JP2002191368A - Ribozyme for detecting gene sequence - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a ribozyme with which the presence of a target base sequence in a sample can be detected and ribozyme activity can be adjusted. SOLUTION: This hairpin type ribozyme is characterized in that the ribozyme is activated by the change of a stem loop three-dimensional structure by hybridization with an oligonucleotide.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a hairpin-type ribozyme activated by a change in the three-dimensional structure of a stem-loop by hybridization with an oligonucleotide, a DNA encoding a ribonucleotide constituting the ribozyme, and a DNA encoding the ribozyme. The present invention relates to a recombinant vector containing the same, a host cell into which the recombinant vector has been introduced, a method for detecting a target nucleotide sequence by the above ribozyme, and the like.

[0002]

It has been found that the plus strand of satellite RNA of tobacco ring spot virus and the plus and minus strand RNA of avocado sandwich viroid are cleaved by their own catalytic activity in the presence of Mg ^2+. [Prody, GA et al., (1986) Science 231 , 1577-1580.
And Hutchins, CJ et al., (1986) Nucleic AcidsRe
s. 14 , 3627-3640]. The nucleotide sequences around the cleavage site of these RNAs have commonality, and the secondary structure of these RNAs was predicted from this commonality. Uhlenbeck designed a 19-mer short RNA fragment based on these consensus sequences,
A has been shown to cleave A catalytically [Uhlenbeck, OC
(1987) Nature 328 , 596-600].

[0003] In addition, satellites of viroids and viruses
Transcripts of newt satellite DNA as well as RNA have been reported to have the nucleotide sequence of this ribozyme [Epstein, LM and Gall, JG (1987) Cel
l, 48 , 535-543]. It was found that when two 21-mer RNAs having nucleotide sequences around the cleavage site of this newt satellite DNA transcript were chemically synthesized and the other was added to one of the RNAs, a cleavage reaction occurred at the same site as that of nature. [Koizumi, M. et al., (1988) FEBS Lett.
228 , 228-230]. Furthermore, based on this result, a method for cleaving other RNA or polyribonucleotide molecules using ribozymes has been developed [Koizumi, M. et al., (198
9) Nucleic Acids Res. 17 , 7059-7071].

On the other hand, it has been revealed that the minus strand of the satellite RNA of tobacco ring spot virus also causes a cleavage reaction and causes cleavage at a specific site [Bu
Zayan, JM et al., (1986) Nature 323 , 349-353].
The minimum region of RNA required for this cleavage has also been identified [Hampel, A. and Tritz, R. (1989) Biochemis
try, 28 , 4929-4933]. RNA with this catalytic activity is 5
A model consisting of 0 nucleotides and having a hairpin loop structure in this RNA was proposed and named a hairpin ribozyme. By converting the nucleotides of this hairpin ribozyme to other nucleotides, several nucleotides important for the cleavage reaction have been identified [Chowrira, BM et al. (1991) Nature 354 , 320-
322 and Sekiguchi, A. et al. (1991) Nucleic Acids R
es. 19 , 6833-6838]. Burke's group also
In vitro selection using DNA (PCR) with random nucleotide sequence (in vitro selec
method) has revealed nucleotide sequences important for hairpin ribozyme cleavage and ligation [Berzal-Herranz, A. et al. (1992) Gene & Development
6 , 129-134]. In addition, the hairpin loop was deleted
It has also been shown that catalytic reactions proceed with RNA [Sekiguchi, A. et al. (1991) Nucleic Acids Res. 19 ,
6833-6838]. Koizumi et al. Have also found that by converting the hairpin loop of a hairpin-type ribozyme into a thermodynamically stabilized sequence, the ribozyme becomes more active than the conventional type [Japanese Patent Laid-Open No. 6-1817].
No. 58].

Further, Komatsu et al. Reported that a hydroxyl group at the 5 'end of a substrate and a short chain of a double-stranded hairpin-type ribosome were synthesized via a linker obtained by repeating propanediol phosphate one to thirteen times. 'The RNA with the terminal hydroxyl group was synthesized. Examination of the cleavage activity of these RNAs revealed that the combination of the substrate and one strand of the ribozyme had more activity than the native form by repeating propanediol phosphate seven or more times. This indicates that the hairpin-type ribozyme has a bent structure between the second helix and the third helix among the four helices [Komatsu, Y. et al., (1)
994) J. Am. Chem. Soc. 116 , 3602]. Otsuka et al. Changed the binding position of the hairpin-type ribozyme domain while maintaining the folded higher-order structure of the hairpin-type ribozyme shown here (by replacing the catalytically active domain and the substrate-binding domain with the multimeric polyribozyme). Attempts to bind at positions of helix 1 and helix 4 via nucleotides) have found that polyribonucleotides still have high ribozyme activity even when the binding position of the domain is changed [ JP-A-8-131163].
Komatsu et al. Constructed a three-domain ribozyme consisting of a hairpin-type ribozyme, which consists of a catalytically active domain and a substrate-binding domain, and another cleavage domain. This ribozyme self-cleaves during transcription. Have been found to have a self-trimming activity [JP-A-10-215876].

[0006] On the other hand, attempts have been made to cleave RNAs involved in diseases by artificially expressing ribozymes in cells [for example, Bratty, J. et al., (1993) Bioch.
im. Biophy. Acta 1216 , 345-359]. In such a case, a method of administering as a DNA encoding a ribozyme or a method using a retroviral vector is employed. In any of the methods, a system for expressing a ribozyme gene under the control of a mammalian promoter is used.

Furthermore, the present inventors have already reported that an externally added oligonucleotide can bind to a hammerhead ribozyme and activate it by forming a pseudo-half-knot structure [Komatsu et al.,
J. Mol. Biol., 2000].

[0008]

In view of the above background, the present inventors have developed a hairpin ribozyme (FIG. 1) which is a different type of ribozyme from the hammerhead ribozyme.
Various studies were conducted for the purpose of conversion to be activated by the addition of oligo.

The natural hairpin ribozyme is composed of two domains as shown in FIG. 1, and the RNA is cleaved at the site indicated by the arrow. Domain I is helix 1, helix 2
Domain II consists of helix 3, helix 4 and inner loop B. The four helices are important for base pairing, but can be converted to other bases. On the other hand, the two inner loops consist essentially of bases essential for cleavage activity. JP-A-6-181758
The technology described in Japanese Patent Application Publication No. H11-115,087 is a thermodynamic stabilization of a hairpin loop corresponding to helix 4 of this hairpin-type ribozyme, and the activity of the ribozyme is not always controlled by an externally added nucleic acid, but is always controlled by a ribozyme. Is in an activated state. Therefore, there is a problem that it cannot be used for gene detection. Similarly, the technique described in Japanese Patent Application Laid-Open No. H10-215876 also forms an helix 4 structure, and thus does not have a form in which activity can be controlled, but always forms an activated structure.

It is an object of the present invention that a ribozyme alone does not cause a self-cleavage reaction, but the structure of the ribozyme changes from an inactive type to an active type by binding of an oligonucleotide having a target nucleotide sequence to the ribozyme, An object of the present invention is to provide a ribozyme exhibiting RNA-cleaving activity and a method for cleaving polyribonucleotides using the ribozyme.

[0011]

The present invention provides a polyribonucleotide (hereinafter, referred to as "ribozyme") having a cleavage activity for the first time in the presence of an oligonucleotide and a method for cleaving a substrate polyribonucleotide using the polynucleotide. To provide.

The present inventors have proposed that the hairpin type ribozyme alone is inactive, but by binding to an oligonucleotide added from the outside, the hairpin loop is converted so that the ribozyme is activated, and the ribozyme is converted. The present inventors have found that the activity can be controlled by polyribozyme nucleotides, and have completed the present invention. FIG. 2 shows an example of ribozyme activation of the inactive structure before oligonucleotide binding and the activated structure after oligonucleotide binding.

That is, the present invention provides the following (1) to (2)
1) is provided. (1) A hairpin ribozyme which is activated by a change in a three-dimensional stem-loop structure due to hybridization with an oligonucleotide. (2) The above (1), wherein the hybridization with the oligonucleotide is composed of 3 to 23 base pairs.
The hairpin-type ribozyme according to [1]. (3) The hairpin ribozyme according to (1) or (2), wherein the oligonucleotide is a part of a target base sequence. (4) The hairpin ribozyme according to any one of the above (1) to (3), which is a cis-type ribozyme and is first cleaved by activation. (5) The hairpin ribozyme according to the above (4), which has a complex structure with an oligonucleotide represented by the general formula (I) or (II).

