JP2002306021A - Transgenic mouse and method for screening anti-obestic medicine - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for screening an anti-obestic medicine or a medicine for treating a disease related to obesity. SOLUTION: The transgenic mouse contains a PGC-1 gene transduced therein. The method for screening a substance for changing the interaction of PGC-1-PPARγ complex comprises adding a test substance to a system containing a vector which contains (1) PGC-1, (2) PPARγ and (3) a response sequence, a promoter, and a reporter gene connected so as to be expressed with the promoter, and then detecting the transcription activity adjustment of the PGC-1-PPARγ complex, while using the expression of the reporter gene as an index.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a transgenic mouse into which a PPARγ cofactor 1 (PGC-1) gene has been introduced, and a method for screening a substance that alters the interaction of a PGC-1-PPARγ complex.

[0002]

2. Description of the Related Art In developed countries, obesity is increasing due to satiety. Obesity is associated with various complications such as diabetes, hypertension and hyperlipidemia. All of these are chronic diseases and affect the lives of individuals for a long period of time. Such an increase in chronic illness is one of the causes of soaring medical expenses, which has become a problem in Japan. Therefore, the development of drugs for treating diseases associated with obesity is important.

[0003] PPARγ is a member of the nuclear receptor family. PPARγ is highly expressed in adipose tissue,
Play an important role in the formation of adipose tissue. In addition, PPA
Rγ has also been reported to have a role in heat production in brown adipose tissue. Elucidation of the signaling mechanism through PPARγ will lead to an understanding of the molecular mechanisms of adipose tissue formation and body heat production (energy expenditure).
The nuclear receptor family to which PPARγ belongs includes liposoluble low molecular weight bioactive receptors such as steroids, thyroid hormone, and retinoic acid (vitamin A). According to active research, 1) steroid hormones, thyroid hormones, retinoic acid, thiazoline, etc. bind to their specific nuclear receptors as lipophilic ligands, and 2) nuclear receptors bound to lipophilic ligands , Directly binds to a specific base sequence on the target gene promoter as a dimer to cause transcriptional activation,
The molecular mechanism has been revealed.

[0004] In recent years, 3) a molecule, a cofactor (coupled transcription regulator), which regulates gene expression by interacting with a nuclear receptor in a protein-protein manner in a ligand-dependent manner has been discovered (Glass, CK, Rosenfeld). , M.
G., The coregulator exchange in transcription func
tions of Nuclear receptors, Genes Dev 14: 121-141 (2
000)). Cofactors of nuclear receptors are found in various tissues,
Although expressed ubiquitously in cells, PGC1 (PPAR g
amma coactivator 1) showed remarkable induction of expression in brown adipocytes (BAT) and skeletal muscle cells of mice subjected to cold stress, suggesting a role in thermogenesis (Puigserver, PA, Cold-inducible coac
tivator of nuclear receptors linked to adaptive th
ermogenesis, Cell 92: 829-939 (1998)).

[0005] Uncoupling protein
-1 (UCP-1) is a mitochondrial protein that dissipates the gradient of the electrochemical potential of protons and has the function of disrupting electron transfer and ATP synthesis in oxidative phosphorylation. It is known that UCP-1 expression is significantly increased in BAT when subjected to cold stress. However, the relationship between PGC1 expression and UCP-1 expression in vivo is not yet clear.

[0006]

Means for Solving the Problems The present inventor has proposed PGC-1.
A transgenic mouse overexpressing was prepared. The transgenic mouse has an increased amount of brown adipose tissue (BAT) as compared to the control mouse, and shows UCP-1 and UCP-1 in specific tissues, particularly in BAT.
-3 protein expression level was found to be significantly increased. The transgenic mice also had increased energy expenditure and decreased body weight. These results indicate that activating PGC-1 increases energy expenditure in the body, resulting in weight loss, that is, elimination of obesity without exercise. By searching for a compound that enhances or attenuates the interaction between PPARγ and PGC-1, it becomes possible to screen for a drug that resolves obesity or a therapeutic drug for a disease related to obesity. Further, the effect of the above-mentioned drug can be confirmed by directly using the transgenic mouse of the present invention.

[0007] That is, the present invention relates to a transgenic mouse into which the PGC-1 gene has been introduced and which overexpresses PGC-1, wherein the weight of the transgenic mouse has decreased, the amount of brown adipose tissue has increased, and the energy consumption has increased. The amount increased, UCP-1
And mice with increased expression of UCP-3 protein.

The present invention further provides a method for screening a substance that alters the interaction of the PGC1-PPARγ complex, comprising: 1) PGC1, 2) PPARγ, and 3) a response element, a promoter, and a gene expressed by the promoter. The present invention also relates to a method comprising adding a test substance to a system containing a vector containing a reporter gene linked to obtain, and detecting the regulation of the transcriptional activity of the PGC1-PPARγ complex using the expression of the reporter gene as an index.

[0009] The present invention further relates to a method for screening an antiobesity drug, which comprises using a transgenic mouse.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION (1) PGC1 gene is introduced
Preparation of Transgenic Mouse First, a DNA construct containing the PGC1 gene to be introduced into the mouse is prepared. Such DNA constructs include, for example, PGC1
Suitable promoters for expression of, for example, the CAG promoter, a rabbit β disposed downstream of the promoter.
Globin intron (Niwa, H., Yamamura, K., and Mi
yazaki, J. (1991) Gene 108, 193-199), the PGC1 gene located downstream of the intron (SEQ ID NO: 1), and the rabbit β-globin polyA addition site located downstream of the PGC1 gene (Niwa, H., Yamamura, K., andMiyazaki, J. (1991)
Gene 108, 193-199) (FIG. 1A). The CAG promoter consists of the chicken actin promoter and the cytomegalovirus enhancer (Niwa, H., Yamamura,
K., and Miyazaki, J. (1991) Gene 108, 193-199). C
The AG promoter and the rabbit β-globin polyA addition site are contained in the pCAGGS plasmid. pCAGGS is available to everyone from RIKEN Genebank, RIKEN Life Science Center Tsukuba Research Center. Next, the DNA construct is introduced into a mouse to prepare a transgenic mouse. Methods for producing transgenic mice are well known, and include the latest technology of Gene Targeting by Youdosha and Gordon, JW (1993) Guide to Te.
chniques in Mouse Development (Wassarman, PM, a
nd DePamphilis, ML, Eds.), Academic Press, San
It is described in detail in Diego and the like. A brief description of the method is as follows. 1) Female mice are injected with hormones to forcibly superovulate, fertilize, and fertilized eggs are removed from the fallopian tubes one day after mating. 2) A DNA construct containing the PGC1 gene is injected by microinjection into the whole male nucleus under a microscope into a fertilized egg before the nucleus is fused. 3) Approximately 20 fertilized eggs subjected to such an operation are transplanted into the uterus or fallopian tube of a pseudopregnant female mouse (foster parent). 4) The female mouse is bred as usual, and the offspring mouse is delivered. Successful introduction of the PGC1 gene is confirmed by Southern blotting of DNA extracted by cutting off the tip of the tail of a pup mouse.

