JP2002338555A - Butanoic acid derivative - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a butanoic acid derivative and its salt having an activity of controlling peroxisome proliferator activated receptor, useful as hypoglycemic agent, hypolipidemic agent, a prophylactic and/or a therapeutic agent for metabolic disorder diseases such as diabetes, obesity, syndrome X, hypercholesterolemia, hyperlipoproteinemia, etc., hyperlipemia, arteriosclerosis, hypertension, circulatory disease, hyperphagia, ischemic heart disease, HDL cholesterol increasing agent, LDL cholesterol and/or VLDL cholesterol reducing agent and a risk factor reducing agent for diabetes and syndrome X. SOLUTION: This compound is represented by general formula (I) (R is a hydrogen atom or an ethyl group) or its salt. This peroxisome proliferator activated receptor inhibitor comprises the compound or its salt as an active ingredient.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a butanoic acid derivative. More specifically, the present invention relates to (1) a compound represented by the general formula (I):

Embedded image Wherein R represents the same meaning as described below, or a non-toxic salt thereof, (2) a method for producing them, and (3) a drug containing them as an active ingredient.

[0002]

BACKGROUND OF THE INVENTION Recently, in the study of transcription factors involved in induction of the expression of adipocyte differentiation marker genes, peroxisome proliferator activated receptor is a nuclear receptor (P eroxiso
me P roliferator A ctivated R eceptor; below, PPAR
(Abbreviated as receptor). As for the PPAR receptor, cDNAs have been cloned from various animal species, multiple isoform genes have been found, and three types of α, δ, and γ are known in mammals (J. Steroid Bioch).
em. Molec. Biol., 51 , 157 (1994); Gene Expressio
n., 4 , 281 (1995); Biochem Biophys. Res. Commun.,
224 , 431 (1996); Mol.Endocrinology., 6 , 1634 (19
92)). In addition, gamma type is mainly adipose tissue, immune cells,
In the adrenal gland, spleen, and small intestine, α-type is mainly expressed in adipose tissue, liver, and retina, and δ-type is known to be ubiquitously expressed mainly without tissue specificity (Endocrinology. , 137 ,
354 (1996)). Meanwhile, the thiazolidine derivatives shown below are known as therapeutic agents for non-insulin-dependent diabetes mellitus (NIDDM), and are hypoglycemic agents used to correct hyperglycemia in diabetic patients. Also,
It is a compound that is effective in correcting or improving hyperinsulinemia, improving glucose tolerance, and lowering serum lipids, and is considered to be extremely promising as an insulin sensitizer.

[0003]

Embedded image

One of the intracellular target proteins of these thiazolidine derivatives is PPARγ receptor,
It has been shown to increase the transcriptional activity of Rγ (Endo
crinology., 137 , 4189 (1996); Cell., 83 , 803 (199
5); Cell., 83 , 813 (1995); J. Biol. Chem., 270 , 1
2953 (1995)). Therefore, PPARγ activators (agonists) that increase the transcriptional activity of PPARγ are considered promising as hypoglycemic agents and / or lipid-lowering agents. Also, PPARγ agonists are known to enhance the expression of PPARγ protein itself (Genes & D
evelopment., 10 , 974 (1996)), agents that not only activate PPARγ but also increase the expression of PPARγ protein itself are considered to be clinically useful.

The nuclear receptor PPARγ is involved in adipocyte differentiation (J. Biol. Chem., 272 , 5637 (1997) and
Cell., 83 , 803 (1995)), and thiazolidine derivatives capable of activating the same are known to promote adipocyte differentiation. Recently, it has been reported that thiazolidine derivatives increase body fat and cause weight gain and obesity in humans (see Lancet., 349 , 952 (1997)). Therefore, antagonists (antagonists) that suppress PPARγ activity
Also, drugs that can reduce the expression of PPARγ protein itself are considered to be clinically useful. By the way, Scienc
e., 274 , 2100 (1996), introduces compounds capable of suppressing the activity of PPARγ by phosphorylating them. Therefore, drugs that do not bind to the PPARγ protein but suppress the activity are also disclosed. Considered clinically useful.

[0006] From these facts, PPARγ receptor activators (agonists) and PPARγ protein expression regulators capable of increasing the expression of the protein itself are hypoglycemic agents, lipid-lowering agents,
As a preventive and / or therapeutic agent for metabolic disorders such as diabetes, obesity, syndrome X, hypercholesterolemia, and hyperlipoproteinemia, hyperlipidemia, arteriosclerosis, hypertension, cardiovascular disease, and bulimia Expected to be useful. On the other hand, an antagonist that suppresses the transcriptional activity of the PPARγ receptor, or a PPARγ that can suppress the expression of the protein itself
The protein expression regulator is expected to be useful as an agent for preventing and / or treating hypoglycemic agents, diabetes, obesity, metabolic disorders such as syndrome X, hyperlipidemia, arteriosclerosis, hypertension, bulimia, etc. Is done. In addition, the following fibrate compounds, for example, clofibrate is known as a lipid-lowering agent,

[0007]

Embedded image

It has also been found that one of the intracellular target proteins of fibrate compounds is a PPARα receptor (Nature., 347 , 645 (1990); J. Steroid Biochem. M.
olec. Biol., 51 , 157 (1994); Biochemistry., 32 , 5
598 (1993)). From these facts, it is considered that a PPARα receptor regulator that can be activated by a fibrate compound is considered to have a lipid-lowering effect, and is useful as a prophylactic and / or therapeutic agent for hyperlipidemia and the like. Be expected.