[0014]

Embedded image

[In the formula, α1 represents a ribozyme, and β represents an oligonucleotide sequence. U is a uracil nucleotide, C is a cytosine nucleotide, A is an adenine nucleotide, G is a guanine nucleotide, and B1 to B
h, E1 to Ep, H1 to H4, Q1 to Q5, W1 to Wn, X1 and X2 are the same or different and each represents any of uracil nucleotides, adenine nucleotides, cytosine nucleotides or guanine nucleotides;
p, J1 to J4, R1 to R5, and Y1 to Yn are each E1
Represents nucleotides complementary to Ep, H1 to H4, Q1 to Q5, and W1 to Wn, S represents either an adenine nucleotide or a cytosine nucleotide, and P represents a uracil nucleotide, an adenine nucleotide, a cytosine nucleotide or a guanine nucleotide. Represents either, L
Represents a uracil nucleotide, an adenine nucleotide or a cytosine nucleotide; V represents an adenine nucleotide when S is a cytosine nucleotide; and represents a uracil nucleotide or a cytosine nucleotide when S is an adenine nucleotide. , H is an integer of 3 to 20, n is an integer of 1 to 10, and p is an integer of 1 to 10). ]

[0016]

Embedded image

[Wherein α2 represents the sequence of a ribozyme and β represents the sequence of an oligonucleotide. Symbols in the formula are general formulas
It has the same meaning as (I). (6) The hairpin ribozyme according to the above (1) or (2), which is a trans ribozyme and cleaves another ribonucleotide sequence upon activation. (7) The hairpin ribozyme according to claim 6, wherein the complex structure with an oligonucleotide is represented by the general formula (III).

[0018]

Embedded image

Wherein γ represents the sequence of a ribozyme and β represents the sequence of an oligonucleotide. U is a uracil nucleotide, C is a cytosine nucleotide, A is an adenine nucleotide, G is a guanine nucleotide, B1 to Bh,
F1-Fp, J1-J4, K1-Km, Q1-Q5, W1-Wn,
X1 and X2 are the same or different and each represents any of a uracil nucleotide, an adenine nucleotide, a cytosine nucleotide and a guanine nucleotide;
1 to R5 and Y1 to Yn are Q1 to Q5 and W1 to
Represents a nucleotide complementary to Wn, S represents either an adenine nucleotide or a cytosine nucleotide,
h is an integer of 3 to 20, m is an integer of 1 to 10, n is 1 to 1
An integer of 0, and p represents an integer of 1 to 10). ]

(8) A DNA encoding a ribonucleotide constituting the hairpin ribozyme according to any one of (1) to (7). (9) A recombinant vector containing the DNA according to (8). (10) A host cell into which the recombinant vector according to (9) has been introduced. (11) A method for activating a hairpin ribozyme, comprising changing a stem-loop three-dimensional structure by hybridization of an oligonucleotide and an inactivated ribozyme. (12) The method for activating a hairpin ribozyme according to (11), wherein one or more nucleotides of the oligonucleotide are 2′-O-methylated.

(13) The method for detecting a target nucleotide sequence using a hairpin ribozyme according to any one of the above (1) to (7). (14) The detection method according to the above (13), wherein the presence of a target base sequence in a sample contained on a DNA chip is detected. (15) A method for detecting a target base sequence, comprising detecting a fragment cleaved by self-cleavage of the hairpin ribozyme according to any of (1) to (5). (16) The detection method according to any one of (13) to (15), wherein the cleavage fragment is detected using a fluorescent dye or a radioactive label.

(17) A kit for detecting a target base sequence in a sample, comprising the hairpin ribozyme according to any one of (1) to (7). (18) A method for cleaving a ribonucleotide sequence, comprising using the hairpin ribozyme according to any one of (1) to (7). (19) The cleavage method according to (18), wherein the hairpin ribozyme according to any one of (1) to (7) and the oligonucleotide are separately administered. (20) The cleavage method according to the above (17) or (18), wherein one or more nucleotides of the oligonucleotide are 2′-O-methylated. (21) A pharmaceutical composition comprising the hairpin ribozyme according to any one of (1) to (7).

According to the present invention, by designing the α1 chain or α2 chain to the sequence shown in the general formula (I) or (II) according to the sequence of the β chain in the general formula (I) or (II), A ribozyme that causes a self-cleaving reaction in a β-chain sequence-specific manner can be designed, and the β-chain sequence can be detected by examining the cleaved fragment or the activated ribozyme. In general formulas (I) and (II), the enzyme site and the reaction site to be cleaved are present in the same chain (cis reaction), but the site to be cleaved is present in a chain different from the enzyme ( Also in III), the formation of a complex between the β chain and the γ chain induces sequence-specific cleavage of a ribonucleotide chain capable of binding to the γ chain (trans reaction). At this time, the complex formed between the β chain and the γ chain can be cleaved by enzymatically acting on the excess ribonucleotide chain. Therefore, by designing γ and β chains of the general formula (III) that cleave the mRNA of the target gene that causes the disease, the activity of the ribozyme that cleaves the target mRNA is induced by the addition of the β chain It becomes possible. Further, by changing the combination of the β and γ chains, it becomes possible to regulate the activity of a plurality of activity-inducing ribozymes by adding specific β chains.

In the present invention, a cleavage reaction that occurs at a sequence near the 3 ′ end of the ribozyme body by binding to an oligonucleotide is called “self-cleavage”. The gene sequence-detecting ribozyme of the present invention causes self-cleavage when the target oligonucleotide is present in a sample or the like, but this reaction occurs not only in a test tube but also in a test tube.
It also has the ability to specifically cause self-cleavage by binding to polyribonucleotides having a target nucleotide sequence generated in cells. Therefore, plants,
It is possible to detect a polyribonucleotide having a target sequence regardless of the animal or human body.

The present invention also provides a DNA containing a nucleotide sequence transcribed into the above-mentioned "gene sequence-detectable ribozyme" by an RNA polymerase reaction, a recombinant vector containing the DNA, and a host cell carrying the vector. It is. By incorporating the vector into the cell, the cell becomes capable of specifically cleaving the desired polyribonucleotide. The target cell may be any plant, animal or human body.

[0026]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in more detail. The present invention provides a hairpin ribozyme which is activated by a change in the three-dimensional structure of a stem-loop caused by hybridization with an oligonucleotide. In the present specification, hereinafter, unless otherwise indicated, the term “oligonucleotide” refers to an oligonucleotide that changes the three-dimensional stem-loop structure of the hairpin ribozyme of the present invention. The oligonucleotide may be part of a longer base sequence,
Preferably, those having a chain length of 5 to 15 can be suitably used.

As described above, a ribozyme has a stem-loop structure as shown in FIG. 1, and it is known that its activity is maintained by this three-dimensional structure. In the present invention, the term “change of the stem-loop three-dimensional structure” refers to a nucleotide that has hybridized in a molecule alone (in the absence of an oligonucleotide) and formed a stem, and / or a nucleotide in the vicinity thereof, By hybridizing with an oligonucleotide of a specific sequence,
It means that it is no longer able to hybridize within the molecule and forms a loop, so that it takes on a three-dimensional structure different from the three-dimensional structure in the absence of the oligonucleotide. This change in three-dimensional structure is determined by which of the three-dimensional structures during intramolecular hybridization in the absence of the oligonucleotide and the three-dimensional structure during hybridization with the oligonucleotide is energetically stable. Is done. That is, in the oligonucleotide that changes the stem-loop three-dimensional structure of the hairpin ribozyme, the complex formed by hybridization with the ribozyme is more complex than the state where intramolecular hybridization is formed in the absence of the oligonucleotide. What is necessary is just a thing which is complementary to a ribozyme to the extent that it has a stable structure. Hybridization between an oligonucleotide and a ribozyme suitable for activating the hairpin ribozyme of the present invention varies depending on the sequence of a domain required for ribozyme cleavage activity, but varies from 3 to 23 base pairs. , Preferably 5 to 15, more preferably 7 to 12 base pairs.

In one embodiment of the present invention, the oligonucleotide is a target nucleotide sequence for detection or a part thereof. In this embodiment, the oligonucleotide is a DNA
Alternatively, it may be any of RNA, and one or more nucleotides may be modified such as methylated. In this embodiment, in the sample or in the DN
The presence or absence of the oligonucleotide on the A chip or the like can be detected using the ribozyme cleavage activity as an index.

In this case, the ribozyme may be a cis ribozyme or a trans ribozyme. When a cis-type ribozyme is used, the ribozyme is
Activated by the presence of the target oligonucleotide, self-cleavage occurs first. Preferable examples of such cis-type ribozymes include those having a structure showing a complex structure with an oligonucleotide in the general formula (I) or (II).

