JP2002218996A - Method for predicting sensitivity to helicobacter pylori by genetic polymorphism analysis of secretory gene, lewis gene, interleukin 1b and myeloperoxidase gene - Google Patents

Abstract

PROBLEM TO BE SOLVED: To predict the sensitivity to the infection with Helicobacter pyroli(HP) and the effectiveness of a method for the removal of HP. SOLUTION: It has been proved on 239 Japanese test subjects that the infection ratio of HP is defined by a specific genotype of secretory gene, Lewis gene, interleukin 1B and myeloperoxidase gene. There is an accumulation of biological basis suggesting the possibility of the participation of these genes in the HP infection. Accordingly, the sensitivity to the HP infection and the effectiveness of an HP-removing method can be estimated by checking the polymorphism of the above four genes or genes linking to these genes.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for predicting susceptibility to Helicobacter pylori infection by analyzing gene polymorphisms.

[0002]

2. Description of the Related Art Helicobacter pigment
i (hereinafter abbreviated as HP) is a bacterium that infects the gastric mucosa causing gastric ulcer, duodenal ulcer, gastric cancer, and MALT lymphoma. HP eradication has been approved in health insurance medical care as a treatment for gastric ulcer and duodenal ulcer from November 1, 2000, and its pathogenicity is already generally known. The number of infected people in Japan is 60 to 8 for those over 60 years old
However, about 10 to 20 percent of infected people in their teens are infected. Infection mainly takes the mouth-to-mouth and fecal-to-mouth route, and most current infected individuals are thought to have been infected during childhood. Improvement of sanitary situation in Japan in recent years,
In particular, it is thought that the spread of flush toilets has greatly prevented infection to the younger generation.

[0003] It is considered that almost all of the Japanese aged 60 and over were exposed to HP during childhood, and the existence of those who have escaped persistent infection is a condition that prevents HP infection, or This suggests that some individuals have a constitution that eliminates bacteria in a short period of time. Predicting such susceptibility to HP infection is useful for determining a subject for HP eradication and for developing a drug for HP eradication. Also,
It can be applied to testing for those who want to know their own risk of infection.

[0004] Regarding HIV infection and the onset of AIDS,
It has been found that polymorphisms in the CCR5 gene are involved in infection prevention, and it is quite possible that a certain genetic polymorphism determines susceptibility in HP infection as well, from a biological standpoint. That is.

[0005] Although there are some reports on the relationship between IL-1B gene polymorphism and gastric cancer, there is no report that this polymorphism regulates susceptibility to HP infection. Only El-Omar et al.
Although there is a tendency for a certain association between the polymorphism at position 31 upstream of the transcription start site of B and susceptibility to HP infection (1), this gene is not statistically significant, and therefore, this gene has It has not been concluded that polymorphisms define susceptibility to HP infection. Therefore, there is still no report clarifying the relationship between human polymorphism and susceptibility to HP infection.

[0006]

SUMMARY OF THE INVENTION A method is provided for predicting susceptibility to HP infection. By elucidating such susceptibility, it becomes possible to determine the subject of HP eradication, and to determine the risk of genetic infection for HP infection.

[0007]

The genotype of a polymorphism is linked to the genotype of a surrounding polymorphism, and a specific polymorphism is directly involved in the expression and function of a protein that is truly produced. It is difficult to determine whether or not. However, the fact that the occurrence of a disease differs depending on the specific genotype difference strongly suggests that the gene or a gene around the gene is involved in disease development.

Thus, the present inventors have conducted intensive studies on the relationship between the genotype and the susceptibility to HP infection, and as a result,
Two genes, namely Se gene, Le gene, IL-
It has been discovered that polymorphisms present in the 1B and MPO genes define persistent susceptibility to HP (2,3,
4), which has led to the present invention.

The Se gene (secretor gen)
e) is α1, fucosyltransferra
secreted enzyme (secre, also called se (FUT2))
toenzyme (Se enzyme)), and the Le gene (Lewis gene) is α1,3 / 1,4f
eucosyltransferase (FUT3), a Lewis enzyme (Lewis enzyme (Le)
Enzyme)). The enzymes encoded by both genes are involved in the synthesis of H1-type sugar chains and Lewis b antigen, which are substances necessary for HP to contact cells of the gastric mucosa.
On the other hand, the IL-1B and MPO genes are interleukin-1β (interleuki
n1β) and myeloperoxidase (myelo)
(peroxidase).

Accordingly, the present invention provides a method for predicting genetic susceptibility to HP infection by analyzing gene polymorphisms of the above four specific genes.