[0009] In addition, WO9736579 recently reported that PPARα has an anti-obesity effect as a biological activity involving PPARα. Also, J. Lip
id Res., 39 , 17 (1998) states that the activation of PPARα receptor raises high-density lipoprotein (HDL) cholesterol; It has been reported that the compound has a triglyceride lowering effect. Diabetes., 46 , 348 (1997) reports that bezafibrate, one of fibrate compounds, improved blood fatty acid composition, hypertension, and insulin resistance. Therefore, an agonist that activates the PPARα receptor or a PPAR that enhances the expression of the PPARα protein itself.
PARα regulators are not only useful as lipid-lowering agents and therapeutic agents for hyperlipidemia, but also have an effect of increasing HDL cholesterol,
It is expected to have the effect of reducing DL cholesterol and / or VLDL cholesterol, and to suppress and treat the progression of arteriosclerosis, and also to suppress obesity. It is also promising for preventing the onset of blood heart disease.

[0010] On the other hand, there are few reports on ligands that significantly activate PPARδ receptors and biological activities involving PPARδ receptors. PPARδ is sometimes referred to as PPARβ, or NUC1 in humans. So far P
As for the biological activity of PARδ, WO9601430 discloses that hNUC1B (a PPAR subtype different from human NUC1 by one amino acid) can suppress the transcriptional activity of human PPARα and thyroid hormone receptor. Also,
Recently, in the specification of WO9728149, PPA
Compounds (agonists) having high affinity to Rδ protein and significantly activating PPARδ have been found, and it has been reported that those compounds have an HDL (high density lipoprotein) cholesterol increasing effect. Was. Therefore, PPA
Agonists capable of activating Rδ include HDL cholesterol elevating action, thereby suppressing the progression of atherosclerosis and treating it.
It is expected to be used as a lipid-lowering agent and hypoglycemic agent, and is also useful for the treatment of hyperlipidemia, hypoglycemic agents, treatment of diabetes, reduction of risk factors for syndrome X, and prevention of ischemic heart disease. It is believed that there is.

[0011]

OBJECTS OF THE INVENTION The present inventors have conducted intensive studies to find a compound having a PPAR receptor controlling action, and as a result, have found that the compound of the present invention represented by the general formula (I) achieves the object. Completed the invention.

DISCLOSURE OF THE INVENTION The present invention relates to (1) a compound represented by the general formula (I)

[0012]

Embedded image

(Wherein R represents a hydrogen atom or an ethyl group) or a non-toxic salt thereof, (2) a method for producing them, and (3) a compound containing them as an active ingredient. Related to drugs. In the present invention, the PPAR receptor modulator is a PPAR receptor α
Type, γ-type, δ-type, α-type + γ-type, α-type + δ-type, γ-type + δ-type, and α-type + γ-type + δ-type control agents. In addition, the preferred control mode of the present invention is a PPAR receptor α-type regulator, a PPAR receptor γ-type regulator, a PPAR receptor δ
Type control agent, PPAR receptor α type + γ type control agent, PPAR
Receptor α-type + δ-type regulator, particularly preferably PP
It is an AR receptor α-type + γ-type regulator.

The PPAR receptor controlling agent of the present invention also includes a PPAR receptor agonist and a PPAR receptor antagonist. Preferred are PPAR receptor agonists, and more preferred are PPAR receptor α-type agonists, PPAR receptor γ-type agonists, PPAR
Receptor δ-type agonist, PPAR receptor α-type + γ-type agonist, PPAR receptor α-type + δ-type agonist,
Particularly preferred are PPAR receptor α-type and γ-type agonists. In the present invention, all isomers are included unless otherwise indicated. For example, the alkyl group, the alkoxy group and the alkylene group include straight-chain and branched ones. Further, isomers (E, Z, cis, trans) in double bonds, rings and condensed rings, isomers due to the presence of asymmetric carbon (R, S, α, β, enantiomers, diastereomers) , An optically active substance having optical activity (D, L, d, l-form), polar forms (high-polarity forms, low-polarity forms) by chromatographic separation, equilibrium compounds, mixtures of any ratio thereof, and racemic mixtures All are included in the present invention.

In the present invention, unless otherwise specified.
Symbol as obvious to the person skilled in the art

Embedded image Indicates that it is connected to the other side of the paper (ie, α-configuration),

Embedded image Indicates that it is connected to the near side of the paper surface (that is, β-configuration),

Embedded image Represents α-, β- or a mixture thereof,

Embedded image Represents a mixture of α-configuration and β-configuration.

The compound represented by the formula (I) can be converted into a non-toxic salt by a known method. In the present specification, the non-toxic salt includes an alkali metal salt, an alkaline earth metal salt, an ammonium salt, an amine salt, an acid addition salt, a solvate and the like. The salt is preferably a non-toxic, water-soluble salt. Suitable salts include salts of alkali metals (potassium, sodium, etc.), salts of alkaline earth metals (calcium, magnesium, etc.), ammonium salts, and pharmaceutically acceptable organic amines (tetramethylammonium, triethylamine, methylamine) Dimethylamine, cyclopentylamine, benzylamine, phenethylamine, piperidine, monoethanolamine, diethanolamine, tris (hydroxymethyl) aminomethane, lysine, arginine, N-methyl-D-glucamine and the like.

