JP2002325590A - Keratinocyte growth factor-2 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new polypeptide presumably identified as a member of a fibroblast growth factor(FGF) family and further especially presumably identified as a keratinocyte growth factor-2(KGF-2) as a result of amino acid sequence homology to other members of the FGF family and a polynucleotide encoding the polypeptde. SOLUTION: (a) This polypeptide has a specific presumed amino acid sequence or the polynucleotide encodes a fragment, an analog or a derivative of the polypeptide. (b) The polypeptide has an amino acid sequence encoded with a cDNA contained in an ATCC accession number 75977 or the isolated polynucleotide is selected from the group consisting of polynuleotides encoding the fragment, the analog or the derivative of the polypeptide and the polypeptide is encoded with the polynucleotide.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and also the use of such polynucleotides. It concerns the production of nucleotides and polypeptides. In particular, the polypeptide of the present invention comprises a keratinocyte growth factor-2, sometimes referred to hereinafter as "KGF-2".
It is. The present invention also relates to inhibiting the action of such polypeptides.

[0002]

BACKGROUND OF THE INVENTION The fibroblast growth factor family has emerged as a large family of growth factors involved in the growth and regeneration of soft-tissue. Currently, the families share varying degrees of homology at the protein level and, with one exception, have similar broad mitogen spectra, i.e., they have diverse mesoderm and neuroectoderm derived origins Includes several members that appear to promote cell growth and / or promote angiogenesis. The expression patterns of various members of the family vary widely, from very limited expression at some stages of development to expression ubiquitous in various tissues and organs. All members bind to heparin and heparin sulfate proteoglycans and glycosaminoglycans and appear to be strongly concentrated in the extracellular matrix. KGF was originally identified as a member of the FGF family by sequence homology or purification and cloning of factors.

[0003]

Keratinocyte growth factor (KGF) has been isolated as a mitogen of cultured mouse keratinocyte strains (Rubin, JS et al.
PNAS, USA, 86: 802-806 (198
9)). Unlike other members of the FGF family, they have little activity on cells derived from mesenchyme, but stimulate the proliferation of epithelial cells. The keratinocyte growth factor gene is 194
Encoding an amino acid polypeptide of (Finc
h, PW) et al., Science, 245: 752-755 (1
989)). The N-terminal 64 amino acids are unique,
The rest of the protein has about 30% homology to bFGF. KGF is the most deviant member of the FGF family. The molecule has a hydrophobic signal sequence and is secreted effectively. Post-translational modifications include cleavage of the signal sequence and N-linked glycosylation at one site, resulting in a 28 kDa protein. Keratinocyte growth factor is produced by fibroblasts from skin and fetal lung (Rubin et al. (1989)). Keratinocyte growth factor mRNA has been found to be expressed in adult kidney, colon and iliac but not in brain or lung (Finch et al., Science, 245: 752-75).
5 (1989)). KGF indicates a conserved region within the FGF protein family. KGF binds to the FGF-2 receptor with high affinity.

[0004]

SUMMARY OF THE INVENTION The polypeptides of the present invention have been putatively identified as members of the family of FGFs, and in particular, the polypeptides have been identified as KGF as a result of amino acid sequence homology with other members of the FGF family. −
It has been presumed to be 2. According to one aspect of the present invention, there is provided a novel mature polypeptide that is KGF-2 and fragments, analogs and derivatives thereof that are biologically active and diagnostically or therapeutically useful. The polypeptides of the present invention are of human origin. According to one aspect of the invention, mRNA, DNA, cDN
A, isolated nucleic acid molecules encoding human KGF-2, including genomic DNA, and also antisense analogs thereof, as well as biologically active, diagnostically or therapeutically useful fragments thereof. provide.

According to another aspect of the present invention, there is provided a method for producing such a polypeptide by recombinant techniques using recombinant vectors such as cloning and expression plasmids useful as reagents in the recombinant production of KGF-2 protein; And a recombinant prokaryotic and / or eukaryotic host cell comprising the nucleic acid sequence of human KGF-2. According to yet another aspect of the present invention, there is provided a therapeutic object for stimulating epithelial cell proliferation for wound healing and stimulating hair follicle production and stimulating skin wound healing, for example. And methods of using such polypeptides or polynucleotides encoding such polypeptides.

In accordance with yet another aspect of the present invention, there are provided antibodies against such polypeptides. According to yet another aspect of the invention, there is provided a nucleic acid probe comprising a nucleic acid molecule of sufficient length to specifically hybridize to a human KGF-2 sequence. According to yet another aspect of the invention, there are provided antagonists to such polypeptides.
The antagonists may be useful for such polypeptides, such as reducing scarring in the wound healing process, preventing and / or treating tumor growth, diabetic retinopathy, rheumatoid arthritis and tumor growth. It is used to suppress the action.

According to yet another aspect of the present invention, KGF-
2. A diagnostic assay for detecting a disease associated with a mutation in a nucleic acid sequence or overexpression of a polypeptide encoded by such a sequence or a susceptibility to the disease. According to another aspect of the invention, the use of such polypeptides or polynucleotides encoding such polypeptides for in vitro purposes related to scientific research, DNA synthesis and production of DNA vectors Provide a way to These and other aspects of the invention will be apparent to those skilled in the art from the teachings herein.

According to one embodiment of the present invention, FIGS.
CD of the mature polypeptide having the deduced amino acid sequence of (SEQ ID NO: 2), or of the clone deposited as ATCC Accession No. 75977 on December 16, 1994.
Provided is an isolated nucleic acid (polynucleotide) encoding a mature polypeptide encoded by NA. The polynucleotide encoding the polypeptide of the present invention,
Obtained from human prostate and fetal lung. A fragment of the cDNA encoding the polypeptide was first isolated from a library from human normal prostate. The open reading frame encoding the full-length protein was subsequently isolated from a randomly primed human fetal lung cDNA library. It is structurally related to the FGF family. It contains an open reading frame encoding a protein of 208 amino acid residues, of which the first 36 amino acid residues are the putative leader sequence and therefore the mature protein contains 172 amino acids. The protein exhibits the highest degree of homology to human keratinocyte growth factor over a length of 206 amino acids with 45% identity and 82% similarity.

[0009] The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, wherein the DNA comprises cD
NA, genomic DNA, and synthetic DNA. The DNA can be double-stranded or single-stranded, and if single-stranded, can be the coding strand or the non-coding (anti-sense) strand. The coding sequence encoding the mature polypeptide is shown in FIGS. 1-3 (SEQ ID NO: 2)
Or the deposited cDNA or the deposited cDNA as a result of duplication or degeneracy of the genetic code. Different coding sequences may encode the same mature polypeptide.

The polynucleotide encoding the mature polypeptide of FIGS. 1-3 (SEQ ID NO: 2) or the mature polypeptide encoded by the deposited cDNA can include the following: Coding sequence only; coding sequence of the mature polypeptide, and additional coding sequences such as leader or secretory or proprotein sequences; coding sequence of the mature polypeptide (and, optionally, additional coding sequences); Non-coding sequences, such as introns of coding sequences or non-coding sequences 5 'and / or 3'.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide that includes only the coding sequence of the polypeptide, as well as a polynucleotide that includes additional coding and / or non-coding sequences.

The present invention further relates to FIGS. 1 to 3 (SEQ ID NO:
A variant of the above polynucleotide which encodes a polypeptide having the deduced amino acid sequence of 2) or a fragment, analog or derivative of the polypeptide encoded by the cDNA of the deposited clone. A variant of a polynucleotide can be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide. Accordingly, the present invention provides a polynucleotide encoding the same mature polypeptide as shown in FIGS. 1-3 (SEQ ID NO: 2) or the same mature polypeptide encoded by the cDNA of the deposited clone, and also And variants of such polynucleotides, such as fragments or derivatives of the polypeptides encoded by the polypeptides of FIGS. 1-3 (SEQ ID NO: 2) or the cDNA of the deposited clone. Or code analog. Such nucleotide variants include deletion variants, substitution variants, and addition and insertion variants.

Referring to the cDNA and corresponding deduced amino acid sequence of the polypeptide of the present invention shown in FIGS. 1-3 (SEQ ID NO: 1), the first 36 amino acid residues represent the deduced leader sequence (underlined). . The figures use standard one-letter abbreviations for amino acids. Sequencing inaccuracy is a common problem when trying to determine polynucleotide sequences. Sequencing is 373 automated DNA
This was performed using a sequencer (Applied Biosystems, Inc.).
Sequencing accuracy is expected to be greater than 97%.
As indicated above, the polynucleotides correspond to FIGS.
(SEQ ID NO: 1) may have a coding sequence that is a naturally occurring allelic variant of the coding sequence shown in (SEQ ID NO: 1) or a naturally occurring allelic variant of the coding sequence of the deposited clone. As is known in the art, an allelic variant is another form of a polynucleotide sequence that may have one or more nucleotide substitutions, deletions or additions, wherein the It does not substantially alter the function of the peptide.