[0030]

Embedded image

[In the formula, α1 represents the sequence of a ribozyme, and β represents the sequence of an oligonucleotide. U is a uracil nucleotide, C is a cytosine nucleotide, A is an adenine nucleotide, G is a guanine nucleotide, and B1 to B
h, E1 to Ep, H1 to H4, Q1 to Q5, W1 to Wn, X1 and X2 are the same or different and each represents any of uracil nucleotides, adenine nucleotides, cytosine nucleotides or guanine nucleotides;
p, J1 to J4, R1 to R5, and Y1 to Yn are each E1
Represents nucleotides complementary to Ep, H1 to H4, Q1 to Q5, and W1 to Wn, S represents either an adenine nucleotide or a cytosine nucleotide, and P represents a uracil nucleotide, an adenine nucleotide, a cytosine nucleotide or a guanine nucleotide. Represents either, L
Represents a uracil nucleotide, an adenine nucleotide or a cytosine nucleotide; V represents an adenine nucleotide when S is a cytosine nucleotide; and represents a uracil nucleotide or a cytosine nucleotide when S is an adenine nucleotide. , H is an integer of 3 to 20, n is an integer of 1 to 10, and p is an integer of 1 to 10). ]

[0032]

Embedded image

[Wherein α2 represents the sequence of a ribozyme and β represents the sequence of an oligonucleotide. Symbols in the formula are general formulas
It has the same meaning as (I). On the other hand, when a trans ribozyme is used, the ribozyme is activated by the presence of the target oligonucleotide, and cleaves another ribonucleotide sequence. Preferable examples of such trans-type ribozymes include those having a structure showing a complex structure with an oligonucleotide in general formula (III).

[0034]

Embedded image

Wherein γ represents the sequence of a ribozyme and β represents the sequence of an oligonucleotide. U is a uracil nucleotide, C is a cytosine nucleotide, A is an adenine nucleotide, G is a guanine nucleotide, B1 to Bh,
F1-Fp, J1-J4, K1-Km, Q1-Q5, W1-Wn,
X1 and X2 are the same or different and each represents any of a uracil nucleotide, an adenine nucleotide, a cytosine nucleotide and a guanine nucleotide;
1 to R5 and Y1 to Yn are Q1 to Q5 and W1 to
Represents a nucleotide complementary to Wn, S represents either an adenine nucleotide or a cytosine nucleotide,
h is an integer of 3 to 20, m is an integer of 1 to 10, n is 1 to 1
An integer of 0, and p represents an integer of 1 to 10). ]

In this case, the sequence of the ribonucleotide to be cleaved depends on the sequence of the catalytic domain of the ribozyme, and a sequence satisfying the conditions shown in the following general formula (IV) as a complex structure with an oligonucleotide and a trans-type ribozyme. It is. Those skilled in the art can determine the sequence to be cleaved according to the ribozyme sequence, and can also appropriately design the ribozyme sequence for a given ribonucleotide.

[0037]

Embedded image

[Wherein, γ represents a ribozyme, β represents an oligonucleotide, and δ represents a ribonucleotide sequence to be cleaved, respectively. Z1 to Zh (h ≦ i), E1 to Ep, and H1 to H4
Represents nucleotides complementary to B1-Bh, F1-Fp, and J1-J4 respectively, P represents any of uracil nucleotides, adenine nucleotides, cytosine nucleotides or guanine nucleotides, and L represents uracil nucleotides, adenine nucleotides or Represents any of the cytosine nucleotides, V represents an adenine nucleotide when S is a cytosine nucleotide, represents either a uracil nucleotide or a cytosine nucleotide when S is an adenine nucleotide, and i is h or more. Represents a large integer, and other symbols in the formula have the same meanings as in formula (III)). ]

In the above general formulas (I), (II) and (III),
h is usually 3 to 20, preferably 3 to 12, and more preferably 3 to 8. Similarly, n is usually 1 to 10, preferably 3 to 8, and more preferably 3 to 6. Similarly, p is usually 1 to 10, preferably 3 to 10, and more preferably 4 to 9. Similarly, m is usually 1 to 30, preferably 1
-20, more preferably 2-5.

The cis hairpin ribozymes represented by the general formulas (I) and (II) cause a cleavage reaction at the site indicated by the arrow in the presence of the oligonucleotide. On the other hand, the trans hairpin ribozyme represented by the general formula (III) exhibits an activity of cleaving another ribopolynucleotide in the presence of an oligonucleotide.

The present invention also provides a DNA encoding a ribonucleotide constituting the above hairpin ribozyme, that is, a DNA serving as a template from which the ribonucleotide can be obtained by transcription. The hairpin ribozyme of the present invention can be constructed, for example, by the in vitro selection method (in vitro evolution method; FIG. 5) as follows.

[0042] First, the hairpin loop portion of the hairpin ribozyme (part of the N ₂₀ of FIG. 3b) to construct a template DNA to be random nucleotide sequence (loop site 19-20
To the sequences corresponding to bases at random, it is the template DNA of 4 ^twenty ribozymes), obtaining a ribozyme pool by transcription therefrom. Thereafter, the molecule having the cleavage activity by the ribozyme alone is removed (pre-selection or negative selection), and the reaction is performed by adding the target oligonucleotide to the inactive molecule by the remaining ribozyme alone, and the molecule that has caused the cleavage reaction is removed therefrom. Separate (positive selection; FIG. 5).

That is, the obtained RNA molecule is not active by the ribozyme alone, but is active in the presence of the oligonucleotide. However, in practice, it is impossible to obtain a truly allosteric molecule by one transcription, negative and positive selection, so after the positive selection, the template DNA was again obtained by reverse transcription reaction, and then the second round was performed. It is preferable to carry out transcription, negative and positive selection, and to repeat the above to concentrate active ribozymes.

When the target ribozyme sequence is known in advance, or when it is determined by the in vitro evolution method, it can be obtained by synthesis. For example,
A DNA containing a nucleotide sequence transcribed by the ribozyme of the present invention is synthesized with partial oligodeoxyribonucleotides of sense and antisense such that the sequences at both ends overlap, and then a ligation reaction by DNA ligase or a polymerase chain reaction (PCR) [Saiki, RK
Et al., (1988) Science 239 , 487-491] and by linking these partial oligodeoxyribonucleotides using a DNA polymerase reaction (FIG. 4).

The oligodeoxyribonucleotide is 5 ′
A nucleoside 3′-O-phosphoramidite in which a hydroxyl group is protected by a dimethoxytrityl group and an amino group in a base portion is protected by an acyl group (available from PerkinElmer, Amersham-Pharmacia, or Glen Research) A DNA / RNA automatic synthesizer (for example, manufactured by PerkinElmer Japan Applied Biosystems Division) can be used to synthesize a desired sequence [Koster, et al., (1984) Nucleic Acids Re.
s. 12 , 4539].

After completion of the synthesis, removal of the β-cyanoethyl group of the protecting group for the phosphate group, excision of the polynucleotide chain from the carrier, and removal of the acyl group of the base are carried out by alkali treatment, followed by acid treatment. The 5'-hydroxyl protecting group is removed. Subsequent purification by a purification operation used for ordinary nucleic acid purification, such as reverse phase and various chromatography such as ion exchange chromatography (including high performance liquid chromatography), can obtain a DNA chain. Confirmation of the nucleotide sequence of the obtained DNA,
For example, the chemical modification method of Maxam-Gilbert [Maxam, A.
M. and Gilbert, W. (1980) Methods in Enzymology
65 , 499-559] and the dideoxynucleotide chain termination method using M13 phage [Messing, J. and Vieir
a, J. (1982) Gene 19 , 269-276].

The sense and antisense strands of the oligodeoxyribonucleotide thus obtained are annealed to form a double strand, and the double-stranded DNA is ligated using DNA ligase under the control of a promoter that acts in the cell. Thus, a DNA transcribed by the ribozyme of the present invention can be constructed.

The ribozyme of the present invention is obtained, for example, by linking the DNA transcribed to the ribozyme of the present invention obtained as described above downstream of the promoter sequence of T7 RNA polymerase to ATP, CTP, GTP and UTP. In the presence of T7 RNA polymerase [Milligan, JF et al., (1987) Nucleic acid.
ic Acids Res. 15 , 8783-8798]. Other, T3R
Other known combinations of RNA polymerases and promoter sequences, such as NA polymerase and SP6 RNA polymerase, can also be used.

The ribozyme of the present invention obtained as described above can be used in the form of a salt. Examples of such salts include inorganic salts such as alkali metals such as sodium and potassium; alkaline earth metals such as calcium; ammonia; basic amino acids such as lysine and arginine; alkylamines such as triethylamine. Or an organic salt can be mentioned.

Further, the present invention provides a recombinant vector containing a DNA containing a nucleotide sequence transcribed by the ribozyme of the present invention, and a host cell into which the vector has been introduced. By introducing the vector into a host cell, the host cell of the present invention can be obtained, and at the same time, the expression vector of the present invention can be mass-produced.

Examples of the host cell and vector include the following. Prokaryotic host cells include, for example, Escherichia coli and Bacillus subti
lis). To express the gene of interest in these host cells, the host cells may be transfected with a replicon derived from a species compatible with the host cell, ie, a plasmid vector containing an origin of replication and regulatory sequences. Further, the vector preferably has a sequence capable of imparting phenotypic (phenotypic) selectivity to the transfected cells.

