JP2002272465A - Paramyxovirus vector for foreign gene transduction - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a paramyxovirus vector capable of transducing a foreign gene, having a replication ability. SOLUTION: A Sendai virus having a foreign gene is constructed by inserting the foreign gene into before or behind a virus gene of Sendai virus genome cDNA. The Sendai virus proves that it has a replication ability and a foreign gene is expressed in a transduced cell. The expression amount of the foreign gene is higher closer to 3' of negative chain RNA and a high expression is obtained when the foreign gene is inserted into especially before an NP gene and between the NP gene and a P gene. On the contrary, the expression is lower closer to 5' of the negative chain RNA and a relatively low expression is obtained when the foreign gene is inserted into especially behind an L gene, between a HN gene and the L gene and between an F gene and the NH gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a replication-competent paramyxovirus vector into which a foreign gene can be introduced.

[0002]

BACKGROUND OF THE INVENTION Many of the approaches to clinical research in gene therapy so far utilize viral vectors such as retroviruses, adenoviruses, and adeno-associated viruses. These gene therapy vectors have major problems in medical applications such as limited transfer efficiency and sustained expression, and the vectors themselves have cytotoxicity and immunogenicity (Lamb, RA & Kolakofsky, D., Paramyxovirid
ae: the viruses and their replication.in Fields V
irology, 3rd edn, (Edited by BN Fields, DM Kni
pe & PP Howley) pp.1177-1204 (Philadelphia, Lippin
cott-Raven. (1996)). As a countermeasure against these, new vectors have been proposed based on lentiviruses and HSV, and research on improving existing vectors has been made vigorously. However, all of these vectors exist in the life cycle in the form of DNA in the nucleus. Therefore, it is difficult to completely avoid the safety concerns associated with random interactions with the patient's chromosomes.

[0003] With the rapid progress of the recent reverse genetics technology, it has become possible to develop a vector based on an RNA virus which has been under development until now. Recombinant RNA viruses show high gene transfer efficiency and expression ability, suggesting high potential as a vector for gene therapy (Roberts, A. & Rose, JK, Virolog
y 247,1-6 (1998); Rose, JK, Proc. Natl. Acad. S
ci. USA 93, 14998-15000 (1996); Palese, P. et al.,
Proc. Natl. Acad. Sci. USA 93, 11354-11358 (199
6)). Paramyxovirus vectors that have negative-strand RNA in their genomes have several features that are significantly different from retrovirus, DNA virus, or plus-strand RNA virus vectors. Its genome or antigenome does not directly function as mRNA and cannot initiate viral protein synthesis or genome replication. Both the RNA genome and the antigenome of a virus always exist in the form of a ribonucleoprotein (RNP) complex, and mRNAs hybridize to naked genomic RNA complementary to mRNAs, as found in positive-strand RNA viruses. Antisense problems, such as interfering with assembly of RNPs into RNPs, are rare. These viruses have their own RNA polymerase and use the RNP complex as a template to perform transcription of viral mRNA or replication of the viral genome. Notably, negative-strand RNA (nsRNA) viruses grow only in the cytoplasm of the host cell and do not have a DNA phase, so no chromosomal integration occurs. Furthermore, homologous recombination between RNAs has not been observed. These properties are thought to greatly contribute to the stability and safety of negative strand RNA virus as a gene expression vector.

The present inventors have paid attention to the Sendai virus (Sendai virus; SeV), which has no pathogenicity to humans among the negative-strand RNA viruses, and particularly to the attenuated strain Z. SeV is a non-segmented negative-strand RNA virus belonging to paramyxovirus
ine parainfluenza virus. The virus is composed of two envelope glycoproteins, hemagglutinin-neuraminidase;
HN) and fusion protein (F)
To adhere to the host cell membrane, cause membrane fusion, and efficiently use its own RNA polymerase and ribonucleoprotein (RN
P) Releases the RNA genome, present in the form of a complex, into the cytoplasm,
Thus, transcription of the viral mRNA and replication of the genome are performed (Bitzer, M. et al., J. Virol. 71 (7): 5481-5486, 19).
97). The viral envelope protein F is synthesized as an inactive precursor protein (F ₀ ) and is cleaved into F1 and F2 by proteolytic cleavage by trypsin (Kido, H. et al., Biopolymers (Peptide Science))
51 (1): 79-86, 1999), which becomes an active protein and causes membrane fusion. The virus is said to be non-pathogenic to humans. Lab attenuated strains (Z strains) have also been isolated, and only induce mild pneumonia in rodents, which are natural hosts. This strain has been widely used as a research model at the molecular level, such as the transcription / replication mechanism of paramyxovirus, and has also been used for producing hybridomas. In addition to such high safety, the virus exhibits a high production titer of ^{109 to 11} pfu / ml in cell lines or chicken eggs. Among the recent successful systems for recovering negative-strand RNA virus vector from cDNA, Sendai virus shows particularly high reconstitution efficiency. Attention has been paid to the ability to efficiently and stably express the introduced foreign gene in the recombinant wild virus into which the foreign gene has been introduced.

So far, Sendai virus vectors in which a foreign gene is inserted upstream of the NP gene have been known. It was not known what the effects would be.

[0006]

An object of the present invention is to provide a replication-competent paramyxovirus vector into which a foreign gene can be introduced.

[0007]

Means for Solving the Problems The present inventors have constructed a virus vector DNA in which a foreign gene has been inserted into sites before and after each gene encoding a virus protein of Sendai virus, and reconstituted the virus and reconstructed the foreign gene. The expression level was examined. That is, a new restriction enzyme site for insertion of a foreign gene was introduced into the full-length genomic cDNA of Sendai virus (SeV) between the start signal of each gene encoding a viral protein and the ATG translation start signal. Insertion of a foreign gene (human secreted alkaline phosphatase gene) into this restriction enzyme site and reconstitution of Sendai virus using LLC-MK2 cells confirmed that Sendai virus having replication ability was reconstituted. Was done. Each of these viruses was amplified in chicken eggs and virus stock solutions were prepared. When this virus was used to infect LLC-MK2 cells together with the titer and the expression level of the foreign gene was measured, the expression of the foreign gene was observed regardless of the location of the inserted foreign gene at any of the positions examined. When the foreign gene is inserted upstream of the genome (3 ′ side of the negative strand), that is, before the NP gene or between the NP gene and the P gene, the expression level of the foreign gene is relatively high,
The insertion position of the foreign gene is located downstream of the genome (negative strand
It has been found that the expression of the foreign gene decreases as the position approaches (5 ′ side).

[0008] These results indicate that the foreign gene is located upstream of the NP gene or downstream of the NP gene (between the NP gene and the P gene).
, It is possible to obtain relatively high expression of a foreign gene, and it is shown that the expression level can be reduced if the foreign gene is located further downstream of the genome. . Based on this finding, in order to obtain high expression of a foreign gene, the foreign gene should be inserted upstream of the genome, that is, at the 3 'side of the negative strand genome, and conversely, high expression of a cytotoxic gene, etc. In the case where is not preferred, the expression level of the foreign gene in the vector can be controlled by inserting the foreign gene downstream of the genome, that is, at the 5 ′ side of the negative strand genome. Thus, the paramyxovirus vector of the present invention is extremely useful as a paramyxovirus vector for attenuating the expression of a foreign gene. The paramyxovirus vector of the present invention is useful for expression of a foreign gene in vivo and in vitro, and is expected to be applied particularly as a gene therapy vector utilizing the excellent characteristics of paramyxovirus.

[0009] Although the problem of genome stability can be pointed out in RNA viruses, as a result of heterologous gene expression using SeV vectors, almost no mutations in bases were observed even after continuous multiple passages of the virus, and the inserted heterologous gene could be deleted. It has been shown to be stable over a long period of time (Yu, D. et al. Genes Cell
s 2, 457-466 (1997)). Vectors based on this negative-strand RNA virus replicon are based on the replicons of the already successful positive-strand RNA viruses Semliki forest virus or Sindbis viruses. Genome stability and transgene size or packaging flexibility due to lack of capsid structural proteins (flex
There are several advantages in nature, such as A Sendai virus vector capable of replication can introduce foreign DNA into at least 4 kbp, and may be able to simultaneously express two or more genes by adding a transcription unit. In this Sendai virus replicon-based vector, the replicated virus re-infects surrounding cells, and multiple copies of RNP replicated in the cytoplasm of infected cells are distributed to daughter cells as the cells divide. Therefore, continuous expression is expected. Further, the present inventors have
Sendai virus vector is highly efficiently transfected into hematopoietic cells, especially granulocyte cells, and c-kit positive pri
It was found that it was also introduced into mitive cells. This suggests that this vector could be a highly applicable vector with a very wide tissue coverage.

