JP2002171992A - Method and kit for detecting target nucleic acid - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method and a kit for simply and simultaneously detecting plural polymorphisms in chromosome or gene of a same sample. SOLUTION: This method detects the existence of a target nucleic acid having a specific sequence comprising a first region, the target part and a second region in the order from the 5'-side. This method mixes the sample nucleic acid with a first oligonucleotide having a complementary sequence to the first region on the 3'-end side, a flap part having a noncomplementary sequence to the second region on the 5'-end side and the 5'-end fixed on a support and a second oligonucleotide having a sequence complementary to the second region, and washing the support after reacting a protein having the 5'-nuclease sensitivity to recognize and break a local triple helix, and then annealing the flap part with a third oligonucleotide having a sequence projecting the 3'-end side by annealing and then detects extension of the first oligonucleotide by a polymerase reaction using the third oligonucleotide as a template.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method and a kit for detecting the presence of a target nucleic acid having a specific sequence. The method and kit of the present invention provide a simple and rapid method for detecting a genetic polymorphism, and are useful in the fields of biology, medicine, and medical care.

[0002]

2. Description of the Related Art Genetic polymorphisms have recently attracted attention in the fields of biology, medicine and medicine. Until now, in various genetic diseases in which the effects of genetic changes on individuals are clear, differences in the nucleotide sequences of normal and abnormal genes and the discovery of a clear causal relationship between genetic diseases and the worldwide genome The nucleotide sequence analysis project has revealed that even in individuals without genetic diseases, the nucleotide sequence is integrated and differs in many sites.

[0003] Since this difference does not directly cause a disease, it is not referred to as a genetic abnormality but as a genetic polymorphism. The effect of genetic polymorphism on individuals is
Although it depends on future research, it is considered to be a factor that causes differences among individuals such as the susceptibility of individuals to disease and the efficacy of drugs. A simple and rapid method for detecting molds is needed.

[0004] Genetic polymorphism includes the following (a) gene sequences:
One base replaced by another (single
nucleotide polymorphism (SNP), (b) those that have deletions or insertions of several tens, sometimes thousands, of bases,
And (c) those having different numbers of repetitive sequences having two to several tens of bases as one unit.

[0005] Until now, (b) and (c) have relatively large gene changes compared to (a), so comparison between individuals is easy, and there have been many research reports relating to diseases.
In (a), except for the restriction fragment length polymorphism (RFLP), it was common to carry out by a nucleotide sequencing method (DNA sequence). For DNA sequencing, a fragment of the gene of interest is taken out, an enzymatic reaction, generally a Sanger reaction using PCR is performed, and it is loaded into a device such as a DNA sequencer.
Analyze using gel electrophoresis. SNP detection only needs to detect a single base difference, but DNA sequences were originally designed for the purpose of testing several hundred to 1,000 bases of a gene fragment in a single reaction in order from the end. I have. For this reason, the reaction is complicated, contains a lot of information unrelated to the result, and there is much waste in cost and time to detect SNP.

[0006] As a method of analyzing SNP, the above-described RFLP is used.
However, this does not work if the SNP on the gene was not located at a restriction site. Alternatively,
Template, announced in 1997 by Pui-Yan Kwok et al.
-directed Dye-terminator Incorporation method (Chen, X.
et al., Proc. Natl. Acad. Sci. USA, 20, 10756-107.
61 (1997)) and the Dye-labeled Oligonucleotide Iigation method also published in 1998 by Pui-Yan Kwok et al. (Chen, X. et al., Genome Res., 5, 549-556 (199)
8)), Mole developed in 1996 by Sanjay Tyagi et al.
cular Beacons method (Tyagi, S. et al., Nat. Biotechno
l., 1, 49-53 (1998)), 1 by W. Mathias Howell et al.
Dynamic Allele-Specific Hybridiza announced in 999
Option method (Howellm, WM et al., Nat. Biotechnol., 1,
87-88 (1998)), all of which involve the amplification of genes using PCR, and the complicated operation of PCR and purification after PCR.
Not suitable.

