentation Research Institute (IF
O) and deposit number IFO 16442. ────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] June 29, 2001 (2001.6.2
9)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0111

[Correction method] Change

[Correction contents]

The transformant Escherichia coli TOP10 / pCR4-hTGR9 obtained in Example 1 below
Is an independent administrative corporation from June 19, 2000 Higashi, Tsukuba, Ibaraki 1 chome No. 1 (zip code 305-8566)
Incorporated by the National Institute of Advanced Industrial Science and Technology (AIST) under the deposit number FERM BP-7192 from June 6, 2000.・ Fermentation Research Institute (IF
O) and deposit number IFO 16442.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 25/00 A61P 29/00 4C084 29/00 35/00 4H045 35/00 37/00 37/00 C07K 14 / 705 C07K 14/705 C12N 1/15 C12N 1/15 1/19 1/19 1/21 1/21 C12P 21/02 C 5/10 C12Q 1/68 A C12P 21/02 G01N 33/15 Z C12Q 1 / 68 33/50 Z G01N 33/15 33/53 D 33/50 M 33/53 33/566 C12N 15/00 ZNAA 33/566 5/00 A (72) Inventor Yasushi Shintani 1-chome, Kasuga, Tsukuba, Ibaraki 7-9 Takeda Kasuga Heights 703 (72) Inventor Hideki Matsui 4-16, 1-70 Namiki, Tsukuba-shi, Ibaraki F-term (reference) 2G045 AA40 DA12 DA13 DA14 DA36 FB02 FB03 4B024 AA01 AA11 BA63 CA04 DA06 EA04 GA11 HA12 HA15 4B063 QA01 QA18 QQ53 QR5 5 QS34 4B064 AG20 CA02 CA19 CC24 DA01 DA13 4B065 AA26X AA93Y AB01 AC14 BA02 CA24 CA44 CA46 4C084 AA17 AA20 MA02 NA14 ZA021 ZA361 ZA661 ZB011 ZB111 ZB261 ZC211 ZC611 4H045 AA10 AA10A20 DA20 FA20

Claims (37)