That is, the present invention relates to a replication-competent paramyxovirus vector into which a foreign gene can be introduced, and more specifically, (1) to carry a foreign gene,
And a replication-competent paramyxovirus vector, wherein, in the negative strand genomic RNA contained in the vector, a foreign gene is located downstream of the gene encoding the viral protein. And a replication-competent paramyxovirus vector, wherein the vector is any one of the following (a) to (f), wherein (a) the first position from the 3 'end of the negative strand genomic RNA contained in the vector: A vector in which a foreign gene is inserted between a gene encoding a viral protein and a gene encoding a second viral protein, (b) a negative strand genome contained in the vector
A vector in which a foreign gene is inserted between the gene encoding the viral protein located at the second position from the 3 'end of the RNA and the gene encoding the third viral protein, (c) negative strand genomic RNA contained in the vector
A vector wherein a foreign gene is inserted between the gene encoding the viral protein located at the third position from the 3 'end and the gene encoding the fourth viral protein,
(D) 3 ′ of negative strand genomic RNA contained in the vector
A vector wherein a foreign gene is inserted between the gene encoding the viral protein located at the fourth position from the end and the gene encoding the fifth viral protein,
(E) 3 ′ of negative strand genomic RNA contained in vector
A vector wherein a foreign gene is inserted between the gene encoding the viral protein located at the fifth position from the end and the gene encoding the sixth viral protein,
(F) 3 ′ of negative strand genomic RNA contained in vector
A vector in which a foreign gene is inserted between the trailer sequence and the gene encoding the viral protein located at the sixth position from the end, (3) the first to sixth positions from the 3 'end of the negative strand genomic RNA contained in the vector The genes encoding the located viral proteins are, in order, the NP gene,
Negatives included in the vector according to (2), (4) the paramyxovirus vector according to any one of (1) to (3), which are the P gene, the M gene, the F gene, the HN gene, and the L gene. (5) a negative strand genomic RNA contained in a paramyxovirus vector capable of replication or a DNA encoding the complementary strand thereof, wherein the negative strand genomic RNA or its complement is In the strand, a DNA having a cloning site for inserting a foreign gene downstream of a gene encoding a viral protein, (6) a negative strand genomic RNA contained in a paramyxovirus vector capable of replication or a strand complementary thereto DNA according to any one of the following (a) to (f):
(A) a DNA having a cloning site for inserting a foreign gene between a gene encoding a viral protein located at the first position from the 3 ′ end of the negative strand genomic RNA and a gene encoding the second viral protein,
(B) a cloning site for inserting a foreign gene between the gene encoding the viral protein and the gene encoding the third viral protein located second from the site corresponding to the 3 'end of the negative strand genomic RNA; DNA to be retained, (c) to insert a foreign gene between the gene encoding the viral protein and the gene encoding the fourth viral protein located at the third position from the site corresponding to the 3 'end of the negative strand genomic RNA (D) negative strand genome R
DNA containing a cloning site for inserting a foreign gene between the gene encoding the viral protein located at the fourth position from the site corresponding to the 3 'end of NA and the gene encoding the fifth viral protein, (e ) A cloning site for inserting a foreign gene between the gene encoding the viral protein and the gene encoding the sixth viral protein located at the fifth position from the site corresponding to the 3 'end of the negative strand genomic RNA. DN
A, (f) DNA having a cloning site for inserting a foreign gene between the trailer sequence and the gene encoding the viral protein located at the sixth position from the site corresponding to the 3 ′ end of the negative strand genomic RNA, 7) The genes encoding the viral proteins located at the first to sixth positions from the site corresponding to the 3 'end of the negative strand genomic RNA are NP gene, P gene, M gene, F gene, HN gene, and L gene in this order. The DNA according to (6),
(8) The vector DNA according to any one of (4) to (7), which is capable of transcribing the DNA according to any one of (4) to (7);
NA, (10) a method for controlling the expression level of a foreign gene in a paramyxovirus vector, comprising: (a) one of the negative strand genomic RNAs contained in the vector,
A method of positioning a foreign gene between the gene encoding the viral protein located at the second position and the gene encoding the second viral protein, (b) the second position from the 3 'end of the negative strand genomic RNA contained in the vector A method for positioning a foreign gene between a gene encoding a viral protein and a gene encoding a third viral protein, (c) a viral protein located third from the 3 'end of negative strand genomic RNA contained in a vector (D) negative genomic genome RN contained in the vector, wherein the foreign gene is located between the gene encoding
(E) a method of positioning a foreign gene between a gene encoding a viral protein located at the fourth position from the 3 'end of A and a gene encoding a fifth viral protein;
A method of positioning a foreign gene between a gene encoding a viral protein located at the fifth position from the 3 'end of the negative strand genomic RNA contained in the vector and a gene encoding the sixth viral protein, (f) being included in the vector And a method of positioning a foreign gene between a trailer sequence and a gene encoding a viral protein located at the sixth position from the 3 'end of the negative strand genomic RNA.

[0011] In the present invention, the term "viral vector" refers to a virus particle capable of introducing a nucleic acid molecule into a host. In the present invention, the term paramyxovirus refers to a virus belonging to the genus Paramyxovirus or a derivative thereof. The paramyxoviruses to which the present invention can be applied include, for example, human parainfluenza virus type 1 (HPIV-1), human parainfluenza virus type 3 (HPIV-3), bovine parainfluenza virus type 3 (BPIV-3), Sendai Virus (Sendai
virus; also referred to as mouse parainfluenza virus type 1), and monkey parainfluenza virus type 10 (SPIV-10). The virus of the present invention is more preferably a Sendai virus. These viruses can be natural strains, wild strains, mutant strains, laboratory passage strains, artificially constructed strains, and the like. DI particles (J. Viro
l. 68, 8413-8417 (1994)), synthesized oligonucleotides, and the like can also be used as materials for producing the virus vector of the present invention.

The genes encoding the viral proteins of the paramyxovirus include the NP, P, M, F, HN, and L genes. "NP, P, M, F, HN, and L genes" refer to genes encoding nucleocapsid, phospho, matrix, fusion, hemagglutinin-neuraminidase, and large protein, respectively. Each gene in each virus belonging to the subfamily Paramyxovirinae is generally represented as follows. Generally, the NP gene is sometimes referred to as “N gene”. Paramyxovirus NP P / C / VMF HN-L Rubravirus NP P / VMF HN (SH) L Mobilivirus NP P / C / VMFH-L

For example, Paramyxoviidae (Paramyxovi)
ridae), the accession number of the base sequence database of each gene of Sendai virus, which is also classified into the genus Respirovirus,
M29343, M30202, M30203, M30204, M51331, M55565, M
69046, X17218, P gene M30202, M30203, M3
0204, M55565, M69046, X00583, X17007, X17008, M11 D11446, K02742, M30202, M30203, M30
204, M69046, U31956, X00584, X53056, F0015 D00152, D11446, D17334, D17335, M30202, M3020
3, M30204, M69046, X00152, X02131, and for HN gene D26475, M12397, M30202, M30203, M30204, M6904
6, X00586, X02808, X56131, L0005
3, M30202, M30203, M30204, M69040, X00587, X58886
checking ...

"Replicating" means that when a viral vector infects a host cell such as LLC-MK2 or CV-1 cell, the virus is replicated in the cell to produce infectious virus particles. Point. In the present invention, “DNA” includes single-stranded DNA and double-stranded DNA.

In the present invention, "gene" refers to genetic material, and includes nucleic acids such as RNA and DNA. There is no limitation on the origin of the gene, and it may be derived from a naturally or artificially designed sequence. Examples of artificial proteins include fusion proteins with other proteins, dominant negative proteins (including soluble molecules of receptor or membrane-bound dominant negative receptors), deletion type cell adhesion molecules, and soluble type cells. It may be in the form of a surface molecule or the like. Alternatively, it may be a gene encoding a partial peptide of a bacterial or viral antigen protein relating to infectious disease. Further, it may be a nucleic acid that does not encode a protein such as an antisense nucleic acid or a ribozyme.

[0016]

DETAILED DESCRIPTION OF THE INVENTION Paramyxoviruses are generally
The envelope contains a complex composed of RNA and protein (ribonucleoprotein; RNP). The RNA contained in RNP is single-stranded negative strand (minus strand) RNA that is the genome of paramyxovirus, and NP protein, P protein, and L protein bind to this RNA to form a complex . The RNA contained in this RNP serves as a template for transcription and replication of the viral genome (Lamb, RA, and D. Kolakofsky, 1996, Paramyxovir
idae: The viruses and their replication.pp.1177-
1204. In Fields Virology, 3rd edn. Fields, BN,
DM Knipe, and PM Howley et al. (Ed.), Raven
Press, New York, NY). The RNP complex autonomously replicates the RNP complex in the cell, and the gene (R
NA). This results in high expression of the foreign gene from the vector carrying the foreign gene.

The viral vector of the present invention usually comprises
(A) A vector DNA encoding negative-stranded single-stranded RNA derived from paramyxovirus or its complementary strand (positive strand) is transcribed in cells (helper cells) expressing NP, P, and L proteins, b) culturing the cells,
It can be prepared by collecting virus particles from the culture supernatant. RNA transcribed from vector DNA
It forms an RNP complex with the NP, L, and P proteins, and also forms an enveloped virus particle containing the envelope protein.

The DNA (vector DNA) encoding the viral genome, which is expressed in helper cells, encodes the minus strand (negative strand RNA) of the genome or its complementary strand (positive strand RNA). For example, a DNA encoding a negative-stranded single-stranded RNA or its complementary strand is ligated downstream of a T7 promoter, and the RNA is reacted with T7 RNA polymerase.
Transfer to As the promoter, any desired promoter can be used other than the promoter containing the recognition sequence of T7 polymerase. Alternatively, transcribed in vitro
RNA may be transfected into helper cells. The strand to be transcribed in the cell may be a positive strand or a negative strand of the viral genome, but it is preferable that the positive strand be transcribed in order to increase the efficiency of reconstitution.

Sendai virus (SeV)
, The genome size of the native virus is about 15,000 bases, followed by a 3 'short leader region in the negative strand, followed by NP (nucleocapsid), P (phospho), M (matrix), F (fusion), HN (Hemagglutinin-neuraminidase), and six genes encoding the L (large) protein, and have a short 5 'trailer region at the other end. In the present invention, some genes may be deleted as long as they have replication ability, and the arrangement of these genes on the virus genome may not be the same as that of the wild type. Because M, HN, and F proteins are not required for RNP formation, RNP is constructed by transcribing this genomic RNA (positive or negative strand) in the presence of NP, P, and L proteins. Infectious virus particles are constructed from RNP. Reconstruction of the vector can be performed, for example, in LLC-MK2 cells. The NP, P, and L proteins can be supplied by introducing an expression vector encoding each gene into cells. Further, each gene may be integrated into the chromosome of the host cell. N expressed to form RNP
The P, P, and L genes need not be completely identical to the NP, P, and L genes encoded in the genome of the vector. That is, the amino acid sequence of the protein encoded by these genes is not limited to the amino acid sequence of the protein encoded by the RNP genome,
May be introduced or a homologous gene of another virus may be used as long as it has the activity of inducing gene expression from this RNP. If RNP is formed,
The NP, P, and L genes are expressed from the RNP, the RNP replicates autonomously in the cell, and a viral vector is produced together with the envelope protein.

[0020] The produced virus includes cultured cells, chicken eggs,
An individual (eg, a mammal such as a mouse) or the like can be reinfected and amplified or passaged. The viral vector of the present invention can also be amplified by re-introducing RNP formed by reconstitution of the viral vector into host cells such as LLC-MK2 cells and culturing the host. This process is
(A) a step of introducing a negative strand single-stranded RNA derived from paramyxovirus and a complex consisting of NP, P / C, and L proteins into cells; and (b) culturing the cells, Recovering virus particles from the supernatant.