The acid addition salts are preferably non-toxic and water-soluble. Suitable acid addition salts include, for example, inorganic salts such as hydrochloride, hydrobromide, hydroiodide, sulfate, phosphate, nitrate, or acetate, lactate, tartrate, benzoate Organic acid salts such as acid, citrate, methanesulphonate, ethanesulphonate, benzenesulphonate, toluenesulphonate, isethionate, glucuronate, gluconate. Preferably, the solvate salt is non-toxic and water-soluble. Suitable solvate salts include, for example, water, alcoholic solvents (eg,
And solvate salts such as ethanol.

[0018]

[Production Method of the Compound of the Present Invention] The compound of the present invention represented by the general formula (I) can be produced by the method described in Examples. In each reaction herein, the reaction product may be purified by conventional purification means, for example, distillation under normal pressure or reduced pressure, high-performance liquid chromatography using silica gel or magnesium silicate, thin-layer chromatography, or column chromatography. Alternatively, it can be purified by a method such as washing and recrystallization. Purification may be performed for each reaction or may be performed after completion of several reactions.

[0019]

[Pharmacological activity] The compound of the present invention represented by the general formula (I)
The following experiments prove that they have PPAR receptor regulatory activity.
It was revealed.PPARα agonist activity and PPARγ agonist
Activity measurement  (1) Lucifer using human PPARα or γ receptor
Preparation of the materials for the enzyme assay The whole operation is based on basic genetic engineering techniques.
Yeast one-hybrid or two-hybrid cis
Utilized a method that is commonly used in systems. Thymidine kina
Luciferase inheritance under the control of the ribonuclease (TK) promoter
PicaGene Basic Vector 2 (trademark)
Product name, Toyo Ink, catalog No. 309-04821)
Cut out the ferase structural gene and add the TK promoter
With pTKβ (Clontech, Catalog No. 6179-1)
TK Promoter,
(-105 / + 51) luciferase gene expression vector
The authors created pTK-Luc. Upstream of the TK promoter,
UAS, a response element of Gal4 protein which is a basic transcription factor of yeast
Is inserted 4 times, and 4xUAS-TK
-Luc. Was constructed and used as a reporter gene. Used below
2 shows the enhancer sequence (SEQ ID NO: 1). Sequence number 1: Enhancer which repeated Gal4 protein response element
-Sequence 5'-T (CGACGGAGTACTGTCCTCCG) x4 AGCT-3 '

A vector expressing a chimeric receptor protein was prepared by fusing the ligand binding region of the nuclear receptor human PPARα or γ receptor to the carboxyl terminus of the DNA binding region of the yeast Gal4 protein, as follows. That is,
PicaGene Basic Vector 2 (trade name, Toyo Ink, Catalog No. 309-04821) was used as a basic expression vector, and the structural gene was replaced with that of the chimeric receptor protein while leaving the promoter / enhancer region intact. D of Gal4 protein
The human PPARα or γ is downstream of the DNA encoding the NA binding region and the amino acid sequence from the 1st to the 147th amino acid sequence.
DNA encoding the ligand-binding region of the receptor is fused in frame so that PicaGene Basic Vector 2
Was inserted downstream of the promoter / enhancer region. At this time, human P was expressed in order to localize the expressed chimeric protein in the nucleus.
At the amino terminus of the ligand binding region of the PARα or γ receptor, a nuclear translocation signal derived from SV40 T-antigen, Ala Pr
o Lys Lys Lys ArgLys Val Gly (SEQ ID NO: 2)
On the other hand, at the carboxy terminus, an influenza hemagglutinin epitope, Tyr Pro Tyr Asp Val Pro Asp Ty
The DNA sequence was such that r Ala (SEQ ID NO: 3) and translation stop codon were arranged in this order.

Human PPARα or γ receptor ligand
The structural gene part used as the binding region was R. Mukherjee
(J. Steroid Biochem. Molec. Biol.,51, 157 (199
4)), M. E. Green et al. (Gene Expression.,Four, 281
(1995)), A. Elbrecht et al. (Biochem Biophys. Res.
 Commun.,224, 431 (1996) or A. Schmidt et al.
ol.Endocrinology.,6, 1634 (1992))
From the structural comparison of the human PPAR receptor, the human PPARα ligand binding region: Ser¹⁶⁷-Tyr⁴⁶⁸  Human PPARγ ligand binding region: Ser¹⁷⁶-Tyr⁴⁷⁸  (In human PPARγ1 receptor and human PPARγ2 receptor,
Ser²⁰⁴-Tyr⁵⁰⁶, And have exactly the same nucleotide sequence. )
Was used. Also, for basic transcription
The PPAR ligand binding region to monitor the effects of
DNA binding region of deleted Gal4 protein, 1st to 147
Has DNA encoding only the amino acid sequence up to
The expression vector was also adjusted. (2) Lucifer using human PPARα or γ receptor
Rase assay

The CV-1 cells used as host cells were cultured according to a conventional method. That is, fetal bovine serum (GIBCO BRL, Catalog No. 261) was added to Dulbecco's modified Eagle's medium (DMEM).
40-061) to a final concentration of 10%, and a medium containing penicillin G at a final concentration of 50 U / ml and streptomycin sulfate at 50 μg / ml in 5% carbon dioxide gas.
Incubated at ℃. At the time of transfection in which both reporter gene and Gal4-PPAR expression vector DNA are introduced into host cells, the cells are previously placed in a 10 cm dish at 2 × 10 ⁶ cells.
After inoculation, the cells were washed once with a serum-free medium, and then 10 ml of the same medium was added. Reporter gene 10
μg, 0.5 μg of Gal4-PPAR expression vector and LipofectAMINE
(Product name, GIBCO BRL, Catalog No. 18324-012) 50μ
1 was mixed well and added to the culture dish. The culture was continued at 37 ° C. for 5 to 6 hours, and 10 ml of dialyzed fetal bovine serum (GIBCO BRL)
Company, Catalog No. 26300-061) A medium containing 20% was added. After culturing at 37 ° C. overnight, the cells were dispersed by trypsinization, and 8000 cells / 100 ml DMEM-10% dialyzed serum
The cells were replated at a cell density of / well in a 96-well plate, cultured for several hours, and when the cells adhered, 100 μl of a DMEM-10% dialyzed serum solution of the compound of the present invention containing twice the test concentration was added. The cells were cultured at 37 ° C. for 42 hours to lyse the cells, and the luciferase activity was measured according to a conventional method.