For example, Escherichia coli includes E. coli. coli
K12 strain and the like are often used.
Although BR322 and pUC-based plasmids are often used, the present invention is not limited to these, and any of various known strains and vectors can be used. Examples of the promoter include a tryptophan (trp) promoter, a lactose (lac) promoter, a tryptophan lactose (tac) promoter, a lipoprotein (lpp) promoter, a bacteriophage-derived lambda (λ) PL promoter, and a polypeptide chain elongation factor in Escherichia coli. A Tu (tufB) promoter and the like can be mentioned, and any promoter can be used for production of the ribozyme of the present invention.

As Bacillus subtilis, for example, 207-
25 strains are preferable, and pTUB28 [Oh
mura, K. et al. (1984) J. Biochem. 95 , 87-93].
Etc. are used, but the present invention is not limited to these. As the promoter, a regulatory sequence of the α-amylase gene of Bacillus subtilis is often used.

Eukaryotic host cells include vertebrates,
Cells such as insects and yeast can be used, and examples of vertebrate cells include mouse cells, such as NIH-3T3 cells (see (1969) J. Viol. 4 , 549-553) and monkey cells. COS cells [Gluzman, Y. (1981) Cell 23 , 175
-182] and Chinese hamster ovary cells (C
HO) dihydrofolate reductase deficient strain [Urlaub,
G. and Chasin, LA, (1980) Proc. Natl. Acad. S
USA 77 , 4216-4220] etc. are often used, but the present invention is not limited to these. As vertebrate cell expression vectors, those having a promoter, an RNA splicing site, a polyadenylation site, a transcription termination sequence, and the like, which are usually located upstream of the gene to be expressed, can be used. It may have a starting point. Examples of the expression vector include SV
PSV2dhfr [Subr with 40 early promoters
amani, S. et al. (1981) Mol. Cell, Biol. 1 , 854-864.
HTLV-IL and SV40 early promoter.
P with TR-U5-linked SRα promoter of TR
cDL-SRα [Takebe, Y. et al., (1988) Mol. Cell Bi
ol. 8 , 466-472], but the present invention is not limited to these. Also, yeast can be used as a eukaryotic microorganism. Examples of expression vectors for eukaryotic microorganisms such as yeast include, for example, an alcohol dehydrogenase gene promoter [Bennetzen, J. and Hall, BD (1982) J. Bio.
l. Chem. 257 , 3018-3025] and the promoter of the acid phosphatase gene [Miyanohara, A. et al. (1983) Pr.
Natl. Acad. Sci. USA 80 , 1-5].

By introducing the vector thus obtained, other prokaryotic or eukaryotic host cells can be transformed. Furthermore, by introducing an appropriate promoter and a sequence related to expression into these vectors, the gene can be expressed in each host cell.

As an example, when Escherichia coli is used as a host cell, an expression vector having a pBR322 origin of replication, capable of autonomous growth in Escherichia coli, and having a transcription promoter and a translation initiation signal is used. be able to. The expression vector was prepared by the calcium chloride method [Mandel, M. and Higa, A. (1970) J. Mol. Biol.
53 , 154], Hanahan's method [Hanahan, D. and
Meselson, M. (1980) Gene 10 , 63] and electroporation [Neumann, E. et al., (1982) EMBO J. 1 , 841-845] and the like. Cells transfected with the vector can be obtained.

When using COS cells as an example, the expression vector has an SV40 origin of replication, is capable of autonomous growth in COS cells, and has a transcription promoter, a transcription termination signal, and an RNA splice site. Those provided can be used. The expression vector DEAE- dextran method [Luthman, H. and Magnusson, G. (1983) Nucleic Acids Res. 11, 12
95-1308], calcium phosphate-DNA coprecipitation method [Gra
ham, FL and van der Ed, AJ (1973) Virology
52 , 456-457] and electroporation [Neumann, E .;
Et al. (1982) EMBOJ. 1 , 841-845].
The cells can be taken up, and thus cells transfected with the desired vector can be obtained.

When a CHO cell is used as a host cell, a vector capable of expressing a neo gene functioning as a G418 resistance marker together with an expression vector, for example, pRSVneo [Sambrook, J. et al., (1989) "Molec
ular Cloning: A LaboratoryManual "Cold Spring Harb
or Laboratory, NY] or pSV2-neo [Southe
rn, PJ and Berg, P. (1982) J. Mol. Appl. Gene
t. 1, co-transformed with 327-341 Reference like, G4
By selecting 18-resistant colonies, transformed cells that stably produce the ribozyme of the present invention can be obtained.

The transformed cells obtained as described above can be cultured according to a conventional method, and the ribozyme of the present invention is produced in the cells by the culture. The medium used for the culture can be appropriately selected from those commonly used depending on the host cell used. For example, in the case of Escherichia coli, a tryptone-yeast medium (Bacto-tryptone 1.6) is used.
%, Yeast extract 1.0%, NaCl 0.5
% (PH 7.0)) or a peptone medium (Difco) can be used.

In the case of COS cells, for example, RPM
I-1640 medium or Dulbecco's modified Eagle medium (DM
EM) or other medium, if necessary, fetal bovine serum (FBS)
What added the serum components, such as this, can be used.
Another embodiment of the present invention relates to a method for activating a hairpin ribozyme, which comprises changing a stem-loop three-dimensional structure by hybridization between an oligonucleotide and an inactivated ribozyme.

In this embodiment, the oligonucleotide can be used as a target nucleotide sequence, or alternatively, can be used as a ribozyme activity regulator. That is, a ribozyme which has been conventionally difficult to regulate its activity can be activated by the presence or absence of a specific oligonucleotide specific to its sequence. In this case, the oligonucleotide may be either an oligodeoxynucleotide or an oligoribonucleotide, but is preferably an oligoribonucleotide;
More preferably, the above nucleotides are 2′-O-methylated.

The change of the ribozyme of the present invention so as to exhibit the activity of cleaving RNA in the presence of a specific oligonucleotide can be confirmed, for example, by the experiments described below.

2 represented by α1 and β in the general formula (I)
A complex consisting of species of polyribonucleotide chains
The hairpin ribozyme α1 of the present invention and the oligonucleotide β desired to be detected are heated in a buffer containing a divalent metal ion. By examining the cleaved fragment of α1, the presence of β chain can be detected. At this time, a system in which oligonucleotide β was not added as a comparative experiment was also performed in parallel to determine whether α1 cleavage occurred in a β-sequence-specific manner. As the divalent metal ion, Mg ²⁺ , Ca ²⁺ , Mn ²⁺ , Pb ²⁺ or the like is preferably used. The buffer is not particularly limited as long as it is a buffer used from neutral to alkaline, but Tris-HCl buffer, glycyl-glycine-sodium hydroxide buffer and the like can be used.

The reaction temperature is preferably from 0 to 100 ° C.
Further, 30 to 50 ° C. is preferable. After a certain time, the reaction is stopped by adding ethylenediaminetetraacetic acid (hereinafter referred to as "EDTA") to the reaction solution. Further, a cleavage reaction using a complex comprising α2 and β represented by the general formula (II) is also performed in the same manner as in the general formula (I).

The present invention also provides a method for detecting a target nucleotide sequence using the hairpin ribozyme of the present invention. The target base sequence may be present in the sample, or may be immobilized on a microarray such as a DNA chip. In this embodiment, although not particularly limited, the ribozyme is preferably a cis-type ribozyme capable of self-cleaving. Suitable ribozymes include, for example, those having a structure represented by the general formula (I) or (II). In this case, the self-cleavage of the ribozyme is a step in which the ribozyme is obtained by transcription from the template DNA, which is previously labeled with a fluorescent dye, a radioisotope, or the like, and the cleavage product of the ribozyme generated by the oligonucleotide added from outside is subjected to fluorescence microscopy. A method of quantifying with an image analyzer or the like, a method of quantifying cleavage products with reversed-phase high-performance liquid chromatography (HPLC), and the like can be used.

Further, the present invention provides a kit for detecting a target base sequence in a sample, which comprises the ribozyme of the present invention corresponding to the target RNA to be detected (oligonucleotide capable of activating the ribozyme of the present invention). I will provide a. In this case, the base sequence of the ribozyme can be designed in advance according to the base sequence of the target RNA to be detected, and the ribozyme can be used properly depending on the target RNA. In the kit of the present invention, cis-type ribozymes, ribozymes themselves, and trans-type ribozymes, which are cleaved by ribozymes and labeled with a fluorescent dye or a radioisotope, can be used. By mixing the ribozyme contained in these kits with the sample, the ribozyme is activated by the RNA in the sample, causes self-cleavage, and detects the resulting change in the fluorescence intensity or wavelength of the fluorescent dye. You can confirm the existence.