In order to introduce RNP into cells, it is possible to form a complex with, for example, lipofectamine or polycationic liposome and then introduce it. Specifically, various transfection reagents can be used.
For example, DOTMA (Boehringer), Superfect (QIAGEN # 30
1305), DOTAP, DOPE, DOSPER (Boehringer # 1811169)
And the like. Chloroquine can be added to prevent degradation in endosomes (Calos, MP, 1
983, Proc. Natl. Acad. Sci. USA 80: 3015).

At the time of virus reconstitution, an envelope protein other than the envelope protein encoded by genomic RNA may be expressed in cells. Such proteins include envelope proteins of other viruses, such as the vesicular stomatitis virus (VSV) G protein (VSV-
G). The paramyxovirus vector of the present invention may be a vector containing an envelope protein derived from a virus other than the virus from which the genome is derived, such as the VSV-G protein. Also,
In addition to the viral envelope proteins, for example,
Adhesion factors, ligands,
It is possible to use a chimeric protein having a polypeptide derived from a receptor or the like in an extracellular region and a polypeptide derived from a virus envelope in an intracellular region.
This can also create vectors that target specific tissues. These may be encoded in the viral genome or supplied by expression of a gene other than the genome (eg, another expression vector or a gene on the host chromosome) upon reconstitution of the viral vector.

In the viral vector of the present invention, for example, the viral gene contained in the vector is modified in order to reduce the immunogenicity of the SeV protein or to increase the efficiency of RNA transcription and replication. It may be something. Specifically, for example, it is conceivable to modify at least one of the NP gene, P / C gene, and L gene that are replication factors to enhance the function of transcription or replication.
HN protein, one of the structural proteins, has both hemagglutinin activity and neuraminidase activity, which are hemagglutinins. For example, if the former activity can be reduced, It will be possible to improve the stability of the virus in it, and it is also possible to modulate infectivity, for example by modifying the activity of the latter. Further, the fusion ability of the membrane-fused liposome can be adjusted by modifying the F protein involved in membrane fusion. Also, for example,
Since the establishment of a reconstitution system has made it possible to analyze antigen-presenting epitopes of F protein and HN protein that can be antigen molecules on the cell surface, Sendai virus has been used to weaken the antigen-presenting ability for these proteins. Can also be prepared.

The viral vector of the present invention encodes a foreign gene in negative-stranded single-stranded RNA or has a site for inserting the foreign gene. As the foreign gene, a desired gene to be expressed in a target cell can be used. For example, when gene therapy is intended, a gene for treating a target disease is inserted into the virus vector DNA. A foreign gene can be inserted downstream of each gene (NP, P, M, F, HN, and L genes) of the virus (see Examples). Here, “downstream” refers to a site adjacent to the 3 ′ side in the sense strand encoding the protein. That is, the negative strand
In the case of RNA (or DNA), the downstream of the gene is the site adjacent to the 5 'side of the gene, and the positive strand RNA (or DNA)
If so, it refers to a site adjacent to the 3 ′ side of the gene.

The present invention is particularly useful when it is desired to restrict the expression of a foreign gene. The more the foreign gene is inserted downstream of the negative strand genome, the more the expression level of the foreign gene can be reduced. In this case, the vector of the present invention is a paramyxovirus vector that retains a foreign gene and has replication ability, and the virus located at the second position from the 3 ′ end in the negative strand genomic RNA contained in the vector. A vector in which a foreign gene is located at least downstream of the gene encoding the protein is preferred. More preferably, the foreign gene is at least downstream of a gene encoding a viral protein located at the third, more preferably the fourth, more preferably the fifth, and even more preferably the sixth from the 3 'end in the negative strand genomic RNA. It is located in. The present invention also provides
The present invention relates to a method for controlling the expression level of a foreign gene using the paramyxovirus vector of the present invention. The more the foreign gene is located on the 3 'side of the negative strand genome, the more the expression level can be relatively increased. Conversely, if the foreign gene is located on the 5' side, the expression level can be decreased. When it is desired to lower the expression level relatively, for example, a gene encoding a viral protein located first from the 3 ′ end of a negative strand genomic RNA contained in a paramyxovirus vector and a second viral protein , More preferably between the second and third, more preferably between the third and fourth, even more preferably between the fourth and fifth, even more preferably It is located between the fifth and the sixth, more preferably between the sixth and the trailer arrangement. Thereby, the expression of the foreign gene can be controlled to a desired level.

For example, in a wild-type paramyxovirus, the viral genes are sequentially sequenced from the 3 ′ of the negative genome.
Although they are arranged in the order of NP, P, M, F, HN, and L, other arrangements may be used in the vector of the present invention. An EIS sequence (transcription termination sequence-intervening sequence-transcription initiation sequence) or a part thereof is appropriately inserted before and / or after the foreign gene so as not to hinder expression of the preceding and following genes. For example, when a foreign gene is introduced into the DNA encoding the Sendai virus genome, it is desirable to insert a sequence having a multiple of 6 times the number of bases between the genes encoding the viral proteins (Journal of Japan).
Virology, Vol. 67, No. 8, 1993, p. 4822-4830). The expression level of the inserted foreign gene can be regulated by the type of transcription initiation sequence added to the 5 ′ side (head) of the foreign gene. It can also be controlled by the position of the gene insertion or the nucleotide sequence before and after the gene.

As shown in the Examples, in the Sendai virus, the insertion position is closer to the 3 ′ end of the negative-strand RNA (in the gene arrangement on the genome of the wild-type virus, closer to the NP gene). Gene expression is high. In order to obtain high expression of a foreign gene, the foreign gene must be located downstream (ie, between the first and second genes) of the gene upstream of the gene encoding the viral protein (3 'of the negative strand). Insert
Specifically, in the gene arrangement of the wild-type genome, a foreign gene is inserted downstream of the NP gene (in the negative strand, at a site 5 ′ adjacent to the NP gene), that is, between the NP gene and the P gene. Insertion of a foreign gene between the second and third from the upstream (3 'side of the negative strand) of the gene encoding the viral protein results in reduced expression compared to insertion between the first and second genes. Can be In this case, in the gene arrangement of the wild-type genome, downstream of the P gene (5 ′ flanking site of the P gene in the negative strand),
It is preferable to insert a foreign gene between the gene and the M gene. The closer the insertion position is to the 5 'end of the negative strand RNA (in the gene arrangement on the genome of the wild-type virus,
The closer to the L gene, the lower the expression level of the inserted gene. Insertion of a foreign gene between the third and fourth from the upstream (3 'side of the negative strand) of the gene encoding the viral protein results in a more reduced expression, and a foreign gene between the fourth and fifth Insertion further suppresses the expression level. When inserting a foreign gene between the 3rd and 4th, in the gene arrangement of the wild-type genome,
It is preferable to insert a foreign gene downstream of the M gene (5 ′ flanking site of the M gene in the negative strand), that is, between the M gene and the F gene. When a foreign gene is inserted between the fourth and fifth positions, the gene is located downstream of the F gene in the gene arrangement of the wild-type genome (the F gene is located in the negative strand).
5 ′ adjacent site), that is, it is preferable to insert a foreign gene between the F gene and the HN gene. In order to further suppress the expression of the foreign gene, it is necessary to upstream the gene encoding the viral protein at the most downstream (5 'side of the negative strand) among the genes encoding the viral protein (ie, the first gene from the 5' side). Between the first and second genes; in the wild-type virus genome, between the fifth and sixth genes from the 3 'end, and downstream to obtain lower expression (ie, one from the 5' end of the negative strand). The foreign gene is inserted between the third gene and the trailer sequence, or between the sixth gene from the 3 ′ side and the trailer sequence in the wild-type genome). Specifically, in the gene arrangement of the wild-type genome, upstream (3 ′ adjacent site of the L gene in the negative strand) or downstream (L in the negative strand)
5 'flanking site of the gene), that is,
A foreign gene is inserted between the L genes or between the L gene and the trailer sequence. The vector of the present invention may carry another foreign gene at a position other than the insertion as described above. The insertion position of the foreign gene can be appropriately adjusted in order to obtain a desired expression level of the gene, and to optimize the combination with the genes encoding the viral proteins before and after.

To facilitate insertion of a foreign gene, a cloning site can be designed at the insertion site. The cloning site can typically be a recognition sequence for a restriction enzyme. Preferably, a restriction enzyme site that is unlikely to exist in the foreign gene to be inserted is designed. As such a restriction enzyme, those having a long recognition sequence, such as an 8 bp recognition restriction enzyme, are preferable. As an 8 bp recognition restriction enzyme, for example, Asc I (GG ↓ C
GCGCC), Fse I (GGCCGG ↓ CC), Not I (GC ↓ GGCCG
C), Pac I (TTAAT ↓ TAA), Pme I (GTTT ↓ AAAC), Sfi
I (GGCCNNNN ↓ NGGCC), Sgf I (GCGAT ↓ CGC), Srf I
(GCCC ↓ GGGC), Sse232 I (CG ↓ CCGGCG), Sse8387 I
(CCTGCA ↓ GG), and Swa I (ATTT ↓ AAAT), but are not limited thereto. The cloning site may be a so-called multi-cloning site having a plurality of restriction enzyme recognition sequences. Further, the sequence may be a sequence that is cleaved by an endonuclease other than a restriction enzyme. It is also conceivable to insert a foreign gene by recombination using the cloning site as a recognition sequence for a recombinase. Designing these sequences in the DNA encoding the viral genome can be performed by a known mutagenesis method. Furthermore, it is also conceivable to divide the foreign gene insertion site in advance and use it as a cloning site. By dephosphorylating the 5 'end of the split vector DNA, a clone into which a foreign gene has been inserted can be preferentially generated. In addition, if the 3 'end of the fragmented vector DNA is a single base protruding end of T, it is possible to easily clone a foreign gene amplified by PCR (the end is a protruding end of A). . If the vector DNA is a circular DNA such as a plasmid, both ends are not released even if the cloning site is divided, so that high ligation efficiency can be obtained.

The insertion of a foreign gene into a DNA encoding a viral genome (vector DNA) is described, for example, in Hasan, M .;
K. et al., 1997, J. General Virology 78: 2813-282
0, Kato, A. et al., 1997, EMBO J. 16: 578-587 and Y
u, D. et al., 1997, Genes Cells 2: 457-466, and can be constructed as follows.

