JP2002233370A - Purification method of protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a rapid purification method of an objective protein without using a physiologically active substance as an eluent by using an entirely new additional tag. SOLUTION: An adsorbent containing a cross-linked dextran is mixed with a solution containing a fusion protein comprising fusing a protein molecule intended for purification with a dextran-binding domain having a specific amino acid sequence derived from a fixed oral bacteria (Cariogenetic streptococci), and then the adsorbent obtained from the solution is mixed with a solution containing a dextran and the fusion protein is eluted into the solution containing the dextran.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for purifying a protein which can easily isolate a target protein.

[0002]

2. Description of the Related Art It is very important to easily and efficiently obtain proteins to be studied in molecular biology, biochemistry, pharmacy and medicine, as well as in various fields such as biochemical and pharmaceutical industries. It is important in various industries. Previously, isolation of target proteins from biological materials such as tissues, organs and cultured cells
The purification method was the mainstream. In this case, handling of the biomaterial is troublesome, and since the amount of the target protein is small, it is difficult to obtain the target protein with high purity and in a large amount. In addition, even when the target protein is present in a large amount, other proteins having similar physicochemical properties to the target protein are often mixed, and only the target protein can be easily isolated / It was difficult to purify.

On the other hand, in recent years, it has become possible to obtain a large amount of a target protein as a recombinant protein by utilizing a large-scale expression system using a recombinant gene and a host cell. To obtain a recombinant protein, first, a gene encoding a target protein is cloned into an expression vector. Next, a host cell is transformed with the expression vector. Then, by expressing the gene cloned in the expression vector in the host cell, a large amount of the target protein can be produced in the host cell.

[0004] When a protein is purified using this mass expression system, a method utilizing a so-called additional tag is known. That is, a fusion protein obtained by fusing a target protein and an additional tag is expressed in large amounts in a host cell. Thereafter, the lysate of the host cell is passed through a column containing the adsorbent, and the additional tag in the fusion protein is bound to the adsorbent to separate and purify the fusion protein.

[0005] Here, polyhistidine, glutathione transferase, maltose binding domain and the like are used as additional tags. However, when the affinity between these additional tags and the target protein is poor, the fusion protein is not expressed, or even if it is expressed, an inclusion body is formed. In such a case, these problems can be sometimes solved by changing the strain of the host cell, examining the culture conditions, or changing the type of the additional tag. In particular, by changing the type of additional tags,
The fusion protein can be reliably expressed, and
In many cases, formation of inclusion bodies can be avoided. Therefore, when purifying the target protein, it is preferable to prepare various additional tags.

When the additional tag as described above is used, after the fusion protein is bound to the adsorbent, the adsorbent and the fusion protein are separated by the action of an eluent corresponding to the type of the additional tag. I have. As an eluent, a physiologically active substance such as imidazole or glutathione is used. Therefore, the fusion protein after separation and purification is present in a solution containing these physiologically active substances, and must be used after removing the physiologically active substances by dialysis or the like. However, dialysis or the like for the purpose of removing a physiologically active substance takes a very long time, and the activity of the target protein may be degraded through the steps of the dialysis or the like.

[0007]

Accordingly, the present invention has been devised in view of the actual situation as described above, and by using a completely novel additional tag, it is possible to eliminate the use of a physiologically active substance as an eluent. Another object of the present invention is to provide a protein purification method capable of rapidly purifying a target protein.

[0008]

Means for Solving the Problems A method for purifying a protein according to the present invention, which has achieved the above-mentioned object, comprises the steps of: purifying a protein molecule to be purified and at least one dextran-binding domain represented by SEQ ID NO: 1; In a solution containing a fusion protein obtained by fusing a dextran-binding domain having a dextran-binding activity having an amino acid sequence in which amino acids have been deleted, substituted or added, mixing an adsorbent containing a crosslinkable dextran, Thereafter, the adsorbent taken out of the solution is mixed with a solution containing dextran to elute the fusion protein into the solution containing dextran.