[0013] The present invention also provides that the coding sequence of the mature polypeptide is a polynucleotide sequence that aids in the expression and secretion of the polypeptide from the host cell, eg, a secretory sequence for controlling the transport of the polypeptide from the cell. A functional leader sequence also includes a polynucleotide that can be fused in the same reading frame. A polypeptide having a leader sequence is a preprotein and may have a leader sequence that has been cleaved by a host cell to form a mature polypeptide. The polynucleotide may also encode a proprotein that is a mature protein with additional 5 'amino acid residues. A mature protein having a prosequence is a proprotein and an inactive form of the protein. Once the prosequence is cleaved, the active mature protein remains. Thus, for example, a polynucleotide of the invention may encode a mature protein, or a protein having a prosequence, or a protein having both a prosequence and a presequence (leader sequence).

The polynucleotide of the present invention may also have the coding sequence fused in frame to a marker sequence that allows for purification of the polypeptide of the present invention. In the case of a bacterial host, the marker sequence may be a hexa-histidine tag provided by the pQE-9 vector to provide for purification of the mature polypeptide fused to the marker, or, for example, A mammalian host, e.g., CO
When using S-7 cells, the marker sequence is:
It may be a hemagglutinin (HA) tag. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cel.
1, 37: 767 (1984)).

The present invention further provides that at least 50
%, And preferably 70% identity, to polynucleotides that hybridize to the above sequences. The invention particularly relates to polynucleotides that hybridize under stringent conditions to the above polynucleotides. As used herein, the term "stringent conditions" refers to at least 95%
It also preferably means that hybridization will only occur if there is at least 97% identity. In a preferred embodiment, the polynucleotide that hybridizes to the above-described polynucleotide is the polynucleotide of FIGS.
CDNA of (SEQ ID NO: 1) or deposited cDNA
Encodes a polypeptide that retains substantially the same biological function or activity as the mature polypeptide encoded by

The deposit referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Patent Procedure. These deposits are provided solely for the convenience of those skilled in the art, and
It is not an admission that it is required under U.S.C. §112. The sequence of the polynucleotide contained in the deposited material, and also the amino acid sequence of the polypeptide encoded thereby, form part of the present specification and may include any of the sequences herein. Whenever it conflicts with the description, it is checked. A license may be required to make, use, or sell the deposited material, and no such license is granted herein.

The present invention further relates to FIGS. 1 to 3 (SEQ ID NO:
C having the deduced amino acid sequence of 2) or deposited
It also relates to polypeptides having the amino acid sequence encoded by DNA, as well as fragments, analogs and derivatives of such polypeptides. 1 to 3
Polypeptide of (SEQ ID NO: 2) or deposited cD
When referring to a polypeptide encoded by NA, the terms "fragment,""derivative," and "analog" refer to a polypeptide that retains essentially the same biological function or activity as such a polypeptide. .
Thus, an analog includes a protein that can be activated by cleavage of the protein portion to produce an active mature polypeptide. The polypeptide of the present invention may be a recombinant, natural or synthetic polypeptide, preferably a recombinant polypeptide.

Fragments, derivatives or analogs of the polypeptides of FIGS. 1-3 (SEQ ID NO: 2) or of the polypeptide encoded by the deposited cDNA are:
(I) one or more amino acid residues have been replaced with homologous or non-homologous amino acid residues (preferably homologous amino acid residues), and such substituted amino acid residues are encoded by the genetic code Or (ii) one or more amino acid residues include a substituent,
Or (iii) the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol), or (iv) a leader or secretory sequence, or mature Additional amino acids may be fused to the mature polypeptide, such as a sequence used to purify the polypeptide, or a protein sequence. Such fragments, derivatives and analogs are deemed to be within the skill of the art in light of the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity. The term "isolated" means that the substance has been removed from its original environment (eg, the natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide in a living animal has not been isolated, but the same polynucleotide or polypeptide isolated from some or all of the coexisting materials in the natural system has been isolated. ing. Such polynucleotides can be part of a vector, and / or such polynucleotides or polypeptides can be part of a composition, and such vectors or compositions are not part of their natural environment. And still isolated.

The present invention also relates to vectors containing the polynucleotides of the present invention, host cells genetically engineered with the vectors of the present invention, and recombinant production of the polypeptides of the present invention. A host cell is genetically engineered (transduced or transformed or transfected) with a vector of the invention, which can be, for example, a cloning vector or an expression vector. The vector can be, for example, in the form of a plasmid, virus particle, phage, and the like. The engineered host cells can be cultured in a conventional nutrient medium that has been modified to activate the promoter, select for transformants, or amplify the KGF-2 gene. Culture conditions, such as temperature, pH, etc., are those previously used in the host cell selected for expression and will be apparent to those skilled in the art.

The polynucleotide of the present invention can be used to produce a peptide by recombinant techniques.
Thus, for example, the polynucleotide can be included in any one of various expression vectors for expressing the polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as SV40.
Bacterial plasmid; phage DNA; baculovirus; yeast plasmid; plasmid and phage DN
A vector obtained from the combination with A; viral DNA such as vaccinia, adenovirus, fowlpox virus, and pseudorabies. However, any other vector can be used as long as it is replicable and viable in the host.

The appropriate DNA sequence can be inserted into the vector by various methods. Generally, the DNA sequence is inserted into an appropriate restriction endonuclease site by methods known in the art. Such and other methods are:
It is believed to be within the purview of those skilled in the art. Expression vector DN
The A sequence is operably linked to an appropriate expression control sequence (promoter) to effect mRNA synthesis. Representative examples of such promoters include: L
TR or SV40 promoter, E. coli lac or t
rp, the phage lambda P _L promoter, and prokaryotic or eukaryotic cells or other promoters known to control expression of genes in their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression. Furthermore, the expression vector may be such as dihydrofolate reductase or neomycin resistance in eukaryotic cell culture, or E. c.
Oli preferably contains one or more selectable marker genes to confer phenotypic characteristics for the selection of transformed host cells, such as tetracycline or ampicillin resistance.

A suitable DNA sequence as described above, as well as a vector containing a suitable promoter or control sequence, can be used to transform a suitable host to allow that host to express the protein. Can be Representative examples of suitable hosts include the following: E. coli , Streptomyces , Salmonella typh
bacterial cells such as imurium ; fungal cells such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9 ; animal cells such as CHO, COS or Bowes melanoma; adenovirus; The selection of an appropriate host will be within the skill of the art in light of the teachings herein.

In particular, the present invention also includes a recombinant construct comprising one or more of the sequences broadly described above. The construct comprises a vector, such as a plasmid or viral vector, into which the sequences of the invention have been inserted in forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter operably linked to the sequence. Many suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are given as examples. For bacteria: pQE70, pQE60, pQE
-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript S
K, pbsks, pNH8A, pNH16a, pNH18A, pN
H46A (Stratagene); ptrc99
a, pKK223-3, pKK233-3, pDR540,
pRIT5 (Pharmacia). For eukaryotes:
pWLNEO, pSV2CAT, pOG44, pXT1, p
SG (Stratagene), pSVK3, pBPV, pMSG, pS
VL (Pharmacia). However, any other plasmid or vector can be used as long as they are replicable and viable in the host.

The promoter region can be selected from any desired gene using a CAT (chloramphenicol transferase) vector or another vector having a selection marker. Two suitable vectors are PKK232-8 and PCM7. Individually named bacterial promoters include lacI, lacZ,
T3, T7, gpt, lambda _P R, include _{P L} and trp. Eukaryotic promoters include immediate early CMV
arly), HSV thymidine kinase, early and late SV
40, LTR from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further aspect, the present invention relates to a host cell comprising the above-described construct. The host cell can be a higher eukaryotic cell, such as a mammalian cell, a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into a host cell
It can be done by calcium phosphate transfection, DEAE-dextran mediated transfection or electroporation. (Davis (Dav
is, L.), Dibner (M.), Batty (Ba
ttey, L.), Basic Methods in Molecular Biolo
gy) (1986)).