As a method without using PCR, it was developed in 1994 by Mats Nisson et al. (Nilsonm, M. et al., Scienc.
e, 5181, 2085-2088 (1994)), and the Padlock probe method improved by Paul M. Lizardi et al. (Lizardi, P. et al., Nat. Ge)
net., 3, 225-232 (1998)) and the Invader Assay method developed by Victor Lyamichev et al. (WO94 / 29482).
No.). The Padlock probe method requires three kinds of enzymes, a DNA ligase, a polymerase, and a restriction enzyme, and is detected using electrophoresis, as in the case of the sequence. Also, Invader Assa
The y method comprises a first oligonucleotide complementary to a first portion of a target nucleic acid, and a second oligonucleotide, wherein a region is complementary to a second portion of the target nucleic acid; Providing said second oligonucleotide, wherein the non-complementary region of the second oligonucleotide provides a single-stranded arm at its 5 'end, comprising a target nucleic acid, said first oligonucleotide and said second oligonucleotide; Mixing the nucleotides under conditions such that the 3 'end of the first oligonucleotide and the second oligonucleotide anneal to the target DNA sequence to produce a first cleavage structure; At the site where the cleavage of the structure is located within the second oligonucleotide, the first and second oligonucleotides are placed on the target nucleic acid. It provides cleavage means under conditions such occurs preferentially in the form that depends on-ring, depending on the presence or absence of cleavage of the second oligonucleotide, a method for detecting the presence of a specific target DNA molecules (WO9
4/29482).

[0008] The Invader Assay method is a simpler method than other methods and is effective for discriminating polymorphisms at one specific site from multiple samples (SNP typing). It is not suitable for simultaneously detecting multiple sites or multiple sites in a chromosome. That is, in any of the methods described above, it is necessary to form one reaction system for the detection of one SNP. Specifically, a plurality of SNs in a sample are required.
To test P, it is necessary to prepare reaction systems for the number of SNPs to be tested.

As a method for simultaneously detecting SNPs at a plurality of sites in one sample, a DNA microarray can be considered. Methods for detecting SNPs on microarrays include Dramanac, R
Single Base Sequencing developed in 1989
on Oligomicroarray (Drmanac, R. et al., Genomics,
2, 114-128 (1989)). This is an improvement of Sequencing by Hybridization (SBH method), in which a DNA oligomer having an average of about 20 to 25 mer is placed on a glass plate, and a labeled sample is detected by SBH. However, specimens are generally partially amplified using PCR due to problems such as insufficient quantity and long DNA chain length for SBH. Since there is no method at present, for example, SNPs at 100 locations on a single chromosome
If you try to test with cing on Oligomicroarray,
It is necessary to perform about several tens of PCR reactions.

[0010]

DISCLOSURE OF THE INVENTION The present invention has been made in view of the above situation, and provides a method and a kit for simultaneously and simply detecting a plurality of SNPs in a chromosome or a gene for the same specimen. The task is to provide.

[0011]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, the Invader Assay
By using this method, an array in which the 5 'end of the probe in the method is immobilized on a carrier is used, polymorphism can be detected more easily, and polymorphisms at a plurality of locations can be detected simultaneously. As a result, the present invention has been completed. That is, the present invention is as follows.