In the present invention, the solution containing dextran preferably contains dextran having a molecular weight of 5 to 70 [kDa]. Furthermore, in the present invention, 20 mg / ml
It is preferable to mix dextran at the above concentrations.

Furthermore, in the present invention, when the adsorbent is mixed with a solution containing the fusion protein, it is preferable that the solution has a high salt concentration. Furthermore, in the present invention, when the adsorbent is mixed in a solution containing the fusion protein, inhibition of non-specific adsorption between the contaminant protein other than the purification target and the adsorbent in the solution is inhibited. It is preferable to add an agent.

Further, in the present invention, it is preferable to use dextran having a molecular weight of 5,000 or less as one of the above inhibitors. Furthermore, in the present invention, it is preferable that the fusion protein has a linker sequence interposed between the protein molecule to be purified and the dextran-binding domain. Furthermore, in the present invention,
The fusion protein eluted in the solution containing dextran is preferably treated with an enzyme that specifically cleaves the linker sequence.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, a method for purifying a protein according to the present invention will be described in detail. 1. Expression of fusion protein In the present method, any protein can be purified. In this method, first, a fusion protein obtained by fusing a protein to be purified (hereinafter, referred to as a target protein) with a domain that specifically binds to dextran, that is, a dextran-binding domain (hereinafter, referred to as DBD). Is prepared.

Here, the DBD has the amino acid sequence shown in SEQ ID NO: 1 or has an amino acid sequence in which at least one amino acid in SEQ ID NO: 1 is deleted, substituted or added, and has dextran binding activity. Means things. DBD stands for certain oral bacteria (Cariogenet)
ic streptococci) is a glucosyltransferase domain produced by Abo. H. et al., J. Bacteriol. 17
3: 989-996, 1991).

In the present method, the fusion protein may have a linker sequence interposed between the target protein and DBD. Here, examples of the linker sequence include a sequence that is specifically recognized and cleaved by an enzyme such as a protease. For example, as the linker sequence, the amino acid sequence shown in SEQ ID NO: 2 which is recognized and cut by thrombin,
The amino acid sequence represented by SEQ ID NO: 3 that is recognized and cleaved by Factor X (manufactured by SIGMA) and Factor Xa (manufactured by Amersham Pharmacia Biotech) can be exemplified.

When preparing the fusion protein, an expression vector for expressing the fusion protein is prepared, a host cell is transformed with the expression vector, and the transformed host cell is cultured. This expression vector contains a gene encoding a target protein downstream of the promoter, a base sequence encoding a linker sequence if necessary, and a DBD.
And a gene encoding The expression vector may include a gene encoding a DBD downstream of the promoter, a base sequence encoding a linker sequence, if necessary, and a gene encoding a target protein in this order. An example of the gene encoding DBD is shown in SEQ ID NO: 4.

[0016] The gene encoding the target protein can be prepared by a conventional gene cloning method. Specifically, Molecular Cloning 2ndEdt., Cold Sp
A gene encoding the protein of interest can be prepared using a method as described in ringHarbor Laboratory Press (1989).

The gene encoding DBD can be prepared, for example, using the method described in Abo. H. et al., J. Bacteriol. 173: 989-996, 1991. In addition, for example, a chromosomal DNA library of an oral bacterium (Cariogenetic streptococci) that produces glucosyltransferase is prepared, a clone having the glucosyltransferase gene is screened from the chromosomal DNA library, and the DBD is screened from the screened clone.
Can be prepared.

Examples of vectors that can be used for constructing the expression vector include, for example, pUC series (manufactured by Takara Shuzo Co., Ltd.), pET series (manufactured by Novagen), pGEX series (manufactured by Amersham Pharmacia Biotech), and pCAL series (STRATAGENE). PYES2 (Invitrogen), pYES2
YEUra3 (Clontech), pFastBac1 (Gibco) and the like can be mentioned. When inserting the gene encoding the target protein and the gene encoding the DBD into these vectors, a conventionally known recombinant DNA method (Molecular Cloning 2ndEdt., Cold Spring Harbor La.
boratory Press (1989)).