The present invention further provides a kit for detecting a target nucleotide sequence in a sample, comprising a DNA chip and the hairpin ribozyme of the present invention. DNA
Chips are one of the nucleic acid analysis tools that have been rapidly used in recent years with the progress of the genome project and the development of bioinformatics (Brown, PO, Botste).
in, D. Nat Genet. 1999, 21, 33-37). In the kit of the present invention, various oligonucleotides prepared from various samples are placed on a DNA chip by means known in the art (Ramsay, G., Nature Biotech. 16, 40-44).
Can be used, but a DNA chip (Kuhara yeast cDNA chip) on which an oligonucleotide is fixed in advance can be used. In addition, the ribozyme may be either cis-type or trans-type, and it is sufficient that a fragment generated by self-cleavage or cleavage of another ribonucleotide sequence can be detected by the above-described detection method.

Further, still another embodiment of the present invention is characterized in that the hairpin ribozyme of the present invention is used.
This is a method for cleaving a ribonucleotide sequence. Using this embodiment, a specific sequence in a sample can be cleaved and a disease caused by expression or overexpression of a specific gene,
For example, it can be administered to humans or animals as a medicament for preventing or treating AIDS or cancer. In this case, the ribozyme of the present invention may be administered simultaneously with the oligonucleotide as an activity regulator, or may be administered separately from the oligonucleotide. Sequence-specific RNA
By administering a ribozyme that cleaves such a polyribonucleotide together with an oligonucleotide that can regulate its activity, it is possible to control cleavage in a site-specific manner. In this case, the oligonucleotide for controlling the activity is preferably an oligoribonucleotide, and more preferably one or more nucleotides are 2′-O-methylated.

That is, the present invention also provides a pharmaceutical composition for humans or animals containing the hairpin ribozyme of the present invention. The pharmaceutical composition of the present invention may contain, in addition to the ribozyme of the present invention, a pharmaceutically usable carrier, a buffer, a preservative, and the like, and may contain other drugs for a target disease. Is also good. The coexisting drug is not particularly limited as long as it does not affect the activity of the ribozyme. Examples of the dosage form of the pharmaceutical composition of the present invention include oral administration using tablets, capsules, granules, powders, syrups and the like, and parenteral administration using injections, drops, suppositories and the like.

Further, the DN transcribed by the ribozyme of the present invention
It is also possible to administer the recombinant vector containing A in a state of being enclosed in a carrier such as a liposome. Such liposomes include N- [1- (2,3-dioleyloxy) propyl] -N, N, N-trimethylammonium chloride (N-
[1- (2,3-dioleyloxy) propyl] -N, N, N-trimethylammon
ium chloride (DOTMA) and dioleoylphosphatidyl ethanol
lipofectin (manufactured by Gibco BRL) or lipopolyamine [Beh
r, JP et al., (1989) Proc. Natl. Acad. Sci. USA 8
6 , 6982-6986] and the like, but are not limited thereto.

The dosage of the pharmaceutical composition of the present invention varies depending on symptoms, age, body weight, etc., and usually, in the case of oral administration, it is about 0.1 mg to 1000 mg per day for an adult. It can be administered once or in several divided doses. In the case of parenteral administration, 0.1 mg to 1000 mg can be administered by subcutaneous injection, intramuscular injection or intravenous injection.

Further, by incorporating the DNA of the present invention into a suitable expression vector and administering the vector itself to a living body, it is possible to express the ribozyme in cells and obtain the effects of the present invention. Such vectors include retroviruses (Moloney murineleukemic virus [Egliti
s, NA and Anderson, WF (1988) Biotechnique
s 6, 608-614 reference], etc.), adenovirus [Hiromi Kanegae et al., Experimental Medicine (1994) 12, 316-322], adeno-associated virus door [Yukihiko Hirai, Takashi Shimada, Experimental Medicine (1994) 1
2 , 323-327] and vaccinia virus, but are not limited thereto.

[0073]

The present invention will be described in more detail with reference to the following Examples and Reference Examples, but the present invention is not limited thereto. Example 1 A hairpin-type ribozyme responsive to an oligonucleotide was constructed by an in vitro selection method (in vitro evolution method; FIG. 5) shown below (FIG. 3).

[0074] First, in order to randomly hairpin loop of the hairpin ribozyme build a template DNA to be random nucleotide sequence (sequence corresponding to the loop site 20 bases may template DNA 4 ²⁰ kinds of ribozymes ), And a ribozyme pool was obtained therefrom by a transcription reaction (FIG. 4). Thereafter, the molecule having the cleavage activity by the ribozyme alone is removed (pre-selection or negative selection), and the reaction is performed by adding the target oligonucleotide to the inactive molecule by the remaining ribozyme alone, and the molecule that has caused the cleavage reaction is removed therefrom. Separated (positive selection; FIG. 5). That is, the obtained RNA molecule is not active by the ribozyme alone, but is active in the presence of the oligonucleotide. However, in practice, it is impossible to obtain a truly allosteric molecule by one-time transcription, negative and positive selection, so that after the positive selection, the template DNA is again obtained by reverse transcription reaction, and then the second transcription is performed. , Negative and positive selections were performed, and this was repeated to concentrate active ribozymes.

After several rounds were repeated, when a ribozyme having a sufficient allosteric effect was obtained, the template DNA was cloned and its sequence was examined. FIG.
Indicates the cleavage activity of the negative and positive selections in each round.

When the sequence of 34 clones showing the allosteric effect was examined, 18 clones showed the same sequence (C
1) but the rest were single clones (Table 1). When the activity of each clone was examined, few clones showed almost no activity in the absence of the oligonucleotide, and some clones were activated about 200 to 300 times by the addition of the oligonucleotide (Table 1). The ribozyme sequence (C1) found in 18 clones also had high activation, and the ribozyme (C4) in which only one base was deleted from the C1 hairpin loop showed slightly higher activity than C1. The expected structure of the hairpin loop at the time of oligonucleotide binding of each clone is shown in FIG.

[0077]

[Table 1]

The oligonucleotide used in this in vitro selection is a 2′-O-methyl oligonucleotide (m7G 2′-OMe (GAGUGAG) rG; 3 ′ terminal G only ribonucleotide). However, for C1, all the unmethylated oligoribonucleotides (r7
G) also showed a sufficiently high activity.

From the above results, in the absence of the oligonucleotide, the internal loop B (FIG. 3) required for the activity of the hairpin ribozyme has a structure that cannot form an active structure. Has been clarified by binding to the hairpin loop, whereby the structure of the inner loop B is activated to convert to the active form. In other words, the sequence causing a structural change as shown in FIG. 8 is considered to be interesting not only for activation of the hairpin ribozyme but also as a module for transmitting an oligo sequence to an enzyme site.

Example 2 Synthesis of oligodeoxyribonucleotide Polyribonucleotide (1) (SEQ ID NO: 2) and polyribonucleotide (2) (SEQ ID NO: 4) having the following structures, whose cleavage activities are induced by oligoribonucleotides, The template DNA1 (SEQ ID NO: 1) and the template DNA2 (SEQ ID NO: 3) used to obtain by transcription were synthesized.

[0081]

Embedded image

[0082]

Embedded image

First, oligodeoxyribonucleotides described below: 5'-CGGCGAATTCTAATACGACTCACTATAGGGAAA
CAGAGAAGTCAACCAGAGAA (U1; SEQ ID NO: 5) GAGCTGGATCCAAACAGGACTGTCAGGGGGGTACCAGGTAATATACATCT
CGAGTGAGATGCAGATTGTTTCTCTGGTTGACTTCTCTG (L1; SEQ ID NO: 6); GAGCTGGATCCAAACAGGACTGTCAGGGGGGTACCAGGTAATATACATCT
CGAGTGAGATGC GATTGTTTCTCTGGTTGACTTCTCTG (L2; SEQ ID NO: 7) was synthesized. Template DNA1 from U1 and L1, U1 and L2
Thus, template DNA2 was prepared.

Each of the above oligodeoxyribonucleotides is a deoxynucleoside 3'-phosphoramidite (
Using a DNA synthesizer (Model 394A; manufactured by PerkinElmer Japan Applied Biosystems Division) as a raw material, 1 μmo was obtained from PerkinElmer Japan Applied Biosystems Division.
Synthesized on l scale.

After completion of the synthesis, U1 was treated and purified as follows. Controlled Pore Gl with concentrated ammonia water
ass), oligodeoxyribonucleotide was cut out and heated at 60 ° C. for 5 hours. After evaporating the solvent and dissolving in deionized water, column chromatography was performed on C18 silica gel (manufactured by Waters) (column size: 1.5 × 12 cm: 5-40% acetonitrile, 0.1%).
1M Triethylammonium acetate
oniumacetate (hereinafter referred to as “TEAA”) eluted with a linear concentration gradient using a solvent of an aqueous solution). Fractions having a color of dimethoxytrityl eluted with about 30% acetonitrile were collected, 2 ml of an 80% acetic acid aqueous solution was added, and the mixture was stirred for 1 hour. Acetic acid was distilled off under reduced pressure, and the aqueous layer was washed with ethyl acetate. After the solvent was distilled off, the residue was dissolved in 1 ml of sterilized water. The polyribonucleotide in this fraction was converted to reverse phase H
After fractionation by PLC, further fractionation by ion exchange HPLC,
Purified. The conditions for reverse phase HPLC were as follows:
Column: μ-bonder sphere (C-18) column Φ
3.9x150mm (manufactured by Waters) Solvent: A solution 5% acetonitrile / 0.1M TEAA
(PH 7.0); B solution 25% acetonitrile / 0.1 M TEAA (p
H7.0). Table 2 shows the conditions and retention time of the linear concentration gradient in reverse phase HPLC of U1.