(2) Transformation into which PGC1 gene is introduced
Properties of the transgenic mouse The transgenic mouse into which the PGC1 gene of the present invention has been introduced is a non-transgenic mouse (control mouse).
It has the following features as compared with. (I) It has a larger BAT mass than control mice. (Ii) Fat droplets of BAT are smaller and more numerous than those of control mice. (Iii) low body weight (iv) high energy consumption (v) increased expression of UCP-1 and UCP-3.
The expression level of UCP-1 increases in BAT, kidney cells, and skeletal muscle cells, and the expression level of UCP-3 increases in BAT, kidney cells, and skeletal muscle cells. These results indicate that when the expression level of PGC-1 increases, B
This indicates that the expression of UCP-1 increases in AT cells and the like, and the electron transfer and the ATP synthesis reaction are disrupted. As a result, fat is consumed, heat is generated, and energy consumption increases. Here, the expression of PGC1 and UCP-
The in vivo relationship of the expression of 1 was first revealed. The UCP-1 gene promoter has a PPARγ binding site (Sears, IB et al., Mol. Cell Bio.
l., 16; 3410-3419 (1996)).
It is considered that the increase in the expression of -1 increases the transcriptional activity of the PPARγ-PGC-1 complex and increases the expression level of UCP-1.

(3) Phase of PGC-1-PPARγ complex
The present invention relates to a method for screening a substance that alters the interaction of a PGC-1-PPARγ complex, comprising: 1) PGC-1, 2) PPARγ, and 3) a response element, A test substance is added to a system containing a promoter and a vector containing a reporter gene linked to be expressed by the promoter, and the transcriptional activity of the PGC-1-PPARγ complex is regulated using the expression of the reporter gene as an index. Also relates to methods that include detecting

The gene sequence and amino acid sequence of PPARγ are known (Dreyer et al., Cell, 68, 879-887).
(1992); Zhu et al., J. Biol. Chem., 268, 26817-2.
6lie (1993); Kliewer et al., Proc. Natl. Acad. Sci. US
A., 91, 7355-7359 (1994); Mukherjee et al.,
J. Biol. Chem., 272, 8071-1807 (1997); Elb.
Recht et al., Biochem. Biophys. Res. Commun., Vol. 224, No. 4.
31-437 (1996); Chem et al., Biochem. Biophys. Res. Com.
mun., 196, 671-677 (1993); Tontonoz et al., G.
enes & Development, Vol. 8, pp. 1224-1234 (1994); A
perlo et al., Gene, 162, 297-302 (1995)). P
There are two isoforms of PARγ, PPARγ1 and PPARγ2, and PPARγ1 is PPARγ2
Although 30 amino acids on the N-terminal side are deleted as compared with
The other amino acid sequences are the same, and all are known to be expressed in adipose tissue. Its ligand binding region is based on homology with other nuclear receptors, etc.
It is presumed that Rγ2 corresponds to a region containing about 174 to 475 amino acids from the N-terminus.

In the method for screening a substance that alters the interaction of the PGC1-PPARγ complex of the present invention, the PPARγ used need not have a full-length amino acid sequence, and may be shorter or longer than the full length in some cases. Can be. In some cases, the structure may have an additional configuration or a sequence different from its natural sequence, that is, deletion, substitution, addition, or the like, as long as the function is not impaired.

[0015] PPARγ can be directly added to a screening system as a protein, or a system can be constructed using a vector containing a gene encoding PPARγ so that the protein is expressed in the screening system. It is possible.

The amino acid sequence of mouse PGC-1 is shown in SEQ ID NO: 2 in the sequence listing. It is understood from the degenerate nature of the genetic code that it is possible to construct a number of different nucleic acid sequences encoding the amino acid sequence of SEQ ID NO: 2. The nucleotide sequence set forth in SEQ ID NO: 1 is only one of many possible PGC-1 encoding sequences. Accordingly, the preferred nucleic acid molecules, vectors, etc. of the present invention described below and in the accompanying Examples are illustrative and not intended to reduce the scope of the present invention. PGC-1 can be directly added as a protein to a screening system, or a system can be constructed using a vector containing a gene encoding PGC-1 so that the protein is expressed in the screening system. Is also possible.

These sequences can be manufactured by various methods, and the invention is not limited to any particular manufacturing method. The nucleic acid sequence of the present invention can be used for DNA synthesis, cDN
It can be produced by a number of processes, including A cloning, genomic cloning, polymerase chain reaction (PCR) technology, and combinations of these means. These and other technologies are described in Maniatis et al., Molecular Cloning: A Labor.
atory Manual '' (Cold Spring Harbor Press, Cold Sprin
g Harbor Laboratory, Cold Spring Harbor, New York (19
89)) or `` Current protocols in Molecular B
iology "(FMAusubel et al., 1989 and special edition).

A gene encoding PPARγ, and
The gene encoding PGC-1 can be constructed by ordinary gene recombination techniques. For example, it can be obtained by screening a cDNA library by PCR or hybridization using a primer or probe designed and synthesized based on known amino acid sequence and base sequence information. By constructing a vector in which these are ligated downstream of an appropriate promoter, PPARγ and PGC-1 can be expressed in an appropriate host. Vectors include, but are not limited to, plasmids, cosmids, and viruses (including phages). In addition, DNAs encoding these may be added, deleted, or substituted with one or several bases, as long as the required functions are not impaired.
It is also possible to construct a gene encoding PPARγ and a gene encoding PGC-1 as one vector so as to be expressed separately.

Vectors containing a response element, a promoter, and a reporter gene operably linked to the promoter include, but are not limited to, plasmids, cosmids, and viruses (including phages). included. In the vector, the response element, the promoter, and the reporter gene are sequentially ligated in the 5 'to 3' direction.