[Claims] 1. A G protein-coupled receptor protein or a salt thereof comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. 2. The G protein-coupled receptor protein according to claim 1, which comprises the amino acid sequence represented by SEQ ID NO: 1. 3. A partial peptide of the G protein-coupled receptor protein according to claim 1, or a salt thereof. 4. A polynucleotide comprising a polynucleotide encoding the G protein-coupled receptor protein according to claim 1. 5. The polynucleotide according to claim 4, which is a DNA. 6. The polynucleotide according to claim 4, which has the nucleotide sequence represented by SEQ ID NO: 2. 7. A recombinant vector containing the polynucleotide according to claim 4. A transformant transformed with the recombinant vector according to claim 7. 9. The G protein-coupled receptor protein according to claim 1, wherein the transformant according to claim 8 is cultured to produce the G protein-coupled receptor protein according to claim 1. Manufacturing method. 10. An antibody against the G protein-coupled receptor protein according to claim 1, or the partial peptide according to claim 2, or a salt thereof. 11. The antibody according to claim 10, which is a neutralizing antibody that inactivates signal transduction of the G protein-coupled receptor protein according to claim 1. 12. A diagnostic agent comprising the antibody according to claim 10. 13. The G protein according to claim 1, which can be obtained by using the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3 or a salt thereof.
A ligand for a protein-coupled receptor protein or a salt thereof. A pharmaceutical comprising the ligand of the G protein-coupled receptor according to claim 13. 15. A ligand for the G protein-coupled receptor protein or a salt thereof according to claim 1, wherein the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3 or a salt thereof is used. How to determine. 16. A ligand comprising the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3, or a salt thereof, and a G protein-coupled receptor protein according to claim 1 or a salt thereof. A method for screening a compound or a salt thereof that changes the binding property to a compound. 17. A ligand comprising the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3, or a salt thereof, and a ligand.
A kit for screening a compound or a salt thereof that alters the binding property to the G protein-coupled receptor protein or a salt thereof according to the above. 18. A ligand which can be obtained by using the screening method according to claim 16 or the screening kit according to claim 17 and a G protein-coupled receptor protein according to claim 1 or a salt thereof. Compound or salt thereof. (19) A ligand that can be obtained by using the screening method according to (16) or the screening kit according to (17) and a G protein-coupled receptor protein or a salt thereof according to (1). A medicament comprising a compound or a salt thereof. 20. A polynucleotide that hybridizes with the polynucleotide of claim 4 under high stringency conditions. 21. A polynucleotide comprising a nucleotide sequence complementary to the polynucleotide according to claim 4 or a part thereof. 22. The G according to claim 1, wherein the polynucleotide according to claim 4 or a part thereof is used.
A method for quantifying mRNA of a protein-coupled receptor protein. 23. The method for quantifying a G protein-coupled receptor protein according to claim 1, wherein the antibody according to claim 10 is used. 24. The method for diagnosing a disease associated with the function of a G protein-coupled receptor according to claim 1, wherein the quantification method according to claim 22 or 23 is used. 25. A method for screening a compound or a salt thereof, which changes the expression level of a G protein-coupled receptor protein according to claim 1, wherein the method according to claim 22 is used. 26. A method for screening a compound or a salt thereof that changes the amount of the G protein-coupled receptor protein according to claim 1 in a cell membrane, wherein the method uses the quantification method according to claim 23. 27. A compound or a salt thereof, which alters the expression level of the G protein-coupled receptor protein according to claim 1, which can be obtained by using the screening method according to claim 25. 28. A compound or a salt thereof, which alters the amount of the G protein-coupled receptor protein according to claim 1 in a cell membrane obtainable by using the screening method according to claim 26. (29) a pharmaceutical comprising a compound capable of changing the expression level of the G protein-coupled receptor protein according to (1) or a salt thereof, which can be obtained by using the screening method according to (25); [30] a pharmaceutical comprising a compound or a salt thereof that alters the amount of the G protein-coupled receptor protein according to [1] in a cell membrane obtainable by the screening method according to [26]; 31. A central disease, an inflammatory disease, a cardiovascular disease,
31. The medicament according to claim 19, 29 or 30, which is an agent for preventing or treating cancer, metabolic disease, immune system disease or digestive system disease. 32. A ligand obtainable by using the screening method according to claim 16 or the screening kit according to claim 17 for a mammal, and the G protein-coupled receptor protein or a salt thereof according to claim 1. Prevention and treatment of central disease, inflammatory disease, cardiovascular disease, cancer, metabolic disease, immune system disease or digestive system disease, characterized by administering an effective amount of a compound or a salt thereof that alters the binding of a compound. Method. 33. An effective amount of a compound or a salt thereof that changes the expression level of the G protein-coupled receptor protein according to claim 1, which can be obtained by using the screening method according to claim 25 to a mammal. A method for preventing or treating a central disease, an inflammatory disease, a circulatory disease, a cancer, a metabolic disease, an immune system disease, or a digestive system disease, characterized in that: 34. An effective amount of a compound or a salt thereof that alters the amount of the G protein-coupled receptor protein according to claim 1 in a cell membrane obtainable by using the screening method according to claim 26 to a mammal. A method for preventing or treating a central disease, an inflammatory disease, a circulatory disease, a cancer, a metabolic disease, an immune system disease, or a digestive system disease, characterized in that: 35. A central disease, an inflammatory disease, a cardiovascular disease,
A screening method according to claim 16 or a ligand obtainable by using the screening kit according to claim 17 for producing an agent for preventing or treating cancer, a metabolic disease, an immune system disease or a digestive system disease. Use of a compound or a salt thereof that changes the binding property to the G protein-coupled receptor protein or a salt thereof according to item 1. 36. A central disease, an inflammatory disease, a cardiovascular disease,
The expression of the G protein-coupled receptor protein according to claim 1, which can be obtained by using the screening method according to claim 25 for producing a prophylactic / therapeutic agent for cancer, metabolic disease, immune system disease or digestive system disease. Use of a compound or a salt thereof that changes the amount. 37. Central diseases, inflammatory diseases, cardiovascular diseases,
The G protein-coupled receptor protein according to claim 1 in a cell membrane obtainable by using the screening method according to claim 26 for producing a prophylactic or therapeutic agent for cancer, metabolic disease, immune system disease or digestive system disease. Use of a compound or a salt thereof that changes