In this experiment, the positive control compound carbacycline (Eur. J. Biochem., 233 , 242) capable of significantly activating the transcription of the luciferase gene with respect to PPARα.
(1996); see Genes & Development., 10 , 974 (1996)) Table 1 shows the relative activity when 10 μM of the compound of the present invention was added when the luciferase activity when 10 μM was added was 1.0. In addition, a positive control compound troglitazone (Cell., 83 , 863 (1995), Endocrinology., 137 , 4189), which is already marketed as a hypoglycemic agent, can significantly activate the transcription of the luciferase gene against PPARγ.
(1996) and J. Med. Chem., 39 , 665 (1996)).
Table 2 shows the relative activities when 10 μM of the compound of the present invention was added, where the luciferase activity when 0 μM was added was 1.0. Further, for promising compounds, the reproducibility was examined by performing the test three times, and the presence or absence of dose dependency was confirmed.

[0024]

[Table 1]

[0025]

[Table 2]

[0026]

[Toxicity] The toxicity of the compound of the present invention represented by the general formula (I) is extremely low, and it is considered that the compound is sufficiently safe for use as a medicament.

[Application to Pharmaceuticals] The compounds of the present invention represented by the general formula (I) and non-toxic salts thereof have a PPAR receptor controlling action, and are hypoglycemic agents, lipid-lowering agents, diabetes, obesity And / or treatment of metabolic disorders such as Syndrome X, hypercholesterolemia, and hyperlipoproteinemia, hyperlipidemia, arteriosclerosis, hypertension, circulatory disease, bulimia, ischemic heart disease, etc. It is expected to be applied as an agent, an agent for increasing HDL cholesterol, an agent for reducing LDL cholesterol and / or VLDL cholesterol, and an agent for reducing risk factors for diabetes and syndrome X.

The compounds of the present invention represented by the general formula (I) and non-toxic salts thereof have a PPARα agonistic action and / or a PPARγ agonistic action, and are therefore hypoglycemic agents, lipid-lowering agents, ,obesity,
Metabolic disorders such as Syndrome X, hypercholesterolemia, hyperlipoproteinemia, hyperlipidemia, arteriosclerosis, hypertension,
Cardiovascular diseases, preventive and / or therapeutic agents for binge eating, etc.,
HDL cholesterol elevating effect, LDL cholesterol and / or VLDL cholesterol decreasing effect, and atherosclerosis progression suppression and treatment, and obesity suppression effect are expected,
Treatment and prevention of diabetes as a hypoglycemic agent, improvement of hypertension,
It is expected to be used as an agent for reducing the risk factor of syndrome X and preventing ischemic heart disease. In order to use the compound represented by the general formula (I) and a non-toxic salt thereof for the above purpose used in the present invention, it is usually administered systemically or locally, in an oral or parenteral form.

[0028] The dosage is determined by the age, body weight, symptoms, therapeutic effect,
Usually varies from 1 mg to 1000 mg per adult per day, depending on the administration method, treatment time, etc.
Orally or several times or per adult,
Parenteral administration (preferably intravenous administration) once to several times a day in the range of 1 mg to 100 mg at a time,
Alternatively, it is continuously administered intravenously for 1 hour to 24 hours a day. Of course, as described above, the dose varies depending on various conditions, so that a dose smaller than the above-mentioned dose may be sufficient, or may be required beyond the range. When administering the compound represented by the general formula (I),
It is used as a solid composition, a liquid composition and other compositions for oral administration and as an injection, an external preparation, a suppository and the like for parenteral administration. Solid compositions for oral administration include tablets, pills, capsules, powders, granules and the like. Capsules include hard capsules and soft capsules.

In such a solid composition, the one or more active substances comprise at least one inert diluent such as lactose, mannitol, glucose, hydroxypropylcellulose, microcrystalline cellulose, starch, polyvinylpyrrolidone, It is mixed with magnesium metasilicate aluminate. The composition may contain, in a conventional manner, additives other than an inert diluent, for example, a lubricant such as magnesium stearate, a disintegrant such as calcium cellulose glycolate, a stabilizer such as lactose, glutamic acid or asparagine. A solubilizing agent such as an acid may be contained. The tablet or pill may be coated with a film of a gastric or enteric substance such as sucrose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, or may be coated with two or more layers, if necessary. . Also included are capsules of absorbable materials such as gelatin.

Liquid compositions for oral administration include pharmaceutically acceptable emulsions, solutions, syrups, elixirs and the like. In such liquid compositions, one or more active substances are contained in commonly used inert diluents (eg, purified water, ethanol). The composition may contain, in addition to the inert diluent, adjuvants such as wetting agents and suspending agents, sweetening agents, flavoring agents, fragrances, and preservatives. Other compositions for oral administration include sprays which contain one or more active substances and are formulated in a manner known per se. The composition may further comprise a buffering agent which provides isotonicity with a stabilizer other than the inert diluent, such as sodium bisulfite,
For example, they may contain isotonic agents such as sodium chloride, sodium citrate or citric acid. Methods for producing sprays are described in detail, for example, in US Pat. Nos. 2,868,691 and 3,095,355.