It is thought that a nuclear receptor such as PPARγ binds to a specific sequence called a response element on the promoter of a target gene and activates transcription in a ligand-dependent manner. The sequence to which PPARγ binds is PPRE (PPARγ Responsiv
e Element, PPARγ response element). The sequence of PPRE is known (SEQ ID NO: 13) (Kliever SA et al., Natur
e, 358: 771-754).

As the promoter of the reporter plasmid, any promoter can be used as long as it is of a type recognized by the cell to be used. Examples of preferred promoters include the thymidine kinase promoter, the CMV (cytomegalovirus) promoter.

The reporter gene in the vector of the present invention is not particularly limited, but is preferably one which is stable and whose activity can be easily quantified. In some cases, transcribed mRNA
Can be determined by means such as a hybridization method and a PCR method. When an enzyme gene or the like is used as the reporter gene, it can be easily measured based on the enzyme activity, which is preferable. Examples include firefly-derived luciferase gene, Escherichia coli-derived β-galactosidase gene, and bacterial transposon-derived chloramphenicol acetyltransferase gene.

The vector can also be designed and constructed using ordinary gene recombination techniques. When screening is performed in a cell, the vector can be present in the cell as a plasmid separately from the chromosome, or can be used by introducing it into the host chromosome using a known technique such as homologous recombination. .

The cell used in the screening system is not particularly limited as long as it can be transfected. Such cells include the CV-1 cell line (Dainippon Pharmaceutical).

A test substance is added to a screening system containing the elements obtained as described above, and if the screening system is in vitro, the expression of the reporter gene is required directly; if the screening system is in vivo, the expression is necessary. If so, screening of a substance that affects the transcription activity of the PGC1-PPARγ complex can be performed by measuring the expression of the reporter gene after culturing the cells. That is,
When a compound is added to the screening system of the present invention,
If the expression level of a reporter gene such as luciferase increases (decreases), the compound becomes PGC-1 and PPA.
This can be considered to be the result of increasing (decreasing) the interaction with Rγ. As described above, in vivo PG
When the expression level of C-1 increases, the expression level of UCP1 increases in BAT cells and the like, and the electron transfer and ATP synthesis reaction are interrupted. As a result, fat is consumed, heat is generated, and energy consumption is reduced. An increase has been revealed by the present invention. Therefore, the substance that increases the transcriptional activity of the PGC-1-PPARγ complex screened by the screening system of the present invention can be used as an antiobesity drug or a drug for treating obesity-related diseases by increasing the expression level of UCP1. In addition, the effect of the transgenic mouse of the present invention can be confirmed by directly administering an antiobesity drug or a candidate substance for a drug for treating a disease associated with obesity to the transgenic mouse.

[0026]

EXAMPLES Example 1 Construction of Plasmid pCAGGS-PGC1 The pCAGGS plasmid is a DNA containing a CAG promoter (consisting of a chicken actin promoter and a cytomegalovirus enhancer) and a rabbit β-globin polyA addition site. The gene fragment incorporated into pCAGGS can highly express proteins in various cells and tissues. (Niwa, H., Yamamura, K., and Miyazaki, J. (1
991) Gene 108, 193-199) pCAGGS is available to anyone from RIKEN Genebank, RIKEN Life Science Center Tsukuba Research Center. Mouse PGC-1 c
DNA was obtained by screening a mouse embryo cDNA library and confirmed by sequencing. PGC
-1 by inserting the full-length coding region of the cDNA (SEQ ID NO: 1) into the EcoRI site of pCAGGS.
pCAGGS-PGC-1 was constructed.

Example 2 Preparation of Transgenic Mouse The transgene fragment was digested with pCAGGS by restriction (SalI /
BamHI) to give pCAGGS-PGC-1
And purified by electrophoresis (2 ng / μ
l). This fragment has 5 kb. The PGC1 gene is C
It is under the control of the AG promoter (having the chicken β-actin promoter and the cytomegalovirus immediate-early enhancer) and contains the rabbit β-globin intron and its polyadenylation site (FIG. 1A). Donor mice were prepared using standard methods (23). Female BDF1 crossed with male BDF1 (C57BL / 6x
Fertilized eggs were collected from DBA / 2) and microinjected by a standard method. In other words, frozen fertilized eggs (can be purchased from Japan SLC, Japan Claire, etc.)
Is thawed, placed on the glass chamber of the microscope, the needle tip is brought close to the fertilized egg with a microscope, and the DNA solution is injected into the fertilized egg using an injection micromanipulator (Leica). Thereafter, the fertilized eggs into which the DNA solution had been injected were transplanted into the fallopian tubes of recipient female mice. This operation can be performed using the latest technology of Gene Targeting by Youdosha or Gordon, JW (199
3) Guide to Techniques in Mouse Development (Wassa
rman, PM, and DePamphilis, ML, Eds.), Academ
ic Press, San Diego, etc., and performed according to it. Mice are generated from recipient female mice. By this operation, a transgenic mouse was created. The transgene copy number was determined by Southern blotting using tail mouse DNA from pups. For Southern blotting, a 0.6 kb EcoRI fragment of pCAGGS-PGC-1 was used as a probe.
The results are shown in FIG. 1B. Introduced PGC-1 in each mouse
Gene copy number was assessed by densitometric scanning of autoradiography from Southern blots. Maximum copy number of transgene (100 or more)
Mice with increased respiration (coarse breath) and died at 8 weeks of age after becoming very lean. Lowest copy number, only 2
Mice carrying the copy (FIG. 1, B, line A3) showed no detectable signal of the transgene. Therefore, lines A1 (64 copies) and A2
(53 copies) with similar results. Offspring were generated by breeding founder mice with C57BL / 6 mice. Mouse 12 hours light / 1
It was kept dark (lit at 6 am) for 2 hours. Mouse care was performed according to standardized guidelines.

Example 3 Properties of PGC1 Transgenic Mice (3-1) Morphology and Tissue of Transgenic Mice
Histological nature Morphological properties: established mouse line expressing PGC-1 is normal pregnancy, have a birth and liter size,
It appears to be developmentally normal, viable and apparently healthy. The appearance and behavior of these transgenic mice are also normal. Young PGC-1 transgenic mice had a weight similar to that of non-transgenic mice. However, an age-dependent increase in body weight was observed in control mice, whereas transgenic mice (24 weeks of age) weighed significantly less than wild-type littermate (control mice 28.7).
± 2.7 g and transgenic mice 25.9 ±
3.4 g, p <0.05) (FIG. 4A). This difference may be the result of increased energy expenditure in transgenic mice, based on the physiological function of UCP in controlling energy expenditure. Statistical comparison is Student '
This was performed using the st-test. Statistical significance was p <0.
05 (the same applies hereinafter).

