JP2002247982A - Human tissue inhibitor for metalloproteinase-4 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new matured polypeptide as human TIMP-4, and to provide biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. SOLUTION: The objective isolated polynucleotide is such as to be selected from the group consisting of (a) a polynucleotide encoding a polypeptide having a specific estimated amino acid sequence, or a polynucleotide encoding the fragment, analog or derivative of the polypeptide, and (b) a polynucleotide encoding a polypeptide having an amino acid sequence encoded by a cDNA included in ATCC Accession No.75946, or a polynucleotide encoding the fragment, analog or derivative of the polypeptide. The above polypeptide is effective for arthritis, osteoporosis, periodontosis, etc.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and the use of such polynucleotides and polypeptides. For the production of

[0002]

BACKGROUND OF THE INVENTION Extracellular matrices include collagen, proteoglycans, glucosaminoglycans, glycoproteins (fibronectin, chondronectin, laminin) and, in some tissues, elastin (Hay,
E. FIG. D. , J. et al. Cell Biol. , 91: 205-
223 (1981)).

[0003] Matrix metalloproteinases (MM
P) is the remodeling of connective tissue between normal physiological processes and some pathological processes.
ng) during the extracellular matrix protein (eg,
It constitutes a major group of zinc-binding endopeptidases that degrade connective tissue, collagen, and gelatin).
The unrestricted activity of MMPs can lead to massive tissue damage, and these enzymes have been implicated in a variety of disease processes, including tumor cell infiltration, tumor angiogenesis, and rheumatoid arthritis (Okada, Y. Et al., J. Bio
l. Chem. , 261: 14245-14255 (1
986)). MMPs are secreted from cells as inactive zymogens, and their activity in the extracellular environment is regulated by various activators and inhibitors (Matrisian, LM, Trends G) .
enet. , 6: 121-125 (1990)).

[0004] Regulation of metalloproteinase-mediated proteolysis can be achieved by controlling naturally occurring inhibitor proteins (eg, tissue inhibitors of metalloproteinases (TIMs).
P)). The balance between MMP production and activation and its inhibition by natural inhibitors such as TIMPs determines whether connective tissue is degraded in both physiological and pathological conditions.

MMPs contain many proteases and include interstitial (type I) collagenase itself, stromelysin (also known as proteoglycanase or tolzin), fibroblasts and polymorphonuclear leukocyte gelatinase (as collagen IVase). Also known as "pu"
mp-1 "(putative metalloproteinase 1, uterine metalloprotease) [Goldber
g et al. Biol. Chem. 2610: 6600
(1986); Whitham et al., Biochem.
J. 240: 913 (1986); Breathnac
h et al., Nucleic Acids Res. , 15: 1
139 (1987); Muller et al., Bioche.
m. J. , 253: 187 (1988); Collie.
R. et al. Biol. Chem. , 263: 6579
(1988); Murphy et al., Biochem. J. ,
258: 463 (1989); Quantin et al., Bi.
ochem. (NY), 28: 5327 (198).
9); Birkedal-Hansen, J .; Oral
Pathol. , 17: 445 (1988)].

In general, the mammalian family of proteases has one or more of the following properties: (a) optimal proteolytic activity near neutral pH; (b) divalent metal ion chelators (eg, 1.10 phe). Nanthroline (preferential chelation of zinc), or EDTA (little limits the chelating properties; EDTA and EGTA also inhibit enzyme inactivation by chelating calcium ions required for enzyme stability. Contribution)) Dependence of enzyme activity on the presence of zinc, as evidenced by loss of activity in the treatment; (c) inhibition by TIMP; (d) other families of neutral zinc-containing metalloproteinases (eg, pyrolysis) , Lack of significant inhibition by known inhibitors of angiotensin converting enzyme and "enkephalinase"); and (e Necessary extracellular activation, biosynthesis and secretion as latent precursor forms (zymogens). Activation was achieved by a number of endoproteases, organomercury compounds, and chaotropic agents.

In general, members of the family of neutral metalloprotease enzymes have unique substrate specificities.
Thus, collagenase type 1 is unique in its ability to cleave certain peptide bonds in the natural fibrils of interstitial collagen (eg, types I, II and III). Gelatinase is slightly active on these collagens, but can degrade denatured interstitial collagen, as well as non-fibrillar collagen (eg, type IV as found in basement membrane). Pump1 was reported to act preferentially on denatured collagen (gelatin), but its profile differs from that of stromelysin or collagenase type IV. In addition, both stromelysin and gelatinase can degrade non-collagenous structural proteins, such as proteoglycan and elastin core proteins. Macromolecules involved in cell-substratum interactions and cell-cell interactions (eg, laminin and fibronectin) also
Sensitive to degradation by some of these metalloproteases.

[0008] Enzymes of this family are produced by synovial and dermal fibroblasts, chondrocytes, peripheral mononuclear cells, keratinocytes, and gingival tissue, and are associated with granule storage in polymorphonuclear leukocytes (PMNL). Present in the vesicle.

[0009] Current information is available on TIMP-1 (a tissue inhibitor of metalloproteinase-1); TIMP-2;
Human TIMP-3, which has been cloned and expressed,
And mapped to human chromosome 22); and a chicken tissue inhibitor of metalloproteinase (C
This suggests that a family of metalloproteinase inhibitors, including hIMP-5), exists.

[0010]

SUMMARY OF THE INVENTION The present invention relates to a human TIM
It is to provide a novel mature polypeptide that is P-4, as well as fragments, analogs and derivatives thereof that are biologically active and diagnostically or therapeutically useful.

[0011]

The present invention relates to an isolated polynucleotide, which comprises: (a) a polynucleotide encoding a polypeptide having the deduced amino acid sequence of FIG. 1, or a fragment of the polypeptide; (B) a polynucleotide encoding a polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Accession No. 75946, or a fragment, analog, or derivative of a polypeptide. A polynucleotide that is selected from the group consisting of:

[0012] In one embodiment, the polynucleotide is DNA.

[0013] In one embodiment, the polynucleotide is RNA.

[0014] In one embodiment, the polynucleotide is genomic DNA.

[0015] In one embodiment, the polynucleotide encodes a polypeptide having the deduced amino acid sequence of FIG.

[0016] In one embodiment, the polynucleotide encodes a polypeptide encoded by the cDNA at ATCC Accession No. 75946.

In one embodiment, the polynucleotide has the coding sequence shown in FIG.

In one embodiment, the polynucleotide has the coding sequence deposited under ATCC Accession No. 75946.

In one embodiment, the vector contains the above DNA.

[0020] In one embodiment, the host cell is genetically engineered with the vector described above.

The present invention relates to a process for producing a polypeptide, comprising the step of expressing the polypeptide encoded by the DNA from the host cell.

In one embodiment, the process of producing a cell capable of expressing the polypeptide comprises genetically engineering the cell with the above vector.

In one embodiment, the polypeptide encodes a polypeptide capable of hybridizing with the DNA and having human TIMP-4 activity.

The present invention relates to a polypeptide, which comprises (i) a polypeptide having the deduced amino acid sequence of FIG. 1 and fragments, analogs and derivatives thereof, and (ii) a polypeptide encoded by the cDNA of ATCC Accession No. 75946. And fragments, analogs, and derivatives of polypeptides.

In one embodiment, the polypeptide has the deduced amino acid sequence of FIG.

In one embodiment, the antibody relates to the polypeptide.

[0027] In one embodiment, the antagonist relates to the above polypeptide. The present invention relates to a human TIM
A method of treating a patient in need of P-4, the method comprising administering to the patient a therapeutically effective amount of the polypeptide.

The present invention is directed to a method of treating a patient having a need to inhibit human TIMP-4, comprising administering to the patient a therapeutically effective amount of the antagonist.

[0029] In one embodiment, a pharmaceutical composition contains the polypeptide and a pharmaceutically acceptable carrier.

[0030] In one embodiment, the method comprises administering the therapeutically effective amount of the polypeptide by providing a DNA encoding the polypeptide to the patient and expressing the polypeptide in vivo. .

The present invention relates to a process for identifying compounds which are active as agonists or antagonists to human TIMP-4, comprising a reaction mixture comprising MMP, human TIMP-4, the compound to be screened and a substrate degradable by MMP. Wherein the substrate is labeled, and determining the ability of the compound to increase or block the degradation of the substrate by MMP by measuring the label released from the substrate. I do.