As the host cell, for example, Escherichia coli, Bacillus subtilis, yeast cells, insect cells, animal cells and the like can be used. These host cells are preferably selected as appropriate according to the type of the expression vector. In other words, the type of vector can be selected depending on the type of host cell used. For example, when Escherichia coli is used as a host cell, the expression vector is preferably constructed using a pUC series, a pET series, a pGEX series, or a pCAL series.

As a method for transforming a host cell, any method conventionally used can be used. For example, a method of transforming Escherichia coli into competent cells and then applying heat shock thereto, a polyethylene glycol method, an electroporation method, a particle gun method, and the like can be used.

The transformed host cell is cultured in a large amount, and the fusion protein is expressed inside the host cell. When the lac promoter was used as the promoter in the expression vector, isopropyl 1-thio-β-D-
By adding galactoside (IPTG), a gene encoding a fusion protein downstream of the lac promoter can be expressed. In addition, T7 promoter (DE3
In the case where a host cell having a gene is used), similar expression can be induced using IPTG even when a vector having a tac promoter is used.

2. Recovery of fusion protein After inducing the expression of the fusion protein, host cells are recovered, and the recovered host cells are dissolved in a buffer and lysed by ultrasonic treatment or the like. At the time of lysing, the method is not limited to the ultrasonic treatment, and a conventionally known method can be used. For example, a lysozyme / DNase method and a French press method can be mentioned.

After lysing the host cells, the solution is centrifuged, and the supernatant is recovered. An adsorbent containing crosslinkable dextran is mixed with the collected supernatant. Here, the adsorbent may have any shape / form such as a bead shape and a dendritic shape. For example, it is preferable to use a bead-shaped adsorbent for ease of handling. As beads containing a crosslinkable dextran (hereinafter referred to as dextran beads), for example, Sephadex beads (manufactured by Amersham Pharmacia Biotech) and Sephacryl beads (manufactured by Amersham Pharmacia Biotech) can be used.

The fusion protein having DBD can be adsorbed on the dextran beads by adding the dextran beads and stirring and leaving the mixture. At this time, it is preferable to remove contaminating proteins contained in the supernatant. For example, by increasing the salt concentration in the supernatant, contaminating proteins other than the fusion protein adsorbed on the dextran beads can be removed.
In addition, it is preferable to add an inhibitor that inhibits nonspecific adsorption between the dextran beads and the contaminant protein other than the purification target to the supernatant. Examples of the inhibitor include a surfactant such as polyoxyethylene-pt-octylphenyl ether and dextran having a low molecular weight. By causing this inhibitor to be present at a predetermined concentration in the supernatant, contaminating proteins other than the fusion protein adsorbed to the dextran beads can be removed.

Here, since low-molecular-weight dextran has relatively low affinity for DBD in the fusion protein, by adding low-molecular-weight dextran to the supernatant, other than the fusion protein adsorbed to the dextran beads, Can be removed.
Here, dextran having a low molecular weight has a molecular weight of 5000 [D
a] means: Examples of the low molecular weight dextran include dextran T1 (manufactured by Fluka). Next, dextran beads are collected from the supernatant by centrifugation or the like. When dextran beads are collected, not only centrifugation but also a technique such as natural standing can be used.

Next, the collected dextran beads are washed. For example, a dextran bead can be washed by adding a buffer solution to the dextran bead and stirring well. In this washing, contaminating proteins can be removed by adding a salt and / or a surfactant as described above. Also, this cleaning
It is preferably performed a plurality of times, for example, preferably performed about five times.

Next, the washed dextran beads are mixed in a solution containing dextran. As a result, the fusion protein bound to the dextran beads separates from the dextran beads. Then, the fusion protein can be purified by removing only the dextran beads from the solution.

Here, Sephadex was used to recover the fusion protein.
If G-100 beads were used, 5
It is preferable to use one having a molecular weight of ７０70 kDa. When dextran having a molecular weight of 5 to 70 kDa is used, the recovery rate of the fusion protein can be improved. In other words, when dextran having a molecular weight of less than 5 kDa or dextran having a molecular weight exceeding 70 kDa is used, the fusion protein may not be separated from the dextran beads, and the recovery rate of the fusion protein may be reduced. .