[0086]

[Table 2]

L1 and L2 were synthesized by an automatic DNA synthesizer in the same manner as U1, and then electrophoresed on an 8% denaturing polyacrylamide gel. The gel was irradiated with ultraviolet light of 254 nm,
Was cut off. Gel piece is sterilized water 800
After extracting the nucleic acid from the gel piece, desalting and purifying with NAP10 (Amersham Pharmacia Biotech),
L1 and L2 were obtained.

Example 3 Preparation of Template DNA Template DNA 1 was constructed as follows. A schematic diagram of the construction is shown in FIG. L1 DNA (200 pmol) and U1 primer
(240 pmol) in T7 sequenase reaction buffer (× 5, 200
mM Tris-HCl (pH 7.5), 100 mM MgCl ₂ , 250 mM NaC
l) Add 20μl and sterile water to make a total volume of 93μl, 90 ℃
And denatured at room temperature for 5 minutes. 0.1 M dithiothreitol (hereinafter referred to as “DTT”)
μl, 25 mM dATP, 25 mM dCTP, 25 mM dG
1.5 μl each of TP and 25 mM dTTP, T7 sequenase
0.5 μl (6.5 U, Amersham Pharmacia Biotech) of DNA polymerase was added, and an extension reaction was performed at 37 ° C. for 2 hours. The reaction solution was subjected to phenol treatment and phenol / chloroform treatment, followed by ethanol precipitation, and the recovered template DNA was dissolved in 20 μl of TE buffer. The resulting template DNA is a 10% native polyacrylamide gel.
Template DNA separated and purified by (29: 1)
Was dissolved in 30 μl of 10 mM Tris-HCl buffer (pH 8.0). Template DNA2 was prepared in the same manner as template DNA1.

Example 4 Transcription reaction of polyribonucleotide (1) from template DNA1 Using template DNA1 prepared in Example 3, the following polyribonucleotide (1) was subjected to the following transcription reaction.
I got The transcription reaction was performed using AmpliScribe ^™ T7 transcription kit (Air Brown). 1 or 2, 20 ng of template DNA, T7 transcription reaction buffer (kit included) (× 1
0) 1 μl, 25 mM ATP, 25 mM CTP, 25 mM
3 μl each of GTP and 25 mM UTP, [α- ³² P] UT
0.5 μl of P, 1 μl of 100 mM DTT, and 1 μl of an AmpliScribe ^™ T7 enzyme solution (included in the kit) were mixed, and sterilized water was added to make a total volume of 10 μl, followed by reaction at 37 ° C. for 2 hours. This is RNa
se-free DNase I 0.5 μl (1 molecular biology unit)
And treated at 37 ° C. for 15 minutes, and then roughly purified by NAP5 (Amersham Pharmacia Biotech). Phenol / chloroform treatment, chloroform treatment and ethanol precipitation were performed, and the recovered RNA was dissolved in 20 μl of sterile water.

A transcription reaction was performed from template DNA2 in the same manner as template DNA1, to obtain polyribonucleotide (2). The polyribonucleotide (1) is a compound of the formula (I)
1, and the polyribonucleotide (2) is a polyribonucleotide corresponding to α2 in claim II of the present invention.

REFERENCE EXAMPLE 1 Synthesis of oligoribonucleotide that induces ribozyme activity Oligoribonucleotide (3) (GAGUGA) that binds to the hairpin loop of polyribonucleotides (1) and (2)
GG) and an oligoribonucleotide (4) (GA) in which two bases of the sequence of the oligoribonucleotide (3) are changed to a sequence that is not complementary to the polyribonucleotide (1).
GUGUCG) was synthesized, fractionated and purified as follows. Oligoribonucleotide (4) is composed of oligoribonucleotides (3) and polyribonucleotides (1) and (2).
In order to confirm the specific activation of the compound, it was synthesized as one having a small number of base pairs.

Using a ribonucleoside 3'-phosphoramidite (GLEN Research), an automatic DNA synthesizer (Applied
Oligoribonucleotides (3) and (4) were synthesized using Biosystem Model 394A). RNA fragment is 1 μmol
Synthesized on a scale. After completion of the synthesis, CPG (Controlled Pore Glass) to which the synthesized oligonucleotide was bound was treated with a mixed solution of concentrated aqueous ammonia and ethanol (3: 1 v / v) for 2 hours at room temperature, and further heated at 55 ° C. for 16 hours. The solvent was distilled off, and 1 ml of 1M TBAF (Tetrabutylammoniu) was added to the residue.
m fluoride) / THF (Tetrahydrofuran) solution and add 3
Stirred at 7 ° C. for 16 hours. 5ml of 0.1M trieth
After adding ylammonium acetate (pH 7.0), column chromatography was performed on C18 silica gel (manufactured by Waters) (column size: 1.5 × 12 cm: 5-40).
% Acetonitrile, 50 mM Triethylammonium bicarbon
elution with a concentration gradient using the solvent of the ate aqueous solution). About 3
The fractions having the color of dimethoxytrityl eluted with 0% acetonitrile are collected and 5 ml of 0.0
1N HCl was added and stirred for 1 hour. After neutralization with 0.1N aqueous ammonia, the aqueous layer was washed with ethyl acetate, and after distilling off the solvent, dissolved in 1 ml of sterilized water. The polyribonucleotide in this fraction was fractionated by reverse phase HPLC, and then fractionated by ion exchange HPLC and purified. These oligonucleotides were used in the experiments described below to be used for the ribozyme cleavage reaction. Oligonucleotide (4) was not purified by reverse phase HPLC, but was purified only by ion exchange HPLC, and was purified to high purity.

The conditions for reverse phase and ion exchange HPLC were as follows: reverse phase HPLC column: μ-bondasphere (C-18) column, Φ
3.9x300mm (Waters) Solvent: A solution 5% acetonitrile / 0.1M TEAA
(PH 7.0); B solution 25% acetonitrile / 0.1 M TEAA (p
H7.0).

Ion exchange HPLC column: TSKgel DEAE 2SW column, 4.6 × 250 mm,
Tosoh Corp. Solvent: A solution 20% acetonitrile; B solution 20 M acetonitrile containing 2M HCOONH ₄ oligoribonucleotides (3) and (4) in reverse phase and ion exchange HPLC for linear concentration gradient conditions and retention times. It is shown in Table 3.

[0095]

[Table 3]

Reference Example 2 Synthesis and Purification of 2'-O-Methyl Oligonucleotide (5) (GAGUGAGG) 2'-O-methyl oligoribonucleotide (5) having the same sequence as oligonucleotide (3) An automatic DNA synthesizer (Applied) using 2'-O-methylribonucleoside 3 'phosphoramidite (Glen Research) instead of the ribonucleoside 3' phosphoramidite (Glen Research) used for the synthesis in Example 1 Biosyste
m Synthesized and purified in the same manner as in Reference Example 1 using Model 394A). However, the 3 'end of the 2'-O-methyl oligoribonucleotide (5) was synthesized using a ribonucleoside resin so as to be a normal ribonucleoside. That is, the synthesized 2'-O-methyl oligoribonucleotide (5) is 5 '
[2'-OMe (GAGUGAG) rG] 3 '. Reversed phase and ion exchange H
The same column and solvent as those used in Reference Example 1 were used for the PLC. Table 4 shows conditions and retention times of the linear concentration gradient of oligoribonucleotide (5) in reverse phase and ion exchange HPLC.