First, a DNA sample containing the cDNA sequence of the desired foreign gene is prepared. It is preferable that the DNA sample can be identified as a single plasmid electrophoretically at a concentration of 25 ng / μl or more. Hereinafter, a case where a foreign gene is inserted into DNA encoding the viral genome using the NotI site will be described as an example. If the target cDNA nucleotide sequence contains a NotI recognition site, the nucleotide sequence is modified using a site-specific mutation insertion method or the like so that the encoded amino acid sequence is not changed, and the NotI site is removed in advance. It is preferable to keep it. The desired gene fragment is amplified and recovered from this sample by PCR. Both ends of the amplified fragment are NotI sites, and NotI restriction sites are added at one end to add copies of the Sendai virus transcription termination sequence (E), intervening sequence (I), and transcription initiation sequence (S) (EIS sequence). As a primer pair comprising an enzyme cleavage site sequence, a transcription termination sequence (E), an intervening sequence (I), a transcription initiation sequence (S), and a partial sequence of a target gene, a forward synthetic DNA sequence and a reverse synthetic DNA sequence
Create a sequence (antisense strand).

For example, the forward synthetic DNA sequence is Not Not
In order to guarantee cleavage by I, any two or more nucleotides (preferably 4 bases not containing a sequence derived from a NotI recognition site such as GCG and GCC, more preferably ACT
T) was selected, a NotI recognition site gcggccgc was added to its 3 ′ side, and any 9 bases or a number obtained by adding a multiple of 6 to 9 as a spacer sequence was added to its 3 ′ side. On the 3 ′ side, a sequence corresponding to about 25 bases of the ORF is added from the start codon ATG of the desired cDNA, including this.
The last base is about G or C from the desired cDNA.
It is preferable to select 25 bases and use it as the 3 'end of the synthetic oligo DNA on the forward side.

The reverse synthetic DNA sequence is composed of any two or more nucleotides (preferably GCG and GCC) from the 5 'side.
4 bases not containing the sequence derived from the NotI recognition site, more preferably ACTT), and a NotI recognition site gcggcc
gc is added, and oligo DNA of an inserted fragment for adjusting the length is added to the 3 ′ side. The length of this oligo DNA is designed such that the sum of the complementary strand base sequence of the cDNA, including the NotI recognition site gcggccgc, and the EIS base sequence of the Sendai virus genome derived from Sendai virus described below is a multiple of six. (The so-called "rule of 6
six) "; Kolacofski, D. et al., J. Virol. 72: 891-
899, 1998). Furthermore, a sequence complementary to the S sequence of Sendai virus on the 3 'side of the inserted fragment, preferably 5'-CTTTCACCCT-3'
(SEQ ID NO: 1), a sequence complementary to the I sequence, preferably 5'-AAG-3 ', E sequence, preferably 5'-TTTTTCTTACTACGG-3' (SEQ ID NO: 2), and further 3 ' Reversely counting from the termination codon of the cDNA sequence, the sequence was added by selecting a length such that the last base of the complementary strand corresponding to about 25 bases was G or C, and the sequence was added. End.

For the PCR, for example, a general method using ExTaq polymerase (Takara Shuzo) can be used. It is preferably carried out using Vent polymerase (NEB). The amplified target fragment is digested with NotI, and then the plasmid vector pBlu
Insert into NotI site of escript. The nucleotide sequence of the obtained PCR product is confirmed with a sequencer, and a plasmid having the correct sequence is selected. The insert is excised from this plasmid with NotI and cloned into the NotI site of the plasmid containing the genomic cDNA. It is also possible to obtain a recombinant Sendai virus cDNA by inserting directly into the NotI site without using the plasmid vector pBluescript.

The DNA encoding the viral genome is constructed by connecting an appropriate transcription promoter to construct a vector DNA,
This can be transcribed in vitro or in cells,
RNPs can be reconstituted in the presence of L, P, and NP proteins to generate a viral vector containing the RNP. The present invention provides a method for producing a paramyxovirus vector, comprising the step of transcribing a DNA encoding the genome of the paramyxovirus vector in the presence of the L, P, and NP proteins of the paramyxovirus. The present invention also provides a DNA for producing a paramyxovirus vector of the present invention, comprising the DNA. The present invention also relates to the use of DNA encoding the genome of the paramyxovirus vector of the present invention for producing the vector. Reconstitution of the virus from the viral vector DNA can be performed according to a known method (WO 97/16539; WO 9/16539).
7/16538; Durbin, AP et al., 1997, Virology 23
5: 323-332; Whelan, SP et al., 1995, Proc. Natl.
Acad. Sci. USA 92: 8388-8392; Schnell. MJ et a
l., 1994, EMBO J. 13: 4195-4203; Radecke, F. et a
l., 1995, EMBO J. 14: 5773-5784; Lawson, ND et a
l., Proc. Natl. Acad. Sci. USA 92: 4477-4481; Garc.
in, D. et al., 1995, EMBO J. 14: 6087-6094; Kato,
A. et al., 1996, Genes Cells 1: 569-579; Baron, M.
D. and Barrett, T., 1997, J. Virol. 71: 1265-1271;
Bridgen, A. and Elliott, RM, 1996, Proc. Natl. A
cad. Sci. USA 93: 15400-15404). By these methods, parainfluenza, vesicular stomatitis virus, rabies virus, measles virus, Linder pest virus,
A virus vector from the family Paramyxoviridae, including Sendai virus, can be reconstituted from DNA.

For example, methods for introducing vector DNA into cells include the following methods, a method for preparing a DNA precipitate that can be taken up by a target cell, a method suitable for uptake by a target cell, and low cytotoxicity. With positive charge properties,
There are methods of making a complex containing DNA, and a method of instantaneously piercing a target cell membrane with an electric pulse enough to allow DNA molecules to pass through.

Various transfection reagents can be used. For example, DOTMA (Boehringer), Sup
erfect (QIAGEN # 301305), DOTAP, DOPE, DOSPER (Boe
hringer # 1811169). As an example, there is a transfection method using calcium phosphate, and it is known that DNA introduced into cells by this method is taken up by phagocytic vesicles, but a sufficient amount of DNA also enters the nucleus (Graham, FL and Van Der Eb,
J., 1973, Virology 52: 456; Wigler, M. and Silvers
tein, S., 1977, Cell 11: 223). Chen and Okayama
Examined the optimization of transfer technology. 1) Increased the co-precipitate incubation conditions to 2-4% CO ₂ , 35
15 ° C, 15-24 hours, 2) Circular DNA is more active than linear, 3) It is reported that optimal precipitation can be obtained when the DNA concentration in the precipitate mixture is 20-30 μg / ml (Chen, C. and O
Kayama, H., 1987, Mol. Cell. Biol. 7: 2745). Is suitable for transient transfection.
As old as DEAE-Dextran (Sigma # D-9885 MW 5 × 10 ⁵
A method is known in which a mixture is prepared at a desired DNA concentration ratio and transfection is performed. Chloroquine can be added to enhance the effect because many of the complexes are broken down in the endosome (Calos, MP, 198
3, Proc. Natl. Acad. Sci. USA 80: 3015). The method is a method called electroporation and is more versatile than the method in that there is no cell selectivity. The efficiency is said to be good under the optimal conditions of pulse current duration, pulse shape, strength of electric field (gap between electrodes, voltage), conductivity of buffer, DNA concentration and cell density.

The transfection reagent is suitable for the present invention because the methods in the above three categories are easy to operate and can examine a large number of samples using a large number of cells. Preferably Superfect Transfe
ction Ragent (QIAGEN, CatNo. 301305) or DOSP
ER Liposomal Transfection Reagent (Boehringer Mann
heim, Cat No. 1811169).

Reconstitution from cDNA can be specifically performed as follows. Use a minimal essential medium (MEM) containing 10% fetal calf serum (FCS) and antibiotics (100 units / ml penicillin G and 100 μg / ml streptomycin) in a plastic plate or a 100 mm petri dish with 24 to 6 wells. Monkey kidney-derived cell line LLC-MK2 70-80
Cultivate until it reaches% confluence (1 × 10 ⁶ cells)
For example, the recombinant vaccinia virus expressing T7 polymerase vTF7-3 (Fuerst, TR et al.) Inactivated by UV irradiation for 20 minutes in the presence of 1 μg / ml psoralen (psoralen)
l., Proc. Natl. Acad. Sci. USA 83: 8122-8126,198
6, Kato, A. et al., Genes Cells 1: 569-579, 1996)
At 2 PFU / cell. Psoralen addition and UV
The irradiation time can be appropriately adjusted. 1 hour after infection, 2
6060 μg, more preferably 3-5 μg of the above-mentioned recombinant Sendai virus cDNA was converted to a plasmid (24-0.5 μg of pGEM-N, 12- 0.25 μg p
GEM-P, and 24-0.5 μg pGEM-L, more preferably 1 μg
PGEM-N, 0.5 μg pGEM-P, and 1 μg pGEM-L) (Kat
o, A. et al., Genes Cells 1: 569-579, 1996)
Transfect by lipofection method using Superfect (QIAGEN). The transfected cells may contain 100 μg / ml rifampicin (Sigma) and cytosine arabinoside (AraC), more preferably 40 μg / ml cytosine arabinoside (AraC), if desired.
(Sigma) alone, and cultured in serum-free MEM, setting optimal drug concentrations to minimize cytotoxicity by vaccinia virus and maximize virus recovery (Kato, A. et al. , 1996, Genes Cells 1: 569-57
9). After culturing for about 48 to 72 hours from the transfection, the cells are collected, freeze-thawing is repeated three times to crush the cells, and then transfected into LLC-MK2 cells and cultured. Alternatively, the culture supernatant is collected, added to a culture solution of LLC-MK2 cells, infected, and cultured. After 3 to 7 days of culture, the culture solution is collected. Alternatively, the cells may be co-cultured by layering the collected cells on another cell. Alternatively, the above-mentioned cell lysate obtained by freeze-thawing may be inoculated into the allantois of 10-day-old embryonated chicken eggs, and after about 3 days, urine fluid may be collected. The virus titer in the culture supernatant or urine fluid is determined by the hemagglutinating activity (H
It can be determined by measuring A). HA is based on the “endo-point dilution method” (Kato, A. et al., 1996, Gene
sCells 1: 569-579; Yonemitsu, Y. & Kaneda, Y., Hem
aggulutinating virus ofJapan-liposome-mediated gen
e delivery to vascular cells.Ed. by Baker AH. Mol
ecular Biology of Vascular Diseases.Method in Mol
ecular Medicine: Humana Press: pp. 295-306, 1999)
Can be determined by In order to remove the vaccinia virus vTF7-3 that may be contaminated, resulting urine sample appropriately diluted with (eg 10 ^6-fold) can be re-amplified in chicken eggs. Re-amplification can be repeated, for example, three times. The resulting virus stock can be stored at -80 ° C.