(1) A method for detecting the presence of a target nucleic acid having a specific sequence consisting of a first region, a target site, and a second region in order from the 5 ′ side, comprising the following steps: A) a recognition sequence portion having a sequence complementary to the first region at the 3 'end, and a flap portion having a sequence non-complementary to the second region at the 5' end,
And a first oligonucleotide having a 5 ′ end immobilized on a carrier, a second oligonucleotide having a sequence complementary to the second region, and a sample nucleic acid, recognizing the first oligonucleotide. The sequence portion and the first region of the target nucleic acid, and the second oligonucleotide and the second region of the target nucleic acid are mixed under annealing conditions, and the mixture recognizes and cleaves a local triplex. A protein having 5 ′ nuclease activity is acted thereon, (b) after dissociating each nucleic acid and oligonucleotide, the carrier is washed, and (c) a sequence complementary to the flap portion of the first oligonucleotide. And annealing the third oligonucleotide having a sequence whose 3 ′ end protrudes when annealed with the flap portion, and the first oligonucleotide on the carrier, The oligo nucleotides as primers, performing a polymerase reaction third oligonucleotide as a template, detects the extension of the first oligonucleotide by (d) polymerase reaction. (2) In the step (a), the annealing with the first oligonucleotide, the second oligonucleotide, and the target nucleic acid, and the local triple chain cleavage by the protein caused by the annealing are repeated in parallel. (1) The method for detecting the presence of a target nucleic acid according to (1). (3) The method for detecting the presence of a target nucleic acid according to (1) or (2), wherein the second oligonucleotide comprises a sequence complementary to the second region and the target site of the target nucleic acid. (4) When the nucleotide at the 3 ′ end of the flap portion of the first oligonucleotide is complementary to the nucleotide at the target site of the target nucleic acid, these nucleotides and the nucleotide at the 3 ′ end of the second oligonucleotide are A method for detecting the presence of a target nucleic acid according to any one of (1) to (3), which forms a local triplex. (5) When the extension of the first oligonucleotide occurs in the step (e), it is determined that a target nucleic acid having a target site corresponding to the nucleotide at the 3 ′ end of the flap portion of the first oligonucleotide is present. ,
A method for detecting the presence of a target nucleic acid according to any one of (1) to (4). (6) The method for detecting the presence of a target nucleic acid according to any one of (1) to (5), wherein the target site of the target nucleic acid is a polymorphic site of the gene. (7) The method for detecting the presence of a target nucleic acid according to any one of (1) to (6), wherein a carrier on which a plurality of types of first oligonucleotides are immobilized is used. (8) The first oligonucleotide has 5-1 at the 5 ′ end.
(7) characterized in that it is immobilized on a carrier having one of five thymidine residues or amino linkers and having a carbodiimide group on the surface thereof by a reaction between the thymidine residue or amino linker and the carbodiimide group. A method for detecting the presence of a target nucleic acid. (9) The first region, the target site, and the second region
A kit for detecting the presence of a target nucleic acid having a specific sequence consisting of a region of the first region, a recognition sequence portion having a sequence complementary to the first region on the 3 ′ end side, and the second A first oligonucleotide having a flap portion having a sequence non-complementary to the region on the 5 ′ end side and having a 5 ′ end immobilized on a carrier; and a sequence complementary to the second region. And a third oligonucleotide having a sequence complementary to the flap portion of the first oligonucleotide and having a sequence protruding at the 3 ′ end when annealed with the flap portion Wherein the first oligonucleotide is a plurality of oligonucleotides, each of which differs from the oligonucleotide at the 3 ′ end of the flap portion and at least one of the recognition sequences, and is fixed on the same carrier. Kit, characterized in that it is.

[0013]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.

<1> Oligonucleotide used in the present invention (1) Immobilized oligonucleotide In the present invention, the target nucleic acid to be detected has a target site to be detected, and a region 5 'to the target site Are referred to as a first region and a region on the 3 ′ side is referred to as a second region. That is, the target nucleic acid has a specific sequence consisting of a first region, a target site, and a second region in order from the 5 ′ side. When the target nucleic acid is isolated, it is itself a sample nucleic acid, and when it is a mixture with other nucleic acids, the mixture becomes the sample nucleic acid.

The first oligonucleotide used in the present invention is conceptually divided into a flap portion at the 5 'end and a recognition sequence portion at the 3' end. The recognition sequence part is
It has a sequence complementary to the first region of the target nucleic acid. On the other hand, the flap portion can be any sequence as long as it has no sequence complementary to the target nucleic acid.

One or two to four types of first oligonucleotides are produced depending on the type of base substitution at the polymorphic site. Specifically, when the polymorphism at the target site of the target nucleic acid is an A → G substitution, the base corresponding to the target site of the first oligonucleotide is preferably a base capable of forming a base pair with G ( C) or a base (T) capable of forming a base pair with A is selected. It is also preferable to use an oligonucleotide whose target site is any other base at the same time. The first oligonucleotide is immobilized on the carrier at the 5 'end. Therefore, in the present invention, the first oligonucleotide is also called an immobilized oligonucleotide.

The length of the immobilized oligonucleotide is usually 3 to 100 bases, preferably 5 to 50 bases, more preferably 8 to 40 bases. The length of the recognition sequence is
Usually, 3 to 100 bases, preferably 5 to 50 bases, more preferably 8 to 40 bases, and the length of the flap portion is usually 3 to 100 bases, preferably 5 to 50 bases, more preferably 8 to 40 bases. .