The present invention relates to a process for diagnosing a disease or susceptibility to a disease associated with a mutation in the human TIMP-4 nucleic acid sequence, comprising the steps of:
Isolating the nucleic acid sequence encoding -4; and determining the mutation in the human TIMP-4 nucleic acid sequence.

[0033] In one embodiment, the diagnostic process involves analyzing the presence of the polypeptide in a sample derived from the host.

A metalloproteinase-4 polypeptide,
And a DNA encoding such a polypeptide (R
NA), as well as procedures for producing such polypeptides by recombinant techniques. Also disclosed are methods of utilizing such polypeptides in the treatment of diseases including arthritis and cancer. Also disclosed are antagonists to such polypeptides and their use as therapeutics to resorb scar tissue. Human TIM
Diagnostic assays for detecting levels of P-4 protein and mutations in the human TIMP-4 nucleic acid sequence are also disclosed.

[0035]

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and the use of such polynucleotides and polypeptides. For the production of More specifically, the polypeptides of the present invention may comprise a metalloproteinase-
No. 4 human tissue inhibitor, hereinafter referred to as "human TIMP-4". The present invention also provides
It relates to inhibiting the action of such polypeptides.

The extracellular matrix is composed of collagen, proteoglycan, glucosaminoglycan, glycoproteins (fibronectin, chondronectin, laminin) and, in some tissues, elastin (Hay,
E. FIG. D. , J. et al. Cell Biol. , 91: 205-
223 (1981)).

The matrix metalloproteinase (MM)
P) is the remodeling of connective tissue between normal physiological processes and some pathological processes.
ng) during the extracellular matrix protein (eg,
It constitutes a major group of zinc-binding endopeptidases that degrade connective tissue, collagen, and gelatin).
The unrestricted activity of MMPs can lead to massive tissue damage, and these enzymes have been implicated in a variety of disease processes, including tumor cell infiltration, tumor angiogenesis, and rheumatoid arthritis (Okada, Y. Et al., J. Bio
l. Chem. , 261: 14245-14255 (1
986)). MMPs are secreted from cells as inactive zymogens, and their activity in the extracellular environment is regulated by various activators and inhibitors (Matrisian, LM, Trends G) .
enet. , 6: 121-125 (1990)).

Regulation of metalloproteinase-mediated proteolysis can be achieved by controlling naturally occurring inhibitor proteins (eg, tissue inhibitors of metalloproteinases (TIM)
P)). The balance between MMP production and activation and its inhibition by natural inhibitors such as TIMPs determines whether connective tissue is degraded in both physiological and pathological conditions.

MMPs contain many proteases and include interstitial (type I) collagenase itself, stromelysin (also known as proteoglycanase or tolzin), fibroblasts and polymorphonuclear leukocyte gelatinase (as collagen IVase). Also known as "pu"
mp-1 "(putative metalloproteinase 1, uterine metalloprotease) [Goldber
g et al. Biol. Chem. 2610: 6600
(1986); Whitham et al., Biochem.
J. 240: 913 (1986); Breathnac
h et al., Nucleic Acids Res. , 15: 1
139 (1987); Muller et al., Bioche.
m. J. , 253: 187 (1988); Collie.
R. et al. Biol. Chem. , 263: 6579
(1988); Murphy et al., Biochem. J. ,
258: 463 (1989); Quantin et al., Bi.
ochem. (NY), 28: 5327 (198).
9); Birkedal-Hansen, J .; Oral
Pathol. , 17: 445 (1988)].

In general, the mammalian family of proteases has one or more of the following properties: (a) optimal proteolytic activity near neutral pH; (b) a divalent metal ion chelator (eg, Nanthroline (preferential chelation of zinc), or EDTA (little limits the chelating properties; EDTA and EGTA also inhibit enzyme inactivation by chelating calcium ions required for enzyme stability. Contribution)) Dependence of enzyme activity on the presence of zinc, as evidenced by loss of activity in the treatment; (c) inhibition by TIMP; (d) other families of neutral zinc-containing metalloproteinases (eg, pyrolysis) , Lack of significant inhibition by known inhibitors of angiotensin converting enzyme and "enkephalinase"); and (e Necessary extracellular activation, biosynthesis and secretion as latent precursor forms (zymogens). Activation was achieved by a number of endoproteases, organomercury compounds, and chaotropic agents.

In general, members of the family of neutral metalloprotease enzymes have unique substrate specificities.
Thus, collagenase type 1 is unique in its ability to cleave certain peptide bonds in the natural fibrils of interstitial collagen (eg, types I, II and III). Gelatinase is slightly active on these collagens, but can degrade denatured interstitial collagen, as well as non-fibrillar collagen (eg, type IV as found in basement membrane). Pump1 was reported to act preferentially on denatured collagen (gelatin), but its profile differs from that of stromelysin or collagenase type IV. In addition, both stromelysin and gelatinase can degrade non-collagenous structural proteins, such as proteoglycan and elastin core proteins. Macromolecules involved in cell-substratum interactions and cell-cell interactions (eg, laminin and fibronectin) also
Sensitive to degradation by some of these metalloproteases.

This family of enzymes is produced by synovial and dermal fibroblasts, chondrocytes, peripheral mononuclear cells, keratinocytes, and gingival tissues, and is associated with granule storage in polymorphonuclear leukocytes (PMNL). Present in the vesicle.

Current information includes TIMP-1 (a tissue inhibitor of metalloproteinase-1); TIMP-2;
Human TIMP-3, which has been cloned and expressed,
And mapped to human chromosome 22); and a chicken tissue inhibitor of metalloproteinase (C
This suggests that a family of metalloproteinase inhibitors, including hIMP-5), exists. The polypeptides of the present invention have been putatively identified as novel human TIMP polypeptides based on amino acid sequence homology.

According to one aspect of the present invention, the human TIM
Novel mature polypeptides that are P-4, as well as fragments, analogs, and derivatives thereof that are biologically active and diagnostically or therapeutically useful are provided.

According to another aspect of the present invention, human TIMP
-4 isolated nucleic acid molecule (mRNA, DN
A, cDNA, genomic DNA), and fragments, analogs and derivatives thereof that are biologically active and useful diagnostically or therapeutically.

According to a still further aspect of the present invention there is provided a method for producing such a polypeptide by recombinant techniques. The method involves culturing a recombinant prokaryotic and / or eukaryotic host cell containing a human TIMP-4 nucleic acid sequence under conditions that promote expression of the protein, followed by recovery of the protein.

According to yet a further aspect of the present invention, there is provided a method of treating a condition associated with insufficient human TIMP activity. This method involves treating the patient's endogenous human TIMP-4
And administering to a patient in need thereof a pharmaceutical composition comprising a human TIMP-4 protein of the present invention that is effective to supplement the above conditions and thereby alleviate the above conditions.
Such conditions include, for example, arthritic diseases such as rheumatism and osteoarthritis, soft tissue rheumatism, polychondritis, and capsular tonitis; bone resorption diseases (eg, osteoporosis, Paget's disease, hyperparathyroidism) And cholesterinoma); increased collagen destruction associated with diabetes; dystrophic epidermolysis bullosa (bullos)
Recessive species of a); results of periodontal disease, gingivitis and associated gingival production of collagenase; corneal ulceration; skin ulceration and gastrointestinal tract ulceration and abnormal wound healing; post-operative collagenase levels are increased Cancer by blocking the destruction of tissue basement membrane leading to cancer metastasis; demyelinating diseases of the central and peripheral nervous system; asthma; glomerulosclerosis;
Septic shock and infection; and psoriasis.

According to a still further aspect of the present invention, there are provided antibodies against such polypeptides.

According to yet another aspect of the present invention, the human TI
A nucleic acid probe is provided that includes a nucleic acid molecule of sufficient length to specifically hybridize to an MP-4 sequence.

In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides that can be used for therapeutic purposes (eg, for tissue remodeling and repair and destruction of scar tissue).

According to another aspect of the present invention, human TIMP
Diagnostic assays are provided for detecting mutations in the -4 sequence and overexpression of this polypeptide.