The construct in a host cell can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptide of the present invention can be produced synthetically using a conventional peptide synthesizer. Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Such a protein,
Cell-free translation systems can also be used for production with RNA obtained from the DNA constructs of the present invention. Cloning and expression vectors suitable for use in prokaryotic and eukaryotic hosts are described in Sambrook.
Et al., Molecular Clonin
g): A Laboratory Manual (A Laboratory Ma)
nual), 2nd edition, Cold Spring Harbor (C
old Spring Harbor), New York, (1989), the disclosure of which is hereby incorporated by reference.

DNA encoding the polypeptide of the present invention
Transcription by higher eukaryotes is increased by inserting an enhancer sequence into the vector. The enhancer is
Acts on a promoter to increase its transcription, usually
It is a cis-acting element of DNA of about 10-300 bp.
Examples include the SV40 enhancer on the late side of the replication origin, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers at bp 100-270.

Typically, the recombinant expression vector contains an origin of replication and a selectable marker that allows for transformation of the host cell, such as the ampicillin resistance gene of E. coli and the S. cerevisiae TRP1 gene, and the downstream gene. A promoter derived from a highly expressed gene to drive transcription of the structural sequence would be included. Such promoters include, inter alia, 3
-It can be obtained from operons encoding glycolytic enzymes such as phosphoglycerate kinase (PGK), α-factor, acid phosphatase or heat shock proteins. The heterologous structural sequence is assembled in appropriate phase, with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of the translated protein into the periplasmic space or extracellular medium. . Optionally, the heterologous sequence can encode a fusion protein that includes an N-terminal identification peptide that confers desired properties, such as stabilization or purification of the expressed recombinant product.

Expression vectors useful for use in bacteria include structural DNA sequences encoding the desired protein;
It is constructed by insertion into an operable reading phase having a functional promoter, with appropriate translation initiation and termination signals. The vector includes one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and, if desired, to provide for amplification in the host. Will be. Prokaryotic hosts suitable for transformation include E. coli and Bacillus subtilis.
s subtilis), Salmonella typhimurium (Salmon
ella typhimurium ) and Pseudomonas ( Pseudo )
monas) genus Streptomyces (Streptomyces) genus,
And various species within the genus Staphylococcus, but others can also be used as selection agents.

As a representative, but non-limiting example, a vector useful for bacterial use is obtained from a commercially available plasmid comprising the genetic elements of the well-known cloning vector pBR322 (ATCC 37017). It may comprise a selectable marker and a bacterial origin of replication. Such commercially available vectors include, for example, pKK2
23-3 (Pharmacia Fine Chemicals (Pharm
acia Fine Chemicals), Uppsala, Sweden) and GEM1 (PromegaBiotec),
Madison, Wisconsin, USA). These pBR322 "bone nuclei" portions are combined with an appropriate promoter and the structural sequence to be expressed.

After transforming a suitable host strain and growing the host strain to a suitable cell density,
The selected promoter is induced by a suitable method (eg, temperature shift or chemical induction) and the cells are cultured for an additional period. The cells are typically collected by centrifugation and disrupted by physical or chemical methods, and the resulting crude extract is retained for further purification. Microbial cells used for protein expression can be disrupted by any conventional method, including freeze-thaw cycles, sonication, mechanical disruption, or the use of cell lysing agents, and such methods are known to those skilled in the art. It is well known.

[0033] Various mammalian cell culture systems can also be used to express the recombinant protein.
Examples of mammalian expression systems include Gluzman, Cel
1, 23: 175 (1981),
Includes the COS-7 line of monkey kidney fibroblasts and other cell lines capable of expressing compatible vectors, such as C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors contain an origin of replication, a suitable promoter and enhancer, as well as any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and non-transcribed sequences flanking the 5 '. Will also comprise. DNA sequences derived from SV40 splicing, and polyadenylation sites can be used to provide the required non-transcribed genetic elements.

The KGF-2 polypeptide can be prepared by ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography,
It can be recovered from the recombinant cell culture and purified by methods including affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. If desired, a protein regeneration step can be used to complete the configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step. The polypeptides of the present invention can be naturally purified products, or products of chemical synthesis, or from prokaryotic or eukaryotic hosts, such as bacteria, yeast, higher plants, insects and mammals in culture. It can be produced by recombinant technology (by cells). Depending on the host used in the recombinant production method, the polypeptide of the present invention may or may not be glycosylated. The polypeptides of the present invention may also include an initial methionine amino acid residue.

The polypeptides of the present invention are used to stimulate new blood vessel growth or angiogenesis. In particular, the polypeptides of the invention stimulate the growth and proliferation of keratinocyte cells. Accordingly, the polypeptides of the invention find use in stimulating wound healing and in stimulating keratinocytes associated with preventing hair loss. The polypeptides of the invention may also be used in healing skin wounds by stimulating epithelial cell proliferation. The polypeptides of the invention may also be used to stimulate the differentiation of cells such as, for example, muscle cells and nerve tissue, prostate cells and lung cells.

KG encoding 1 to 36 amino acids
The signal sequence of F-2 may generally be used to identify secreted proteins by hybridization and / or computer search algorithms. The nucleotide sequence of KGF-2 can be used to isolate the 5 'sequence by hybridization. The plasmid containing the KGF-2 gene under the control of the native promoter / enhancer sequence is then used in in vitro studies aimed at identifying transactivators of endogenous cellular and viral KGF-2 gene expression. be able to.

The KGF-2 protein is also known as KGF-2
Peptidomimetics that act on receptors
o-mimetics) may be used as a positive control in experiments designed to identify them. According to yet another aspect of the present invention, such polypeptides or polynucleotides encoding such polypeptides may be used for in vitro purposes related to scientific research, DNA synthesis, production of DNA vectors and Methods for use in providing diagnostic and therapeutic agents for human diseases are provided.

The full-length KGF-2 gene fragment was used as a hybridization probe in a cDNA library to isolate the full-length KGF-2 gene and to obtain other genes having high sequence similarity or similar biological activity with these genes. Is isolated. Generally, this type of probe has at least 20 bases. However, preferably, the probe will have at least 30 bases, generally no more than 50 bases, but may have more bases. The probe also contains a clone corresponding to the full-length transcript, and a complete KGF containing control and promoter regions, exons and introns.
May be used to identify single or multiple genomic clones containing the -2 gene. Examples of screening include isolating the coding region of the KGF-2 gene by using a known DNA sequence to synthesize an oligonucleotide probe. A labeled oligonucleotide having a sequence that is complementary to the sequence of the gene of the present invention can be used to determine which member of the library the probe hybridizes to, to obtain a library of human cDNA, genomic DNA or mRNA. Used to screen

The present invention provides a method for identifying a receptor for a KGF-2 polypeptide. The gene encoding the receptor can be prepared by a number of methods known to those skilled in the art, such as ligand panning and FACS sorting (Coligan).
Et al., Current Protocols in Immun (Curren
t Protocols in Immun. ), 1 (2), Chapter 5, (19
91)). Preferably, expression cloning is used, in which polyadenylated RNA is prepared from cells responsive to the polypeptide, and the cDNA library created from this RNA is divided into pools and used for COS cells or the polypeptide. Used to transfect other cells that are not responsive. The transfected cells grown on glass slides are exposed to the labeled polypeptide. The polypeptide can be labeled by a variety of means, including iodination or including a site-specific recognition site for protein kinases. After fixation and incubation, the slides are subjected to autoradiographic analysis. Identifying a positive pool, then preparing a subpool, and then re-transfecting using the interactive sub-pool and rescreening method,
Finally, a single clone encoding the putative receptor is produced.

As an alternative to receptor identification, the labeled polypeptide can be photoaffinity bound to cell membranes or to an extract preparation expressing the receptor molecule. The crosslinked material is separated by PAGE analysis and then exposed to X-ray film. The labeled complex containing the polypeptide receptor is excised, separated into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing is used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.

The present invention provides a method for screening compounds to identify those that agonize the action of KGF-2 or block the function of KGF-2. Examples of such assays include mixing mammalian keratinocyte cells, the compound to be screened, and ³ [H] thymidine under cell culture conditions under which keratinocyte cells normally grow. Control assays are performed in the absence of the compound to be screened and compared to the amount of keratinocyte growth in the presence of the compound to determine whether the compound stimulates keratinocyte growth. To screen for antagonists, the same assay is set up in the presence of KGF-2, and then the ability of the compound to interfere with keratinocyte proliferation is determined to determine the ability of the antagonist. The amount of keratinocyte cell proliferation is measured by liquid scintillation chromatography measuring incorporation of ³ [H] thymidine.