The immobilized oligonucleotide can be chemically synthesized by a usual solid phase synthesis method. The same applies to the following insertion oligonucleotide and template oligonucleotide.

(2) Insertion oligonucleotide The second oligonucleotide has a sequence complementary to the second region of the target nucleic acid. Preferably, the base of the second oligonucleotide corresponding to the target site of the target nucleic acid is capable of forming a base pair with the target site.

The second oligonucleotide, when the immobilized oligonucleotide, the target nucleic acid and the second oligonucleotide are annealed, the recognition sequence portion of the immobilized oligonucleotide is the first region of the target nucleic acid and the second region. The oligonucleotide and the second region of the target nucleic acid anneal,
The flap portion forms a flap (FIG. 1). Due to the shape formed by the three, in the present invention, the second oligonucleotide is also called an insertion oligonucleotide.

(3) Template Oligonucleotide The third oligonucleotide has a sequence complementary to the flap portion of the first oligonucleotide, and a sequence whose 3 ′ end protrudes when annealed with the flap portion. Having. The third oligonucleotide anneals to the flap portion of the immobilized oligonucleotide, and when the flap portion is released from the immobilized oligonucleotide, serves as a template for a polymerase reaction using the flap portion as a primer. Therefore, in the present invention, the second oligonucleotide is also called a template oligonucleotide.

<2> Detection of Presence of Target Nucleic Acid Next, the method of the present invention will be described. The method of the present invention includes the steps (a) to (e). Hereinafter, each step will be described (see FIGS. 1 and 2).

(1) Step (a) In this step, the immobilized oligonucleotide, the sample nucleic acid, and the inserted oligonucleotide are combined with the recognition sequence portion of the immobilized oligonucleotide, the first region of the target nucleic acid, and the inserted oligonucleotide. The nucleotides and the second region of the target nucleic acid are mixed under annealing conditions (FIG. 1).

The immobilized oligonucleotide is immobilized on the carrier at the 5 'end. The carrier used in the present invention is not particularly limited as long as the oligonucleotide can be immobilized by physical adsorption or chemical bonding and can withstand ordinary hybridization conditions. Specific examples include those which are insoluble in a solvent used for immobilization and hybridization of an oligonucleotide, and which are solid or gel at room temperature or in a temperature range around the room temperature (for example, 0 ° C to 100 ° C). Note that the carrier is insoluble in the solvent means that a carrier having a binding property to an oligonucleotide such as a carbodiimide group is adhered to the carrier as described below, and then the oligonucleotide is immobilized. It means that it is substantially insoluble in various solvents such as aqueous solvents and organic solvents used in each step when used as such.

Specific examples of the material of such a carrier include plastics, inorganic polymers, metals, natural polymers, and ceramics. Specific examples of the plastic include polyethylene, polystyrene, polycarbonate, polypropylene, polyamide, phenolic resin, epoxy resin, polycarbodiimide resin, polyvinyl chloride, polyvinylidene fluoride, polyfluoroethylene, polyimide, and acrylic resin.

Specific examples of the inorganic polymer include glass, quartz, carbon, silica gel, graphite and the like. Also, specifically, as a metal, gold, platinum,
Examples include silver, copper, iron, aluminum, magnets, paramagnets, and apatite.

The natural polymer includes polyamino acids, cellulose, chitin, chitosan, alginic acid and derivatives thereof. Specific examples of the ceramic include alumina, silica, silicon carbide, silicon nitride, and boron carbide.

Examples of the shape of the carrier include films, flat plates, particles, molded articles (beads, strips, wells or strips of multi-well plates, tubes,
Mesh, continuous foam, membrane, paper, needle, fiber, plate, slide, cell culture vessel, etc.), latex and the like. There is no particular limitation on their size.

In immobilizing the oligonucleotide on the carrier, the oligonucleotide may be directly immobilized on the carrier, or the carrier may be supported on the carrier, and the oligonucleotide may be immobilized on the carrier via the carrier. As the carrier, the carrier itself may have a binding property to the oligonucleotide, or a carrier capable of immobilizing the oligonucleotide via a ligand having a binding property to the oligonucleotide may be used. Here, `` supporting '', when immobilizing the oligonucleotide on the carrier, when using the oligonucleotide-immobilized carrier as a DNA chip or the like water-soluble solvent, in various solvents such as an organic solvent, It means that the carrier is not substantially detached from the carrier.