Histological Analysis of BAT Mice were perfused through the left ventricle with PBS followed by 4% paraformaldehyde (pH 7.4), then the BAT was removed and embedded in paraffin. Deparaffinized sections were stained with hematoxin and eosin or by immunohistochemical methods. Immunoperoxidase staining was performed using a previously reported polyclonal antibody against UCP-1. Briefly, endogenous peroxidase activity was blocked by incubating in 0.3% H2O2 in methanol for 20 minutes. Next, with the primary antibody, ie, anti-UCP-1 antibody, 8
After incubation at 4 ° C. for hours, the tissue sections were exposed to 2% normal goat serum for 10 minutes. The UCP
The -1 antibody was diluted 1: 500 in PBS for use.
The sections were then incubated with a biotinylated goat anti-rabbit IgG secondary antibody for 10 minutes. The section is avidin-biotin-peroxidase complex (Vect
or Laboratories, Inc., Burlingame, Calif.) and then incubated for 5 minutes, 50 mM Tris-HCl (p
0.5 mg / ml 3,3-diaminobenzidine tetrahydrochloride (Sigma, St. Louis, H7.5) in H7.5).
MO, USA) and treatment with 3 μl / ml H 2 O 2. Between each step, sections were washed three times in PBS. As a control for immunohistochemical specificity, anti-UC
Sections incubated in normal rabbit blood at the same dilution instead of the P-1 antiserum did not give any discernable signal. The number of lipid droplets and nuclei, or the average diameter of lipid droplets of the BAT, is based on counting or measuring six microscopic fields of histological sections.

PGC-1 transgenic mice have a larger BAT mass than non-transgenic mouse littermate controls (FIG. 3A, PGC-1 at 12 weeks of age).
0.73 ± 0.1 in transgenic mice
4g and 0.49 ± 0.12g in control mice, p <
0.05). Histologically, BAT from control mice showed typical brown adipocytes, whereas PGC-1 transgenic BAT cells, in contrast, had numerous cytoplasmic lipid droplets (FIGS. 3B and C). These lipid droplets are smaller than those present in control mice (FIG. 3D, average diameter of lipid droplets: 4.2 ± 1.8 μm in PGC-1 transgenic mice and 10 ± 3.2 μm in control mice).
m, p <0.05), high in number (FIG. 3E, 14.7 per cell in PGC-1 transgenic mice).
± 3.9 lipid droplets and 9.6 ± cells per cell in control mice
2.1 fat droplets, p <0.05). These suggest that the BAT of the PGC-1 transgenic mouse is performing hyperactive breathing. In fact, UCP-1 protein expression was determined by immunohistochemical analysis of UCP-1 protein, as compared to that of control mice.
The BAT section of one transgenic mouse significantly increased (FIG. 3, C).

(3-2) Transgenic mice
PGC1 expression level in PGC-1 transgene expression was first assessed by Northern blot analysis. Northern blotting was performed as previously described (24). Total RNA was isolated from cells and mouse tissues by extraction with guanidine isocyanate, followed by centrifugation on a layer of 5.7 M CsCl. 20 μg of total RNA is separated by electrophoresis,
Next, it was transferred to a nylon membrane (Amersham Pharmacia Biotech, Tokyo). The membrane was washed with 0.65M NaC
1, 0.1 M sodium PIPES, pH 7.4, 5
Prehybridization was performed for 6 hours at 42 ° C. in 50% formamide containing 0.1% each of mM EDTA, SDS, bovine serum albumin, polyvinylpyrrolidone, and Ficoll 400, and 100 μg / ml calf thymus DNA. Hybridization was performed overnight under the same conditions in the presence of the random primer-labeled cDNA probe. After hybridization, the membrane was incubated for 2 hours at 65 ° C.
Wash buffer (0.2% x SSC, 0.1% SDS)
The mixture was washed while stirring at a constant speed, and then subjected to autoradiography. The quantitative analysis was performed using an image analyzer (FLA2000, Fuji Film).

FIG. 2A shows PGCs against total RNA isolated from tissues of 8-week-old PGC-1 transgenic mice (line A1) and control littermate mice.
1 shows the intensity of hybridization with the probe. When a transgene-specific probe (probe 2 in FIG. 1A) was used, only a 3 kb band (indicated by an arrow) was detected. It has been reported that the CAG promoter has strong activity in ubiquitous tissues. However, unexpectedly, this promoter is associated with BAT, heart, kidney,
Some limited tissues, such as skeletal muscle, express high levels of the PGC-1 transgene, but low expression, for example, in the liver (FIG. 2A). These expression profiles indicate that the endogenous PG
It corresponds well to the C-1 expression pattern (FIG. 2A). This observation suggests that an important tissue-specific regulatory cis factor for PGC-1 expression may be in the used PGC-1 cDNA. Two independent transgenic lines (FIG. 1B, lines A1 and A2) show similar expression patterns, suggesting that transgene expression is not significantly affected by insertion sites in the mouse genome.

(3-3) Transgenic mice
The effect of PGC-1 gene expression on UCP expression in various tissues of transgenic mice and control mice was examined. To this end, the expression of UCP in PGC-1 transgenic mice and littermate controls was compared by Northern blot analysis. UCP-1, UCP-2 and UCP-3 radiolabeled on the same blot
The cDNA was hybridized one by one (FIG. 2B-
E).

Mouse UCP-1, UCP-2, UCP-
3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA fragments were obtained by polymerase chain reaction from first strand cDNA using mouse BAT total RNA. First strand cDNA was prepared using a T-primed first strand kit (Amersham Pharmacia Biotech, Tokyo). The primers of the polymerase chain reaction used are as follows.