It is preferable to mix dextran at a concentration of 20 mg / ml or more in the solution containing dextran beads. Dextran concentration in the solution was 20 mg
By setting the ratio to / ml or more, the recovery rate of the fusion protein can be improved. In other words, if the dextran concentration in the solution is less than 20 mg / ml,
In some cases, the fusion protein cannot be separated from the dextran beads, and the recovery rate of the fusion protein may decrease.

On the other hand, in the solution containing the fusion protein,
Dextran will be included. However, since dextran is an inert substance, it does not adversely affect the fusion protein even if it is present in the solution containing the fusion protein. Therefore, except for the case where dextran is actively removed, the fusion protein can be purified by the above-described steps.

When dextran is removed,
Techniques such as dialysis and chromatography can be used. Specifically, since the DBD in the fusion protein is an acidic domain, an anion exchange resin such as DE
Dextran can be removed by adsorbing the fusion protein to AE-Toyopearl650M (manufactured by Tosoh Corporation).
The fusion protein adsorbed on the anion exchange resin is
It can be eluted with a salt such as NaCl. When low molecular weight dextran (for example, molecular weight 5 KDa) is used for elution, it can be removed by dialysis.

When a fusion protein in which a linker sequence is interposed between the target protein and DBD is purified, the target protein and DBD are separated by treatment with an enzyme that specifically cleaves the linker sequence. be able to. For example, when the linker sequence of SEQ ID NO: 2 is interposed, thrombin is added to a solution containing the purified fusion protein, and the solution is treated, whereby the target protein and DBD can be separated. Thereafter, the DBD can be removed and the target protein can be purified to a high degree of purity by recovering the DBD with dextran beads or performing chromatography utilizing properties such as the isoelectric point of the target protein.

Further, in the above description, an example in which the protein purification method according to the present invention is carried out in a batch system has been described. However, the protein purification method according to the present invention comprises The purification may be performed in a so-called column system. That is, a column filled with dextran beads as described above is prepared. After lysing host cells expressing the fusion protein,
The collected supernatant is passed through this column. This allows the fusion protein to be adsorbed to the dextran beads inside the column. Subsequently, a predetermined buffer or the like is passed through the column for the purpose of removing contaminating proteins existing inside the column. Next, the fusion protein adsorbed on the dextran beads can be eluted by passing a solution containing dextran through the column.

Thus, the method for purifying a protein according to the present invention can purify a target fusion protein even by applying a column method. The solution containing the fusion protein eluted from the column contains dextran. However, since dextran is an inert substance, it does not adversely affect the fusion protein even if it is present in the solution containing the fusion protein. Therefore, the fusion protein can be purified by elution from the column, except when dextran is actively removed.

[0035]

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to Examples, but the technical scope of the present invention is not limited to the following Examples. [Example 1] In this example, green fluorescent protein (Green fluoprotein) used as a model protein in various fields was used.
rescent protein (hereinafter referred to as GFP)).

1. Construction of Expression Vector As shown in FIG. 1, DBD / pUC18 (Abo, H. et al., J. Bacteriol. 173) in which a gene encoding DBD is linked downstream of the lac promoter in pUC18 (Takara Shuzo).
989-996, 1991). In this DBD / pUC18, a gene encoding GFP was ligated between the lac promoter and the gene encoding DBD (multicloning site) to construct GFP-DBD / pUC18 as shown in FIG.

[0037] 2. As a transformed host cell, Escherichia coli BL21 which is a protease-deficient strain was used.
(DE3) strain (manufactured by Novagen) was used. This E. coli BL21 (DE
3) The strain was transformed by heat shock using GFP-DBD / pUC18.

Specifically, Escherichia coli BL21 (DE3) was mixed with 20 mM β-mercaptoethanol, allowed to stand on ice for 10 minutes, and then added with GFP-DBD / pUC18 and stored on ice. After 30 storage in ice, the mixture was heat-treated at 42 ° C for 30 seconds, and then stored in ice for 2 minutes. After adding an SOC medium at 42 ° C, the cells were cultured with shaking at 37 ° C for 1 hour. The cell culture was cultured overnight at 37 ° C. on an LB plate containing chloramphenicol and ampicillin.