The recovered paramyxovirus can be purified to be substantially pure. The purification can be performed by a known purification / separation method including filtration, centrifugation, column purification and the like. "Substantially pure" refers to an isolated substance (compound, polypeptide,
Or a virus, etc.) as a major component of the sample in which it is present. Typically, the substantially pure component present in the sample is at least 50%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, of the total of the other components in the sample. Account for more than%. The ratio is calculated by a procedure known to those skilled in the art, for example, as a weight ratio [w / w]. Naturally, it should be calculated excluding the solvent, salt, additive compound and the like. As a specific method for purifying paramyxovirus, for example, a method using cellulose sulfate or cross-linked polysaccharide sulfate (Japanese Patent Publication No. 62-30752, Japanese Patent Publication No. 62-33879, and Japanese Patent Publication No. 62-30753) ), And a method of adsorbing to a sulfated-fucose-containing polysaccharide and / or a decomposition product thereof (WO97 / 32010).

The recombinant Sendai virus vector of the present invention may be, for example, a physiological saline or a phosphate buffered saline (PBS).
For example, the composition can be appropriately diluted with the composition described above. When the recombinant Sendai virus vector of the present invention is propagated in chicken eggs, urine fluid can be contained. The recombinant Sendai virus vector-containing composition of the present invention may contain a physiologically acceptable carrier or medium such as deionized water and a 5% dextrose aqueous solution. A "physiologically acceptable carrier or vehicle" is a material that can be administered with a vector and does not significantly inhibit gene transfer by the vector. In addition, it may further contain a vegetable oil, a suspending agent, a surfactant, a stabilizer, a biocide, and the like. Further, a preservative and other additives can be added.

As long as the viral vector is reconstituted, the host cell used for reconstitution is not particularly limited. For example, in reconstitution of the Sendai virus vector, cultured cells such as monkey kidney-derived CV-I cells and LLC-MK2 cells, hamster kidney-derived BHK cells, and human-derived cells can be used.
By expressing an appropriate envelope protein in these cells, infectious virus particles having the envelope can also be obtained. In addition, in order to obtain a large amount of Sendai virus vector, a virus vector obtained from the above-described host can be infected to embryonated chicken eggs to amplify the vector. A method for producing a viral vector using chicken eggs has already been developed (Nakanishi et al., Eds. (1993), "Advanced Technology Protocol for Neuroscience III, Molecular Neuronal Physiology", Kouseisha, Osaka, pp.153-172) ). Specifically, for example, a fertilized egg is placed in an incubator and cultured at 37 to 38 ° C. for 9 to 12 days to grow an embryo. The Sendai virus vector is inoculated into the allantoic cavity, and eggs are cultured for several days to propagate the virus vector. Conditions such as the culture period may vary depending on the recombinant Sendai virus used. Thereafter, the urine fluid containing the virus is collected. Separation and purification of Sendai virus vector from urine fluid can be performed according to a conventional method (Masato Tashiro, “Virus Experimental Protocol”, supervised by Nagai and Ishihama,
Medical View, pp.68-73, (1995)).

When a viral vector is prepared using a gene for treating a disease as a foreign gene, gene therapy can be performed by administering this vector. The application of the viral vector of the present invention to gene therapy includes gene expression by direct administration and gene expression by indirect (ex vivo) administration. Insufficient endogenous genes and the like can be expressed. Since the virus vector of the present invention has high safety and can control the expression level of a foreign gene, it is expected to be applicable to a wide range of clinical applications. The foreign gene is not particularly limited, and may be, for example, a nucleic acid that does not code for a protein such as an antisense or a ribozyme, in addition to a nucleic acid that codes for a protein. When a gene encoding a bacterial or viral antigen related to infectious disease is used as a foreign gene, immunity can be induced in the animal by administering the gene to the animal. That is, it can be used as a vaccine. The present invention can also be applied to pathogenic paramyxoviruses, such as measles virus and mumps virus, which are highly required for vaccines.

When used as a vaccine, for example, tumors,
It is conceivable to apply the viral vector of the present invention to infectious diseases and other general diseases. For example, as a tumor treatment, a gene having a therapeutic effect can be expressed in a tumor cell or an antigen-presenting cell (APC) such as a DC cell using the vector of the present invention. Such genes include cancer antigen Muc-1 or Muc-1-like mucin tandem repeat peptide (US Pat. No. 5,744,144),
Melanoma gp100 antigen and the like. Treatment with such genes has been used in breast, colon, pancreatic, prostate,
A wide variety of applications, such as lung cancer, have been demonstrated. It is also effective to combine cytokines that enhance the adjuvant effect. Such genes include, for example, i) IL-2
And single-chain IL-12 (Proc. Natl. Acad. Sc
USA 96 (15): 8591-8596, 1999), ii) IL-2 and interferon-γ (US Pat. No. 5,798,100), iii) Granulocyte colony stimulating factor (GM-CSF) used alone, i.
v) A combination of GM-CSF and IL-4 for treating brain tumors (J. Neurosurgery 90 (6), 1115-1124 (1999)).

In the treatment of infectious diseases, influenza, for example, the virulent strain H5N1-type envelope, and Japanese encephalitis, for example, the envelope chimera (Vaccine, v
ol. 17, No. 15-16, 1869-1882 (1999)), and in AIDS, for example, HIV gag or SIV gag protein (J. Im.
munology (2000) vol. 164, 4968-4978), vaccine treatment by oral administration of HIV envelope protein, administration in a polylactic acid-glycol copolymer (Kaneko, H. et.
al., Virology 267: 8-16 (2000)), and in cholera, for example, the B subunit (CTB) of cholera toxin (Arakaw
a, T., et al., Nature Biotechnology (1998) 16 (10):
934-8, Arakawa, T., et al., Nature Biotechnology
(1998) 16 (3): 292-7) In rabies, for example, glycoproteins of rabies virus (Lodmell, DL et al., 1
998, Nature Medicine 4 (8): 949-52), in cervical cancer, human papillomavirus type 6 capsid protein L
1 (J. Med. Virol, 60, 200-204 (2000)).

When the vector of the present invention is used as a vaccine, immunostimulants such as cytokines, cholera toxin, and salmonella toxin can be combined to enhance immunogenicity. Vaccines include alum, incomplete Freund's adjuvant, MF59 (oil emulsion), MTP-PE (muramyl derived from mycobacterial cell wall).
tripeptide), and QS-21 (soapbark tree Quilaja s
aponaria) can be combined.

Further, application to general diseases is also conceivable. In diabetes, for example, insulin fragment peptides are expressed in type I diabetes model animals (Coon,
B. et al., J. Clin. Invest., 1999, 104 (2): 189-9
Four).

The dose of the vector depends on the disease, the weight of the patient,
Although it varies depending on age, sex, symptoms, administration purpose, administration form, administration method and the like, those skilled in the art can appropriately determine them. Preferably, the amount of vector contained in the administration composition is in the range of about 10 ⁵ pfu / ml to about 10 ¹¹ pfu / ml. More preferably, the amount of vector contained in the administration composition should be in the range of about 10 ⁷ pfu / ml to about 10 ⁹ pfu / ml. Most preferably, an amount in the range of about 1 × 10 ⁸ pfu / ml to about 5 × 10 ⁸ pfu / ml is administered in a pharmaceutically acceptable carrier.

When the treatment is completed and it becomes necessary to suppress the propagation of the viral vector, or during the treatment, if the RNA-dependent RNA polymerase inhibitor is administered, only the propagation of the viral vector can be performed without damaging the host. Can be specifically suppressed.

[0049]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples. [Example 1] Control of gene expression level using polarity effect in Sendai virus I <Construction of SeV genomic cDNA> Sendai virus (SeV) full-length genomic cDNA, pSeV (+) (Kato, A. et al., Genesto Cell)
s1: 569-579, 1996), a new Not I site was introduced between the start (S) signal of each gene and the ATG translation initiation signal. First, a fragment (2645 bp) obtained by digesting pSeV (+) with Sph I / Sal I as shown in FIG.
The fragment digested with Cla I (3246 bp) and the fragment digested with Cla I / Eco RI (5146 bp) were each separated by agarose gel electrophoresis, the corresponding band was cut out, and QIAEXII Gel Extr.
It was collected and purified using an action system (QIAGEN). Sph I
/ Sal I digested fragment is LITMUS38 (NEW ENGLAND BIOLAB
The fragment digested with Cla I and the fragment digested with Cla I / Eco RI were ligated to pBluescriptII KS + (Stratagene) and subcloned. Then, to introduce Not I site, Quickchange Site-Directed Mutagenesi
s kit (STRATAGENE) was used. The primer used for each transfer was the sense strand between NP-P: 5'-ccaccgacc
acacccagcggccgcgacagccacggcttcgg-3 '(SEQ ID NO:
3), antisense strand: 5'-ccgaagccgtggctgtcgcggccgc
tgggtgtggtcggtgg-3 ′ (SEQ ID NO: 4), sense strand between PMs: 5′-gaaatttcacctaagcggccgcaatggcagatatctatag-
3 '(SEQ ID NO: 5), antisense strand: 5'-ctatagatatc
tgccattgcggccgcttaggtgaaatttc-3 ′ (SEQ ID NO: 6),
Between MFs, sense strand: 5'-gggataaagtcccttgcggccgcttggt
tgcaaaactctcccc-3 ′ (SEQ ID NO: 7), antisense strand: 5′-ggggagagttttgcaaccaagcggccgcaagggactttatccc
-3 '(SEQ ID NO: 8), sense strand between F-HN: 5'-ggtcgc
gcggtactttagcggccgcctcaaacaagcacagatcatgg-3 ′ (SEQ ID NO: 9), antisense strand: 5′-ccatgatctgtgcttgttt
gaggcggccgctaaagtaccgcgcgacc-3 ′ (SEQ ID NO: 1
0), sense strand between HN-L: 5'-cctgcccatccatgacctagcc
ggccgcttcccattcaccctggg-3 ′ (SEQ ID NO: 11), antisense strand: 5′-cccagggtgaatgggaagcggccgctaggtcatgg
atgggcagg-3 ′ (SEQ ID NO: 12) was synthesized and used.