UCP-1 (Genbank Accession, U63419) (forward) 5'-ACGCCTCTCTGCCCTCCAAGCCAG-3 '(SEQ ID NO: 3) (Reverse) 5'-TCAGTATCTCTTCCTCCAAGTTGC-3' (SEQ ID NO: 4) UCP-2 (Genbank Accession, U82819) ) (Forward) 5'-GGGCTGGTGGTGGTCGGAGA-3 '(SEQ ID NO: 5) (Reverse) 5'-TCAGCATGGAGAGGCTCAGA-3' (SEQ ID NO: 6) UCP-3 (Genbank Accession, AF001787) (Forward) 5'-GAGGGACTATGGATGCCTAC-3 ' (SEQ ID NO: 7) (Reverse) 5'-TTGCCTTGTTCAAAACGGAG-3 '(SEQ ID NO: 8) GAPDH (Genbank Accession, M32599) (Forward) 5'-TCGTCCCGTAGACAAAATGG-3' (SEQ ID NO: 9) (Reverse) 5'-TCTTACTCCTTGGAG GCCAT -3 '(SEQ ID NO: 10)

In addition, long exposure of the blots
1 expression was shown to be induced not only in BAT but also in other tissues, including kidney and skeletal muscle (FIG. 2).
C). UCP-3 mRNA levels were increased in BAT, heart, and skeletal muscle of transgenic mice (FIG. 2D). UCP-2 mRNA expression was reduced in the heart to 56% of that of the wild-type and slightly increased in skeletal muscle. (FIG. 2E). The induction of UCP-1 mRNA in the BAT of PGC-1 transgenic mice is comparable to the induction of UCP-1 mRNA in the BAT of non-transgenic mice when exposed to cold conditions, or Greater than that. These data suggest that physiologically significant amounts of functional PGC-1 protein are produced from the transgene in the BAT of transgenic mice.

(3-4) Transgenic mice
Kicking was measured using an indirect calorimeter system combining the energy consumption of oxygen consumption and carbon dioxide production amount to the mass analyzer and computer. The mouse was subjected to gas mass spectrometry (WSMR-1400,
Open circuit plastic breathing chamber (24x46x18) connected to Westron, Chiba, Japan
cm). The air flow was adjusted to 2 L / min.
Gas analysis was performed from 10:00 to 9:00 the next day. Samples were continuously monitored in a 2 minute block in room air as a control. Motor activity was placed under each respiratory chamber
Automatically recorded every 10 minutes by Animex-III (Shimazu, Kyoto, Japan). Energy consumption was calculated (Ko
menami, N., J. Nutr. Sci. Vitaminol. (Tokyo), 4
1: 395-407). Data for physiological measurements were obtained from male mice. Similar results were obtained from female mice.

The energy consumption of PGC-1 transgenic mice was significantly greater at 12 weeks of age than control mice. (Static energy expenditure: control mice 75.8 ±
2.4 kcal / day / kg 0.75 and PGC-1 transgenic mouse 94.9 ± 5.7 kcal / day /
kg 0.75; total energy expenditure including free exercise:
Control mice 143 ± 2.0 kcal / day / kg 0.75
And PGC-1 transgenic mice 165 ± 6.
6 kcal / day / kg 0.75, p <0.05) (FIG. 4, B and C). These results suggest that the difference in body weight between control and transgenic mice is due to their difference in energy expenditure.

Example 4 Vector encoding PPARγ (pCMX-PPAR
Construction of γ) (1) Isolation of PPARγ1 gene PPARγ1 cDNA was obtained by PCR from cDNA obtained by a reverse transcription reaction from RNA prepared from mouse adipocytes. For the PCR, the sequences shown in the following SEQ ID NOs: 11 and 12 were used as primers.
Mouse PP described in accession number MMU09138 of
The gene was designed based on the ARγ gene sequence, and a restriction enzyme recognition site for insertion into a vector was added to the end of the primer. The resulting 1518 bp fragment was a full-length mouse PPA.
Codes for Rγ. SEQ ID NO: 11: ATGGGTGAAACTCTGGGA
GA SEQ ID NO: 12: CTAATACAAGTCCTTGTA
GA (2) Construction of plasmid for expressing PPARγ protein This PPARγ cDNA was blunt-ended, and
(Forman et al., Cell, Vol. 83, pp. 803-812) with HindII.
It was cut at the I recognition site and inserted into a blunt-ended vector. As a result, a plasmid pCMX-PPARγ for expressing the PPARγ protein was obtained.

Example 5 Construction of Reporter Plasmid (PPRE-TK-luc) Sequence PPRE (SEQ ID NO: 13) to which PPARγ binds (Klie
ver SA et al., Nature, 358: 771-754) and oligonucleotides of complementary strand (SEQ ID NO: 14) were synthesized and mixed, and a TK-luc vector having a thymidine kinase promoter (-105 / + 51) and a luciferase gene. (Forman
Cell, Vol. 83, pp. 803-812) were inserted into the vector cut at the SalI recognition site. As a result, a reporter plasmid PPRE-TK-luc was obtained. PPRE sequence: TCGAGAGGGAGGAGGACAAAGGTCACGTTCGGGAG (SEQ ID NO: 13) PPRE sequence (complementary strand): TCGACTCCCGAACGTGACCTTTGTCCTGGTCCCCTGT (SEQ ID NO: 14)

Example 6 Construction of Screening System A cell line CV-1 (manufactured by Dainippon Pharmaceutical Co., Ltd.) was used.
Plasmid pCAGGS-PGC1 expressing GS-1
(Example 1), pCMX-PPA expressing PPARγ
Rγ (Example 4) and reporter plasmid PPR
Transfected with E-TK-luc (Example 5).
Dulbecco supplemented with CV-1 cells supplemented with 10% fetal bovine serum
In modified Eagle's medium (DMEM). Cells are washed with phosphate-buffered saline, 0.125%
And plated in 24-well dishes. Two hours before transfection, add 5μl of medium.
Replaced with fresh DMEM supplemented with g / ml insulin, 5 μg / ml transferrin and bovine serum albumin without 0.01% fatty acids. Transfection was performed by the calcium phosphate precipitation method. Cells were transformed with 250 ng of reporter plasmid PPRE-T.
K-luc, 250 ng of control plasmid (pCMX-
βgal), 30 ng of pCMX-PPARγ, and varying amounts (0 ng to 60 ng) of pCAGGS-PG
Transfections were performed for 6 hours in 24 wells with C1 and empty pCAGGS in an amount that resulted in a total of 600 ng DNA per well. After washing off the DNA precipitate, the cells were incubated for 36 hours in serum-free medium (DMEM without added fetal calf serum). Cell extracts were then prepared and analyzed for luciferase and β-galactosidase activity. Luciferase activity was measured in specific light units and normalized with β-galactosidase activity. The results of the three experiments are averaged, and the results are shown in FIG. 5 on the basis of the absence of PGC-1. PGC-1
As the expression increases, the expression level of luciferase increases. It is considered that PGC-1 interacts with PPARγ to form a complex, thereby increasing transcription activity. Therefore, when a certain compound is added to the screening system of the present invention, if the expression level of a reporter gene such as luciferase is increased (decreased), the compound becomes PGC
This can be considered to be the result of increasing (decreasing) the interaction between -1 and PPARγ.