In another method, a mammalian cell or membrane preparation expressing the KGF-2 receptor is incubated with labeled KGF-2 in the presence of the compound. The ability of the compound to enhance or block this interaction can then be measured. Alternatively, the response of a known second messenger system following KGF-2 interaction with the receptor is measured and compared in the presence or absence of the compound. Such second messenger systems include, but are not limited to, cAMP
Guanylate cyclase, ion channel or phosphoinositide hydrolysis is included. Potential KGF-
Examples of two antagonists include antibodies, and in some cases, oligonucleotides, that bind to the polypeptide. Alternatively, a potential KGF-2 antagonist may be in the form of a variant of KGF-2 that binds to the KGF-2 receptor, however, because it does not elicit a second messenger response, Effectively blocks action.

Another potential antagonist also includes antisense constructs prepared by utilizing antisense technology. Antisense technology can be used to control gene expression by triple helix formation or antisense DNA or RNA, both methods of polynucleotide DNA or RN.
Based on binding to A. For example, an antisense RNA oligonucleotide of about 10 to 40 base pairs in length is designed using the 5 'coding portion of a polynucleotide sequence, which encodes a mature polypeptide of the invention. DNA oligonucleotides are designed to be complementary to the gene region involved in transcription (triple helix-Lee).
Et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 (19).
88); and Dervan et al., Science, 25.
1: 1360 (1991)), thereby preventing transcription and production of KGF-2. Antisense RNA oligonucleotides are used in vivo
It hybridizes to RNA, and the mRNA molecule KGF-
Blocking translation into two polypeptides (antisense-Okano, J. Neurochem., 56: 560 (1
991); Oligodeoxynucleotides as antisense of gene expression (Oigode
oxynucleotides as Antisense Inhibitors of Gene Exp
ression), CRC Press, Boca Leighton, Florida (1988)). The oligonucleotides described above can also be delivered to cells, resulting in antisense RNA or DN.
A can be expressed in vivo to inhibit the production of KGF-2.

Potential KGF-2 antagonists include those that bind to the KGF-2 receptor and occupy the binding site of the receptor, thereby rendering it inaccessible to KGF-2 and exhibiting normal biological activity. Interfering small molecules are included. . Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules. KGF-2
Antagonists are used to prevent the induction of new blood vessel growth or angiogenesis in tumors. Angiogenesis stimulated by KGF-2 has also been implicated in some pathologies treated by antagonists of the invention, including diabetic retinopathy, and by the suppression of the growth of pathological tissues such as rheumatoid arthritis. To contribute.

[0045] Antagonists of KGF-2 may also be used to treat glomerulonephritis, which is characterized by a marked proliferation of glomerular epithelial cells forming a cell mass filling the Bowman's capsule. Antagonists may also be used to inhibit postoperative keloid formation, fibrosis after myocardial infarction, fibrosis associated with pulmonary fibrosis and scar tissue hyperproliferation seen in restenosis. KGF-2 antagonists also include KGF-, including cancer and Kaposi's sarcoma.
It may be used to treat other proliferative disorders stimulated by the two.

KGF-2 antagonists may also be used to treat keratitis, a deep infiltration of corneal and uveal inflammation characterized by epithelial cell proliferation. The antagonist may be used in a composition with a pharmaceutically acceptable carrier, for example, as described below. The polypeptides, agonists and antagonists of the present invention can be used to include pharmaceutical compositions in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, agonist or antagonist and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention. In connection with such containers, a notice may be provided in a form prescribed by governmental authorities that regulate the manufacture, use, or sale of pharmaceutical or biological products, the notice being provided for administration to humans. Represents the approval of the relevant bureau of manufacture, use or sale for the purpose. Further, the polypeptides, agonists and antagonists of the present invention can be used with other therapeutic compounds.

The pharmaceutical composition may be topical, intravenous, intraperitoneal,
Such as intramuscular, subcutaneous, intranasal or intradermal routes,
It can be administered in a convenient manner. The pharmaceutical composition comprises:
It is administered in an amount effective to treat and / or prevent the particular indication. Generally, they will have at least about 10
Administered in an amount of μg / kg (body weight), most often they will be administered in an amount not to exceed about 8 mg / kg (body weight) per day. In most cases, the dosage is about 10 μg / kg to about 1 m / day, taking into account the route of administration and symptoms.
g / kg (body weight). The dose in the specific case of topical administration is from 0.1 μg to 9 mg / cm ² .

The KGF-2 polypeptides, agonists and antagonists or agonists that are polypeptides may also be used in accordance with the present invention due to the in vivo expression of such polypeptides, often referred to as “gene therapy”. it can. So, for example,
After cells from the patient have been engineered with a polynucleotide (DNA or RNA) encoding the polypeptide ex vivo, the engineered cells are given to a patient to be treated with the peptide. Such methods are well-known in the art.
For example, cells can be engineered by methods known in the art by use of retroviral particles comprising RNA encoding a polypeptide of the invention.

Similarly, for expression of a polypeptide in vivo, eg, by methods known in the art,
Cells can be manipulated in vivo. As is known in the art, to engineer cells in vivo to produce a retroviral particle comprising RNA encoding a polypeptide of the present invention, in order to express a polypeptide in vivo. Can be administered to a patient. These and other methods for administering a polypeptide of the present invention by such methods will be apparent to those skilled in the art from the teachings of the present invention.
For example, expression vehicles for manipulating cells may be other than retroviruses, such as adenoviruses that can be used to manipulate cells in vivo after combination with a suitable delivery vehicle. Good. Examples of other delivery vehicles are HSV-based vector systems, adeno-associated virus vectors and inert vehicles (eg, dextran-coated ferrite particles).
Is included.

The present invention also relates to a disease related to the presence of a mutation in a KGF-2 nucleic acid sequence, or to KGF as part of a diagnostic assay for detecting susceptibility to the disease.
-2 gene use. Individuals having a mutation in the KGF-2 gene can be DN-
It can be detected at the A level. Diagnostic nucleic acids can be obtained from cells of a patient, for example, from blood, urine, saliva, tissue biopsy, and autopsy material. Genomic DNA can be used directly for detection, or
CR (Saiki et al., Nature, 324: 163-1)
66 (1986)), it can be amplified enzymatically. RNA or cDNA can also be used for the same purpose. As an example, KGF-
KGF-2 mutations can be identified and analyzed using PCR primers complementary to the nucleic acid encoding 2. For example, deletions and insertions can be detected by a change in the size of the amplified product relative to the normal genotype. Point mutations can be identified by hybridizing the amplified DNA to radiolabeled KGF-2 RNA or alternatively, radiolabeled KGF-2 antisense DNA sequence. Perfectly matched sequences can be distinguished from unpaired duplexes by RNase A digestion or by differences in melting temperatures.

Genetic testing based on DNA sequence differences
This can be accomplished by detecting a change in electrophoretic mobility of the DNA fragment on a gel with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. D
The different sequences of the NA fragments can be distinguished on denaturing formamide gradient gels, where different DN
The mobility of A fragments is delayed at various positions in the gel by their specific or partial melting temperatures (see, eg, Myers et al., Science,
230: 1242 (1985)).

Sequence changes at specific positions can also be demonstrated by nuclease protection assays, such as RNase and S1 protection, or by chemical cleavage methods (eg, Cotton et al., PNAS, USA, 85:
4397-4401 (1985)). Thus, detection of specific DNA sequences can be accomplished by hybridization of genomic DNA, RNase protection, chemical cleavage, direct DNA sequencing, or the use of restriction enzymes (eg, restriction fragment length polymorphism (RFLP)), and Southern. This can be achieved by methods such as blotting. In addition to conventional gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

The present invention also relates to KGF in various tissues.
The present invention also relates to a diagnostic assay for detecting changes in the level of -2 protein. This is because overexpression of the protein relative to a normal control tissue sample detects the presence of a disease or susceptibility to a disease, such as a tumor. Assays used to detect levels of KGF-2 protein in a sample derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, ELISA assays and "sandwich" assays. It is. EL
ISA assay (Corrigan et al., Current Protocols in Immunology, 1 (2), Chapter 6, (199)
1)) first involves preparing an antibody specific to the KGF-2 antigen, preferably a monoclonal antibody. Further, a reporter antibody is prepared for the monoclonal antibody. The reporter antibody is bound to a detectable reagent such as radioactivity, fluorescence or, in this example, horseradish peroxidase enzyme.