When a gene polymorphism is linked to another gene polymorphism in the vicinity, the above method is indirectly carried out by analyzing the linked other gene polymorphism to predict the susceptibility of HP infection. It is possible to Therefore, in another aspect, the present invention provides a method for elucidating genetic susceptibility to HP infection by analyzing a polymorphism existing outside the gene and linked to the polymorphism. .

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.

The Se gene includes Se1, Se2, se1,
The genotypes of sej, se3, se4, and se5 are known. Se1 and Se2 are genotypes (Se) having enzymatic activity, and are se1, sej, se3, se4, s
e5 is a genotype (se) with low or no enzyme activity. In Japan, se1, se3 and se4 are hardly recognized (5).

The Le gene includes Le, le1, le2,
The genotype of le3 is known, and the enzyme activities of Le and le3 are observed (Le), and the enzyme activities of le1 and le2 are low (le).

In IL-1B, those having cytosine and those having thymine have polymorphisms of 511 bases upstream (C-511T), 31 bases upstream (C-31T),
395 bases downstream (C + 3954T), -31T
Is presumed to have high expression of IL-1B.

463 bases upstream from the transcription start point in MPO
Guanine and adenine polymorphism (G-463A)
Gene expression with known guanine base
Is estimated to be high.1. Genotyping of genetic polymorphisms  The genotypes of these polymorphisms are
e chain reaction
(6, 7, 8), the implementation of which requires special skills
It does not do.

[0017]Se gene  Shadow of pseudogene Sec1 similar in base sequence to Se gene
To eliminate the effects, first use primer 5'-CCTT
TCTCCTTTCCCATGGCCCACTTCAT
C-3 'and 5'-GGCACTCATCTTGAGGG
PCR was performed using GAGGCAGAGAA-3 '
The obtained DNA product is used as a template. Se1 or S
Since e2 is 385A and sej is 385T,
This was used as the primer 5'-AACGACTGGATGGGA.
GGAGGAATACCGCAGC-3 'and 5'-AA
GGTCCAGGAGCAGGGTAGCCGGTG
Amplified with AAG-3 'and cut with restriction enzyme AluI
The allele is determined by whether or not it is performed (9, 10). se5 is
Since this is an allele fused with Sec1, the Sec1 gene
Within the sequence 5'-TTTGGCAGGGGGTGGG
TGAAGAGACTCCTG-3 'and within the Se gene
Certain sequences 5'-GGCACTCATCTTGAGGGGA
Using GGCAGAGAA-3 'as a primer, D
Identification is performed based on whether the NA is amplified (6).

[0018]Le gene  Le (59T, 508G, 1067T), le1 (59
G, 508A, 1067T), le2 (59G, 508)
G, 1067A), le3 (59G, 508G, 106
7T) to identify T59G, G508A, T1
067A using the PCR-RFLP method
The genotype is determined (9). Primer is T59G
On the other hand, 5'-CCATGGCGCCGCTGTCTGGG
CCGCCC-3 'and 5'-AGTGGGCATCGT
For CTCGGGACACACG-3 ', G508A
5'-CTCCCGACAGGGACACCACTCC
CA-3 'and 5'-CTCAAGCTTCGTGCCG
TGATGATCTCTCTGCAC-3 ', T106
5'-CGCTCCTCTCAGCTGGGG for 7A
CACTGGA-3 'and 5'-CGGCCTCTCCA
GGTGAACCAAGAAGCT-3 'is used.
However, for T1067A, D for G508A
PCR is performed using the NA product as a template. Annie
The temperatures of the rings are 62 ° C, 76 ° C, and 60 ° C, respectively.
You. Restriction enzymes are MspI, PvuII, HindIII
Depending on whether it is cleaved by the restriction enzyme or not.
Allele is determined.

[0019]IL-1B  Using the PCR-CTPP method using four primers
I have. The primer used was F1: 5'-AATGTG
GACATCAACTGCA-3 ', R1: 5'-CT
CCCTCGCTGTTTTTATA-3 ', F2:
5'-ACTTCTGCTTTTGAAAGCC−
3 ', R2: 5'-TCAGCTGTTAGATAAG
CAG-3 ', and the site of the gene polymorphism is underlined.
I have. PCR conditions were as follows:
30 minutes at 94 ° C, 54 ° C, and 72 ° C for 1 minute each.
Repeat. Under these setting conditions, 5 for C allele
74 bp and 345 bp are 574 for T allele
 bp and 266 bp long DNA are synthesized
(3).