[0042]

[Sequence List] SEQUENCE LISTING <110> Osaka Bioscience Institute <120> Transgenic Mouse and Method for Screening Anti-obesity Drug <130> 176973 <160>

[0043] <210> 1 <211> 3029 <212> DNA <213> mouse <400> 1 aattcggcac gaggttgcct gcatgagtgt gtgctgtgtg tcagagtgga ttggagttga 60 aaaagcttga ctggcgtcat tcgggagctg gatggcttgg gacatgtgca gccaagactc 120 tgtatggagt gacatagagt gtgctgctct ggttggtgag gaccagcctc tttgcccaga 180 tcttcctgaa cttgaccttt ctgaacttga tgtgaatgac ttggatacag acagctttct 240 gggtggattg aagtggtgta gcgaccaatc ggaaatcata tccaaccagt acaacaatga 300 gcctgcgaac atatttgaga agatagatga agagaatgag gcaaacttgc tagcggtcct 360 cacagagaca ctggacagtc tccccgtgga tgaagacgga ttgccctcat ttgatgcact 420 gacagatgga gccgtgacca ctgacaacga ggccagtcct tcctccatgc ctgacggcac 480 ccctccccct caggaggcag aagagccgtc tctacttaag aagctcttac tggcaccagc 540 caacactcag ctcagctaca atgaatgcag cggtcttagc actcagaacc atgcagcaaa 600 ccacacccac aggatcagaa caaaccctgc cattgttaag accgagaatt catggagcaa 660 taaagcgaag agcatttgtc aacagcaaaa gccacaaaga cgtccctgct cagagcttct 720 caagtatctg accacaaacg atgaccctcc tcacaccaaa cccacagaaa acaggaacag 780 cagcaga gac aaatgtgctt ccaaaaagaa gtcccataca caaccgcagt cgcaacatgc 840 tcaagccaaa ccaacaactt tatctcttcc tctgacccca gagtcaccaa atgaccccaa 900 gggttcccca tttgagaaca agactattga gcgaacctta agtgtggaac tctctggaac 960 tgcaggccta actcctccca caactcctcc tcataaagcc aaccaagata accctttcaa 1020 ggcttcgcca aagctgaagc cctcttgcaa gaccgtggtg ccaccgccaa ccaagagggc 1080 ccggtacagt gagtgttctg gtacccaagg cagccactcc accaagaaag ggcccgagca 1140 atctgagttg tacgcacaac tcagcaagtc ctcagggctc agccgaggac acgaggaaag 1200 gaagactaaa cggcccagtc tccggctgtt tggtgaccat gactactgtc agtcactcaa 1260 ttccaaaacg gatatactca ttaacatatc acaggagctc caagactcta gacaactaga 1320 cttcaaagat gcctcctgtg actggcaggg gcacatctgt tcttccacag attcaggcca 1380 gtgctacctg agagagactt tggaggccag caagcaggtc tctccttgca gcaccagaaa 1440 acagctccaa gaccaggaaa tccgagcgga gctgaacaag cacttcggtc atccctgtca 1500 agctgtgttt gacgacaaat cagacaagac cagtgaacta agggatggcg acttcagtaa 1560 tgaacaattc tccaaactac ctgtgtttat aaattcagga ctagccatgg atggcctatt 1620 tgatgacagt gaaga tgaaa gtgataaact gagctaccct tgggatggca cgcagcccta 1680 ttcattgttc gatgtgtcgc cttcttgctc ttcctttaac tctccgtgtc gagactcagt 1740 gtcaccaccg aaatccttat tttctcaaag accccaaagg atgcgctctc gttcaagatc 1800 cttttctcga cacaggtcgt gttcccgatc accatattcc aggtcaagat caaggtcccc 1860 aggcagtaga tcctcttcaa gatcctgtta ctactatgaa tcaagccact acagacaccg 1920 cacacaccgc aattctccct tgtatgtgag atcacgttca aggtcaccct acagccgtag 1980 gcccaggtac gacagctatg aagcctatga gcacgaaagg ctcaagaggg atgaataccg 2040 caaagagcac gagaagcggg agtctgaaag ggccaaacag agagagaggc agaagcagaa 2100 agcaattgaa gagcgccgtg tgatttacgt tggtaaaatc agacctgaca caacgcggac 2160 agaattgaga gaccgctttg aagtttttgg tgaaattgag gaatgcaccg taaatctgcg 2220 ggatgatgga gacagctatg gtttcatcac ctaccgttac acctgtgacg ctttcgctgc 2280 tcttgagaat ggatatactt tacgcaggtc gaacgaaact gacttcgagc tgtacttttg 2340 tggacggaag caatttttca agtctaacta tgcagaccta gataccaact cagacgattt 2400 tgaccctgct tccaccaaga gcaagtatga ctctctggat tttgatagtt tactgaagga 2460 agctcagaga agcttgcgca ggtaacgtgt tcccaggctg aggaatgaca gagagatggt 2520 caatacctca tgggacagcg tgtcctttcc caagactctt gcaagtcata cttaggaatt 2580 tctcctactt tacactctct gtacaaaaat aaaacaaaac aaaacaacaa taacaacaac 2640 aacaacaaca ataacaacaa caaccatacc agaacaagaa caacggttta catgaacaca 2700 gctgctgaag aggcaagaga cagaatgata atccagtaag cacacgttta ttcacgggtg 2760 tcagctttgc tttccctgga ggctcttggt gacagtgtgt gtgcgtgtgt gtgtgtgggt 2820 gtgcgtgtgt gtatgtgtgt gtgtgtactt gtttggaaag tacatatgta cacatgtgag 2880 gacttggggg cacctgaaca gaacgaacaa gggcgacccc ttcaaatggc agcatttcca 2940 tgaagacaca cttaaaacct acaacttcaa aatgttcgta ttctatacaa aaggaaaata 3000 aataaatata aaaaaaaaaa aaaaaaaaa 3029