A sample is taken from the host and then incubated on a solid support (eg, a polystyrene dish, which binds the proteins in the sample). The free protein binding sites on the dish are then covered by incubation with a non-specific protein such as bovine serum albumin. The monoclonal antibody is then incubated, during which time it binds to the KGF-2 protein attached to the polystyrene dish. Wash off any unbound monoclonal antibody with buffer. Next, when the reporter antibody bound to horseradish peroxidase is placed in a dish, the reporter antibody binds to the monoclonal antibody bound to KGF-2. The unbound reporter antibody is then washed away. The amount of peroxidase substrate that is then added to the dish and the amount of color developed at a given time is a measure of the amount of KGF-2 protein present in a given amount of the patient sample when compared to a standard curve.

A competition assay may be used, wherein K
An antibody specific for GF-2 is bound to a solid support, labeled KGF-2 and a host-derived sample are passed through the solid support and the amount of level detected by, for example, liquid scintillation chromatography or the like. Can be correlated to the amount of KGF-2 in the sample. The "sandwich" assay is similar to the ELISA assay. In a "sandwich" assay, KGF-2 is passed through a solid support and binds to antibodies bound to the solid support. The second antibody is then bound to KGF-2. A labeled, third antibody that is specific for the second antibody can then be passed through a solid support and bound to the second antibody, and the amount can then be quantified.

The sequences of the present invention are also useful for chromosome identification. The sequence can be specifically targeted to a particular location on an individual human chromosome and hybridized. Moreover, there is currently a need to identify specific sites on the chromosome. Chromosome marking reagents based on actual sequence data (repetitive polymorphisms) are currently scarcely available for marking chromosomal locations. The mapping of DNA to chromosomes according to the present invention is an important first step in relating those sequences to genes associated with disease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Using computer analysis of the 3 'untranslated region, genomic DNA
The rapid selection of primers that do not span one or more exons therein complicates the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will give the amplified fragment.

PCR mapping of somatic cell hybrids is a rapid method for assigning specific DNA to specific chromosomes. Utilizing the present invention with the same oligonucleotide primers, sublocalization can be achieved in a similar manner using panels of fragments from a pool of specific chromosomes or large genomic clones. Other mapping methods that can also be used to map to that chromosome include in s
It includes itu hybridization, prescreening using labeled flow-sorted chromosomes, and preselection by hybridization to construct a chromosome-specific cDNA library.

Fluorescence in situ hybridization (FISH) of cDNA clones to metaphase chromosomal spreads
Can be used to provide the exact chromosomal location in one step. This technique can be used with cDNAs as short as 500 or 600 bases; however, 2,000
Clones larger than bp are more likely to bind to unique chromosomal locations that have sufficient signal strength for easy detection. F
ISH requires the use of the clone from which the EST was obtained, and the longer the better. For example, 2,000bp
Is better, 4,000 is better and 4,000
Above zero is probably not necessary to get good results at a reasonable time rate. An overview of the technology includes Verm
a) et al., Human Chromosom
es): See a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be associated with genetic map data. Such data is
For example, V. McKusick, Mendelian
Mendelian Inheritance
in Man) Jones Hopkins University
Welch Medical Library (Johns Hopkins U
niversity (available online through the Welch Medical Library)). Then, a joint analysis of the relationship between the disease and the gene mapped to the same chromosomal region (coinheritanc of physically adjacent genes)
Confirm by e)).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If the mutation is found in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be disease-causing. At present, from the analysis of physical and genetic mapping, a cDNA localized correctly to the chromosomal region associated with the disease could be one of 50-500 possible causative genes. (this is,
Assume 1 megabase mapping analysis and one gene per 20 kb).

[0062] The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as immunogens to produce antibodies thereto. These antibodies are
For example, it can be a polyclonal or monoclonal antibody. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the products of a Fab expression library. Various methods known in the art can be used for the production of such antibodies and fragments.

Antibodies raised against a polypeptide corresponding to a sequence of the present invention can be obtained by injecting the polypeptide directly into an animal or by administering the polypeptide to an animal, preferably a non-human animal. Can be. The antibody so obtained will then bind to the polypeptide itself. In this way, even sequences that encode only fragments of the polypeptide,
It can be used to produce antibodies that bind the whole naturally occurring polypeptide. Such an antibody can then be used to isolate the polypeptide from tissues expressing the polypeptide.

For preparing monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include hybridoma technology
(Kohler and Milstein
n), 1975, Nature, 256: 495-497), trioma technology, human B cell hybridoma technology
(Kozbor et al., 1983, Immunology Toda
y 4:72), and EBV-hybridoma technology for producing human monoclonal antibodies (Cole)
1985, Monoclonal Antibodies and Cancer Therapy
and Cancer Therapy), Alan R. Liss, Inc., pp. 77-96). Techniques described for the production of single-chain antibodies
(U.S. Pat. No. 4,946,778) may be adapted for producing single-chain antibodies to the immunogenic polypeptide products of the invention. Also, using a transgenic mouse,
Humanized antibodies to the immunogenic polypeptide products of the invention can also be expressed.

[0065]

The invention will be further described with reference to the following examples; however, it is to be understood that the invention is not limited to such examples. All parts or amounts are by weight unless otherwise indicated. To facilitate understanding of the following examples, some frequently occurring methods and / or terms will be described. “Plasmids” are preceded by a lower case p and / or followed by a capital letter and / or
Or it is indicated by a number. The starting plasmids herein are commercially available, publicly available on a non-limiting basis, or can be constructed from plasmids available by published methods. In addition, plasmids equivalent to the described plasmids are known in the art and will be apparent to those skilled in the art.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to one of skill in the art. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, DN
Digest 5-50 μg of A with 20-250 units of enzyme.
Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 ° C. are usually utilized, but can be varied according to the supplier's instructions. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment. The size separation of the cleaved fragments
Goeddel, D. et al., NucleicAcids Res., 8:
Performed using an 8% polyacrylamide gel as described by 4057 (1980).

“Oligonucleotide” is a single-stranded polydeoxynucleotide that can be chemically synthesized.
Or two complementary polydeoxynucleotide chains. Since such a synthetic oligonucleotide does not have a 5 'phosphate, it will not ligate to another oligonucleotide without adding a phosphate with ATP in the presence of a kinase. Synthetic oligonucleotides will ligate to fragments that have not been dephosphorylated. "Ligation" refers to the process of forming a phosphodiester bond between two double-stranded nucleic acid fragments (Maniatis et al., Ibid., P. 146).
Unless otherwise stated, ligation was performed with approximately equimolar amounts of 0.5 of the DNA fragment to be ligated.
This can be accomplished using known buffers and conditions with 10 units of T4 DNA ligase per μg (“ligase”).

A cell has been "transformed" by exogenous DNA when the exogenous DNA has been introduced inside the cell membrane. The exogenous DNA is integrated (covalently linked) into the inter-chromosomal D
It may or may not be NA. For example, in prokaryotes and yeast, exogenous DNA is maintained on episomal elements, such as plasmids. For eukaryotic cells, stably transformed or transfected cells are transfected with exogenous DNA by daughter cells through chromosomal replication.
Is an exogenous DNA integrated into a chromosome so that is inherited. This ability is evidenced by the ability of eukaryotic cells to establish cell lines or clones consisting of a population of daughter cells containing exogenous DNA. Examples of transformations are Graham, F. and Van der Ebb.
Eb, A.), Virology 52: 456-457 (197).
3)). The terms "transduction" or "transduced" refer to foreign DNA
Is the process by which cells take up and integrate the foreign DNA into their chromosomes. For example, transduction
It can be done by transfection (various techniques by which cells take up DNA) or by infection (viruses are used to transfer DNA to cells).

Example 1 Bacterial Expression and Purification of KGF-2 First, a DNA sequence encoding KGF-2 (ATCC
No. 75977) is processed KGF-2 cD.
Amplification is performed using PCR oligonucleotide primers corresponding to the 5 'and 3' ends of the NA (including the signal peptide sequence) sequence. The 5 'oligonucleotide primer has the sequence: CCCCACATGTGGAAATGGATACTGACACATTGTGCC (SEQ ID NO:
3) contains the following Afl III restriction enzyme site, followed by 30 nucleotides of the KGF-2 coding sequence beginning with the codon following the putative start codon. 3 'sequence: CCCAAGCTTCCACAAACGTTGCCTTCCTCTATGAG (SEQ ID NO:
4) is the sequence complementary to the HindIII site, followed by KG
It contains 26 nucleotides of F-2. The restriction sites correspond to those of the bacterial expression vector pQE-60 (Qiagen, Inc., Qiagen Inc., 91311, Chatsworth, CA). pQE-60 is resistant to antibiotics (Amp ^r ), bacterial origin of replication (ori), IPTG-regulatable promoter / operator (P / O), ribosome binding site (RBS), 6
-Encodes a His tag and a restriction enzyme site.