A SalI / SphI fragment, PM
ClaI fragment, F-HN, HN-L, Cla I / Eco RI
The fragment was subcloned as described above, and the fragment was introduced according to the protocol of the Quickchange Site-Directed Mutagenesis kit. The introduced product is again digested with the subcloned enzyme and recovered and purified in the same manner.
Assembled into the original Sendai genomic cDNA. as a result,
As shown in FIG. 1 (B), five types of NotI were newly introduced between each gene (pSeV (+) NPP, pSeV (+) PM, pSeV (+) MF, pSeV (+) FHN and pSeV (+) HNL A) Sendai virus genomic cDNA was constructed. To insert a foreign gene, a DNA fragment having a termination signal-intervening sequence-start signal (EIS) added downstream of the foreign gene is inserted into the NotI site of the genomic cDNA. For this purpose, for example, the multiple cloning site and the termination signal-intervening sequence-start signal are two NotI
It is convenient to prepare a sequence sandwiched between the sites (see FIG. 2) in advance and insert a foreign gene into the multicloning site.

To insert a foreign gene downstream of the L gene, for example, pSeV (+) or the desired SeV cDNA (pSV
eV18 ⁺ , pSeV (+) NPP, pSeV (+) PM, pSeV (+) MF, pSeV (+) FH
In N and pSeV (+) HNL), the gene can be inserted into the restriction enzyme Kpn I site existing between the termination codon of the L gene and the transcription termination signal (FIG. 3 (A)). In that case, the foreign gene to be inserted should have a KpnI site on both ends and a termination signal-intervening sequence-start signal on the 5 'side.
(FIG. 3B). Add the added DNA to SeV cDNA
And a foreign gene was inserted downstream of the L gene
Obtain cDNA.

Human reporter alkaline phosphatase (SEAP) was used as a reporter gene to check the gene expression level.
It was subcloned by PCR. 5 'primer with Asc I restriction enzyme site added to the primer: 5'-gcggcgcgcca
tgctgctgctgctgctgctgctgggcctg-3 ′ (SEQ ID NO: 1
3), 3 'primer: 5'-gcggcgcgcccttatcatgtctgctcg
aagcggccggccg-3 ′ (SEQ ID NO: 14) was synthesized and subjected to PCR. PSEAP-Basic (CLONTECH) was used as a template, and Pfu tourbo DNA polymerase (STRATAGENE) was used as an enzyme. After PCR, the product was digested with AscI and purified and recovered by electrophoresis. As a plasmid to be subcloned, a synthetic double-stranded DNA containing a multicloning site (PmeI-AscI-SwaI) and a termination signal-intervening sequence-start signal at the NotI site of pBluescriptII KS + [sense strand: 5'-gcg
gccgcgtttaaacggcgcgccatttaaatccgtag taagaaaaacttagggtgaaagttcatcgcggccgc-3 ′ (SEQ ID NO: 15), antisense strand: 5′-gcggccgcgatgaactttcaccctaagtttttcttactacgga
tttaaatggcgcgccgtttaaacgcggccgc-3 ′ (SEQ ID NO: 1
6)] was prepared (FIG. 2). The purified and recovered PCR product was ligated to the Asc I site of this plasmid and cloned. This was digested with Not I, and the SEAP gene fragment was recovered and purified by electrophoresis.
It was ligated and incorporated into the Sendai virus genomic cDNA and NotI site of pSeV18 +, respectively. PSeV (+) NPP / SEAP, pSeV (+) PM / SEA
P, pSeV (+) MF / SEAP, pSeV (+) FHN / SEAP, pSeV (+) HNL / SEA
P and pSeV18 (+) / SEAP.

<Reconstitution of virus> LLC-MK2 cells were
Seed at ⁶ cells / dish in a 100 mm Petri dish, cultured for 24 hours, and then cultured with psoralen and UV-treated T7 polymerase (PLWUV-VacT7) (Fue
rst, TR et al., Proc. Natl. Acad. Sci. USA 83:81
22-8126,1986, Kato, A. et al., Genes Cells 1: 569-
579, 1996) at room temperature with moi = 2 for 1 hour. Each Sendai virus cDN incorporating SEAP after washing cells
A, 12 μg each of pGEM / NP, pGEM / P, and pGEM / L, 4
OptiMEM (GIBOCO BR) at a quantitative ratio of μg, 2 μg, and 4 μg / dish
L) and 110 μl of SuperFecttransfection re
An agent (manufactured by QIAGEN) was added and mixed, left at room temperature for 15 minutes, finally added with 3 ml of OptiMEM containing 3% FBS, added to the cells, and cultured for 3 to 5 hours. After the culture, the cells were washed twice with serum-free MEM, and cultured for 72 hours in MEM containing cytosine β-D-arabinofuranoside (AraC). Collect these cells, resuspend the pellet in 1 ml PBS, freeze-thaw
Repeated times. 100 μl of these eggs for 10 days
After inoculation and incubation at 35 ° C. for 3 days, urine was collected. To make vaccinia virus-free, these collected urine fluids were further diluted to 10 ^-5 to 10 ^-7 and re-inoculated to chicken eggs, similarly collected, dispensed and stocked at -80 ° C. Name each virus vector as SeVNPP / SEAP, SeVPM / SEA
P, SeVMF / SEAP, SeVFHN / SEAP, SeVHNL / SEAP and SeV18
/ SEAP.

<Measurement of titer by plaque assay
> CV-1 cells in a 6-well plate 5 × 10 per well^Fivecell
The cells were sown and cultured for 24 hours. After washing with PBS, BSA / PBS (1%
10 with BSA in PBS)^-3,Ten^-Four,Ten^-Five,Ten^-6,Ten^-7Diluted into
1 hour incubation with recombinant SeV
Wash, BSA / MEM / agarose (0.2% BSA + 2 x MEM
% Agarose) 3ml per well
And 6 days at 37 ℃, 5% CO_Two And cultured. After culturing,
Add ethanol / ethanol (ethanol: acetic acid = 1: 5) for 3 hours
Allowed to stand and removed with agarose. Three times washed with PBS
Afterwards, chamber with 100 times diluted rabbit anti-Sendai virus antibody
Incubated for 1 hour at warm. After washing three times with PBS,
Alexa Flour diluted 200 times ^TM Labeled goat anti-rabbit Ig (G + H)
(Molecular Probe) and incubate at room temperature for 1 hour.
Was an option. After washing three times with PBS,
Capture fluorescent images with riser LAS1000 (Fuji Film)
And plaque was measured. FIG. 4 shows the results. Also this
Are shown in Table 1.

[0055]

[Table 1] Titer results of each recombinant Sendai virus measured from the results of the plaque assay

<Comparison of Reporter Gene Expression> LLC-MK2
Cells are seeded on a 6-well plate at 1 to 5 × 10 ⁵ cells per well, and cultured for 24 hours.
After 24 hours, 100 μl of the culture supernatant was collected and
The assay was performed. Assay is Reporter Assay Kit -SE
Performed by AP- (Toyobo), Lumino Image Analyzer LAS
It was measured at 1000 (Fuji Film). Measured value is SeV18 + / SEA
The value of P was expressed as a relative value with 100 as the value. As a result, SEAP activity was detected regardless of whether the SEAP gene was inserted at any of the positions shown in FIG. It was found that the SEAP activity decreased as it was located downstream of the genome, that is, the expression level decreased. The expression level of the SEAP gene monotonically decreased as the insertion position went from upstream (NP side) to downstream (L side) of the genome. For example, SEA between NP gene and P gene
When the P gene was inserted, a SEAP gene was inserted upstream of the NP gene, and the SE gene was inserted between the P and M genes.
The intermediate expression level of the vector into which the AP gene was inserted was detected.

<Preparation of Multicloning Site> A multicloning site was added to the SeV vector. There are two methods below. 1) Sendai virus (SeV) full-length genomic cDNA, pSeV18 ⁺
b (+) (Hasan, MK et al., 1997, J. General Virolog
y 78: 2813-2820) ("pSeV18 ⁺ b (+)" is also referred to as "pSeV18 ⁺ ") New restriction enzyme sites that contain several crushed restriction enzyme sites in the cDNA genome Was introduced between the start signal of each gene and the ATG translation start signal (FIG. 6). 2) A multi-cloning site sequence and a transcription initiation signal-intervening sequence-termination signal are added to the already constructed SeV vector cDNA and integrated into the NotI site (FIG. 7).

In the case of 1), as an introduction method, first, FIG.
As shown in (A), a fragment obtained by digesting pSeV18 ⁺ with Eag I (2644b
p), a fragment (3246 bp) digested with Cla I, a fragment (5146 bp) digested with ClaI / Eco RI, and a fragment (5010 bp) digested with Eco RI, respectively, were separated by agarose gel electrophoresis, and the corresponding band was cut out. Gel Extraction Syste
m (manufactured by QIAGEN) and purified. The fragments digested with Eag I were LITMUS38 (manufactured by NEW ENGLAND BIOLABS), a fragment digested with Cla I, a fragment digested with Cla I / Eco RI, and Eco RI
The fragment digested with was ligated to pBluescriptII KS + (manufactured by STRATAGENE) and subcloned. Subsequently, the restriction enzyme site was destroyed and introduced into Quickchange Site-D.
The affected Mutagenesis kit (STRATAGENE) was used.