<210> 2 <211> 797 <212> PRT <213> mouse <400> 2 Met Ala Trp Asp Met Cys Ser Gln Asp Ser Val Trp Ser Asp Ile Glu 1 5 10 15 Cys Ala Ala Leu Val Gly Glu Asp Gln Pro Leu Cys Pro Asp Leu Pro 20 25 30 Glu Leu Asp Leu Ser Glu Leu Asp Val Asn Asp Leu Asp Thr Asp Ser 35 40 45 Phe Leu Gly Gly Leu Lys Trp Cys Ser Asp Gln Ser Glu Ile Ile Ser 50 55 60 Asn Gln Tyr Asn Asn Glu Pro Ala Asn Ile Phe Glu Lys Ile Asp Glu 65 70 75 80 Glu Asn Glu Ala Asn Leu Leu Ala Val Leu Thr Glu Thr Leu Asp Ser 85 90 95 Leu Pro Val Asp Glu Asp Gly Leu Pro Ser Phe Asp Ala Leu Thr Asp 100 105 110 Gly Ala Val Thr Thr Asp Asn Glu Ala Ser Pro Ser Ser Met Pro Asp 115 120 125 Gly Thr Pro Pro Pro Gln Glu Ala Glu Glu Pro Ser Leu Leu Lys Lys 130 135 140 Leu Leu Leu Ala Pro Ala Asn Thr Gln Leu Ser Tyr Asn Glu Cys Ser 145 150 155 160 Gly Leu Ser Thr Gln Asn His Ala Ala Asn His Thr His Arg Ile Arg 165 170 175 Thr Asn Pro Ala Ile Val Lys Thr Glu Asn Ser Trp Ser Asn Lys Ala 180 185 190 Lys Ser Ile Cys Gln Gln Gln Lys Pro Gln Arg Arg Pro Cys Ser Glu 195 200 205 Leu Leu Lys Tyr Leu Thr Thr Asn Asp Asp Pro Pro His Thr Lys Pro 210 215 220 Thr Glu Asn Arg Asn Ser Ser Arg Asp Lys Cys Ala Ser Lys Lys Lys 225 230 235 240 Ser His Thr Gln Pro Gln Ser Gln His Ala Gln Ala Lys Pro Thr Thr 245 250 255 Leu Ser Leu Pro Leu Thr Pro Glu Ser Pro Asn Asp Pro Lys Gly Ser 260 265 270 Pro Phe Glu Asn Lys Thr Ile Glu Arg Thr Leu Ser Val Glu Leu Ser 275 280 285 Gly Thr Ala Gly Leu Thr Pro Pro Thr Thr Pro Pro His Lys Ala Asn 290 295 300 Gln Asp Asn Pro Phe Lys Ala Ser Pro Lys Leu Lys Pro Ser Cys Lys 305 310 315 320 Thr Val Val Pro Pro Pro Thr Lys Arg Ala Arg Tyr Ser Glu Cys Ser 325 330 335 Gly Thr Gln Gly Ser His Ser Thr Lys Lys Gly Pro Glu Gln Ser Glu 340 345 350 Leu Tyr Ala Gln Leu Ser Lys Ser Ser Gly Leu Ser Arg Gly His Glu 355 360 365 Glu Arg Lys Thr Lys Arg Pro Ser Leu Arg Leu Phe Gly Asp His Asp 370 375 380 Tyr Cys Gln Ser Leu Asn Ser Lys Thr Asp Ile Leu Ile Asn Ile Ser 385 390 395 400 Gln Glu Leu Gl n Asp Ser Arg Gln Leu Asp Phe Lys Asp Ala Ser Cys 405 410 415 Asp Trp Gln Gly His Ile Cys Ser Ser Thr Asp Ser Gly Gln Cys Tyr 420 425 430 Leu Arg Glu Thr Leu Glu Ala Ser Lys Gln Val Ser Pro Cys Ser Thr 435 440 445 Arg Lys Gln Leu Gln Asp Gln Glu Ile Arg Ala Glu Leu Asn Lys His 450 455 460 Phe Gly His Pro Cys Gln Ala Val Phe Asp Asp Lys Ser Asp Lys Thr 465 470 475 475 480 Ser Glu Leu Arg Asp Gly Asp Phe Ser Asn Glu Gln Phe Ser Lys Leu 485 490 495 Pro Val Phe Ile Asn Ser Gly Leu Ala Met Asp Gly Leu Phe Asp Asp 500 505 510 Ser Glu Asp Glu Ser Asp Lys Leu Ser Tyr Pro Trp Asp Gly Thr Gln 515 520 525 Pro Tyr Ser Leu Phe Asp Val Ser Pro Ser Cys Ser Ser Phe Asn Ser 530 535 540 Pro Cys Arg Asp Ser Val Ser Pro Pro Lys Ser Leu Phe Ser Gln Arg 545 550 555 560 Pro Gln Arg Met Arg Ser Arg Ser Arg Ser Phe Ser Arg His Arg Ser 565 570 575 Cys Ser Arg Ser Pro Tyr Ser Arg Ser Arg Ser Arg Ser Pro Gly Ser 580 585 590 Arg Ser Ser Ser Arg Ser Cys Tyr Tyr Tyr Glu Ser Ser His Tyr Arg 595 600 605 His Arg Thr His Ar g Asn Ser Pro Leu Tyr Val Arg Ser Arg Ser Arg 610 615 620 Ser Pro Tyr Ser Arg Arg Pro Arg Tyr Asp Ser Tyr Glu Ala Tyr Glu 625 630 635 640 His Glu Arg Leu Lys Arg Asp Glu Tyr Arg Lys Glu His Glu Lys Arg 645 650 655 Glu Ser Glu Arg Ala Lys Gln Arg Glu Arg Gln Lys Gln Lys Ala Ile 660 665 670 Glu Glu Arg Arg Val Ile Tyr Val Gly Lys Ile Arg Pro Asp Thr Thr 675 680 680 685 Arg Thr Glu Leu Arg Asp Arg Phe Glu Val Phe Gly Glu Ile Glu Glu 690 695 700 Cys Thr Val Asn Leu Arg Asp Asp Gly Asp Ser Tyr Gly Phe Ile Thr 705 710 715 715 720 Tyr Arg Tyr Thr Cys Asp Ala Phe Ala Ala Leu Glu Asn Gly Tyr Thr 725 730 735 Leu Arg Arg Ser Asn Glu Thr Asp Phe Glu Leu Tyr Phe Cys Gly Arg 740 745 750 Lys Gln Phe Phe Lys Ser Asn Tyr Ala Asp Leu Asp Thr Asn Ser Asp 755 760 760 Asp Phe Asp Pro Ala Ser Thr Lys Ser Lys Tyr Asp Ser Leu Asp Phe 770 775 780 Asp Ser Leu Leu Lys Glu Ala Gln Arg Ser Leu Arg Arg 785 790 795