[0020]MPO gene  PCR-RFLP using two primers was performed.
U. The primer used is F: 5'-CGGTAG
GCACACAATGGTGAG-3 ', R: 5'-G
CAATGGTTCAAGCGATTCTTC-3 '
is there. PCR was performed at 94 ° C for 2 minutes as a progress reaction at the start.
Then repeat 94 ° C, 56 ° C, 72 ° C for 30 seconds each 35 times
You. The amplified DNA product is prepared in the presence of the restriction enzyme AciI.
Cleave by keeping the temperature at 37 ° C for 3 hours. this thing
Thus, in the G allele, 169 bp, 120 bp and
61 bp, 289 bp and 61 bp for A allele
Are generated (8).2. Grouping method based on HP infection susceptibility Grouping based on single gene polymorphism  In grouping based on Se gene polymorphism, se / se
Are classified into low-risk groups, and Se /
High squirrels with se or Se / Se genotype
Classified into groups. Group odor based on Le gene polymorphism
For those with a Le / Le genotype,
And has a genotype of Le / le or le / le
Are classified into high-risk groups. IL-1B gene polymorphism
Have a genotype of C / C
Are classified into low-risk groups and C / T or T / T genes
Classify those with a type into high-risk groups. MPO gene
In grouping based on polymorphisms, G / G genotypes
Are classified into high-risk groups, and G / A or A / A
Those having the gene type are classified into the low risk group.

[0021]Grouping based on combinations of multiple gene polymorphisms  The Se and Le genes are mediated by the same biological mechanism.
Therefore, by combining the two groups,
It is possible to precisely predict infection susceptibility.

A set of polymorphisms of Se gene and Le gene
In grouping based on matching, the se / se & Le / Le
High-risk group, Se / Se & le / l
e, Se / Se & Le / le or Se / se & le / le
Are classified into low-risk groups,
Classify the offspring into the medium risk group.3. Testing for HP infection  Methods for testing for HP infection include gastric mucosal biopsy,
Test method and measuring anti-HP antibody in blood
There is a method, but the method used in epidemiological studies is anti-HP
This is an antibody measurement method.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited thereto. In particular, the invention can be practiced with any genotyping method and should not be construed as limited to using any particular genotyping method.

[0024]

[Example] Anti-HP antibody measurement and Se gene, Le gene, and 239 non-cancer patients of Aichi Cancer Center
IL-1B and MPO gene polymorphism analysis was performed. Anti-HP
High-Molecular Weig for antibody measurement
ht Campylobacter-Associat
ed-Protein (HM-CAP) ELISA (E
electronic product; USA).
If the isa Value is 2.3 or more,
1). For the Se gene, Se (Se1 or Se1)
2), 3 types of sej and se5 were specified, and 4 types of Le, le1, le2, and le3 were determined for the Le gene. C-31T was determined for IL-1B and G-463A for the MPO gene. Table 1 shows the infection rates and relative risks for the four genotypes. In the Se gene
Se / Se is 2.84 times that of se / se, L
In the e gene, le / le is 2.80 with respect to Le / Le.
The risk of double infection was high. T / T is 2.42 times higher than that of C / C for IL-1B, and those who combined G / A (46) and A / A (2) compared to G / G for the MPO gene are statistical data. It was 0.67 times that of non-significant significance.

Since the Se gene and Le gene are mediated by the same biological mechanism, they were examined in combination (Table 2). Genotype with the lowest risk (se / se & Le /
Le) compared to high-risk groups (Se / Se & le / le,
(Se / Se & Le / le, Se / se & le / le) had a 10.2 times higher risk. IL-1B is T
In the case of / T only, the high-risk group of the Se gene and Le gene had a 17.5-fold risk of infection.

Table 3 shows the relative risk for a combination of smoking habits and the genotype of MPO. Given that the MPO is 1 for a G / G smoker, a G / G non-smoker and a G / A or A / A smoker and a non-smoker have a relative risk of less than 1 and a G / G smoker In all cases, the relative risk was 0.36, significantly (p <0.018), and the number of persistently infected individuals was small.

[0027]Conclusion  Analysis of Se and Le
Up to 10.2 times higher HP sustainability by combining children
An increased risk of staining was noted. Furthermore, the T / T type of IL-1B
In the case of the individual, the value showed a difference of 17.5 times. MP
If the smoker whose O-463 is G / G is 1, the others are
It was noted that the risk was reduced by about one third. this
Four genes determine susceptibility to HP infection
It has been found.

[0028]

EFFECT OF THE INVENTION Se gene, Le gene, IL-1B,
By determining the polymorphism of the MPO gene, HP
Infection susceptibility can be predicted. In addition, the analysis of the susceptibility to persistent infection can be applied to the determination of a subject for HP eradication and drug discovery of an HP eradication agent.