[0052] These and other aspects of the invention include:
It should be apparent to those skilled in the art from the teachings herein.

The accompanying drawings are illustrative of embodiments of the present invention and are not intended to limit the scope of the invention, which is defined by the appended claims.

FIG. 1 shows the cDNA sequence of the full length human TIMP-4 polypeptide and the corresponding deduced amino acid sequence. Standard single letter abbreviations for amino acids are used. Sequencing was performed using a 373 automated DNA sequencer (Applied
Biosystems, Inc. ). Sequencing accuracy is expected to be greater than 97%.

FIG. 2 is an amino acid sequence comparison between the polypeptide of the present invention and other human TIMP polypeptides.

FIG. 3 shows the results of Northern blot analysis showing various human tissues in which human TIMP-4 is expressed.

According to an aspect of the present invention, it encodes a mature polypeptide having the deduced amino acid sequence of FIG. 1 or ATCC Accession No. 759 on Nov. 11, 1994.
Provided is an isolated nucleic acid sequence (polynucleotide) encoding the mature polypeptide encoded by the cDNA of the clone deposited as No. 46.

The polynucleotide encoding the polypeptide of the present invention can be obtained from early human brain. this is,
It contains an open reading frame and encodes a protein of 224 amino acid residues. The first approximately 29 amino acid residues are the leader sequence so that the mature protein contains 195 amino acid residues. The polynucleotide of the present invention was discovered from a cDNA library derived from early human brain. This protein exhibits the highest degree of homology to human TIMP-2 with 48% identity and 72% similarity over a length of 136 amino acids. Human T
IMP-4 has 12 cysteine amino acids, a signature that is conserved in all members of the TIMP family. Twelve cysteine residues are all disulfide bonded in TIMP-1 and TIMP-2. This evidence strongly suggests that the polypeptides of the present invention are novel members of the TIMP family.

The polynucleotide of the present invention may be in the form of RNA or DNA. DNA is cDN
A, including genomic DNA and synthetic DNA. DNA can be double-stranded or single-stranded. And in the case of a single strand, it can be a coding strand or a non-coding (antisense) strand. The coding sequence encoding the mature polypeptide may be identical to the coding sequence shown in FIG. 1 or may be identical to the coding sequence of the deposited clone. Or,
The coding sequence is a duplicate of the genetic code (redundanc).
y) or, as a result of degeneracy, a different coding sequence encoding the same mature polypeptide as the DNA of FIG. 1 or the deposited cDNA.

The mature polypeptide of FIG. 1 or the deposited c
The polynucleotides encoding the mature polypeptide encoded by the DNA include: the coding sequence of the mature polypeptide only; the coding sequence of the mature polypeptide and additional coding sequences (eg, leader or secretory or protein sequences); It may include coding sequences for the polypeptide (and additional coding sequences as appropriate) as well as non-coding sequences (eg, non-coding sequences 5 'and / or 3' to the coding sequence of an intron or mature polypeptide).

Thus, the term "polynucleotide encoding a polypeptide" includes polynucleotides comprising only the coding sequence of the polypeptide as well as polynucleotides comprising additional coding and / or non-coding sequences.

The present invention further relates to a polypeptide having the deduced amino acid sequence of FIG.
A fragment of the polypeptide encoded by A,
Variants of the above-described polynucleotides encoding analogs and derivatives. A variant of a polynucleotide can be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Thus, the present invention relates to polynucleotides encoding the same mature polypeptide as shown in FIG. 1 or the same mature polypeptide encoded by the cDNA of the deposited clone, as well as variants of such polynucleotides. Is included. These variants encode fragments, derivatives, or analogs of the polypeptides encoded by the polypeptides of FIG. 1 or the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants, and addition or insertion variants.

As indicated hereinabove, the polynucleotide may have a coding sequence that is a naturally occurring allelic variant of the coding sequence shown in FIG. 1 or of the deposited clone. As is known in the art, an allelic variant is another form of a polynucleotide sequence that may have one or more nucleotide substitutions, deletions, or additions, which is a function of the encoded polypeptide. Is not substantially changed.

The present invention also includes a polynucleotide,
Here, the coding sequence for the mature polypeptide is the same reading as a polynucleotide sequence that assists in the expression and secretion of the polypeptide from the host cell (eg, a leader sequence that functions as a secretory sequence to control transport of the polypeptide from the cell). Can be fused with a frame. A polypeptide having a leader sequence is a preprotein and may have a leader sequence that is cleaved by a host cell to form a mature form of the polypeptide. The polynucleotide may also encode a proprotein that is an additional 5 ′ amino acid residue in addition to the mature protein. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Cleavage of the prosequence leaves an active mature protein.

Thus, for example, the polynucleotide of the present invention may be a mature protein or a protein having a prosequence, or a prosequence and a presequence (leader sequence)
May be encoded.

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence that allows for purification of the polypeptide of the present invention. The marker sequence may be a hexahistidine tag provided by the pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host. Or
For example, the marker sequence may be a mammalian host (eg, CO
S-7 cells) are used, hemagglutinin (HA)
It can be a tag. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wils
on, I. Et al., Cell, 37: 767 (198).
4)).

The present invention further provides that at least 50
%, And preferably 70% identity,
The present invention relates to polynucleotides that hybridize to the above sequences. The invention particularly relates to polynucleotides that hybridize under stringent conditions to the herein above-described polynucleotides. As used herein, the term "stringent conditions" means that hybridization occurs only when there is at least 95%, and preferably at least 97%, identity between the sequences. In a preferred embodiment, the polynucleotide that hybridizes to the polynucleotide herein above is the cDNA of FIG. 1 or the deposited cDNA.
Encodes a polypeptide that retains substantially the same biological function or biological activity as the mature polypeptide encoded by

The deposit (s) referred to herein are maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of patent proceedings.
These deposits are provided to one of ordinary skill in the art merely for convenience and are not an admission that a deposit is required under 35 USC 112. The sequence of the polynucleotide contained in the deposit, as well as the amino acid sequence of the polypeptide encoded thereby, is incorporated herein by reference and any conflicts with any description of the sequences herein. You also have control. A license may be required to make, use, or sell the deposit, and such license is not granted by this specification.

The present invention further provides a human TIMP-4 polypeptide having the deduced amino acid sequence of FIG. 1 or having the amino acid sequence encoded by the deposited cDNA,
And fragments, analogs, and derivatives of such polypeptides.

The terms “fragment,” “derivative,” and “analog” when referring to the polypeptide of FIG. 1, or the polypeptide encoded by the deposited cDNA, are essentially the same organism as such a polypeptide. A polypeptide that retains a biological function or biological activity. Thus, analogs include proproteins that can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

[0072] The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide.

The polypeptide of FIG. 1 or the deposited cD
A fragment, derivative, or analog of the polypeptide encoded by NA comprises (i) wherein one or more amino acid residues are replaced with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue); Such a substituted amino acid residue may or may not be an amino acid residue encoded by the genetic code, a fragment, derivative, or analog; Or (i
i) a fragment, derivative or analog in which one or more amino acid residues contain a substituent, or (i)
ii) a fragment, derivative, or analog in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol), or (iv) additional Amino acids (eg, leader or secretory sequences or sequences used to purify a mature polypeptide or proprotein sequence) can be fragments, derivatives, or analogs fused to the mature polypeptide. Such fragments, derivatives, and analogs are deemed to be within the skill of the art in light of the teachings herein.

[0074] The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the substance has been removed from its original environment (eg, the natural environment, if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide present in a living animal has not been isolated, but the same polynucleotide or polypeptide separated from some or all of the coexisting materials in the natural system has been isolated. Have been. Such a polynucleotide may be part of a vector, and / or such a polynucleotide or polypeptide may be part of a composition, and furthermore, such a vector or composition may be part of its natural environment. Can be isolated because it is not part of

The present invention also relates to vectors containing the polynucleotides of the present invention, host cells that are genetically engineered with vectors of the present invention, and the production of polypeptides of the present invention by recombinant techniques.

The host cell is genetically engineered (transduced or transformed or transfected) with a vector of the invention, which can be, for example, a cloning vector or an expression vector. Vectors, for example,
It can be in the form of a plasmid, virus particle, phage, and the like. The engineered host cells can be cultured in a conventional nutrient medium suitably modified to activate the promoter, select for transformants, or amplify the human TIMP-4 gene. Culture conditions (eg, temperature, pH, etc.)
Are the conditions previously used in the host cell selected for expression, and will be apparent to those skilled in the art.