[0097]

[Table 4]

Example 5 Polyribonucleotide (1) Cleavage Reaction in the Absence and Absence of Oligonucleotide Polyribonucleotide (1) Obtained in Example 4
(16 pmol) in buffer for cleavage reaction (× 1, 40 mM Tris-
Dissolve in 8 μl of hydrochloric acid (pH 7.5), 12 mM magnesium chloride, 2 mM spermidine trihydrochloride) and separately cleave the oligonucleotide (3), (4) or (5) (200 pmol) in a buffer for cleavage reaction. Dissolved in μl. The polyribonucleotide (1) denatured at 90 ° C. for 2 minutes and then ice-cooled is added to the oligonucleotide (3), (4) or (5), which is separately denatured by heating
μl was added and the reaction was started at 37 ° C. Samples were taken at regular intervals, and the reaction was stopped by adding to a solution (5 μl) containing 50 mM EDTA and 10 M urea. The resulting reaction mixture was electrophoresed on a 20% polyacrylamide gel containing 8 M urea to separate reaction products and unreacted products. The gel after the electrophoresis was analyzed using a bioimage analyzer (BAS2000; manufactured by Fuji Photo Film Co., Ltd.). That is, the isotope activity of the reaction product and the unreacted product was quantified, the cleavage rate was determined, and the apparent reaction rate constant k _obs was calculated. In addition, the reaction of the polyribonucleotide (1) in the absence of the oligonucleotide was carried out by the cleavage reaction buffer (x1 ) Only 8 μl was added to the polyribonucleotide (1), sampling was performed at regular intervals, and the rate constant was determined from the cleavage rate.

The complex RNA formed by the polyribonucleotide (1) and the oligonucleotide (3) is the activated gene sequence-detecting ribozyme of the present invention, and the polyribonucleotide (1) alone does not cause a cleavage reaction. Although it did not occur, RNA cleavage reaction occurred at the site indicated by the arrow by binding to oligonucleotide (3).

[0100]

Embedded image

Further, a complex RN formed of polyribonucleotide (1) and oligoribonucleotide (4)
A has a relatively weak hydrogen bond formed between two RNAs,
It was unstable and almost no cleavage reaction of polyribonucleotide (1) occurred. This is because oligoribonucleotide (4) is not completely complementary to polyribonucleotide (1), and the 5 ′ of oligoribonucleotide (4) is
Only the terminal 5 bases are derived from being complementary to polyribonucleotide (1).

[0102]

Embedded image

The complex RNA formed by the polyribonucleotide (1) and the oligoribonucleotide (5) is a complex having the structure of the present invention.
Are 5'-side 7 residues of RNA corresponding to 2'-O-methyl oligoribonucleotide. It is known that 2'-O-methyl oligoribonucleotide / RNA duplex forms a more stable duplex than RNA / RNA duplex. Therefore, polyribonucleotides of 2'-O-methyl oligoribonucleotide (1)
Was examined for induction of cleavage activity.

[0104]

Embedded image

Polyribozyme nucleotide (1) showed almost no self-cleavage reaction under the absence of oligonucleotide (3) and in the presence of oligonucleotide (4), which could not stably bind to polyribonucleotide (1). On the other hand, in the presence of the oligonucleotide (3) complementary to the polyribonucleotide (1), the polyribonucleotide (1) specifically caused a self-cleavage reaction. This indicates that the cleavage reaction of polyribonucleotide (1) specifically occurred in the presence of the oligonucleotide capable of binding to polyribonucleotide (1), indicating that the sequence can be detected. Suggests. In addition, since polyribonucleotide (1) exhibited high cleavage activity even when oligonucleotide (5) was added, the oligonucleotide that induces the activity of polyribonucleotide (1) was stable not only with RNA strand but also with ribozyme. It has been shown that 2'-O-methyl oligoribonucleotide capable of binding to is also possible. FIG. 10 shows an example.
0 min, 1 min, 3 min, 5 min, 7 min, 10 min of polyribonucleotide (1) in the absence (minus lane) and addition (plus lane) of oligonucleotide (5)
The results of denaturing polyacrylamide gel electrophoresis of the cleavage reaction for 12 minutes and 12 minutes are shown. Polyribonucleotide (1)
The cleavage fragment is not given by itself, but the cleavage reaction is specifically caused by the addition of the oligonucleotide (5).

Table 5 shows the cleavage rate constant (k) of polyribonucleotide (1) in the presence of each oligonucleotide. The 2′-O-methyl oligoribonucleotide (5) induced the cleavage activity of the polyribonucleotide (1) most efficiently. This means that 2'-O-methyl oligoribonucleotides are more stable than oligonucleotides
It seems to be derived from being able to bind with.

[0107]

[Table 5]

Example 6 Cleavage reaction of polyribonucleotide (2) in the absence and presence of oligonucleotide

[0109]

Embedded image

In the same manner as in the cleavage reaction of Example 5, using the polyribonucleotide (2) obtained in Example 4, the cleavage activity by addition of an oligonucleotide was examined. As an oligonucleotide, 2′-O-methyl oligoribonucleotide (5) showing the highest inducing activity in Example 5
Was used. Polyribonucleotide (2) (16 pmol) was cleaved with a buffer (× 1, 40 mM Tris-HCl (pH 7.
5), 8 mM of 12 mM magnesium chloride, 2 mM spermidine trihydrochloride), and oligonucleotide (5) (200 pmol) was separately dissolved in 10 μl of a buffer for cleavage reaction. Oligonucleotide (5) denatured at 90 ° C for 2 minutes and ice-cooled, followed by another heat-denatured oligonucleotide (5)
8 μl was added and the reaction was started at 37 ° C. Samples were taken at regular intervals, and the reaction was stopped by adding to a solution (5 μl) containing 50 mM EDTA and 10 M urea. The resulting reaction mixture was electrophoresed on a 20% polyacrylamide gel containing 8 M urea to separate reaction products and unreacted products. The gel after electrophoresis is analyzed using a bioimage analyzer (BAS2000; Fuji Photo Film Co., Ltd.).
(Manufactured by the company). That is, the isotope activity of the reaction product and the unreacted product was quantified, the cleavage rate was determined, and the apparent reaction rate constant k _obs was calculated (Table 6). In addition, the reaction of the polyribonucleotide (2) in the absence of the oligonucleotide was carried out by the cleavage reaction buffer (x
1) Only 8 μl was added to the polyribonucleotide (2), sampling was performed at regular intervals, and the rate constant was determined from the cleavage rate.

Polyribonucleotide (2) hardly caused a cleavage reaction by itself, but RNA cleavage reaction occurred at the site indicated by the arrow in the presence of oligonucleotide (5).

[0112]

[Table 6]

Example 7 In Examples 5 and 6, after the ribozyme transcribed from the template DNA was isolated, the cleavage reaction was examined by adding an oligonucleotide. However, the amount of cleavage products obtained in that reaction is limited to the amount of RNA provided at the start of the reaction. In addition, when RNA is used as a detection reagent due to its instability, it may be difficult to preserve it. Therefore, to increase the detection sensitivity and to investigate whether the ribozyme cleavage reaction occurs without isolating RNA after transcription,
An experiment was conducted to examine the cleavage reaction during transcription from the template DNA. A ribozyme transcribed one after another from the template DNA undergoes a cleavage reaction after binding to a coexisting oligonucleotide, so that more cleavage products can be obtained and higher sensitivity can be expected. A buffer for cleavage reaction (× 5, 200 mM Tris-hydrochloric acid (pH 7.5), 60 μm) was added to template DNA 1 or template DNA 2 (50 nmol and oligoribonucleotide (5) (600 pmol)).
M magnesium chloride, 10 mM spermidine trihydrochloride) 4
μl, 2.5 mM NTPs (ATP, GTP, CTP, UTP) 4 μl,
^{[α- 32 P] UTP 1μl,} 100 mM DTT 1 μl, was dissolved by adding an appropriate amount of sterile water, Ampliscribe T7 RNA polymerase 2
The reaction was started at 37 ° C. by adding μl to a total volume of 20 μl. At an appropriate time, 1.5 μl of the reaction solution was added to a solution (5 μl) containing 50 mM EDTA and 10 M urea to stop the reaction. The obtained reaction mixture was subjected to electrophoresis on a 10% polyacrylamide gel containing 8 M urea to separate a reaction product and an unreacted product. The gel after the electrophoresis was analyzed using a bioimage analyzer (BAS2000; manufactured by Fuji Photo Film Co., Ltd.). FIG. 11 shows the results of gel electrophoresis in which a cleavage reaction of polyribonucleotide (1) occurs specifically in a transcription reaction in the presence of oligoribonucleotide (5). That is, the isotope activity of the reaction product and the unreacted product was quantified, the cleavage rate was determined, and the apparent reaction rate constant k _obs was calculated.

In the absence of oligoribonucleotide (5), polyribonucleotide (1) or (2)
Showed almost no cleavage activity, whereas a significant cleavage reaction was confirmed in the presence of oligoribonucleotide (5).

[0115]

[Table 7]

[0116]

The activity-inducible hairpin ribozyme constructed this time is a novel ribozyme exhibiting self-cleaving activity after specifically recognizing a certain RNA sequence. The recognition site differs from the catalytically active site and is located at a remote site. When there is no externally added target RNA, the ribozyme assumes an inactive structure and does not show activity. However, in the presence of the target RNA, it binds to the RNA, changes the structure of the ribozyme to an active form, and induces cleavage activity. This novel ribozyme is an RNA with a sensor function by showing catalytic activity after sequence-specific recognition of a certain target RNA.
It is considered an enzyme. Therefore, by constructing a ribozyme that specifically identifies mRNA having the target nucleotide sequence, it is possible to convert the gene sequence into a signal for RNA cleavage of the ribozyme, which can be applied to gene polymorphism detection. It has nature. Since the present invention is a novel gene expression detection method required for conventional gene expression detection by gene immobilization, which does not require immobilization and PCR, the present invention provides a simpler detection method. There is expected.