[0039] 3. Culture of Transformed Cells The transformed Escherichia coli BL21 (DE3) strain was precultured in LB liquid medium containing ampicillin at 37 ° C. with shaking for 12 to 16 hours. Then, 2.5 ml of the preculture solution was added to 500 ml of the TPM medium.
And cultured at 37 ° C. while measuring the absorbance as appropriate. Then, when the absorbance at a wavelength of 600 nm reached 0.5, 0.5 mM IPTG was added, and the culture was continued at 20 ° C. for 3 hours.
The addition of IPTG induces the expression of a gene downstream of the lac promoter.

At this time, the culture solution was observed visually and found to be pale green. In addition, Escherichia coli BL
When the 21 (DE3) strain was observed using a fluorescence microscope (OLYMPUS IX50), it was confirmed that GFP-derived fluorescence was emitted over the entire bacterial body. In addition, in the E. coli BL21 (DE3) strain, no inclusion body was formed.

[0041] 4. The Escherichia coli BL21 (DE3) strain was collected by centrifuging the recovered culture solution of the fusion protein at 4 ° C. and 7,500 × g for 2 minutes. E. coli B recovered
L21 (DE3) strain was added to buffer A (composition: 10 mM Tris-acetate (pH
8.0), suspended in 1 mM Mg-acetate and 150 mM K-acetate) and centrifuged to collect E. coli BL21 (DE3) strain. The collected E. coli BL21 (DE3) strain exhibited a clear yellow-green color.

Next, the recovered Escherichia coli BL21 (DE3) was
After suspending in buffer A containing EDTA and 1 mM PMSF, the cells were lysed by sonication. Then, at 4 ° C, 10,000 xg, 3
Centrifuged for 0 minutes. Here, it was confirmed that the supernatant fraction (hereinafter, referred to as supernatant A) obtained by centrifugation exhibited a bright yellow-green fluorescent color. The electrophoresis pattern of the obtained supernatant fraction is shown in lane 1 in FIG.

Next, Sephadex G-200 was added to the supernatant A at a final concentration of 2.5%, and the mixture was left on a rotator at 4 ° C. for 30 minutes. Thereafter, Sephadex G-200 was collected as a precipitate fraction by centrifugation at 4 ° C. and 2000 × g for 20 seconds. Next, an excess amount of buffer A was added to the recovered Sephadex G-200.
Was added and mixed well, and then centrifuged under the same conditions to recover Sephadex G-200 again as a precipitate fraction. By repeating this washing process 5 times, Sephadex G-200
Non-specifically adsorbed contaminating proteins were removed.

Next, Sephadex G-200 after the washing treatment was suspended in buffer A, dextran having a molecular weight of 18000 (manufactured by SIGMA) was added thereto at a concentration of 10 mg / ml, and mixed well. Thereafter, Sephadex G-200 was precipitated by centrifugation at 2,000 xg for 20 seconds at 4 ° C, and a supernatant exhibiting a yellow-green fluorescent color was collected. When the collected supernatant was analyzed by SDS-PAGE / CBB staining (lane 2 in FIG. 2) and densitometry, it was found that the purity of the fusion protein exceeded 95%.

[0045] 5. Other examples : Red fluorescent protein (Red fluorescent
The fusion protein was purified in the same manner as in the above-mentioned example except that the target protein was used as the target protein. Analysis of the finally recovered supernatant by SDS-PAGE / CBB staining revealed that the fusion protein could be purified to an extremely high purity, as shown in lane 3 in FIG.

6 Examination of the adsorption amount of the fusion protein The adsorption amount of the fusion protein to Sephadex G-200 was examined. Specifically, Abo, H. et al. J. Bacteriol. 173: 989
Glycosyltransferase (GTF) and DBD described in -996, (1991) are each purified by a conventionally known method, and a solution having a predetermined concentration is prepared for each protein. Then, various volumes of Sephadex G-200 suspended in the buffer A are mixed with the protein. The mixed solution was left on a rotator at 4 ° C. for 30 minutes, and then centrifuged at 4 ° C. and 2000 × g for 60 seconds to precipitate Sephadex G-200 and collect the supernatant.