The injections for parenteral administration according to the present invention include sterile aqueous and / or non-aqueous solutions, suspensions and emulsions. Aqueous solutions and suspensions include, for example, distilled water for injection and physiological saline.
Examples of the water-insoluble solutions and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol, and Polysorbate 80 (registered trademark). In addition, sterile aqueous and non-aqueous solutions, suspensions, and emulsions may be mixed and used. Such compositions may also contain adjuvants such as preserving, wetting, emulsifying, dispersing, stabilizing (eg, lactose) and solubilizing agents (eg, glutamic acid, aspartic acid). . These are sterilized by filtration through a bacteria retaining filter, blending of a bactericide or irradiation. They can also be used to produce sterile solid compositions, for example, sterilized or dissolved in sterile distilled water for injection or other solvents before use of the lyophilized product. Other compositions for parenteral administration include one or more active substances,
It includes external solutions, ointments, liniments, suppositories for rectal administration, and pessaries for vaginal administration, etc., which are formulated in a conventional manner.

[0032]

Reference Examples and Examples Hereinafter, the present invention will be described in detail with reference to Reference Examples and Examples, but the present invention is not limited thereto. Point of separation by chromatography,
The solvent in parentheses shown in TLC indicates the elution solvent or developing solvent used, and the ratio indicates the volume ratio. NMR
The solvent in the parentheses shown in the column indicates the solvent used for the measurement.

[0033]Reference Example 1  3-methoxycarbonyl-2-isobutyrylaminopro
Panic acid / benzyl ester

Embedded image

To a solution of isobutyric acid (78 mL) in dimethylformamide (2400 mL) were added aspartic acid / α-benzyl β-methyldiester / hydrochloride (240 g) and triethylamine (123 mL). -Hydroxybenzotriazole (131 g), 1-ethyl-3-
After adding (3-dimethylaminopropyl) carbodiimide hydrochloride (180 g) and triethylamine (135 mL), the mixture was stirred at room temperature for 15 hours. The reaction mixture was poured into ice water and extracted with ethyl acetate. The extract was washed with 1N hydrochloric acid, water and saturated saline in this order, dried over anhydrous magnesium sulfate, and concentrated to give the title compound (258 g) having the following physical data.
I got

TLC: Rf 0.46 (hexane: ethyl acetate = 1: 1); NMR (CDCl ₃ ): δ 7.40-7.29 (m, 5H), 6.49 (brd, J)
= 8.0 Hz, 1H), 5.20 (d, J = 12.5 Hz, 1H), 5.16 (d,
J = 12.5 Hz, 1H), 4.90 (dt, J = 8.0, 4.5 Hz, 1H),
3.62 (s, 3H), 3.05 (dd, J = 17.5, 4.5 Hz, 1H), 2.
84 (dd, J = 17.5, 4.5 Hz, 1H), 2.40 (sept, J = 6.5
Hz, 1H), 1.15 (d, J = 6.5 Hz, 3H), 1.14 (d, J = 6.
5 Hz, 3H).

[0036]Reference example 2  3-methoxycarbonyl-2-isobutyrylaminopro
Panic acid

Embedded image

To a solution of the compound (252 g) prepared in Reference Example 1 in ethanol (1000 mL) was added 1
After adding 0% palladium carbon (25.6 g, 50% wt, water-containing), the mixture was stirred at room temperature under hydrogen pressure for 3 hours. The reaction mixture was filtered through celite. The filtrate was concentrated to give the title compound (185 g) having the following physical data.

TLC: Rf 0.17 (hexane: ethyl acetate = 1: 1); NMR (CDCl ₃ ): δ 6.86 (br, 1H), 6.69 (d, J = 8.0)
Hz, 1H), 4.88 (dt, J = 8.0, 4.5 Hz, 1H), 3.72 (s, 3
H), 3.07 (dd, J = 17.5, 4.5 Hz, 1H), 2.87 (dd, J =
17.5, 4.5 Hz, 1H), 2.45 (sept, J = 6.5 Hz, 1H),
1.18 (d, J = 6.5 Hz, 3H), 1.17 (d, J = 6.5 Hz, 3H).

[0039]Reference Example 3  3-acetyl-3-isobutyrylaminopropanoic acid
Chill ester

Embedded image

To a solution of the compound (383 g) prepared in Reference Example 2 in pyridine (800 mL) was added 4-dimethylaminopyridine (6.0 g) and acetic anhydride (800 mL).
Stirred for hours. After allowing the reaction mixture to cool to room temperature, it was poured into ice water and extracted with ethyl acetate. The extract was washed successively with 1N hydrochloric acid, water and saturated saline, dried over anhydrous magnesium sulfate and concentrated, and a mixture of the title compound and acetic anhydride (190.8
g) was obtained. This was used for the next reaction without purification. TLC: Rf 0.26 (hexane: ethyl acetate = 1: 1).

[0041]Reference example 4  2- (2-isopropyl-5-methyloxazole-4
-Yl) acetic acid / methyl ester

Embedded image

Acetic anhydride (400 mL) and concentrated sulfuric acid (40 mL) were added to the compound prepared in Reference Example 3 (190.8 g),
Stirred at C for 2 hours. After allowing the reaction mixture to cool to room temperature, it was poured into ice water and neutralized with sodium hydrogen carbonate. This aqueous solution was extracted with ethyl acetate. The extract was washed with brine, dried over anhydrous magnesium sulfate, and concentrated to give a mixture of the title compound and acetic anhydride (167 g). This mixture was used directly in the next reaction without purification.