[0078] The polynucleotides of the present invention can be used to produce polypeptides by recombinant techniques. Thus, for example, a polynucleotide can be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomes, non-chromosomes,
And synthetic DNA sequences, eg, derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids;
Vectors derived from combinations of NA, vaccinia, adenovirus, fowlpox virus, and viral DNA such as pseudorabies. However, any other vector can be used as long as it is replicable and viable in the host.

The appropriate DNA sequence can be inserted into the vector by various procedures. Generally, the DNA sequence is inserted into the appropriate restriction endonuclease site (s) by procedures known in the art. Such and other procedures are considered to be within the purview of those skilled in the art.

The DNA sequence in the expression vector
Is operably linked to an appropriate expression control sequence (s) (promoter) to direct the synthesis of As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, E. c
oli. lac or trp , the phage lambda P _L promoter, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. Vectors may also include appropriate sequences for amplifying expression.

In addition, the expression vector is preferably a phenotypic trait for selection of transformed host cells (eg, dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline resistance in E. coli) . (Or ampicillin resistance).

A vector containing a suitable DNA sequence as described herein above and a suitable promoter or control sequence can be used to transform a suitable host to express the protein in the host.

Representative examples of suitable hosts may include: bacterial cells (eg, E. coli , S.
Treptomyces , Salmonella ty
Phimurium); fungal cells (such as yeast); insect cells (e.g., Drosophila S2 and Sf
9 ); animal cells (eg, CHO, COS or Bow)
es melanoma); adenovirus; plant cells and the like. Selection of an appropriate host is considered to be within the skill of the art in light of the teachings herein.

More particularly, the present invention also encompasses a recombinant construct comprising one or more of the sequences broadly described above. The constructs include a vector (eg, a plasmid vector or a viral vector) into which the sequence of the invention has been inserted in a forward or reverse orientation. According to a preferred aspect of this embodiment, the construct further comprises a regulatory sequence operably linked to the sequence (eg, including a promoter). Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided as examples. Bacterial: pQE70, pQE60, pQE-9
(Qiagen), pbs, pD10, phasesc
Rip, psiX174, pbluescript
SK, pbsks, pNH8A, pNH16a, pNH
18A, pNH46A (Stratagene); p
trc99a, pKK223-3, pKK233-3,
pDR540, pRIT5 (Pharmacia).
Eukaryotic: pWLNEO, pSV2CAT, pOG44,
pXT1, pSG (Stratagene); pSV
K3, pBPV, pMSG, pSVL (Pharma
cia). However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

The promoter region can be selected from any desired gene using a CAT (chloramphenicol transferase) vector or other vector having a selectable marker. Two suitable vectors are p
KK232-8 and PCM7. Particularly well-known bacterial promoters are lacI, lacZ, T3,
Includes T7, gpt, λP _R , P _L , and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein I.
Is included. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell (eg, a mammalian cell) or a lower eukaryotic cell (eg, a yeast cell), or the host cell can be a prokaryotic cell (eg, a bacterial cell). Introduction of the construct into host cells can be accomplished by calcium phosphate transfection, DEAE-dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Bat).
ey, I. , Basic Methods in
Molecular Biology, (198
6)).

The construct in a host cell can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptide of the present invention comprises
It can be produced synthetically by conventional peptide synthesizers.

[0088] Mature proteins include mammalian cells, yeast,
It can be expressed in bacteria, or other cells, under the control of a suitable promoter. Cell-free translation systems can also be used to produce such proteins, using RNA from the DNA constructs of the present invention. Suitable cloning and expression vectors for use in prokaryotic and eukaryotic hosts are described in Sambrook et al., Molecule.
ar Cloning: A Laboratory
Manual, 2nd edition, Cold Spring H
arbor, N .; Y. , (1989), the disclosure of which is incorporated herein by reference.

DNA encoding the polypeptide of the present invention
Transcription by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancer is D
Cis-acting element of NA, usually about 10 to about 3
00 bp, which act on the promoter to increase its transcription. As an example, the replication origin bp100-27
0, the SV40 enhancer on the late side, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

In general, the recombinant expression vectors contain an origin of replication and a selectable marker which allows for transformation of the host cell (eg, the ampicillin resistance gene of E. coli and the TRP1 gene of S. cerevisiae ) and the transcription of downstream structural sequences. Contains a promoter derived from a highly expressed gene. Such promoters include glycolytic enzymes (eg, especially 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase,
Or a heat shock protein). The heterologous structural sequence is constructed in a suitable phase with translation initiation and termination sequences, and preferably a leader sequence capable of directing secretion of the translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein that includes an N-terminal identification peptide that provides the desired characteristics (eg, stabilization or simplified purification of the expressed recombinant product).

Expression vectors useful for bacterial use are constructed by inserting a structural DNA sequence encoding the desired protein, with appropriate translation initiation and termination signals, in a operable reading phase with a functional promoter. Is done. The vector contains one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and, optionally, to provide for amplification in the host. Suitable prokaryotic hosts for transformation, E.
coli , Bacillus subtilis , S
almonella typhimurium , and Pseudomonas sp., Streptomyces
s, and various species of the genus Staphylococcus, but other species may also be used as selections.

As a representative, but non-limiting example, expression vectors useful for bacterial use include selection markers derived from commercially available plasmids containing the genetic elements of the well-known cloning vector pBR322 (ATCC 37017) and bacterial replication. An origin may be included. Such commercially available vectors are, for example, pKK223-3 (Phar
macia Fine Chemicals, Upps
ala, Sweden) and GEM1 (Promeg)
a Biotec, Madison, WI, USA). These pBR322 "backbone" portions are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of the appropriate host strain and propagation of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (eg, temperature shift or chemical induction) and Is cultured for an additional period.

The cells are typically collected by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.

The microbial cells used in protein expression can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or the use of cell lysing agents. It is well known to those skilled in the art.

[0097] Various mammalian cell culture systems can also be used to express the recombinant protein. Examples of mammalian expression systems are described in Gluzman, Cell, 23: 1.
75 (1981), and other cell lines capable of expressing compatible vectors (e.g., C127, 3T3, CHO, He).
La, and BHK cell lines). Mammalian expression vectors contain an origin of replication, a suitable promoter and enhancer, and additionally any necessary ribosome binding, polyadenylation, splice donor and splice acceptor sites, transcription termination sequences, and 5 'flanking non-transcribed sequences. It contains. DN from SV40 splice and polyadenylation sites
The A sequence can be used to provide the necessary non-transcribed genetic elements.

[0097] Human TIMP-4 polypeptide can be recovered from recombinant cell culture and purified by the methods described below. These methods include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. No. If desired, a protein refolding step can be used to complete the configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

The polypeptides of the present invention may be natural, purified products, or products of chemical synthesis procedures, or may be prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects in culture). , And by mammalian cells). Depending on the host used for the recombinant production procedure, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the present invention may also include a starting methionine amino acid residue.

The present invention also provides, in part, human TIMP-4.
About. Human TIMP-4 has the ability to inhibit the action of MMPs, such as defined characteristics. Human TIM
P-4 polypeptides can be used as metalloproteinase inhibitors to prevent tumor invasion and angiogenesis, and subsequent metastasis. Human TIMP-4 polypeptides also include arthritis diseases (eg, rheumatoid arthritis and osteoarthritis), soft tissue rheumatism, polychondritis, and tendinitis; and bone resorption diseases (eg, osteoporosis, Paget disease, parathyroid) Hyperactivity, and cholesterinoma). Human TIMP
-4 may also be used to prevent increased collagen destruction associated with diabetes, the recessive class of dystrophy epidermolysis bullosa, periodontal disease, and the associated gingival production of collagenase. Human TIMP-4 also
It can be used to inhibit PMNL collagenase release following infiltration of cells into inflammatory gums, including resistance of diabetic patients to increased susceptibility to periodontal disease.