The concentration of the protein contained in the collected supernatant was measured using BIO-RAD PROTEIN ASSAY (manufactured by BIO-RAD). Then, the amount of protein adsorbed on Sephadex G-200 was calculated from the difference between the protein concentration measured without mixing with Sephadex G-200 and the protein concentration in the recovered supernatant. The amount of protein bound to Sephadex G-200 and Se
The relationship with the amount of phadex G-200 is shown in FIG.

FIG. 3 shows that dextran beads (Sephadex)
It was found that 30 μmole (4.1 mg) of GTF was adsorbed and 70 μmole (2.1 mg) of DBD was adsorbed per 1 ml of (G-200).
When a similar experiment was performed with an incubation time of 3 hours, GTF was 103 μmol (14.2 mg) and DBD was 97 μmol.
μmol (2.9 mg) was adsorbed. From these results, it was proved that the fusion protein could be sufficiently adsorbed to the dextran beads by the above-mentioned method, and that the fusion protein could be sufficiently purified.

[0049] 7. Influence of coexisting reagents When the fusion protein was adsorbed to the dextran beads, the effect of various reagents in the supernatant A on the adsorption characteristics was examined. Specifically, using Sephadex G-100 as dextran beads, the adsorption ratio of DBD to Sephadex G-100 in supernatant A containing various reagents was measured. Table 1 shows the results.

[0050]

[Table 1]

As can be seen from Table 1, the adsorption rate of DBD to Sephadex G-100 hardly decreases even when various reagents are contained. On the contrary, when various reagents other than 0.1% Tween 20 are contained in the supernatant A, the adsorption rate of DBD to Sephadex G100 is improved. From this, it was found that when various reagents were present in the buffer solution A when the fusion protein was adsorbed to the dextran beads, the adsorption rate of the fusion protein could be improved, and a larger amount of the fusion protein could be purified. .

[0052] 8. Relationship between Mixing Time and Purification Efficiency When adsorbing the fusion protein contained in the supernatant A to the dextran beads, the relationship between the incubation time after mixing the dextran beads with the supernatant A and the recovery rate of the fusion protein was examined. Specifically, Sephadex G-100 was used as dextran beads, the incubation time was varied from 0 to 15 hours, and the amount of the fusion protein recovered in each case was measured. The amount of the recovered fusion protein relative to the total amount of the fusion protein contained in the supernatant A was calculated as a percentage. FIG. 4 shows the results.

As can be seen from FIG. 4, the recovery rate of the fusion protein increases as the incubation time increases. It was also found that by setting the incubation time sufficiently, 70% or more of the fusion protein could be recovered. From these results, it has been clarified that the fusion protein expressed in the host cell can be recovered at a high yield according to the method described above.

9. Dex used for elution of fusion protein
Examination of Tolan 1 The concentration of dextran used to elute the fusion protein adsorbed on the dextran beads was examined. Specifically, Sephadex with adsorbed fusion protein
The concentration of dextran having a molecular weight of 18000 (manufactured by SIGMA) to be added to the buffer A containing G-200 was changed, and the amount of the fusion protein eluted at each concentration was measured. Fig. 5 shows the results.
Shown in

As can be seen from FIG. 5, the higher the concentration of dextran having a molecular weight of 18000, the more the fusion protein can be eluted. In particular, it was found that when the concentration of dextran was 20 mg / ml or more, the fusion protein could be eluted almost to the maximum.