Sal I: (sense strand) 5'-ggagaagtctcaacaccgtccacccaagataatcgatcag-3 'to destroy the restriction enzyme site
(SEQ ID NO: 17), (antisense strand) 5'-ctgatcgat
tatcttgggtggacggtgttgagacttctcc-3 ′ (SEQ ID NO: 1
8), Nhe I: (sense strand) 5'-gtatatgtgttcagttgagcttg
ctgtcggtctaaggc-3 ′ (SEQ ID NO: 19), (antisense strand) 5′-gccttagaccgacagcaagctcaactgaacacatatac-3 ′
(SEQ ID NO: 20), Xho I: (sense strand) 5'-caatgaac
tctctagagaggctggagtcactaaagagttacctgg-3 ′ (SEQ ID NO: 21), (antisense strand) 5′-ccaggtaactctttagt
gactccagcctctctagagagttcattg-3 ′ (SEQ ID NO: 2
2) Also, between NP-P for restriction enzyme introduction: (sense strand) 5'-g
tgaaagttcatccaccgatcggctcactcgaggccacacccaaccccacc
g-3 ′ (SEQ ID NO: 23), (antisense strand) 5′-cggtg
gggttgggtgtggcctcgagtgagccgatcggtggatgaactttcac-3 '
(SEQ ID NO: 24), between PMs: (sense strand) 5'-cttagggt
gaaagaaatttcagctagcacggcgcaatggcagatatc-3 ′ (SEQ ID NO: 25), (antisense strand) 5′-gatatctgccattgcgc
cgtgctagctgaaatttctttcaccctaag-3 ′ (SEQ ID NO: 2
6), between MF: (sense strand) 5'-cttagggataaagtcccttgtg
cgcgcttggttgcaaaactctcccc-3 ′ (SEQ ID NO: 27),
(Antisense strand) 5'-ggggagagttttgcaaccaagcgcgcaca
agggactttatccctaag-3 '(SEQ ID NO: 28), between F-HN:
(Sense strand) 5'-ggtcgcgcggtactttagtcgacacctcaaacaag
cacagatcatgg-3 ′ (SEQ ID NO: 29), (antisense strand) 5′-ccatgatctgtgcttgtttgaggtgtcgactaaagtaccgcgc
gacc-3 '(SEQ ID NO: 30), between HN-L: (sense strand) 5'-
cccagggtgaatgggaagggccggccaggtcatggatgggcaggagtcc-
3 '(SEQ ID NO: 31), (antisense strand) 5'-ggactcc
tgcccatccatgacctggccggcccttcccattcaccctggg-3 ′ (SEQ ID NO: 32) was synthesized and used for the reaction. After the introduction, each fragment was recovered and purified in the same manner as described above, and cDNA was assembled (FIG. 6 (B)).

In the case of 2), (sense strand) 5'-ggccgcttaatt
aacggtttaaacgcgcgccaacagtgttgataagaaaaacttagggtgaa
agttcatcac-3 ′ (SEQ ID NO: 33), (antisense strand) 5′-ggccgtgatgaactttcaccctaagtttttcttatcaacactg
ttggcgcgcgtttaaaccgttaattaagc-3 ′ (SEQ ID NO: 34)
At 85 ° C 2
Min, 65 ° C for 15 minutes, 37 ° C for 15 minutes, and room temperature for 15 minutes and incorporate into SeV cDNA. Or pUC18 or pBlue
Termination signal for multiple cloning sites such as scriptII
-Subcloning by PCR with primers containing an intervening sequence-start signal, which is incorporated into the SeV cDNA. Got
Virus reconstitution with cDNA is performed as described above.

Example 2 Control of Gene Expression Using Polarity Effect in Sendai Virus II <Construction of SeV Genomic cDNA and Recovery of Virus> Not full-length cDNA of Sendai virus (SeV) and pSeV (+) I
A site was introduced between the translation stop codon of the L gene and the transcription termination signal. First, as shown in FIG. 8, a fragment (5010 bp) obtained by digesting pSeV (+) with Eco RI was separated by agarose electrophoresis, and the corresponding band was cut out.
Collected with AEXII Gel Extraction System (QIAGEN)
Purified. The recovered fragment was pBluescriptII SK + (STRATAG
ENE) and subcloned. Then, to introduce the restriction enzyme Not I site, Quickchan
ge Site-Directed Mutagenesis kit (Stratagene)
Was used. Primer on the sense side: 5'-cgtgcagaacgatcg
aagctccgcggccgctggaagtcttggacttgtcc-3 '(SEQ ID NO:
35), antisense side: 5'-ggacaagtccaagacttccagcg
gccgcggagcttcgatcgttctgcacg-3 ′ (SEQ ID NO: 36) was synthesized and used for the reaction. After the introduction, the fragment (2010 bp) digested with Xho I-Mlu I was recovered and purified in the same manner as described above, and cD
NA was assembled (FIG. 8).

Human Vascular Endothelial Growth Factor (VEGF) was subcloned by PCR as a gene for checking the gene expression level. Primer Asc I
5 'primer with added site: 5'-gcggcgcgccaaccatg
aactttctgctgtcttgggtgcattgg-3 ′ (SEQ ID NO: 37),
3 'primer: 5'-gcggcgcgcctcaccgcctcggcttgtcacatc
tgcaagt-3 ′ (SEQ ID NO: 38) was synthesized and subjected to PCR. KOD-plus-DNA polymerase (manufactured by TOYOBO) was used as the enzyme. After PCR, the product was digested with AscI and purified and recovered by electrophoresis. To this, a plasmid for adding a transcription termination signal-intervening sequence-transcription initiation signal of Sendai virus was constructed (FIG. 9). Mlu I of pSeV18 +
-LITMUS38 (pAC114) incorporating the Sph I fragment (3317 bp)
Synthetic double-stranded DNA containing termination signal-intervening sequence-initiation signal and cloning site (Asc I-Pme I)
(Sense strand: 5'-ggccgctaagaaaaacttagggtgaaagttcactt
cacgagggcgcgccgtttaaactgc-3 ′ (SEQ ID NO: 39), antisense strand: 5′-ggccgcagtttaaacggcgcgccctcgtgaagt
gaactttcaccctaagtttttcttagc-3 '(SEQ ID NO: 40)
A pAG180 incorporating the above was produced (FIG. 9). In the AscI site of this plasmid, the purified and recovered VEGF PCR
The product was ligated and cloned. This is No
After digestion with t I, the VEGF gene fragment was recovered and purified by electrophoresis, ligated to the Not I site of Sendai virus genomic cDNA, and integrated. PSeV for viral vector cDNA
+ L / VEGF. Further, the termination signal-intervening sequence-start signal (see FIG. 2) prepared by the method described in Example 1 was converted to VE
Those that were connected downstream of the GF cDNA and incorporated into pSeV18 + and pSeV (+) HNL (pSeV18 + / VEGF and pSeV (+) HNL / VEGF, respectively)
) Was also constructed for comparison of expression levels. Each cD
The virus was recovered from NA in the conventional manner, and
8 + / VEGF, SeVHNL / VEGF, SeVL / VEGF.

<Comparison of expression levels> LLC-MK2 cells were seeded at 5 × 10 ⁵ cells per well on a 6-well plate, cultured for 24 hours, infected with each virus vector at moi = 5, and cultured for 24 hours. Was collected, and VEGF in the culture supernatant was quantified by ELISA. The result is shown in FIG. This allows the expression of VEGF to be reduced to N
It was found to be about 1/10 lower than when it was integrated upstream of the P gene. The present inventors have disclosed that the expression level can be changed by changing the transcription initiation signal (WO01 / 18223), and it is expected that the combination of the two will further expand the control range of the expression level. Is done.

[0064]

According to the present invention, a replication-competent paramyxovirus vector into which a foreign gene can be introduced has been provided. The vector of the present invention can control the expression level by controlling the insertion position of a foreign gene. In particular, by inserting a foreign gene into the negative strand genome, the expression level of the foreign gene can be kept low. It is also conceivable to prepare a viral vector in which a foreign gene has been inserted into two or more sites. In particular, the Sendai virus vector has an extremely high gene transfer efficiency for a wide range of cell types, and furthermore, can control the expression level of a foreign gene according to the present invention.
It is expected to be used for gene transfer in living organisms such as gene therapy.

[0065]