Human TIMP-4 also produces corneal ulceration (eg, induced by alkali or other burns, radiation, vitamin E or retinoid deficiency); ulceration of the skin and gastrointestinal tract, and abnormal wound healing. And can be used to treat post-operative conditions in which collagenase levels are elevated, including colonic anastomosis.

MMPs mediate tumor growth in situ. Thus, human TIMP-4 can be used to block the destruction of the cell's basement membrane, which causes cancer cells to metastasize. MMPs are responsible for neovascularization required to support tumor growth and survival, tissue remodeling required to accommodate growing primary and secondary tumors, and vascular wall formation during metastasis. For invasion of tumor cells through the basement membrane.

MMPs are responsible for the local degradation of the follicular wall during ovulation and the local degradation of the uterine wall for implantation of undifferentiated germ cells. Therefore, human TIMP-4 can be used as a contraceptive.

[0103] Human TIMP-4 can also be used as a general growth factor to treat restenosis and similar diseases. Human TIMP-4 may in particular be used as a growth factor of the erythroid lineage.

Other diseases for which human TIMP-4 may be used for treatment include alveolitis, asthma, psoriasis, glomerulosclerosis, and septic shock. MMPs are involved in the tissue invasiveness of some parasites.

A fragment of the full-length human TIMP-4 gene was used to isolate this full-length gene and to isolate other genes having high sequence similarity or similar biological activity to this gene. In order to
It can be used as a hybridization probe to a library. This type of probe can be, for example, between 20 and 2000 bases. However, preferably, the probe has between 30 and 50 base pairs. This probe was also used to identify cDNA clones corresponding to full-length transcripts, as well as genomic clones or clones containing the complete human TIMP-4 gene containing control and promoter regions, exons and introns. obtain. One example of a screen is by using a known DNA sequence to synthesize an oligonucleotide probe.
Isolating the coding region of the MP-4 gene. A labeled oligonucleotide having a sequence complementary to the sequence of the gene of the invention is used to determine to which member of the library the probe will hybridize.
It is used for screening libraries of human cDNA, genomic DNA, or mRNA.

The present invention also relates to the use of the human TIMP-4 gene as part of a diagnostic assay for detecting a disease or susceptibility to a disease associated with the presence of mutant human TIMP-4.

Individuals having a mutation in the human TIMP-4 gene can be detected at the DNA level by various techniques. Diagnostic nucleic acids are derived from patient cells (eg, blood, urine,
Saliva, tissue biopsy, and dissection material). Genomic DNA can be used directly for detection or, prior to analysis, PCR (Saiki et al., Nature,
324: 163-166 (1986)). RNA or cDNA can also be used for the same purpose. For example, human TIMP-4
PCR primers complementary to the nucleic acid encoding can be used to identify and analyze human TIMP-4 mutations. For example, deletions and insertions can be detected by a change in size of the amplified product relative to the normal genotype. The point mutation is obtained by radiolabeling the amplified DNA with radiolabeled human TIMP-4R.
It can be identified by hybridizing to NA or a radiolabeled human TIMP-4 antisense DNA sequence. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.

Genetic testing based on DNA sequence differences
This can be achieved by detecting changes in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA of different sequence
Fragments can be distinguished on denaturing formamide gradient gels, where the mobility of different DNA fragments depends on their specific or partial melting temperature.
Delayed to different locations in the gel (eg, Myers
Et al., Science, 230: 1242 (1985)).

Sequence changes at specific positions may also be indicated by nuclease protection assays (eg, RNase and S1 protection or chemical cleavage methods) (eg, Cot
ton et al., PNAS, USA, 85: 4397-440.
1 (1985)).

Thus, detection of a particular DNA sequence can be accomplished by hybridization, RNase protection, chemical cleavage, direct DNA sequencing, or the use of restriction enzymes (eg, restriction fragment length polymorphism (RFLP)) and genomics. DN
A can be achieved by methods such as Southern blotting.

In addition to more conventional gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

The present invention also relates to human T cells in various tissues.
A diagnostic assay for detecting altered levels of IMP-4 protein. This is because overexpression of this protein compared to normal control tissue samples can detect a disease regulated by human TIMP-4 or susceptibility to the disease. Assays used to detect levels of human TIMP-4 protein in a sample derived from a host are well known to those of skill in the art, and include radioimmunoassays, competitive binding assays, Western blot analysis, ELISA assays, and Includes a "sandwich" assay. ELI
SA assay (Coligan et al., Current P
rotocols in Immunology, 1
(2), Chapter 6, (1991)) first describes the human TIM
It involves preparing an antibody specific to the P-4 antigen, preferably a monoclonal antibody. In addition, a reporter antibody is prepared against the monoclonal antibody. A detectable reagent, such as radioactivity, fluorescence, or, in an embodiment of the present invention, a horseradish peroxidase enzyme, is attached to the reporter antibody. The sample is removed from the host and incubated on a solid support (eg, a polystyrene dish) that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as BSA. Next, the monoclonal antibody is incubated in the dish. During this time, the monoclonal antibody attaches to any human TIMP-4 protein attached to the polystyrene dish. All unbound monoclonal antibodies are washed out with buffer. The reporter antibody bound to horseradish peroxidase is
Placed in the dish, resulting in binding of the reporter antibody to any monoclonal antibody bound to human TIMP-4. Then, the non-attached reporter antibody is washed out.
A peroxidase substrate is then added to the dish, and the amount of color developed in a given time period is determined by comparing the amount of human TI present in a given volume of a patient sample when compared to a calibration curve.
It is a measured value of the amount of MP-4 protein.

[0113] Competition assays can be used. Here, an antibody specific for human TIMP-4 is attached to a solid support, and labeled human TIMP-4 and a sample from the host are passed over the solid support, and
The amount of label detected by liquid scintillation chromatography can correlate with the amount of human TIMP-4 in a sample.

The “sandwich” assay is an ELISA
Similar to the assay. In a “sandwich” assay,
Human TIMP-4 is passed over a solid support and binds to the antibody attached to the solid support. Then the second
Is bound to human TIMP-4. A third antibody, which is labeled and specific for the second antibody, is then:
Passed over a solid support and binds to a second antibody, then the amount can be quantified.

The present invention also provides methods of screening compounds to identify those that are agonists or antagonists to human TIMP-4 polypeptide. One example of such a method involves obtaining a mammalian tissue containing an extracellular matrix (eg, a bovine root joint). Articular cartilage is cut into smaller discs and ³⁵ S in DMEM for a time sufficient for the cartilage to take up the labeled sodium sulfate.
-Labeled with sodium sulfate (10 microCi / ml). The MMP (eg, stromelysin) or IL1 or TNF is then added to the cartilage disc under appropriate conditions such that tissue disruption is normal. The human TIMP-4 and the compound to be screened are then added to the reaction mixture for a time sufficient for the MMP to disrupt the cartilage disc normally. The supernatant, which is the medium outside the cartilage disc, is then collected and the radioactivity is counted by a liquid scintillation counter. The percentage of ³⁵ S released into the medium is then calculated. This release of ³⁵ S-GAG is
Represents the proteoglycan pool in the extracellular matrix of cartilage and reflects proteoglycan degradation by MMPs. The amount of ³⁵ S-GAG, determined by liquid scintillation chromatography, is then compared to a control assay performed in the absence of the compound to be screened and the human T
The ability to agonize or antagonize the effects of IMP-4 can be determined.

Examples of potential human TIMP-4 antagonists, in addition to those identified above, include antibodies or, in some cases, oligonucleotides that bind to the polypeptide. Alternatively, the potential antagonist may be a mutant form of human TIMP-4. It recognizes the natural substrate but is inactive, thereby preventing the action of human TIMP-4.

[0117] Potential human TIMP-4 antagonists also include antisense constructs prepared using antisense technology. Antisense technology can be used to control gene expression via triple helix formation or antisense DNA or RNA. Both of these methods are based on the binding of the polynucleotide to DNA or RNA. For example, the 5 'coding portion of a polynucleotide sequence encoding a mature polypeptide of the invention may comprise an antisense R of about 10 to 40 base pairs in length.
Used to design NA oligonucleotides.
DNA oligonucleotides are designed to be complementary to the gene region involved in transcription (triple helix-
Lee et al., Nucl. Acids Res. , 6:
3073 (1979); Cooney et al., Science.
ce, 241: 456 (1988); and Der.
van et al., Science, 251: 1360.
(1991)), whereby the human TIM
Interferes with the transcription and production of P-4. Antisense RN
The A oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into human TIMP-4 (antisense-Okan
o. Neurochem. , 56: 560
(1991); Oligodeoxynucleot.
ides as Antisense Inhibito
rs of Gene Expression, CR
C Press, Boca Raton, FL
(1988)). The oligonucleotides described above can also be delivered to cells so that antisense RNA or DNA can be expressed in vivo to inhibit the production of human TIMP-4.