<210> 3 <211> 24 <212> DNA <213> Artificial Sequence <400> 3 acgcctctct gccctccaag ccag 24

<210> 4 <211> 24 <212> DNA <213> Artificial Sequence <400> 4 tcagtatctc ttcctccaag ttgc 24

<210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 gggctggtgg tggtcggaga 20

<210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 tcagcatgga gaggctcaga 20

<210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 gagggactat ggatgcctac 20

<210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 ttgccttgtt caaaacggag 20

<210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 tcgtcccgta gacaaaatgg 20

<210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 tcttactcct tggaggccat 20

<210> 11 <211> 20 <212> DNA <213> Artificial Sequence <223> Description of Artificial Sequence: primer sequence for PPARgamma <400> 11 atgggtgaaa ctctgggaga 20

<210> 12 <211> 20 <212> DNA <213> Artificial Sequence <223> Description of Artificial Sequence: primer sequence for PPARgamma <400> 12 ctaatacaag tccttgtaga 20

<210> 13 <211> 35 <212> DNA <213> Artificial Sequence <223> Description of Artificial Sequence: primer sequence for PPARgamma <400> 13 tcgagaggga ggaggacaaa ggtcacgttc gggag 35

<210> 14 <211> 37 <212> DNA <213> Artificial Sequence <223> Description of Artificial Sequence: primer sequence for PPARgamma <400> 14 tcgactcccg aacgtgacct ttgtcctggt cccctgt 37

[Brief description of the drawings]

FIG. 1A: Map of the 5 kb construct used for transgenic microinjection. The transgene is under the control of the CAG promoter and contains the rabbit β-globin intron and its polyadenylation site. The probes used for the Southern blot (Probe 1 for PGC-1 gene) and the probes used for Northern blot (Probe 1 for PGC-1 mRNA and Probe 2 specific to the transgene) are shown on the map of the transgene. . FIG. 1B: Characterization of PGC-1 transgenic mice. Three transgenic F1 mice, A1, A2, and A3, were identified by tail Southern blot analysis. The copy number of each line was assessed by densitometry scanning from Southern blots,
1:64, A2: 53, and A3: 2.

FIG. 2 shows the expression of the PGC-1 transgene and altered levels of UCP in mice. PGC-1 (A), UC in tissues from PGC-1 transgenic mice (line A) and littermate control mice
P-1 (B, C), UCP-3 (D), and UCP-2
(E) Northern blot analysis of mRNA expression. RNA from brown adipose tissue (BAT), heart, kidney, liver and skeletal muscle was analyzed. Each lane contains 20 μg of total RNA. GAPDH mRNA was examined as a control (F).

FIG. 3 A: Rittermate control mouse and PGC-
1 shows a comparison of BAT weight of transgenic mice. The vertical axis represents the average value of BAT weight ± standard error (n = 6 per mouse group, p <0.05). B, C: Comparison of BAT morphology of litermate control mice and PGC-1 transgenic mice. BAT was removed from 12-week-old PGC-1 transgenic mice and littermate control mice, and B was tissue fixed with paraformaldehyde and stained with hematoxin and eosin (H & E). C is the immunohistochemistry of UCP-1 in the same section from mouse as shown in B. Magnification 400x. D, E: Comparison of diameter (D) and number (E) of fat droplets of BAT. The diameter of the lipid droplets was measured and the number per 10 cells from the section indicated in B was counted. The vertical axis represents the mean value ± standard error (n = 20, p <0.
001, n = 6 for the number of fat droplets, p <0.05)

FIG. 4 shows the phenotype of female PGC-1 transgenic mice. A: When measured at the age of 24 weeks, PGC-
One transgenic mouse was significantly lighter than the litermate control mouse. The vertical axis represents the average value of the body weight ± standard error (n = 6 per mouse group, p <0.05). B, C: static (B) and total (C) energy consumption is 1
At 2 weeks of age, it was significantly greater in PGC-1 transgenic mice than in litermate controls. The vertical axis represents the average value of energy consumption ± standard error (n = 6 per mouse group, p <0.05).

FIG. 5 shows the activity of PGC-1 to regulate the transcription of PPARγ.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/50 C12Q 1/66 // C12Q 1/66 C12R 1:91 (C12Q 1/02 C12N 15/00 ZNAA C12R 1:91) F term (reference) 2G045 AA34 AA35 DA13 DA36 FB02 FB12 GC15 4B024 AA11 BA63 BA80 DA02 EA04 GA11 HA01 4B063 QA01 QA18 QQ20 QR02 QR59 QR69 QR77 QR80 QS03 QS24 QS28 QS36 QX02

Claims (5)

[Claims] 1. The PPARγ cofactor 1 of SEQ ID NO: 1.
A transgenic mouse into which the (PGC-1) gene is introduced and which overexpresses PGC-1, wherein the body weight is reduced, the mass of brown adipose tissue is increased, and energy consumption is increased, as compared with a wild-type mouse; Non-conjugated protein-1 (UCP
-1) and a mouse in which the expression level of non-conjugated protein-3 (UCP-3) is increased. 2. A method for screening a substance that alters the interaction of a PGC-1-PPARγ complex, comprising: 1) PGC-1, 2) PPARγ, and 3) a response element, a promoter, and expression by the promoter. A method comprising the steps of: adding a test substance to a system containing a vector containing a reporter gene linked so as to be capable of being detected, and detecting the regulation of the transcriptional activity of the PGC-1-PPARγ complex using the expression of the reporter gene as an index. 3. The substance to be screened is PGC-1
The screening method according to claim 2, which increases the interaction of the -PPARγ complex. 4. The method according to claim 2, which is used for screening an antiobesity drug or a drug for treating a disease associated with obesity. 5. A method for screening an anti-obesity drug or a drug for treating a disease associated with obesity, which comprises using the transgenic mouse according to claim 1.