TLC: Rf 0.59 (hexane: ethyl acetate = 1: 1); NMR (CDCl ₃ ): δ 3.71 (s, 3H), 3.47 (s, 2H), 3.01
(sept, J = 7.0 Hz, 1H), 2.23 (s, 3H), 1.31 (d, J =
7.0 Hz, 6H).

[0044]Reference example 5  2- (2-isopropyl-5-methyloxazole-4
-Yl) ethanol

Embedded image

A solution of the compound (167 g) prepared in Reference Example in anhydrous tetrahydrofuran (200 mL) was added dropwise to a solution of lithium aluminum hydride (32 g) in anhydrous tetrahydrofuran (1700 mL) under ice cooling. Stir for 1 hour.
To the reaction mixture was added a saturated aqueous sodium sulfate solution (17
0 mL) was added dropwise, and the mixture was stirred at room temperature for 1 hour. After adding t-butyl methyl ether (1000 mL) to the reaction mixture and stirring, anhydrous magnesium sulfate was added and the mixture was filtered through celite. The filtrate was concentrated to give the title compound (104 g) having the following physical data.

TLC: Rf 0.14 (hexane: ethyl acetate =
2: 1); NMR (CDCl ₃ ): δ 3.85 (dt, J = 6.0, 6.0 Hz, 2H),
3.36-3.27 (m, 1H), 2.98 (sept, J = 7.0 Hz, 1H), 2.
62 (t, J = 6.0 Hz, 2H), 2.22 (s, 3H), 1.30 (d, J =
7.0 Hz, 6H).

[0047]Reference Example 6  3- (3-benzyloxyphenyl) propanoic acid / methyl
Ruster

Embedded image

To a solution of 3- (3-hydroxyphenyl) propanoic acid methyl ester (192 g) in dimethylformamide (1000 mL) were added benzyl bromide (191 g) and potassium carbonate (220 g). Stirred overnight. The reaction mixture was poured into ice water and extracted with a mixed solvent (hexane: ethyl acetate = 2: 1). The extract was washed successively with water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated to give the title compound (273 g) having the following physical data.
I got

TLC: Rf 0.61 (hexane: ethyl acetate =
3: 1); NMR (CDCl ₃ ): δ 7.46-7.29 (m, 5H), 7.24-7.17 (m,
1H), 6.85-6.78 (m, 3H), 5.05 (s, 2H), 3.67 (s, 3
H), 2.93 (t, J = 7.0 Hz, 2H), 2.62 (t, J = 7.0 Hz,
2H).

[0050]Reference Example 7  3- (3-benzyloxyphenyl) propanol

Embedded image

A solution of the compound (273 g) prepared in Reference Example 6 in anhydrous tetrahydrofuran (300 mL) was added dropwise to a solution of lithium aluminum hydride (38 g) in anhydrous tetrahydrofuran (2000 mL) under ice cooling. Stirred at C for 1 hour. A saturated aqueous sodium sulfate solution (200 mL) was added dropwise to the reaction mixture under ice cooling, and the mixture was stirred at room temperature for 1 hour. After adding t-butyl methyl ether (1000 mL) to the reaction mixture and stirring, anhydrous magnesium sulfate was added and the mixture was filtered through celite. The filtrate was concentrated to give the title compound (238 g) having the following physical data.

TLC: Rf 0.19 (hexane: ethyl acetate =
3: 1); NMR (CDCl ₃ ): δ 7.46-7.29 (m, 5H), 7.20 (t, J =
8.0 Hz, 1H), 6.85-6.79 (m, 3H), 5.05 (s, 2H), 3.66
(t, J = 6.5 Hz, 2H), 2.72-2.65 (m, 2H), 1.94-1.82
(m, 2H).

[0053]Reference Example 8  1-benzyloxy-3- (2-formylethyl) ben
Zen

Embedded image

To a solution of the compound (238 g) prepared in Reference Example 7 in dimethyl sulfoxide (1500 mL) was added triethylamine (700 mL), and under ice-cooling, sulfur trioxide pyridine complex (400 g) was added. The mixture was stirred at about 25 ° C for 2 hours. The reaction mixture was poured into ice water and extracted with a mixed solvent (hexane: ethyl acetate = 2: 1). After hexane was added to the extract, the mixture was washed successively with water and saturated saline and concentrated with anhydrous magnesium sulfate to obtain the title compound (232 g) having the following physical data.

TLC: Rf 0.44 (hexane: ethyl acetate =
3: 1); NMR (CDCl ₃ ): δ 9.82 (t, J = 1.0 Hz, 1H), 7.46-
7.27 (m, 5H), 7.25-7.17 (m, 1H), 6.85-6.78 (m, 3H),
5.05 (s, 2H), 2.94 (t, J = 7.5 Hz, 2H), 2.80-2.74
(m, 2H).