As long as the carrier used in the present invention is carried on the above-mentioned carrier, it may be carried simply utilizing physical adhesiveness, or may be chemically supported via a covalent bond or the like. It may be. In addition, the above carrier, if necessary,
It may be supported on the entire surface of the carrier, or may be partially supported.

Examples of the carrier include low organic molecules, plastics, inorganic polymers, metals, natural polymers, ceramics and the like. Specific examples of the organic low-molecular compound include a carbodiimide group-containing compound, an isocyanate group-containing compound, a nitrogen-ipert group-containing compound, and an aldehyde group-containing compound.
Examples include an amino group-containing compound.

Specific examples of the plastic include polyethylene, polystyrene, polycarbonate, polypropylene, polyamide, phenolic resin, epoxy resin, polycarbodiimide resin, polyvinyl chloride, polyvinylidene fluoride, polyfluoroethylene, polyimide, and acrylic resin. No.

Further, specific examples of the inorganic polymer include glass, quartz, carbon, silica gel, and graphite. Also, specifically, as a metal, gold, platinum,
Examples include silver, copper, iron, aluminum, magnets, paramagnets, and apatite.

Examples of natural polymers include polyamino acids, cellulose, chitin, chitosan and derivatives thereof. Specific examples of the ceramic include alumina, silica, silicon carbide, silicon nitride, and boron carbide.

Such a carrier has high adhesiveness to the above-mentioned carrier, and is carried on the carrier by utilizing this adhesiveness. A typical form when the carrier is carried on the carrier using physical adhesiveness is a film. Known methods such as spraying, dipping, brushing, stamping, vapor deposition, and coating using a film coater can be used as a method for supporting the carrier with a film on the carrier.

For example, to support a resin having a carbodiimide group on the entire surface of a glass carrier, first, a solution obtained by dissolving an amino-substituted organoalkoxysilane such as 3-aminopropyltriethoxysilane in a suitable solvent is used. Then, the glass carrier is immersed for about 2 to 3 hours under a temperature condition of about 70 to 80 ° C., taken out, washed with water, and further dried by heating at about 100 to 120 ° C. for about 4 to 5 hours. . After drying, it may be immersed in an appropriate solvent, added with a carbodiimide resin, stirred for about 12 hours at a temperature of about 30 to 170 ° C., and washed. In addition, the amino group of the above-mentioned 3-aminopropyltriethoxysilane and a functional group other than the oligonucleotide binding group of the nitrogen ipetrite group may be reacted with a suitable solvent to introduce the nitrogen ipetrite group on the surface of the glass carrier. .

Even when a functional group other than an amino group is present on the glass carrier or when the carrier is made of a material other than glass, various functional groups are introduced on the surface of the various materials mentioned in the description of the carrier. This is generally performed conventionally, and the method is also known. Therefore, a functional group can be introduced into the surface of the carrier using such a known method.

Further, some of the plastic carriers of the above-mentioned carriers already have the above-mentioned functional group on the surface of the carrier, and in this case, without introducing the functional group onto the surface of the carrier, This can be used as it is for the production of the carrier. Even such a plastic carrier can be used for the production of the above-mentioned carrier by further introducing a functional group.

The immobilized oligonucleotide is immobilized on the above-mentioned carrier at the 5 'end. The method of immobilizing the oligonucleotide is a carrier, a functional group on the carrier surface,
What is necessary is just to set suitably according to the kind of ligand, etc.

The immobilized oligonucleotide may have a homopolymer having a length of 3 bases or more bound to the 5 'end. In particular, when a carrier having a carbodiimide group on the surface is used, the oligonucleotide having a homopolymer is firmly immobilized by the carrier.

As a method for binding a homopolymer to the 5 ′ end of the oligonucleotide as described above, a known method can be used. Specifically, for example, using a commercially available nucleic acid synthesizer, the 5 ′
A method of integrally synthesizing such that at least three or more nucleobases are polymerized at the terminal is cited. In addition, a method in which a homopolymer is bound to an oligonucleotide using a chemical or enzymatic technique, or the like, may be used. The nucleobase constituting the homopolymer is adenine, guanine, cytosine or thymine when the nucleic acid is DNA, and RN
A is adenine, guanine, cytosine or uracil.