Next, the pQE-60 vector was replaced with NcoI and
Digest with HindIII. The amplified sequence was ligated into pQE-60 and then inserted in frame. Then, using the ligation mixture, M15 / re
E. coli strain p4 (Qiagen, Inc.) was isolated from Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Spring.
Laboratory Press (Cold Spring LaboratoryPres)
s), by the method described in (1989). M15 / rep4 contains multiple copies of plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Clones containing the desired construct are
Grow overnight in liquid culture in LB medium supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml) (O /
N). The O / N culture is used to inoculate a large culture at a ratio of 1: 100 to 1: 250. Cells
Grow to an optical density of 600 (OD ⁶⁰⁰ ) between 0.4 and 0.6.

Next, IPTG (“isopropyl-B-
D-thiogalactopyranoside ") was added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing P / O, and increasing gene expression. Cells were grown for an additional 3-4 hours. The cells were then collected by centrifugation. The cell pellet was solubilized in the chaotropic agent 6M guanidine HCl. After clarification, the solubilized KGF-2 is purified from this solution by chromatography on a heparin affinity column under conditions that allow strong binding by the protein (Hochu
li, E.) et al., J. Chromatography 411: 177-18.
4 (1984)). Elute KGF-2 (75% purity) from the column with a high salt buffer.

Example 2 Bacterial Expression and Purification of Truncated Form of KGF-2 First, the DNA sequence encoding KGF-2 (ATCC
No. 75977) is amplified using PCR oligonucleotide primers corresponding to the 5 ′ and 3 ′ ends of the sequence of the truncated form of the KGF-2 polypeptide. The truncated form includes the polypeptide minus the 36 amino acid signal peptide sequence, with methionine and alanine residues added immediately before the cysteine residue that constitutes amino acid 37 of the full length protein. The 5 'oligonucleotide primer has the sequence: CATGCCATGGCGTGCCAAGCCCTTGGTCAGGACATG (SEQ ID NO:
5) having the following NcoI restriction enzyme site followed by KGF-2
Contains 24 nucleotides of the coding sequence. 3 'sequence: CCCAAGCTTCCACAAACGTTGCCTTCCTCTATGAG (SEQ ID NO:
6) is the sequence complementary to the HindIII site, followed by KG
It contains 26 nucleotides of F-2. The restriction sites correspond to those of the bacterial expression vector pQE-60 (Qiagen, Inc., Chatterworth, Calif.). pQE-60 contains antibiotic resistance (Amp ^r ), bacterial origin of replication (ori), IPTG-regulatable promoter / operator (P / O), ribosome binding site (R
BS), a 6-His tag and a restriction enzyme site.

Next, pQE-60 is digested with NcoI and HindIII. The amplified sequence is ligated into pQE-60 and then inserted in frame. The ligation mixture was then used to isolate the E. coli strain, M15 / rep4 (Qiagen, Inc.), from Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press,
(1989). M15 / rep4 contains multiple copies of plasmid pREP4, which expresses the lacI repressor and
It also gives kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. A clone containing the desired construct is
Grow overnight (O / O) in liquid culture in LB medium supplemented with both p (100 μg / ml) and Kan (25 μg / ml).
N). The O / N culture is used to inoculate a large culture at a ratio of 1: 100 to 1: 250. Cells
Grow to an optical density of 600 (OD ⁶⁰⁰ ) between 0.4 and 0.6.

Next, IPTG (“isopropyl-B-
D-thiogalactopyranoside ") is added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing P / O, and increasing gene expression. Cells were grown for an additional 3-4 hours. The cells were then collected by centrifugation. The cell pellet is solubilized in the chaotropic agent 6M guanidine HCl. After clarification, the solubilized KGF-2 is purified from this solution by chromatography on a heparin affinity column under conditions that allow for strong binding by the protein (Hochuri et al., J. Am.
Chromatography 411: 177-184 (198
4)). KGF from column with high salt buffer
-2 is eluted.

Example 3 KGF-2 Expression Using Baculovirus Expression System
Cloning and expression DNA encoding full length KGF-2 protein
The sequence, ATCC No. 75977, is amplified utilizing PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene. The 5 'primer has the sequence: GCGGGATCCGCCATCATGTGGAAATGGATACTCAC (SEQ ID NO:
7) and 6 nucleotides (Kozak, M., J. Mol.) Which have a BamHI restriction enzyme site (bold print) followed by a signal effective for initiation of translation in eukaryotic cells. . B
196: 947-950 (1987)), and immediately following is the first 17 nucleotides of the KGF-2 gene (the translation initiation codon "ATG" is underlined).

The 3 ′ primer has the sequence: GCGCGGTACCACAAACGTTGCCTTCCT (SEQ ID NO: 8) and has a 19 ′ complementary to the cleavage site for the restriction endonuclease Asp718 and the 3 ′ untranslated sequence of the KGF-2 gene. Contains nucleotides. The amplified sequence is transferred to a commercially available kit (Qiagen, Ink, Chatters,
(California) using a 1% agarose gel. The fragment was then digested with the endonucleases BamHI and Asp718 and purified again on a 1% agarose gel. This fragment is named F2.

The vector pA2 (modification of the pVL941 vector, discussed below) is used for expression of the KGF-2 protein using a baculovirus expression system (for review, see Summers, MD and Smith,
GE) 1987, A Manual of Methods
Four Baculovirus Vectors and Insect Cell Culture Procedures (Ama
nual of methods for baculovirus vectors and insect
cell culture procedures), Texas Agricultural Exp
erimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the Autographa California Polyhedrovirus (AcMNPV), followed by recognition sites for the restriction endonucleases BamHI and Asp718. The simian virus (SV) 40 polyadenylation site is used for efficient polyadenylation. For easy selection of recombinant viruses, the β-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter followed by the polyhedrin gene polyadenylation signal. Viral sequences for cell-mediated homologous recombination of cotransfected wild-type viral DNA are flanked by polyhedrin sequences.
Many other baculovirus vectors, for example, pAc
373, pVL941, and pAcIM1 could be used instead of pRG1 (Lucco ゥ (Luc
kow, VA) and Summers, Virology, 170: 31.
-39).

The plasmid was replaced with the restriction enzymes BamHI and Asp718.
Digest with. The DNA is then isolated from a 1% agarose gel using a commercially available kit (Qiagen, Inc., Chatterworth, CA). This vector DN
Name A as V2. Fragment F2 and plasmid V2 are ligated with T4 DNA ligase. Next, E. coli HB101 cells were transformed to obtain a plasmid having the KGF-2 gene (pBacK
Bacteria containing GF-2) are identified using PCR with both cloning oligonucleotides. The sequence of the cloned fragment is confirmed by DNA sequencing.

The lipofection method (Felgn
er) et al., Proc. Natl. Acad. Sci. USA, 84: 7413.
-7417 (1987)) and the plasmid pBa
5 μg of cKGF-2 was obtained from a commercially available linearized baculovirus.
( "BaculoGold ^TM baculovirus DNA", Pharmingen (Pharmingen), San Diego (San Dieg
o), California) Co-transfect with 1.0 μg. BaculoGold ^™ virus DNA 1μg
And 25 μg of plasmid pBacKGF were added to serum-free Grace's medium (Life Technologies Inc., Gaithersburg, Ga.).
Ithersburg), MD) Mix in sterile wells of a microtiter plate containing 50 μl. Then, 10 μl of Lipofectin and 90% of Grace's medium
Add μl, mix and incubate at room temperature for 15 minutes. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded on 35 mm tissue culture plates containing 1 ml of serum-free Grace's medium. The plate is rocked back and forth to mix the newly added solution. The plate is then placed at 27 ° C.
And incubate for 5 hours. After 5 hours, the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. Return the plate to the incubator and continue culturing at 27 ° C. for 4 days.

After 4 days, the supernatant is collected and a plaque assay is performed as described by Summers and Smith (supra). As a variant, an agarose gel containing "Blue Gal" (Life Technologies, Inc., Gaithersburg) was used, which makes it possible to easily isolate plaques stained blue.
(A detailed description of the "plaque assay" can also be found in a user's guide to insect cell culture and in Baculovirology distributed by Life / Technologies, Inc., Gaithersburg, pages 9-10.) . Four days later, serial dilutions of the virus were added to the cells,
The blue-stained plaque is collected with the tip of an Eppendorf pipette. The agar containing the recombinant virus is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by brief centrifugation and the supernatant containing the recombinant baculovirus was removed from the agar.
Used to infect Sf9 cells seeded in mm dishes. Four days later, the supernatant of these culture dishes was collected,
To save.

Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are given a recombinant baculovirus V-GPR at a multiplicity of infection (MOI) of 2.
Infect. After 6 hours, the medium was removed and the SF900 II medium without methionine and cysteine was removed.
(Life Technologies, Inc., Gaithersburg)
Replace with After 42 hours, 5 μCi ³⁵ S-methionine and 5 μCi ³⁵ S cysteine 5 μCi (Amersham) are added. After incubating the cells for an additional 16 hours, they are collected by centrifugation and the labeled proteins are visualized by SDS-PAGE and autoradiography.

Example 4 Expression of a recombinant KGF-2 expression plasmid, KGF-2 HA in COS cells was carried out according to (1) SV4
0 replication origin, (2) ampicillin resistance gene,
(3) E. coli origin of replication, (4) polylinker region,
Vector pcDNAI / Am containing the CMV promoter followed by the SV40 intron and polyadenylation site
p (Invitrogen). Precursors of complete G-protein coupled receptors and their 3 '
The recombinant protein expression is directed under the CMV promoter, since the DNA fragment encoding the HA tag fused in-frame to the ends is cloned into the polylinker region of the vector. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein as described above (Wilson, H. Niman, R. Heighten, A. Cherenson, M. Connolly) ,
And R. Lerner, 1984, Cell 3.
7, 767). Fusion of the HA tag to our target protein allows the recombinant protein to be easily detected with an antibody that recognizes the HA epitope.

The plasmid construction procedure is described below:
ATCC No. 75977 DNA encoding GF-2
The sequence is constructed by PCR using two primers: 5 'primer sequence: CCCAAGCTTATGTGGAAATGGATACTGACACATTGTGCC (SEQ ID NO: 9) contains a Hind III site followed by 30 nucleotides of KGF-2 coding sequence starting from the start codon; The 3 'sequence is: TGCTCTAGACTAAGCGTAGTCTGGGACGTCGTATGGGTATGAGTGTACCA
CCATTGGAAGAAAGTGAGG (SEQ ID NO: 10) is the complementary sequence to the XbaI restriction enzyme site, the translation stop codon, the HA tag, and the last 32 nucleotides of the KGF-2 coding sequence (the stop codon is not included).
including. Therefore, the PCR product has a HindIII site, KGF
-2 coding sequence, followed by an HA tag fused in frame, a translation termination codon next to the HA tag, and an XbaI site. The DNA fragment and vector, pcDNAI / Amp, amplified by PCR were
Digest with II and XbaI restriction enzymes and ligate.

The ligation mixture was transferred to E. coli strain X
L1 Blue (Stratagene Cloning Systems), La Jol
la), California) and place the transformed culture on ampicillin medium plates to select for resistant colonies. Plasmid D
NA is isolated from transformants and tested by PCR and restriction analysis for the presence of the correct fragment. For expression of recombinant KGF-2, DEAE-
COS cells are transfected with an expression vector by the DEXTRAN method. (Sunbrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press,
(1989)).

The expression of KGF-2 HA protein is detected by radiolabeling and immunoprecipitation (E. Harlow, D. Lane, Antibodies: A Laboratory Manual (A) La
boratory Manual), Cold Spring Laboratory Press, (1988)). Two days after transfection, proteins are labeled with ³⁵ S-cysteine for 8 hours. The cell culture medium was then collected and the cells were washed with detergent (RIPA buffer (150 mM NaCl, 1% NP-
40, 0.1% SDS, 1% NP-40, 0.5% D
OC, 50 mM Tris, pH 7.5)) (Wilson et al., Supra, 37: 767 (1984)). The ³⁵ S-cysteine labeled protein obtained from COS cell lysate and supernatant is immunoprecipitated with HA polyclonal antibody and separated using 15% SDS-PAGE.

Example 5 In Vitro Transcription and Translation of Recombinant KGF-2 PCR products were cloned into pA2 vector.
Derived from DNA and used for insect cell expression of KGF-2. Primers used for this PCR were: ATTAACCCTCAC
TAAAGGGAGGCCATGTGGAAATGGATACTGACACATTGTGCC (SEQ ID NO: 11) and CCCAAGCTTCCACAAACGTTGCCTTCCTCTATGA
G (SEQ ID NO: 12). The first primer is AT
Contains the sequence 5 'of the T3 promoter for the G start codon. The second primer is complementary to the 3 'end of the KGF-2 open reading frame and encodes a sequence that is the reverse complement of the stop codon.

The resulting PCR product is purified using a kit commercially available from Qiagen. This DNA
Is used as template for the in vitro transcription reaction. The reaction is performed in a kit commercially available from Promega under the name TNT. The assay was performed at 33 ° C. except that only half the indicated amount of reagent was used, using radiolabeled methionine as substrate.
The reaction is allowed to proceed for 1.5 hours according to the instructions of the kit. 5 μl of the reaction is separated by electrophoresis on a 10-15% denaturing polyacrylamide gel. The gel was run for 30 minutes with water: methanol: acetic acid 6: 3:
Fix in one volume of mixture. The gel is then dried by heating under reduced pressure and subsequently exposed to X-ray film for 16 hours. Developed that film and conceptually translated K
The presence of a radioprotein band in size matching GF-2 was shown, suggesting that the cloned KGF-2 cDNA contains an open reading frame encoding a protein of the expected size. Was. Because many modifications and variations of the present invention are possible in light of the above teachings, the present invention can be practiced otherwise than as specifically described within the scope of the following claims.

SEQUENCE LISTING <110> Human Genome Sciences, Inc. <120> Keratinocyte Growth Factor-2 <130> 182446 <160> 12 <210> 1 <211> 627 <212> DNA <213> Artificial Sequence <400> 1 atg tgg aaa tgg ata ctg aca cat tgt gcc tca gcc ttt ccc cac ctg 48 Met Trp Lys Trp Ile Leu Thr His Cys Ala Ser Ala Phe Pro His Leu -35 -30 -25 ccc ggc tgc tgc tgc tgc tgc ttt ttg ttg ctg ttc ttg gtg tct tcc 96 Pro Gly Cys Cys Cys Cys Cys Phe Leu Leu Leu Phe Leu Val Ser Ser -20 -15 -10 -5 gtc cct gtc acc tgc caa gcc ctt ggt cag gac atg gtg tca cca gag 144 Val Pro Val Thr Cys Gln Ala Leu Gly Gln Asp Met Val Ser Pro Glu 1 5 10 gcc acc aac tct tct tcc tcc tcc ttc tcc tct cct tcc agc gcg gga 192 Ala Thr Asn Ser Ser Ser Ser Ser Phe Ser Ser Pro Ser Ser Ala Gly 15 20 25 agg cat gtg cgg agc tac aat cac ctt caa gga gat gtc cgc tgg aga 240 Arg His Val Arg Ser Tyr Asn His Leu Gln Gly Asp Val Arg Trp Arg 30 35 40 aag cta ttc tct ttc acc aag tac ttt ctc aag att gag aag aac ggg 288 Lys Leu Phe Ser Phe Thr Lys Tyr Phe Leu Lys Ile Glu Lys Asn Gly 45 50 55 60 aag gtc agc ggg acc aag aag gag aac tgc ccg tac agc atc ctg gag 336 Lys Val Ser Gly Thr Lys Lys Glu Asn Cys Pro Tyr Ser Ile Leu Glu 65 70 75 ata aca tca gta gaa atc gga gtt gtt gcc gtc aaa gcc att aac agc 384 Ile Thr Ser Val Glu Ile Gly Val Val Ala Val Lys Ala Ile Asn Ser 80 85 90 aac tat tac tta gcc atg aac aag aag ggg aaa ctc tat ggc tca aaa 432 Asn Tyr Tyr Leu Ala Met Asn Lys Lys Gly Lys Leu Tyr Gly Ser Lys 95 100 105 gaa ttt aac aat gac tgt aag ctg aag gag agg ata gag gaa aat gga 480 Glu Phe Asn Asn Asp Cys Lys Leu Lys Glu Arg Ile Glu Arg Ile Glu Asn Gly 110 115 120 tac aat acc tat gca tca ttt aac tgg cag cat aat ggg agg caa atg 528 Tyr Asn Thr Tyr Ala Ser Phe Asn Trp Gln His Asn Gly Arg Gln Met 125 130 135 140 tat gtg gca ttg aat gga aaa gga gct cca agg aga gga cag aaa aca 576 Tyr Val Ala Leu Asn Gly Lys Gly Ala Pro Arg Arg Gly Gln Lys Thr 145 150 155 cga agg aaa aac acc tct gct cac ttt ctt cca atg gtg gta cac tca 624 Arg Arg Lys Asn Thr Ser Ala His Phe Leu Pro Met Val Val His Ser 160 165 170 tag 627