[0056]Reference Example 9  1-benzyloxy-3- (3,3-diethoxypropyl
Le) benzene

Embedded image

To a solution of the compound (232 g) produced in Reference Example 8 in ethanol (1500 mL) was added p-toluenesulfonic acid monohydrate (9.2 g), and the mixture was refluxed for 3 hours. The reaction mixture was allowed to cool to room temperature, concentrated under reduced pressure to about one-third, and then a mixed solvent (hexane: ethyl acetate = 2: 1, 1000 mL) was added. The solution was washed successively with a saturated aqueous solution of sodium hydrogen carbonate, a diluted saline solution and a saturated saline solution, dried over anhydrous magnesium sulfate, and concentrated to give the title compound (279 g) having the following physical data. This was used directly in the next reaction without purification. TLC: Rf 0.72 (hexane: ethyl acetate = 3: 1).

[0058]Reference example 10  1-benzyloxy-3- (3-cyano-3-ethoxy
Propyl) benzene

Embedded image

To a solution of the compound (4.5 g) prepared in Reference Example 9 in methylene chloride (110 mL) was added trimethylsilyl cyanide (5.7 mL) and a boron trifluoride-diethyl ether complex (0.45 mL), and the mixture was added at room temperature. Stir for 1 hour. The reaction mixture was diluted with methylene chloride. The diluted solution was washed successively with a saturated aqueous solution of sodium hydrogen carbonate, water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 30: 1 → 9: 1) to give the title compound (3.80 g) having the following physical data.

TLC: Rf 0.33 (hexane: ethyl acetate =
8: 1); NMR (CDCl ₃ ): δ 7.48-7.30 (m, 5H), 7.23 (m, 1H),
6.88-6.75 (m, 3H), 5.06 (s, 2H), 4.02 (t, J = 7.0
Hz, 1H), 3.81 (m, 1H), 3.46 (m, 1H), 2.80 (t, J =
7.5 Hz, 2H), 2.14 (m, 2H), 1.26 (t, J = 7.0 Hz, 3
H).

[0061]Reference Example 11  4- (3-benzyloxyphenyl) -2-ethoxyb
Tanoic acid

Embedded image

To a solution of the compound prepared in Reference Example 10 (3.79 g) in ethanol (225 mL) was added a 5N aqueous sodium hydroxide solution (75 mL), and the mixture was refluxed for 3 hours. The reaction mixture was allowed to cool to room temperature and concentrated. The residue was diluted with water. After washing the diluted solution with diethyl ether, after acidifying with concentrated hydrochloric acid,
Extracted with ethyl acetate. The extract was washed with water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated to give the title compound (4.03 g) having the following physical data.

TLC: Rf 0.21 (chloroform: methanol = 20: 1); NMR (CDCl ₃ ): δ 7.47-7.30 (m, 5H), 7.21 (dd, J =
9.0, 7.0 Hz, 1H), 6.86-6.76 (m, 3H), 5.05 (s, 2
H), 3.87 (t, J = 6.0 Hz, 1H), 3.58 (m, 2H), 2.74
(t, J = 8.0 Hz, 2H), 2.09 (m, 2H), 1.27 (t, J = 7.
0 Hz, 3H).

[0064]Reference Example 12  4- (3-benzyloxyphenyl) -2-ethoxyb
Tanoic acid / ethyl ester

Embedded image

To a solution of the compound (4.03 g) produced in Reference Example 11 in methylene chloride (65 mL) was added ethanol (1.20 g).
g), 4-dimethylaminopyridine (240 mg) and 1
-Ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (3.76 g) was added, and the mixture was stirred at room temperature for 15 hours. The reaction mixture was poured into ice water, and the organic layer was separated. The organic layer was washed with 0.1N hydrochloric acid, water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated to give the title compound (4.39 g) having the following physical data.

TLC: Rf 0.76 (hexane: ethyl acetate =
2: 1); NMR (CDCl ₃ ): δ 7.47-7.31 (m, 5H), 7.20 (m, 1H),
6.90-6.76 (m, 3H), 5.05 (s, 2H), 4.20 (m, 2H), 3.
80 (t, J = 6.5 Hz, 1H), 3.65 (m, 1H), 3.39 (m, 1
H), 2.73 (m, 2H), 2.03 (ddd, J = 7.0, 7.0, 7.0 Hz,
2H), 1.32-1.21 (m, 6H).

[0067]Reference Example 13  4- (3-hydroxyphenyl) -2-ethoxybutane
Acid / ethyl ester

Embedded image

A mixture of the compound (4.38 g) prepared in Reference Example 12 in ethanol (130 mL) and acetic acid (50 mL) was added to a 10% palladium carbon (450 m
After adding g), the mixture was stirred at room temperature under a hydrogen atmosphere for 5 hours.
The reaction mixture was filtered through celite. The filtrate was concentrated to give the title compound (2.11 g) having the following physical data.

TLC: Rf 0.47 (hexane: ethyl acetate =
3: 1); NMR (CDCl ₃ ): δ 7.15 (m, 1H), 6.76 (d, J = 8.0 H
z, 1H), 6.70-6.63 (m, 2H), 4.93 (brs, 1H), 4.20 (m,
2H), 3.80 (t, J = 6.5 Hz, 1H), 3.66 (m, 1H), 3.40
(m, 1H), 2.71 (m, 2H), 2.02 (m, 2H), 1.32-1.21
(m, 6H).

[0070]Example 1  4- (3- (2- (2-isopropyl-5-methyloxy)
Sazol-4-yl) ethoxy) phenyl) -2-eth
Xybutanoic acid / ethyl ester

Embedded image

The compound prepared in Reference Example 13 (1.00 g),
To a solution of the compound (1.00 g) produced in Reference Example 5 and triphenylphosphine (1.55 g) in methylene chloride (70 mL) was added 1,1 ′-(azodicarbonyl) dipiperidine (1.49 g) at room temperature under an argon gas atmosphere. ) Was added and stirred for 18 hours. The reaction mixture was concentrated. The residue was diluted with diethyl ether and filtered. The filtrate was washed sequentially with a 2N aqueous sodium hydroxide solution, water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated. The residue was subjected to silica gel column chromatography (hexane: ethyl acetate = 5: 1 → 3:
The compound of the present invention (1.08) having the following physical properties was purified by 1).
g) was obtained.