Another potential human TIMP-4 antagonist binds to and occupies the active site of human TIMP-4, such that human TIMP-4 is interrupted by normal biological activity. Is a small molecule that prevents it from interacting with MMPs. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules (eg, peptide binding molecules).

[0119] Human TIMP-4 antagonists can be used, for example, in tissue repair and remodeling where destruction of scar tissue is desired. In some situations, increased connective tissue turnover or remodeling may be desirable, for example, in the reabsorption of scar tissue; in uterine involution after parturition; in the remodeling of fibrous deposits in the lung, liver, or joints. . Proper control of extracellular matrix protein turnover in these situations requires a balance between MMPs and human TIMP-4 that properly control degradation.

The polypeptides and agonists or antagonists, which are also polypeptides
May be used in accordance with the present invention by in vivo expression of such polypeptides. This is often called "gene therapy".

Thus, for example, cells from a patient can be engineered ex vivo with a polynucleotide (DNA or RNA), and the engineered cells are then provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells can be engineered by procedures known in the art by use of retroviral particles containing RNA encoding a polypeptide of the invention.

[0122] Similarly, cells can be engineered in vivo for expression of the polypeptide in vivo, for example, by procedures known in the art. As known in the art,
Producer cells for producing retroviral particles containing RNA encoding a polypeptide of the invention can be administered to a patient for engineering cells in vivo and for expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such methods should be apparent to those skilled in the art from the teachings of the present invention. For example, expression vehicles for manipulating cells are other than retroviruses (eg,
Adenovirus). This can be used to manipulate cells in vivo after being combined with a suitable delivery vehicle.

The polypeptides and agonists or antagonists of the present invention can be used in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The present invention also relates to one of the pharmaceutical compositions of the present invention.
A pharmaceutical pack or kit comprising one or more containers filled with the above components is provided. For such containers,
A product label may be provided in a form prescribed by a governmental agency that controls the manufacture, use, or sale of a drug or biological product, and this product label may be approved by the agency in manufacturing, using, or marketing for human administration Represents Further, the pharmaceutical compositions can be used in combination with other therapeutic compounds.

These pharmaceutical compositions can be topical, intravenous,
It can be administered in a convenient manner, such as by the intra-articular, intratumoral, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes. Pharmaceutical compositions are administered in an amount effective to treat and / or prevent a particular indication. Generally, the pharmaceutical compositions will be administered in an amount of at least about 10 μg / kg body weight, and often they will be administered in an amount not to exceed about 8 mg / kg body weight per day, and preferably, the dosage will be 1
It is about 10 μg / kg body weight to about 1 mg / kg body weight per day, depending on the administration route, symptoms, and the like.

The sequences of the present invention may also be useful for chromosome identification. This sequence can specifically target a particular location on an individual human chromosome and hybridize at that location. In addition, it is now necessary to identify specific sites on the chromosome. Currently, there are few chromosome labeling reagents based on actual sequence data (repetitive polymorphisms) available for labeling chromosomal locations. Mapping of DNA to chromosomes according to the present invention is an important first step in correlating these sequences with disease-related genes.

[0127] Briefly, the sequence is derived from cDNA by P
The chromosome can be mapped by preparing a CR primer (preferably 15-25 bp). Computer analysis of the 3 'untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA and thus do not complicate the amplification process.
These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific DNA to specific chromosomes. The present invention can be used with the same oligonucleotide primers to sublocate a panel of fragments from a particular chromosome or a pool of large genomic clones in a similar manner.
ation) can be achieved. Other mapping strategies that can also be used to map to chromosomes are:
In situ hybridization, prescreening using labeled chromosomes sorted by flow cytometry, and preselection by hybridization to construct a chromosome-specific cDNA library.

Fluorescence in situ hybridization (FISH) of cDNA clones to metaphase chromosomal spreads
Can be used to provide a precise chromosomal location in one step. This technique can be used with cDNAs as short as 500 or 600 bases, but 2,000
Clones larger than bp are more likely to bind to unique chromosomal locations with sufficient signal intensity for easy detection. FISH requires the use of the clone from which the EST was obtained, the larger the better. For example, 2,000 bp is better, 4,000 bp is better, and anything greater than 4,000 is probably not necessary to get good results at a reasonable time rate. For a review of this technology, see Verma et al.
Human Chromosomes: a Manu
al of Basic Technologies, P
ergamon Press, New York (1
988).

[0130] Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data, for example,
V. McKusick, Mendelian Inhe
literance in Man (Johns Hop
kins University Welch Med
(available online from iCal Library). Next, the relationship between the disease and the gene mapped to the same chromosomal region is identified by linkage analysis (simultaneous inheritance of physically adjacent genes).

Next, c between the affected individual and the unaffected individual
DNA or genomic sequence differences need to be determined.
If the mutation is observed in some or all affected individuals but not in normal individuals, then the mutation is likely to be a causative agent of the disease.

At the current resolution of physical and genetic mapping techniques, a cDNA correctly located in a chromosomal region associated with a disease may be one of between 50 and 500 potential causative genes. . (this is,
Assuming a mapping resolution of one megabase and one gene per 20 kb. ).

The polypeptides, fragments or other derivatives thereof, or analogs thereof, or cells expressing them can be used as an immunogen to raise antibodies against them. These antibodies are
For example, it can be a polyclonal or monoclonal antibody. The invention also relates to chimeric, single-chain and humanized antibodies, and Fab fragments, or F
Contains the products of the ab expression library. Various procedures known in the art can be used for the production of such antibodies and fragments.

Antibodies raised against polypeptides corresponding to the sequences of the present invention can be obtained by direct injection of the polypeptide into an animal or by administration of the polypeptide to an animal. The animal is preferably not a human. The antibody thus obtained then binds to the polypeptide itself. In this way, even sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind to the entire native polypeptide.
Such antibodies can then be used to isolate the polypeptide from a tissue that expresses the polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technology (Kohler and Milstein, 1975, N.
ature, 256: 495-497), trioma technology, human B cell hybridoma technology (Kozbor).
Et al., 1983, Immunology Today.
4:72), and EBV hybridoma technology for producing human monoclonal antibodies (Cole et al., 198).
5. Monoclonal Antibodies a
nd CancerTherapy, Alan R.C.
Liss, Inc. , 77-96).

The techniques described for producing single chain antibodies (US Pat. No. 4,946,778) can be adapted to generate single chain antibodies to the immunogenic polypeptide products of the invention. In addition, transgenic mice can be used to express humanized antibodies to the immunogenic polypeptide products of the invention.

The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts are by weight unless otherwise specified.

To facilitate understanding of the following examples,
List particular methods and / or terms that appear frequently.

"Plasmids" are designated by a lower case p preceded and / or followed by capital letters and / or numbers. The starting plasmid herein is
It is either commercially available, publicly available without restriction, or can be constructed from available plasmids according to published procedures. In addition, plasmids equivalent to the described plasmids are known in the art and will be apparent to those skilled in the art.

“Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only on specific sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions,
Cofactors and other requirements used were known to those skilled in the art. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction,
Typically, 5-50 μg of DNA is digested with 20-250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. An incubation time of about 1 hour at 37 ° C. is usually used, but can vary according to the supplier's instructions. After digestion, the reaction is directly electrophoresed on a polyacrylamide gel to isolate the desired fragment.

Separation by size of the cleaved fragments is described in Goeddel, D .; Et al., Nucleic A
cid Res. , 8: 4057 (1980).

"Oligonucleotide" refers to either a single-stranded polydeoxynucleotide or two complementary polydeoxynucleotide chains, which can be chemically synthesized. Such synthetic oligonucleotides are
It has no 5 'phosphate and therefore will not ligate to another oligonucleotide without the addition of phosphate and ATP in the presence of the kinase. The synthetic oligonucleotide is ligated to a fragment that has not been dephosphorylated.