[0117]

[Sequence List] SEQUENCE LISTING <110> DNA Chip Research Inc. Hitachi Software <120> A Ribozyme for detecting Gene Sequences <130> 12A139 <160> 7 <170> PatentIn Ver. 2.0 <210> 1 <211> 122 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 1 cggcgaattc taatacgact cactataggg aaacagagaa gtcaaccaga gaaacaatct 60 gcatctcact cgagatgtat attacctggt acccccctga cagtcctgtt <t> > RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic RNA <400> 2 gggaaacaga gaagucaacc agagaaacaa ucugcaucuc acucgagaug uauauuaccu 60 gguacccccc ugacaguccu guuu 84 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 3 cggcgaattc taatacgact cactataggg aaacagagaa gtcaaccaga gaaacaatcg 60 catctcactc gagatgtata ttacctggta cccccctgac agtcctgttt ggatccagct 120c 121c 1201 121 c 121 Artificial Sequence <220> <223> Descrip tion of Artificial Sequence: Synthetic RNA <400> 4 gggaaacaga gaagucaacc agagaaacaa ucgcaucuca cucgagaugu auauuaccug 60 guaccccccu gacaguccug uuu 83 <210> 5 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence Synthetic DNA <400> 5 cggcgaattc taatacgact cactataggg aaacagagaa gtcaaccaga gaa 53 <210> 6 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 6 gagctggatc caaacaggac tgtcagg gtaccaggta atatacatct cgagtgagat 60 gcagattgtt tctctggttg acttctctg 89 <210> 7 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 7 gagctggatc caaacaggac tgtcagggg gattc gctacct ctctggttga cttctctg 88

[Brief description of the drawings]

FIG. 1 shows the structure of a natural hairpin ribozyme.

FIG. 2 shows an example of ribozyme activation by an oligonucleotide.

FIG. 3 a. 1 shows the structure of a natural hairpin ribozyme. It is cut at the position of the arrow by the interaction of loops A and B. b. The schematic diagram of what made the hairpin loop random is shown. Lower case letters are sequences derived from the template DNA, and are derived from the sequences of restriction enzyme sites at the time of cloning.

FIG. 4 shows a procedure for obtaining a DNA containing a nucleotide sequence transcribed by the ribozyme of the present invention by synthesis.

FIG. 5 shows the procedure of the in vitro selection method used in the present invention.

FIG. 6 shows the negative and positive selection cleavage rates and the time of each reaction in each round of in vitro selection. Preselection 2 represents the second preselection.

FIG. 7 shows a predicted structure of a hairpin loop at the time of oligonucleotide binding of each clone having the ribozyme activity of the present invention.

FIG. 8 shows the change of the stem-loop three-dimensional structure of the hairpin ribozyme of the present invention from an inactive form to an active form.

FIG. 9: Template encoding polyribonucleotide (1)
1 shows a construction diagram of DNA.

FIG. 10 shows autoradiography of the cleavage reaction of polyribonucleotide (1) in the absence and presence of oligonucleotide (5).

FIG. 11 shows a self-cleavage reaction of polyribonucleotide (1) generated during transcription from template DNA 1 in the presence and absence of oligonucleotide (5).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/15 C12N 1/19 4C086 1/19 1/21 1/21 9/00 5/10 C12Q 1 / 68 A 9/00 C12N 15/00 ZNAA C12Q 1/68 5/00 A (72) Inventor Eiko Otsuka 134th Kobe-cho, Hodogaya-ku, Yokohama, Kanagawa Prefecture F-Term in DIP Chip Research Laboratories Co., Ltd. 4B024 AA01 AA11 BA07 CA05 GA11 HA14 HA20 4B029 AA23 BB16 4B050 CC03 DD20 LL01 LL03 4B063 QA01 QQ42 QQ53 QR01 QR32 QR55 QR62 QS26 QS32 QX02 4B065 AB01 CA27 CA44 CA46 4C086 AA01 AA02 EA16 MA01 MA04 NA33 ZB26

Claims (21)

[Claims] 1. A hairpin ribozyme which is activated by a change in a three-dimensional stem-loop structure due to hybridization with an oligonucleotide. 2. The hairpin ribozyme according to claim 1, wherein the hybridization with the oligonucleotide is composed of 3 to 23 base pairs. 3. The hairpin ribozyme according to claim 1, wherein the oligonucleotide is a part of a target base sequence. 4. The hairpin ribozyme according to any one of claims 1 to 3, which is a cis ribozyme and is first cleaved by activation. 5. The hairpin ribozyme according to claim 4, which has a complex structure with an oligonucleotide represented by the general formula (I) or (II). Embedded image [In the formula, α1 represents the sequence of a ribozyme, and β represents the sequence of an oligonucleotide. U is uracil nucleotide, C is cytosine nucleotide, A is adenine nucleotide, G
Represents a guanine nucleotide; B1 to Bh, E1 to Ep, H1 to H4, Q1 to Q5, W1 to W
n, X1 and X2 are the same or different and each represents a uracil nucleotide, an adenine nucleotide, a cytosine nucleotide or a guanine nucleotide; F1 to Fp, J1 to J4, R1 to R5, and Y1 to Yn are E1 to Ep, respectively. , H1 to H4, Q1 to Q5, and W1 to Wn represent nucleotides complementary to each other, S represents any of adenine nucleotides or cytosine nucleotides, and P represents any of uracil nucleotides, adenine nucleotides, cytosine nucleotides, or guanine nucleotides. L represents either a uracil nucleotide, an adenine nucleotide or a cytosine nucleotide; V represents an adenine nucleotide when S is a cytosine nucleotide; and a uracil nucleotide when S is an adenine nucleotide. Other represents either cytosine nucleotides, h is an integer of 3 to 20, n is an integer of from 1 to 10, p is 1 to 1
Each represents an integer of 0). ] [In the formula, α2 represents a ribozyme and β represents an oligonucleotide sequence. The symbols in the formula have the same meaning as in formula (I). ] 6. The hairpin ribozyme according to claim 1, which is a trans ribozyme and cleaves another ribonucleotide sequence upon activation. 7. The hairpin ribozyme according to claim 6, wherein the complex structure with an oligonucleotide is represented by the general formula (III). Embedded image [Wherein, γ represents the sequence of the ribozyme, and β represents the sequence of the oligonucleotide. U is uracil nucleotide, C is cytosine nucleotide, A is adenine nucleotide, G is guanine nucleotide, B1 to Bh, F1 to Fp, J1 to J4, K1 to Km, Q1 to Q5,
W1 to Wn, X1 and X2 are the same or different and each represents a uracil nucleotide, an adenine nucleotide, a cytosine nucleotide or a guanine nucleotide; R1 to R5 and Y1 to Yn are Q1 to Q5 and W1 respectively;
Represents a nucleotide complementary to ~ Wn, S represents either an adenine nucleotide or a cytosine nucleotide, h is an integer of 3 to 20, m is an integer of 1 to 10, n is 1 to 1
An integer of 0, and p represents an integer of 1 to 10). ] 8. A DNA encoding a ribonucleotide constituting the hairpin ribozyme according to any one of claims 1 to 7. 9. A recombinant vector containing the DNA according to claim 8. A host cell into which the recombinant vector according to claim 9 has been introduced. 11. A method for activating a hairpin ribozyme, comprising changing a three-dimensional stem-loop structure by hybridization of an oligonucleotide and an inactivated ribozyme. 12. The method for activating a hairpin ribozyme according to claim 11, wherein one or more nucleotides of the oligonucleotide are 2′-O-methylated. 13. A method for detecting a target base sequence using the hairpin ribozyme according to claim 1. 14. A method for detecting the presence of a target base sequence in a sample contained on a DNA chip,
The detection method according to claim 13. A method for detecting a target base sequence, comprising detecting a fragment cleaved by self-cleavage of the hairpin ribozyme according to any one of claims 1 to 5. 16. The detection method according to claim 13, wherein the cleavage fragment is detected by a fluorescent dye or a radioactive label. A kit for detecting a target base sequence in a sample, comprising the hairpin ribozyme according to any one of claims 1 to 7. 18. A method for cleaving a ribonucleotide sequence, comprising using the hairpin ribozyme according to any one of claims 1 to 7. 19. The method according to claim 18, wherein the hairpin ribozyme according to any one of claims 1 to 7 and the oligonucleotide are separately administered. 20. The method according to claim 17, wherein one or more nucleotides of the oligonucleotide are 2′-O-methylated. 21. A pharmaceutical composition comprising the hairpin ribozyme according to any one of claims 1 to 7.