10. Dex used for elution of fusion protein
Examination of Strand 2 The molecular weight of dextran used to elute the fusion protein adsorbed on the dextran beads was examined. Specifically, Sephadex with adsorbed fusion protein
Dextran of various molecular weights was added to buffer A containing G-100, and the relationship between the molecular weight of dextran and the recovery of the fusion protein was examined. At this time, the molecular weight of dextran is 1KDa (Fluka), 5KDa (Fluka), 10KDa
a (Amersham Pharmacia Biotech), 18.1KDa
(SIGMA), 70KDa (Fluka), 150KDa (Fluka), 500KDa (Amersham Pharmacia Biotech), 2000KDa (Amersham Pharmacia Biotech), and 5000KDa (polyscience) were used. FIG. 6 shows the results.

As can be seen from FIG. 6, the molecular weight is 5 to 70 k.
When Da dextran was used, the recovery of the fusion protein was high. From this result, Seph
It has been found that to efficiently purify the fusion protein from adexG-100, it is preferable to use dextran having a molecular weight of 5 to 70 kDa.

[0058]

As described above in detail, according to the present invention, by using a dextran-binding domain as an additional tag, a target protein can be rapidly obtained without using a physiologically active substance as an eluent. A method for purifying a protein that can be purified can be provided.

[0059]

[Sequence List] SEQUENCE LISTING <110> Director-General of National Institute of Advanced Industrial Science and Technology, Ministry of Economy, Trade and Industry <120> A method for a protein purification <130> 117F0123 <140> <141> < 160> 4 <170> PatentIn Ver. 2.0 <210> 1 <211> 236 <212> PRT <213> Cariogenetic streptococci <400> 1 Tyr Tyr Phe Gly Lys Asp Gly Tyr Met Val Thr Gly Ala Gln Thr Ile 1 5 10 15 Asn Gly Ala Asn Tyr Phe Phe Leu Glu Asn Gly Thr Ala Leu Arg Asn 20 25 30 Thr Ile Tyr Thr Asp Ala Gln Gly Asn Ser His Tyr Tyr Ala Asn Asp 35 40 45 Gly Lys Arg Tyr Glu Asn Glu Asn Gly Tyr Gln Gln Phe Gly Asn Asp 50 55 60 Trp Arg Tyr Phe Lys Asp Gly Asn Met Ala Val Gly Leu Thr Thr Val 65 70 75 80 Asp Gly Asn Val Gln Tyr Phe Asp Lys Asp Gly Val Gln Ala Lys Asp 85 90 95 Lys Ile Ile Val Thr Arg Asp Gly Lys Val Arg Tyr Phe Asp Gln His 100 105 110 Asn Gly Asn Ala Val Thr Asn Thr Phe Ile Ala Asp Lys Thr Gly His 115 120 125 Trp Tyr Tyr Leu Gly Lys Asp Gly Val Ala Val Thr Gly Ala Gln Thr 130 135 140 Val Gly Lys Gln Lys Leu Tyr Phe Glu Ala Asn Gly Gln Gln Val Lys 145 150 155 160 Gly Asp Phe Val Thr Ser Asp Glu Gly Lys Leu Tyr Phe Tyr Asp Val 165 170 175 Asp Ser Gly Asp Met Trp Thr Asp Thr Phe Ile Glu Asp Lys Ala Gly 180 185 190 Asn Trp Phe Tyr Leu Gly Lys Asp Gly Ala Ala Val Thr Gly Ala Gln 195 200 205 Thr Ile Arg Gly Gln Lys Leu Tyr Phe Lys Ala Asn Gly Gln Gln Val 210 215 220 Lys Gly Asp Ile Val Lys Gly Thr Asp Gly Lys Ile 225 230 235 <210> 2 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: linker sequence <400> 2 Leu Val Pro Arg Gly Ser 1 5 <210> 3 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: linker sequence <400> 3 Ile Glu Gly Arg 1 <210> 4 <211> 708 <212> DNA <213> Cariogenetic streptococci <400> 4 tactacttcg gtaaagacgg ttatatggtg actggcgctc aaaccattaa tggtgccacac 60 tatttcttcc ttgaaaatgg tacggctctt cgcaacacta tttatacaga tgctcaacctcagca tgctcaagca tgctcaaagca tgctcaaagca tgctcaaagca tgctcaagtagcagagacacgac tacctagcacagtagacagtagacagtagcagtagacagtagacagtagactag tgg ttaccaacaa 180 tttggtaatg actggcgtta cttcaaggac ggtaacatgg ctgttggctt gacaactgtt 240 gatggcaatg ttcaatactt tgataaagat ggtgttcaag ctaaggataa gattattgtc 300 acccgtgatg gtaaggttcg ttactttgac caacataatg gaaatgctgt aaccaatacc 360 ttcatcgctg acaagactgg tcactggtac tatctaggta aagatggtgt cgctgttacc 420 ggtgctcaaa ccgttgggaa acaaaaactt tactttgaag caaacggtca acaagttaag 480 ggtgacttcg taacttctga cgaaggtaaa ctttacttct acgatgtcga ttcaggtgac 540 atgtggactg ataccttcat tgaagataag gcaggcaatt ggttctacct tggtaaagat 600 ggtgcagctg tgactggtgc tcaaactatt cgtggccaaa aactttactt caaggctaac 660 ggccaacaag tcaagggaga tatcgtcaag ggtactgatg gtaagatc 708