“Ligation” refers to the process of forming a phosphodiester bond between two double-stranded nucleic acid fragments (Maniatis, T. et al., Supra, p. 146).
Unless otherwise provided, ligation may be accomplished using known buffers and conditions with approximately equimolar amounts of 10 units of T4 DNA ligase (“ligase”) per 0.5 μg of DNA fragment to be ligated.

Unless otherwise stated, transformation was performed using Gra
ham, F .; And Van der Eb, A. et al. ,
Virology, 52: 456-457 (197
Performed as described in method 3).

[0145]

EXAMPLE 1 Bacterial Expression and Purification of Human TIMP-4 The DNA sequence encoding human TIMP-4 (ATCC Accession No. 75946) was used to process human TIM-4.
It is first amplified using PCR oligonucleotide primers corresponding to the 5 'sequence of the P-4 protein (excluding the signal peptide sequence) and the vector sequence 3' to the TIMP-4 gene. Additional nucleotides corresponding to human TIMP-4 were added to the 5 'and 3' sequences, respectively. The 5 'oligonucleotide primer has the sequence 5' GCCAGAGGATCCTGCAGCTGC
GCCCCGGCGCAC 3 ′, which is Bam
Contains the HI restriction enzyme site followed by the 21 nucleotide human TIMP-4 coding sequence starting from the putative terminal amino acid of the processed protein codon. 3 'sequence, 5'
CGGCTTCTAGAACTAGGGCTGAAC
GATGTCAAC 3 'contains an Xba I site,
Followed by 18 nucleotides of human TIMP-4. Restriction enzyme sites were constructed using the bacterial expression vector pQE-9 (Qiagen,
Inc. 9259 Eton Avenue, Ch
atsworth, CA, 91311). pQE-9 is resistant to antibiotics (Amp
^r ), encodes the bacterial origin of replication (ori), IPTG regulatable promoter / operator (P / O), ribosome binding site (RBS), 6-His tag, and restriction enzyme site. Then, pQE-9 was digested with Bam HI and Xba I. The growth sequence was ligated into pQE-9 and inserted in frame with the sequence encoding the histidine tag and RBS. The ligation mixture is then used to obtain E. coli available from Qiagen . coli m
The 15 / pREP4 strain was isolated from Sambrook, J .; M
olecular Cloning: A Labor
attory Manual, Cold Spring
Laboratory Press, (1989)
The transformation was carried out according to the procedure described in 1. m15 / pREP4
Contains multiple copies of plasmid pREP4,
It expresses the cI repressor and also confers kanamycin resistance (Kan ^r ). Transformants were identified by their ability to grow on LB plates, and ampicillin / kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml). O / N
The culture is used to inoculate a large culture at a ratio of 1: 100 to 1: 250. Cells were grown at an optical density of 600 (O.
D. ⁶⁰⁰ ) was between 0.4 and 0.6. IPTG ("isopropyl-BD-thiogalactopyranoside") was then added to a final concentration of 1 mM. IPTG induces P / O clearing to increase gene expression by inactivating the lacI repressor. Cells were grown for an additional 3-4 hours. The cells were then harvested by centrifugation. The cell pellet was treated with the chaotropic agent 6M guanidine H.
Solubilized with Cl. After clarification, solubilized human TI
MP-4 was purified from this solution by chromatography on a nickel chelating column under conditions that allowed it to bind more tightly to the protein containing the 6-His tag (Hoc).
huli, E .; J. et al. Chromatograph
hy 411: 177-184 (1984)). Human T
IMP-4 (90% pure) was treated with 6M guanidine HClp
Elute from the column with H 5.0 and for regeneration purposes 3M guanidine HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced), and 2 mM
It was adjusted to glutathione (oxidized form). After incubation with this solution for 12 hours, the protein was dialyzed against 10 mM sodium phosphate.

Example 2 Expression of Recombinant Human TIMP-4 in COS Cells The expression of human TIMP-4 HA was determined using the vector pcDNA.
Induction by I / Amp (Invitrogen).
The vector pcDNAI / Amp contains: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli. coli
Origin of replication, 4) a CMV promoter followed by a polylinker region, an SV40 intron and a polyadenylation site;
It contains. The DNA fragment encoding the fully human TIMP-4 precursor and the HA tag fused in frame to its 3 'end is cloned into the polylinker region of the vector. Therefore, recombinant protein expression is directed under the CMV promoter. The HA tag is
Corresponds to an epitope from the influenza hemagglutinin protein as described previously (I. Wils
on, H. Niman, R .; Heighten, A
Cherenson, M .; Connolly, and R.C. Lerner, 1984, Cell 37,
767). An HA tag fusion to the target protein allows for easy detection of the recombinant protein using an antibody that recognizes the HA epitope.

The plasmid construction strategy is described below: The DNA sequence encoding human TIMP-4 (AT
(CC Accession No. 75946) was constructed by PCR using two primers: 5 ′ primer 5 ′ GC
CAGAGGATCCGCCACATGCCCTGGG
AGCCCTCGGCCC 3 ′ has a BamHI site,
Followed by a 21 nucleotide sequence of the human TIMP-4 coding sequence starting from the start codon; 3 ′ sequence 5 ′
CGGCTTCTAGAATCAAGCGTAGTCT
GGGACGTCGTATGGGTAGGGCTGAA
CGATGTCAAC 3 'is an Xbal site, a translation stop codon, an HA tag, and the last 18 nucleotides of the human TIMP-4 coding sequence (not including the stop codon).
And a sequence complementary to Therefore, the PCR product is Ba
Includes an mHI site, a human TIMP-4 coding sequence followed by an HA tag fused in frame, a translation stop stop codon adjacent to the HA tag, and an XbaI site. PCR amplified DNA fragments and vectors (pcDNAI / A
mp) was digested with BamHI and XbaI restriction enzymes and ligated. The ligation mixture is coli S
URE strain (Stratagene Cloning S
systems, 11099 North Torre
y Pines Road, LaJolla, CA
92037), the transformed cultures were plated on ampicillin medium plates and resistant colonies were selected. Plasmid DNA is isolated from the transformants and tested by restriction analysis for the presence of the correct fragment. For expression of recombinant human TIMP-4,
COS cells are transfected with an expression vector by the DEAE-DEXTRAN method (J. Sambrook).
k, E.C. Fritsch, T .; Maniatis,
Molecular Cloning: A Labo
rattro Manual, Cold Spring
g Laboratory Press, (198
9)). Expression of human TIMP-4 HA protein
Detection was by radiolabeling and immunoprecipitation. (E. H
arrow, D.E. Lane, Antibody
s: A Laboratory Manual, C
old Spring Harbor Laborat
ory Press, (1988)). Cells were labeled for 8 hours with ³⁵ S-cysteine two days after transfection. The culture medium is then harvested and the cells are washed with detergent (RIPA buffer (150 mM NaCl, 1%
NP-40, 0.1% SDS, 1% NP-40,
0.5% DOC, 50 mM Tris (pH7.
5)) (Wilson, I. et al., Ibid. 3)
7: 767 (1984)). Both cell lysate and culture medium were sedimented with an HA-specific monoclonal antibody. Precipitated protein was purified by 15% SDS-PAG.
Analyzed on E-gel.

Example 3 Cloning and Expression of TIMP-4 Using the Baculovirus Expression System The DNA sequence encoding the full-length TIMP-4 protein (ATCC Accession No. 75946) was replaced with the 5 ′ of the gene.
And amplified using PCR oligonucleotide primers complementary to the 3 'sequence.

The 5 'primer has the sequence

[0150]

Embedded image And a BamHI restriction enzyme site (bold) followed by a TI
Includes the first 21 nucleotides of the MP-4 gene (translation initiation codon "ATG" is underlined).

The 3 'primer has the sequence 5' CGGCT
TCTAGAACTAGGGCTGAACGATGTC
With AAC 3 ', restriction endonuclease XbaI
And the 18 nucleotides complementary to the 3 'untranslated sequence of the TIMP-4 gene. The amplified sequence was prepared using a commercially available kit (“Geneclean”, BIO 101I).
nc. , La Jolla, Ca. ) Using 1
% Agarose gel. The fragment is then digested with the endonucleases BamHI and XbaI and then purified again on a 1% agarose gel. This fragment is called F2.