<210> 2 <211> 208 <212> PRT <213> Artificial Sequence <400> 2 Met Trp Lys Trp Ile Leu Thr His Cys Ala Ser Ala Phe Pro His Leu -35 -30 -25 Pro Gly Cys Cys Cys Cys Cys Phe Leu Leu Leu Phe Leu Val Ser Ser -20 -15 -10 -5 Val Pro Val Thr Cys Gln Ala Leu Gly Gln Asp Met Val Ser Pro Glu 1 5 10 Ala Thr Asn Ser Ser Ser Ser Ser Ser Phe Ser Ser Pro Ser Ser Ala Gly 15 20 25 Arg His Val Arg Ser Tyr Asn His Leu Gln Gly Asp Val Arg Trp Arg 30 35 40 Lys Leu Phe Ser Phe Thr Lys Tyr Phe Leu Lys Ile Glu Lys Asn Gly 45 50 55 60 Lys Val Ser Gly Thr Lys Lys Glu Asn Cys Pro Tyr Ser Ile Leu Glu 65 70 75 Ile Thr Ser Val Glu Ile Gly Val Val Ala Val Lys Ala Ile Asn Ser 80 85 90 Asn Tyr Tyr Leu Ala Met Asn Lys Lys Gly Lys Leu Tyr Gly Ser Lys 95 100 105 Glu Phe Asn Asn Asp Cys Lys Leu Lys Glu Arg Ile Glu Glu Asn Gly 110 115 120 Tyr Asn Thr Tyr Ala Ser Phe Asn Trp Gln His Asn Gly Arg Gln Met 125 130 135 140 Tyr Val Ala Leu Asn Gly Lys Gly Ala Pro Arg Arg Gly Gln Lys Thr 145 150 155 Arg Arg Lys Asn T hr Ser Ala His Phe Leu Pro Met Val Val His Ser 160 165 170

<210> 3 <211> 36 <212> DNA <213> Artificial Sequence <400> 3 ccccacatgt ggaaatggat actgacacat tgtgcc 36 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <400> 4 cccaagcttc cacaaacgtt gccttcctct atgag 35

<210> 5 <211> 36 <212> DNA <213> Artificial Sequence <400> 5 catgccatgg cgtgccaagc ccttggtcag gacatg 36 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <400> 6 cccaagcttc cacaaacgtt gccttcctct atgag 35

<210> 7 <211> 35 <212> DNA <213> Artificial Sequence <400> 7 gcgggatccg ccatcatgtg gaaatggata ctcac 35 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <400> 8 gcgcggtacc acaaacgttg ccttcct 27

<210> 9 <211> 39 <212> DNA <213> Artificial Sequence <400> 9 cccaagctta tgtggaaatg gatactgaca cattgtgcc 39 <210> 10 <211> 69 <212> DNA <213> Artificial Sequence <400> 10 tgctctagac taagcgtagt ctgggacgtc gtatgggtat gagtgtaccaccattggaag 60 aaagtgagg 69

<210> 11 <211> 54 <212> DNA <213> Artificial Sequence <400> 11 attaaccctc actaaaggga ggccatgtgg aaatggatac tgacacattg tgcc 54 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <400 > 12 cccaagcttc cacaaacgtt gccttcctct atgag 35

[Brief description of the drawings]

FIG. 1 shows the cDNA of the polypeptide of the invention and the corresponding deduced amino acid sequence.

FIG. 2 shows the cDNA of the polypeptide of the invention and the corresponding deduced amino acid sequence.

FIG. 3 shows the cDNA of the polypeptide of the invention and the corresponding deduced amino acid sequence.

FIG. 4 shows an amino acid sequence comparison between a polypeptide of the invention and other fibroblast growth factors.

FIG. 5 shows an amino acid sequence comparison between a polypeptide of the invention and another fibroblast growth factor.

FIG. 6 shows an amino acid sequence comparison between a polypeptide of the invention and other fibroblast growth factors.

FIG. 7 shows an amino acid sequence comparison between a polypeptide of the invention and another fibroblast growth factor.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification code FI Theme coat ゛ (Reference) C12N 1/21 C12P 21/02 C 4C084 5/10 C12Q 1/02 4C086 C12P 21/02 1/68 A 4H045 C12Q 1/02 G01N 33/15 Z 1/68 33/50 Z G01N 33/15 A61K 31/7088 33/50 31/7105 // A61K 31/7088 31/711 31/7105 48/00 31/711 A61P 43 / 00 105 38/04 111 38/27 C12N 15/00 ZNAA 48/00 5/00 A A61P 43/00 105 A61K 37/36 111 37/43 (72) Inventor Joachim El Gruber United States 20879 Maryland Gay Saarsburg, Lost Knife Circle No. 103, 18403 (72) Inventor Patrick Jay Dillon USA 20879 Boxbury Terrace 7508 No.F Term (Reference) 2G045 AA25 AA40 CA25 CB01 CB03 CB07 DA12 DA13 DA14 DA36 DA77 FB02 FB03 FB04 FB07 4B024 AA01 AA11 BA21 CA04 DA02 DA06 EA04 FA18 GA11 QA12 QAQ QQ52 QR32. ZC03 ZC41 ZC42 4H045 AA10 AA11 AA30 BA10 CA40 DA01 DA75 EA20 FA72 FA73 FA74

Claims (22)

[Claims] 1. (a) a polypeptide having the deduced amino acid sequence of SEQ ID NO: 2, or a polynucleotide encoding a fragment, analog or derivative of the polypeptide; (b) cD contained in ATCC Accession No. 75977
An isolated polynucleotide selected from the group consisting of a polypeptide having an amino acid sequence encoded by NA, or a polynucleotide encoding a fragment, analog or derivative of said polypeptide. 2. The polynucleotide according to claim 1, wherein the polynucleotide is DNA. 3. The polynucleotide according to claim 1, wherein the polynucleotide is RNA. 4. The polynucleotide according to claim 1, wherein the polynucleotide is genomic DNA. 5. The polynucleotide encodes a polypeptide having the deduced amino acid sequence of SEQ ID NO: 2,
The polynucleotide according to claim 2. 6. The polynucleotide of claim 2, wherein said polynucleotide encodes a polypeptide encoded by the cDNA of ATCC Accession No. 75977. 7. The polynucleotide according to claim 1, which has the coding sequence shown in SEQ ID NO: 1. 8. having the coding sequence of a polypeptide deposited under ATCC Accession No. 75977;
The polynucleotide according to claim 2. 9. A vector comprising the DNA according to claim 2. 10. A host cell genetically engineered with the vector of claim 9. 11. A method for producing a polypeptide, comprising expressing the polypeptide encoded by the DNA from the host cell according to claim 10. 12. A method for producing a cell capable of expressing a polypeptide, comprising genetically manipulating the cell with the vector according to claim 9. 13. An isolated DNA capable of hybridizing to the DNA of claim 2 and encoding a polypeptide having KGF-2 activity. 14. A polypeptide having the deduced amino acid sequence of SEQ ID NO: 2, and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the cDNA of ATCC Accession No. 75977, and a polypeptide thereof. A polypeptide selected from the group consisting of polypeptide fragments, analogs and derivatives. 15. The polypeptide according to claim 14, wherein the polypeptide is KGF-2 having the deduced amino acid sequence of SEQ ID NO: 2. 16. An antibody against the polypeptide according to claim 14. 17. A compound which is an effective agonist for the polypeptide according to claim 14. (18) A compound which is an effective antagonist for the polypeptide according to (14). 19. A method for identifying a compound that is active as an agonist for KGF-2, comprising the steps of: (a) adding a compound to be screened to a reaction mixture containing cells; (B) determining the degree of proliferation of the cells to determine whether the compound is an effective agonist A method that includes verifying. 20. The method of claim 19, wherein KGF-2 is added to the mixture of step (a) to identify compounds that are active as antagonists to KGF-2. 21. A method for diagnosing a disease associated with underexpression of the polypeptide according to claim 14 or a susceptibility to said disease, wherein the nucleic acid sequence encodes the polypeptide from a sample derived from a host. And then determining the mutation in the nucleic acid sequence encoding the polypeptide. 22. A diagnostic method comprising analyzing the presence of the polypeptide of claim 14 in a sample derived from a host.