TLC: Rf 0.41 (hexane: ethyl acetate = 2: 1); NMR (CDCl ₃ ): δ 7.88 (d, J = 8.7 Hz, 2H), 7.28-
7.24 (m, 2H), 7.19-7.13 (m, 1H), 6.78-6.70 (m, 3H),
4.23-4.13 (m, 4H), 3.78 (t, J = 6.3 Hz, 1H), 3.70
-3.58 (m, 1H), 3.45-3.33 (m, 1H), 2.96 (t, J = 6.9
Hz, 1H), 2.80-2.60 (m, 2H), 2.58-2.48 (m, 1H), 2.
36 (s, 3H), 2.06-1.98 (m, 2H), 1.95-1.70 (m, 6H),
1.50-1.30 (m, 4H), 1.29-1.22 (m, 6H).

[0073]Example 2  4- (3- (2- (2-isopropyl-5-methyloxy)
Sazol-4-yl) ethoxy) phenyl) -2-eth
Xybutanoic acid, sodium salt

Embedded image

To a solution of the compound prepared in Example 1 (1.08 g) in ethanol (20 mL) was added a 2N aqueous sodium hydroxide solution (2.00 mL) at room temperature, and the mixture was stirred for 15 hours. The reaction mixture was adjusted to pH 4-5 with 2N hydrochloric acid and extracted with ethyl acetate.
The extract was washed sequentially with water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated. A 1N aqueous solution of sodium hydroxide (2.27 mL) was added to a solution of the residue (0.85 g) in ethanol (20 mL) at room temperature, followed by lyophilization to give the compound of the present invention (902 mg) having the following physical data. Was.

TLC: Rf 0.27 (chloroform: methanol = 9: 1); NMR (DMSO-d ₆ ): δ 7.17-7.10 (m, 1H), 6.72-6.63
(m, 3H), 4.08 (t, J = 6.6 Hz, 2H), 3.64-3.54 (m, 1
H), 3.40-3.30 (m, 1H), 3.21-3.10 (m, 1H), 2.93 (se
pt, J = 7.2 Hz, 1H), 2.77 (t, J = 6.6 Hz, 2H), 2.6
1-2.45 (m, 2H), 2.20 (s, 3H), 1.83-1.60 (m, 2H),
1.22 (d, J = 7.2 Hz, 6H), 1.06 (t, J = 7.2 Hz, 3
H).

[0076]

[Formulation example]Formulation Example 1  The following components are mixed in a conventional manner, and then tableted.
To give 100 tablets containing 50 mg of the active ingredient.・ 4- (3- (2- (2-isopropyl-5-methyloxazol-4-yl) ethoxy) phenyl) -2-ethoxybutanoic acid ・ sodium salt ・ ・ ・ ・ ・ 5.0g ・ Carboxymethylcellulose calcium (disintegrant・ ・ ・ ・ ・ 0.2g ・ Magnesium stearate (lubricant) ・ ・ ・ ・ ・ ・ ・ 0.1g ・ Microcrystalline cellulose ・ ・ ・ ・ ・ 4.7g

[0077]Formulation Example 2  After mixing the following components by a conventional method, the solution is mixed by a conventional method.
Sterile, fill in 5 ml aliquots, and freeze by standard methods
Freeze dried and contains 20mg of active ingredient in 1 ampoule
100 ampoules were obtained.・ 4- (3- (2- (2-isopropyl-5-methyloxazol-4-yl) ethoxy) phenyl) -2-ethoxybutanoic acid ・ sodium salt ・ ・ ・ ・ ・ 2.0g ・ mannitol ・ ・ ・ ・ ・ ・ ・20g ・ Distilled water ・ ・ ・ ・ 1000ml

[0078]

[Sequence List] Sequence Listing <110> ONO Pharmaceutical Co., Ltd. <120> BUtanoic acid derivatives <130> PPJP-17 <160> 3 <170> PatentIn Ver. 2.1 <210> 1 <211> 85 <212> DNA <213> Artificial sequence <220> <223> Enhancer sequence including 4 times repeated Gal4 protein response sequences <400> 1 tcgacggagt actgtcctcc gcgacggagt actgtcctcc gcgacggagt actgtcctcc 60 gcgacggagt actgtcctcc gagct 85 <210> 2 <211> 9 <212> 213> Unknown <220> <223> Nuclear localozation signal derived from SV-40 T-antigen <400> 2 Ala Pro Lys Lys Lys Arg Lys Val Gly 1 5 <210> 3 <211> 9 <212> PRT <213> Influenza virus <220> <223> hemagglutinin epitope <400> 3 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 1 5

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (reference) A61P 9/00 A61P 9/00 9/10 101 9/10 101 9/12 9/12 F term (reference) 4C056 AA01 AB01 AC02 AD01 AE03 BA03 BA08 BB01 BC01 4C086 AA02 AA03 BC69 MA04 MA52 MA55 NA14 ZA36 ZA42 ZA45 ZA70 ZC33 ZC35

Claims (1)

[Claims] 1. A compound of the general formula (I) (Wherein, R represents a hydrogen atom or an ethyl group), or a non-toxic salt thereof.