[Sequence List] SEQUENCE LISTING <110> DNAVEC Research INC. <120> Paramyxovirus vectors used for transduction of foreign genes <130> D3-X0002Y1 <140> <141> <150> JP 2000-152726 <151> 2000-05- 18 <150> CA 2322057 <151> 2000-10-27 <160> 40 <170> PatentIn Ver. 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 1 ctttcaccct 10 <210> 2 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 2 tttttcttac tacgg 15 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 3 ccaccgacca cacccagcgg ccgcgacagc cacggcttcg g 41 <210> 4 <211> 41 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 4 ccgaagccgt ggctgtcgcg gccgctgggt gtggtcggtg g 41 <210> 5 <211> 40 <212> DNA <213> Ar tificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 5 gaaatttcac ctaagcggcc gcaatggcag atatctatag 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 6 ctatagatat ctgccattgc ggccgcttag gtgaaatttc 40 <210> 7 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 7 gggataaagt cccttgcggc cgcttggttg caaaactctc ccc 43 <210> 8 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 8 ggggagagtt ttgcaaccaa gcggccgcaa gggactttat ccc 43 <210 9 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 9 ggtcgcgcgg tactttagcg gccgcctcaa acaagcacag atcatgg 47 <210> 10 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Des cription of Artificial Sequence: artificially synthesized sequence <400> 10 ccatgatctg tgcttgtttg aggcggccgc taaagtaccg cgcgacc 47 <210> 11 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence < 400> 11 cctgcccatc catgacctag cggccgcttc ccattcaccc tggg 44 <210> 12 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 12 cccagggtga atgggaagcg gccgctaggt catggatggg cagg 44 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 13 gcggcgcgcc atgctgctgc tgctgctgct gctgggcctg 40 <210> 14 <211> 40 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 14 gcggcgcgcc cttatcatgt ctgctcgaag cggccggccg 40 <210> 15 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 15 gcggccgcgt ttaaacggcg cgccatttaa atccgtagta agaaaaactt agggtgaaag 60 ttcatcgcgg ccgc 74 <210> 16 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially sequence <400> 16 gcggccgcga tgaactttca ccctaagttt ttcttactac ggatttaaat ggcgcgccgt 60 ttaaacgcgg ccgc 74 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <ag> 17ct caacaccgtc cacccaagat aatcgatcag 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 18 ctgatcgatt atcttgggtg gacggtgttg agacttctcc 40 <210> 19 <211 > 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 19 gtatatgtgt tcagttgagc ttgctgtcgg tctaaggc 38 <210> 20 <211> 38 <212> DNA <213> Artificial Sequen ce <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 20 gccttagacc gacagcaagc tcaactgaac acatatac 38 <210> 21 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 21 caatgaactc tctagagagg ctggagtcac taaagagtta cctgg 45 <210> 22 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 22 ccaggtaact ctttagtgac tccagcctct ctagagagtt cattg 45 <210> 23 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 23 gtgaaagttc atccaccgat cggctcactc gaggccac ac ccaaccccac 52 > 24 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 24 cggtggggtt gggtgtggcc tcgagtgagc cgatcggtgg atgaactttc ac 52 <210> 25 <211> 47 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 25 cttagggtga aagaaatttc agctagcacg gcgcaatggc agatatc 47 <210> 26 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 26 gatatctgcc attgcgccgt gctagctgaa atttctttca ccctaag 47 <210> 27 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 27 cttagggata aagtcccttg tgcgcgcttg gttgcaaaac tctcccc 47 <210> 28 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 28 ggggagagtt ttgcaaccaa gcgcgcacacc g210 29 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 29 ggtcgcgcgg tactttagtc gacacctcaa acaagcacag atcatgg 47 <210> 30 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 30 ccatgatctg tgcttgtttg aggtgtcgac taaagtaccg cgcgacc 47 <210> 31 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 31 cccagggtga atgggaaggg ccggccaggt catggatggg caggagtcc 49 <210> 32 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 32 ggactcctgc ccatccatga cctggccggc ccttcccatt caccctggg 49 <210> 33 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 33 ggccgcttaa ttaacggttt aaacgcgcgcacaagactag 72 <210> 34 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 34 ggccgtgatg aactttcacc ctaagttttt cttatcaaca ctgttggcgc gcgtttaaac 60 cgt taattaa gc 72 <210> 35 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 35 cgtgcagaac gatcgaagct ccgcggccgc tggaagtctt ggacttgtcc 50 <210> 36 <211 > 50 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 36 ggacaagtcc aagacttcca gcggccgcgg agcttcgatc gttctgcacg 50 <210> 37 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 37 gcggcgcgcc aaccatgaac tttctgctgt cttgggtgca ttgg 44 <210> 38 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 38 gcggcgcgcc tcaccgcctc ggcttgtcac atctgcaagt 40 <210> 39 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 39 ggccgctaag aaaaacttag ggtgaaagtt cacttcacga gg gcgcgccg tttaaactgc 60 <210> 40 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: artificially synthesized sequence <400> 40 ggccgcagtt taaacggcgc gccctcgtga agtgaacttt caccctaagt ttttcttagcc 60

[Brief description of the drawings]

FIG. 1 is a diagram showing subcloning (A) of a Sendai virus genomic cDNA fragment and structures (B) of five Sendai virus genomic cDNAs newly constructed by introducing a NotI site.

FIG. 2 is a diagram showing the structure of a cloning plasmid for adding a NotI site, a transcription initiation signal, an intervening sequence, and a transcription termination signal to SEAP.

FIG. 3 shows the structure of Sendai virus genome downstream of the L gene (A) and the structure of cloning DNA for inserting a foreign gene downstream of the L gene (B).

FIG. 4 is a diagram showing the results of a plaque assay for each Sendai virus vector. A part of the fluorescence image of the plaque assay taken by LAS1000 is shown.

FIG. 5 is a view showing the results of comparing differences in the expression level of a reporter gene (SEAP) between each Sendai virus vector. SeV18 + / SEAP data were expressed as relative values with 100 as the data. It was found that the activity, ie, the expression level, decreased as the SEAP gene was located downstream.

FIG. 6 is a diagram showing the structure of a multiple cloning site constructed in Sendai virus genomic cDNA.

FIG. 7 is a diagram showing the structure of a multicloning site. The nucleotide sequence shows an example of a restriction enzyme site of PacI-PmeI-BssHII-TspRI and a multiple cloning site having an E / I / S sequence.

FIG. 8 is a diagram showing the structure of a Sendai virus genomic cDNA constructed by subcloning a Sendai virus genomic cDNA fragment and introducing a new Not I site.

FIG. 9 is a diagram showing the structure of a cloning plasmid for adding a Not I site, a transcription initiation signal, an intervening sequence, and a transcription termination signal to VEGF, and the structure of VEGF after addition.

FIG. 10 is a diagram showing a comparison of the expression levels of SeGF vectors carrying VEGF by ELISA. The one with VEGF after the L gene had the lowest expression level.

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (Reference) A61P 35/00 C12N 15/00 ZNAA (72) Inventor: Mamoru Hasegawa 1-25-11 Kannondai, Tsukuba, Ibaraki Stock Company F-term in Dinavec Laboratories (reference) 4B024 AA01 AA20 BA08 BA21 BA80 CA04 CA11 CA20 DA03 EA02 FA20 GA11 GA18 HA17 HA20 4C084 AA13 NA14 ZB262 ZB312 ZB332 4C087 AA01 AA02 AA03 BC83 MA02 NA05 NA13 NA14 ZB21 Z33

Claims (10)

[Claims] Claims: 1. A paramyxovirus vector that retains a foreign gene and has replication ability, wherein a negative strand genomic RNA contained in the vector has the foreign gene located downstream of a gene encoding a viral protein. Vector. 2. A paramyxovirus vector which retains a foreign gene and has replication ability, wherein the vector is one of the following (a) to (f). (A) 3 ′ of negative strand genomic RNA contained in vector
A vector having a foreign gene inserted between the gene encoding the viral protein located at the first position from the end and the gene encoding the second viral protein. (B) 3 ′ of negative strand genomic RNA contained in vector
A vector having a foreign gene inserted between the gene encoding the viral protein located at the second position from the end and the gene encoding the third viral protein. (C) 3 ′ of negative strand genomic RNA contained in vector
A vector having a foreign gene inserted between the gene encoding the viral protein located at the third position from the end and the gene encoding the fourth viral protein. (D) 3 ′ of negative strand genomic RNA contained in the vector
A vector having a foreign gene inserted between the gene encoding the viral protein located at the fourth position from the end and the gene encoding the fifth viral protein. (E) 3 ′ of negative strand genomic RNA contained in vector
A vector having a foreign gene inserted between the gene encoding the viral protein located at the fifth position from the end and the gene encoding the sixth viral protein. (F) 3 ′ of negative strand genomic RNA contained in vector
A vector having a foreign gene inserted between the trailer sequence and the gene encoding the viral protein located at the sixth position from the end. 3. Negative strand genome contained in a vector
The gene according to claim 2, wherein the genes encoding the viral proteins located at the first to sixth positions from the 3 'end of the RNA are NP gene, P gene, M gene, F gene, HN gene, and L gene in order. vector. 4. A negative strand genome contained in the paramyxovirus vector according to any one of claims 1 to 3.
DNA encoding RNA or its complementary strand. 5. A negative strand genomic RNA contained in a paramyxovirus vector having replication ability or a DNA encoding a complementary strand thereof, wherein the negative strand genomic RNA is
Alternatively, a DNA having a cloning site for inserting a foreign gene downstream of a gene encoding a viral protein in the complementary strand thereof. 6. The DNA according to any one of the following (a) to (f), which is a DNA encoding a negative strand genomic RNA or a complementary strand thereof contained in a paramyxovirus vector having a replication ability. (A) DNA having a cloning site for inserting a foreign gene between the gene encoding the viral protein located at the first position from the 3 'end of the negative strand genomic RNA and the gene encoding the second viral protein. (B) a cloning site for inserting a foreign gene between the gene encoding the viral protein and the gene encoding the third viral protein located second from the site corresponding to the 3 'end of the negative strand genomic RNA; DNA to retain. (C) a cloning site for inserting a foreign gene between the gene encoding the viral protein and the gene encoding the fourth viral protein located at the third position from the site corresponding to the 3 'end of the negative strand genomic RNA; DNA to retain. (D) a cloning site for inserting a foreign gene between the gene encoding the viral protein and the gene encoding the fifth viral protein located fourth from the site corresponding to the 3 'end of the negative strand genomic RNA; DNA to retain. (E) a cloning site for inserting a foreign gene between the gene encoding the viral protein and the gene encoding the sixth viral protein located fifth from the site corresponding to the 3 'end of the negative strand genomic RNA; DNA to retain. (F) DNA having a cloning site for inserting a foreign gene between the gene encoding the viral protein and the trailer sequence, which is located sixth from the site corresponding to the 3 'end of the negative strand genomic RNA. 7. A gene encoding the viral proteins located in the first 6 position from the portion corresponding to the 3 'end of negative-strand genomic RNA is, in turn NP gene, P gene, M gene, F gene, HN gene, And the L gene. 8. The DNA according to any one of claims 4 to 7,
Is a vector DNA that can be transcribed. 9. The vector DNA according to claim 8, which holds the positive-strand genomic RNA in a transcribable manner. 10. A method for controlling the expression level of a foreign gene in a paramyxovirus vector, comprising: (a) 3 ′ of negative strand genomic RNA contained in the vector;
A method in which a foreign gene is located between a gene encoding a viral protein located at the first position from the end and a gene encoding a second viral protein. (B) 3 ′ of negative strand genomic RNA contained in vector
A method for locating a foreign gene between a gene encoding a viral protein located second from the end and a gene encoding a third viral protein. (C) 3 ′ of negative strand genomic RNA contained in vector
A method in which a foreign gene is located between a gene encoding a viral protein located at the third position from the end and a gene encoding a fourth viral protein. (D) 3 ′ of negative strand genomic RNA contained in the vector
A method in which a foreign gene is located between the gene encoding the viral protein located at the fourth position from the end and the gene encoding the fifth viral protein. (E) 3 ′ of negative strand genomic RNA contained in vector
A method in which a foreign gene is located between the gene encoding the viral protein located at the fifth position from the end and the gene encoding the sixth viral protein. (F) 3 ′ of negative strand genomic RNA contained in vector
A method in which a foreign gene is located between the trailer sequence and the gene encoding the viral protein located at the sixth position from the end.