[0029]

[Table 1]

[0030]

[Table 2]

[0031]

[Table 3]

[0032]

[References] 1) El-Omar EM, Carrington M, Chow W-
H, McColl KEL, Bream JH, Young HA, Herrera J, L
issowska J, Yuan CC, Rothman N, Lanyon G, Martin
M, Fraumeni JF Jr, Rabkin C S. Interleukin-1 poly
morphisms associated with increased risk of gastri
c cancer.Nature 404: 398-402, 2000.2) Ikehara Y, Nishihara S, Yasutomi H, Kitamura T,
Matsuo K, Simizu N, Inada K, Kodera Y, Yamamura
Y, Narimatsu H, Hamajima N, Tatematsu M. Polymorph
ism of the two fucosyltransferase genes (Lewis and
Secretor gene) involving type I Lewis antigens af
fect Helicobacter pylori infection riskdefined by
the presence of anti-Helicobacter pylori IgG antib
ody (posting) 3) Hamajima N, Matsuo K, Saito T, Tajima K, Okuma
K, Yamao K, Tominaga S. Interleukin 1 polymorphism
s, lifestyle, and Helicobacter pylori infection
(Posting) 4) Hamajima N, Matsuo K, Suzuki T, Nakamura T, Mat
suura A, Tajima K, Tominaga S. Low exprssion myelo
peroxidase negatively associated with Helicobacter
pylori infection (submission) 5) Nishihara S, Kudo T, Narimatsu H: Analysis of fucose transferase mutants in humans. , Ikehara Y,
Kudo T, Nishihara S, Sugano K, Okura H, Fujita S,
Hirohashi S. Lewis and secretor gene dosageaffect
CA19-9 and DU-PAN-2 serum levels in normal individ
uals and colorectal cancer patients.Cancer Res 5
8: 512-518, 1998.7) Hamajima N, Saito T, Matsuo K, Kozaki K, Takaha
shi T, Tajima K. Polymerase chain reaction with co
nfronting two-pair primers for polymorphismgenotyp
ing. Jpn J Cancer Res 91: 865-868, 2000.8) Cascorbi I, Henning S, Brockmoller J, Gephart
J, Meisel C, Muller JM, Loddenkemper R, Roots I. Su
bstantially reduced risk of cancer of the aerodige
stive tract in subjects with variant -463 of the m
yeloperoxidase gene.Cancer Res 60: 644-649, 2000.9) Kudo T, Iwasaki H, Nishihara S, Shinya N, Ando
T, Narimatsu I, Narimatsu H. Molecular genetic ana
lysis of the human Lewis histo-blood group system.
J Biol Chem 271: 9830-9837, 1996.10) Koda Y, Soejima M, Liu Y, Kimura H. Molecular
basis for secretor type alpha (1,2) -fucosyltransfer
ase gene deficiency in a Japanese population: a fu
sion gene generated by unequal crossover responsib
le for the enzyme deficiency. Am J Hum Genet 59:34
3-350, 1996.11) Evans DJ, Evans DG, Graham DY, Klein PD.
sitive and specific serologic test for detection o
f Campylobacter pylori infection.Gastroenteology
96: 1004-1008, 1989.

 ──────────────────────────────────────────────────続 き Continuing from the front page (71) Applicant 501028781 Masae Tatematsu 1-1-1 Kagono, Chigusa-ku, Nagoya-shi, Aichi Prefecture Inside the Aichi Cancer Center Research Institute (71) Applicant 501028840 Shoko Nishihara 1-chome Tangicho, Hachioji-shi, Tokyo 236, Soka University Life Science Research Institute (72) Inventor Nobuyuki Hamashima 1-1, Kago-dono, Chigusa-ku, Nagoya-shi, Aichi Prefecture In-house Aichi Cancer Center Research Institute (72) Inventor Joru Ikehara 1, Kago-dono, Chigusa-ku, Nagoya, Aichi No. 1 In Aichi Cancer Center Research Institute (72) Inventor Masae Tatematsu 1-1-1 Kagoden, Chigusa-ku, Nagoya-shi, Aichi Prefecture In-house Aichi Cancer Center Research Institute (72) Inventor Shoko Nishihara 1-chome Tangicho, Hachioji-shi, Tokyo 236 F-term in Soka University Life Science Institute (reference) 4B024 AA13 CA01 CA03 HA08 HA12 HA1 5 4B063 QA01 QA07 QA12 QA19 QQ23 QQ43 QR32 QR40 QR55 QR62 QS25 QS34

Claims (3)

[Claims] 1. A method for predicting susceptibility to Helicobacter pylori, which comprises determining polymorphisms of Se gene, Le gene, IL-1B or MPO gene alone or in combination. 2. The method according to claim 1, wherein the subjects are classified into a high-risk group and a low-risk group, or a high-risk group, a medium-risk group and a low-risk group, based on the genetic polymorphism.
The method described in. 3. Se gene, Le gene, IL-1 for predicting susceptibility to Helicobacter pylori
A method for determining a polymorphism in the B or MPO gene.