The vector pA2 (a modified version of the pVL941 vector, described below) was transformed into a TI using a baculovirus expression system.
Used for expression of MP-4 protein (for review, see Summers, MD and Smith,
G. FIG. E. FIG. 1987, Manual of met
hods for baculovirus vector
ors and insect cell culture
re procedures, Texas Agri
cultural Experimental Sta
Tion Bulletin No. 1555). This expression vector is Autographa
californica nuclear polyhedrosis virus (AcM
NPV), which contains the strong polyhedrin promoter, followed by recognition sites for the restriction endonucleases BamHI and XbaI. The simian virus (SV) 40 polyadenylation site is used for efficient polyadenylation. For easy selection of recombinant viruses, E. coli was used. c
The oli-derived β-galactosidase gene is inserted in the same direction as the polyhedrin promoter, followed by the polyhedrin gene polyadenylation signal. The polyhedrin sequence is flanked on both ends by viral sequences for cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors (eg, pAc373, pVL941, and pAcIM1
(Luckow, VA and Summers,
M. D. , Virology, 170: 31-3.
9)) could be used instead of pRG1.

The plasmid was replaced with the restriction enzymes BamHI and X
Digested with baI. This DNA was then converted to a commercially available kit ("Geneclean" BIO 101 Inc.,
La Jolla, Ca. ) Was used to isolate from a 1% agarose gel. This vector DNA is called V2.

Fragment F2 and plasmid V2
Was ligated using T4 DNA ligase. Then
E. FIG. E. coli HB101 cells were transformed and TIMP-4 was purified using the enzymes BamHI and XbaI.
Bacteria containing the gene-containing plasmid (pBacTIMP-4) were identified. The sequence of the cloned fragment was confirmed by DNA sequencing.

5 μg of plasmid pBacTIMP-4
By the lipofection method (Felgner et al. Pro
c. Natl. Acad. Sci. USA,
84: 7413-7417 (1987)).
1.0 μg of commercially available linearized baculovirus (“B
aculoGold ^™ baculovirus DN
A ", Pharmingen, San Dieg
o, CA. ) And co-transfected.

1 μg of BaculoGold ^™ viral DNA and 5 μg of plasmid pBacTIMP-4
Was replaced with 50 μl of serum-free Grace's medium (Life T
technologies Inc. , Gaither
sburg, MD) in a sterile well of a microtiter plate. Thereafter, 10 μl Lipofectin and 90 μl Grace's medium were added, mixed and incubated at room temperature for 15 minutes. The transfection mixture was then used to seed Sf9 insect cells (ATCC CRL 1711) in 35 mm tissue culture plates with 1 ml of serum-free Grace's medium.
Was dropped. The plate was shaken back and forth to mix the newly added solution. Then plate 2
Incubated at 7 ° C for 5 hours. After 5 hours, the transfection solution was removed from the plate and 10%
One ml of Grace's insect medium supplemented with fetal calf serum was added. Return plate to incubator and add 2
Culture is continued at 7 ° C. for 4 days.

After 4 days, the supernatant was collected and the Summe
Plaque assays were performed as described by rs and Smith (supra). As a modification, "Blue Ga" allows easy isolation of blue-stained plaques.
l ”(Life Technologies In
c. An agarose gel with Gaithersburg, Inc. was used. (A detailed description of the “plaque assay” is also available from Life Technologies Incorporated.
c. User's Guide to Insect Cell Culture Methods and Baculovirology distributed at Gaithersburg, Inc. (9
10 to 10).

Four days after adding serial dilutions of virus to the cells, blue-stained plaques were picked up with the tip of an Eppendorf pipette. The agar containing the recombinant virus was then resuspended in an Eppendorf tube containing 200 μl Grace's medium. The agar was removed by brief centrifugation and the supernatant containing the recombinant baculovirus was removed from the supernatant for 35 minutes.
It was used to infect Sf9 cells seeded on mm dishes. Four days later, the supernatants of these culture dishes were collected and then stored at 4 ° C.

Sf9 cells were cultured in Grace's medium supplemented with 10% heat-inactivated FBS. Cells were grown at a multiplicity of infection (MOI) of 2 by recombinant baculovirus V-TIMP-
No. 4 infected. After 6 hours, the medium was removed and SF900 II free of methionine and cysteine.
Medium (Life Technologies In
c. , Gaithersburg). 4
After 2 hours, 5 μCi of ³⁵ S-methionine and 5 μCi
³⁵ was added to the S cysteine (Amersham) of. The cells were incubated for a further 16 hours, after which the cells were harvested by centrifugation and the labeled proteins visualized by SDS-PAGE and autoradiography.

Example 4 Expression Pattern of Human TIMP-4 in Human Tissue 20 μg of total RNA from each of the above tissues was denatured and run on a 1.2% formaldehyde agarose gel, and the capillary was placed on a nylon filter overnight. Blotted. RNA was immobilized on the filter by UV crosslinking. Random primer probe is partially T
Prepared from EcoRI-XhoI insert of IMP-4 nucleic acid sequence and 100 μg / m as blocking agent
The blot was used to probe the blot by overnight hybridization in Church buffer with 1 denatured herring sperm DNA. Wash 2 x S at 65 ° C
SC / 0.1% SDA and 0.2 × SSC / 0.1
Performed continuously with% SDS. The size marker is BR
They were the L RNA ladder and the 18S and 23S ribosomal RNA bands (FIG. 3).

[0161]

The present invention provides a novel mature polypeptide that is human TIMP-4, and a biologically active polypeptide.
And fragments thereof that are diagnostically or therapeutically useful,
Analogs and derivatives were provided.

[0162]

[Sequence list]

[0163]

[Table 1]

[Brief description of the drawings]

FIG. 1 shows the cDNA sequence of the full-length human TIMP-4 polypeptide and the corresponding deduced amino acid sequence.

FIG. 2 shows a polypeptide of the present invention and another human TI.
FIG. 4 shows an amino acid sequence comparison with an MP polypeptide.

FIG. 3 is an electrophoretic photograph showing the results of Northern blot analysis showing various human tissues in which human TIMP-4 is expressed.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (Reference) A61K 45/00 A61P 1/02 48/00 1/04 A61P 1/02 3/10 1/04 11/06 3/10 13/02 11/06 17/00 13/02 17/02 17/00 19/02 17/02 19/08 19/02 19/10 19/08 27/02 19/10 29/00 101 27 / 02 35/00 29/00 101 43/00 111 35/00 C12N 15/00 ZNAA 43/00 111 A61K 37/02 (71) Applicant 597018381 9410 Key West Avenue, Rockville, Maryland d 20850, United States s of America (72) Inventor John M. Green United States Maryland 20878, Geysersburg, Diamond Drive 872 (72) Inventor Craig A. Rosen United States Maryland 20882, Laytonsville, Rolling Hill Road 22400 F-term (reference) 4B024 AA01 BA19 CA04 DA02 DA05 DA06 EA02 EA04 FA02 HA01 4C084 AA01 AA02 AA06 AA07 AA13 AA17 BA01 BA08 BA22 BA23 MA01 NA14 ZA332 ZA892 ZAZZAZZZZZZZZZZZZZZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZAZA ZA892 ZB152 ZB262 ZB352 ZC202 ZC352 4C085 AA13 AA14 CC32 DD62 EE01 GG01 4C086 AA01 AA02 AA03 AA04 EA16 MA01 MA04 NA14 ZA33 ZA59 ZA67 ZA68 ZA81 ZA89 ZA96 ZA97 ZB15 ZB26 ZB35 ZC20

Claims (1)

[Claims] 1. An isolated polynucleotide comprising:
(A) a polynucleotide encoding a polypeptide having the deduced amino acid sequence of FIG. 1, or a polynucleotide encoding a fragment, analog, or derivative of the polypeptide; (b) cDN contained in ATCC Accession No. 75946
An isolated polynucleotide selected from the group consisting of a polynucleotide encoding a polypeptide having the amino acid sequence encoded by A, or a polynucleotide encoding a fragment, analog, or derivative of the polypeptide.