[Brief description of the drawings]

FIG. 1 is a diagram for explaining the construction of an expression vector prepared in an example.

FIG. 2 is SDS-PAGE photographs of supernatant A (lane 1), supernatant containing eluted GFP-DBD fusion protein (lane 2), and red fluorescent-DBD fusion protein (lane 3).

Fig. 3 Amount of protein bound to Sephadex G-200 and Seph
FIG. 3 is a characteristic diagram showing a relationship with the amount of adex G-200.

FIG. 4 is a characteristic diagram showing a relationship between an incubation time and a recovery rate of a fusion protein.

FIG. 5 is a characteristic diagram showing the relationship between the concentration of dextran and the amount of eluted protein.

FIG. 6 is a characteristic diagram showing the relationship between the molecular weight of dextran and the recovery rate of a fusion protein.

 ────────────────────────────────────────────────── ─── Continued on the front page (72) Inventor Keiko Hirose 1-4-1 Higashi, Tsukuba City, Ibaraki Pref. Ministry of Economy, Trade and Industry (AIST) F-term in the Institute of Advanced Industrial Science and Technology (AIST) 4B024 AA01 AA03 BA80 CA07 CA10 DA06 EA04 GA11 HA01 4B064 AG01 CA02 CA21 CB05 CC24 CE09 CE20 DA01 DA16 4H045 AA20 BA41 EA61 EA65 FA16 FA74 GA15

Claims (8)

[Claims] 1. A protein molecule to be purified and a dextran-binding domain represented by SEQ ID NO: 1 or SEQ ID NO: 1.
Adsorbent comprising a cross-linkable dextran in a solution containing a fusion protein obtained by fusing a dextran-binding domain having an amino acid sequence in which at least one amino acid has been deleted, substituted or added and having dextran-binding activity And then mixing the adsorbent taken out of the solution into a solution containing dextran, and eluting the fusion protein into the solution containing dextran. 2. The method according to claim 1, wherein the solution containing dextran contains dextran having a molecular weight of 5 to 70 [kDa]. 3. A solution containing 20 mg of dextran.
2. The method for purifying a protein according to claim 1, wherein dextran is mixed at a concentration of / ml. 4. The method for purifying a protein according to claim 1, wherein when the adsorbent is mixed with the solution containing the fusion protein, the solution is made to have a high salt concentration. 5. When the adsorbent is mixed with a solution containing the fusion protein, an inhibitor that inhibits non-specific adsorption between a contaminant protein other than a target to be purified and the adsorbent is mixed in the solution. 2. The method for purifying a protein according to claim 1, wherein the protein is added. 6. One of the above-mentioned inhibitors, having a molecular weight of 500
The method for purifying a protein according to claim 5, wherein 0 or less dextran is used. 7. The method for purifying a protein according to claim 1, wherein the fusion protein comprises a linker sequence interposed between a protein molecule to be purified and a dextran-binding domain. 8. The method according to claim 7, wherein the fusion protein eluted in the solution containing dextran is treated with an enzyme that specifically cleaves the linker sequence.