The length of the homopolymer is preferably from 3 bases to 100 bases, more preferably from 5 bases to 50 bases, and particularly preferably from 10 bases to 40 bases. When the number of bases is 2 or less, a sufficient amount of nucleic acid cannot be immobilized on the carrier, and when the number of bases is 101 or more, the yield is remarkably reduced in the nucleic acid production step.

The homopolymer may be a homopolymer composed of a certain base and a homopolymer composed of another base linked to each other. Further, the 5 ′ end of the oligonucleotide may be immobilized via an amino linker.

In immobilizing the oligonucleotide,
It is preferred that the nucleic acid is fixed on the carrier in a dot-like manner. The term “dot-like fixation” means that the nucleic acid fixation site is small enough to provide a plurality of nucleic acid fixation sites relative to the size of the carrier. The shape of the point is not particularly limited, but is generally preferably circular. The immobilized oligonucleotide is usually immobilized at a plurality of positions on a carrier, and is prepared as a so-called DNA array or DNA chip.

Specifically, for example, the oligonucleotide is usually supplied in a form contained in water or a buffer so that the activity of the immobilized oligonucleotide is maintained in the contact reaction between the oligonucleotide and the carrier. You. The temperature at the time of contact is generally from 0 to 10 so that the activity of the immobilized oligonucleotide is not lost.
The temperature is preferably set to 0 ° C.

Alternatively, the oligonucleotide can be fixed by irradiating it with electromagnetic waves such as UV after contacting the oligonucleotide with the carrier. Furthermore, in a state in which a known compound such as an oligonucleotide and a carbodiimide resin, a nitrogen ipellit, a polyamino acid, and nitrocellulose are chemically or physically bonded, the mixture may be contacted with a carrier to be fixed, and At this time, it may be fixed by irradiating electromagnetic waves such as UV.

In the present invention, a method using a dispenser, a method using a pin, and a bubble jet (registered trademark) may be used as a means for supplying an oligonucleotide, usually water or a buffer containing the oligonucleotide, to the carrier in a dotted manner. Although there are methods to be used, the present invention is not limited to these. Further, such a device for supplying a small amount of a solution is generally commercially available, and these can be used in the present invention.

The carrier having the oligonucleotide immobilized thereon is
In order to prevent the sample nucleic acid, the inserted oligonucleotide, the template oligonucleotide and the like from non-specifically binding, after immobilizing the oligonucleotide in the form of dots as described above, excess bovine serum albumin (BSA) , Casein, salmon sperm DNA and the like, and it is preferable to block unreacted portions.

The sample nucleic acid is generally expected to contain a target nucleic acid or a nucleic acid similar thereto, and nucleic acids derived from various organisms are used depending on the purpose. The sample nucleic acid is
It is prepared from microbial cells or various tissues of animals or plants. The preparation of a sample nucleic acid can be performed in the same manner as the preparation of a nucleic acid from a normal cell. As the sample nucleic acid, a nucleic acid prepared from cells can be used as it is, but a nucleic acid obtained by isolating or concentrating a target nucleic acid by a PCR method or the like may be used.

An immobilized oligonucleotide as described above,
The sample nucleic acid and the inserted oligonucleotide are mixed. Although the specific method is not particularly limited, for example, the carrier on which the oligonucleotide is immobilized is immersed in a solution containing the sample nucleic acid and the insertion oligonucleotide, or the sample nucleic acid and the insertion oligonucleotide are immobilized on the portion of the carrier on which the oligonucleotide is immobilized. By spotting a solution containing nucleotides,
It can be carried out. In addition, as shown in the examples, the carrier may be covered with a frame so as to surround the portion where the oligonucleotide is immobilized, and a solution containing the sample nucleic acid and the inserted oligonucleotide may be poured into the frame.

The solution is not particularly limited as long as the nucleic acid can be hybridized and a protein having 5 ′ nuclease activity can function, and various buffers can be used. Normally, Tris-HCl pH 6.
About 5 to 8 are used. The mixture is usually raised to a temperature at which the base pairs formed in the molecules of the nucleic acid or oligonucleotide are dissociated, for example, about 90 to 100 ° C., and then adjusted to a temperature at which the target nucleic acid and each oligonucleotide anneal. Is done. This temperature is not particularly limited as long as the recognition sequence portion of the immobilized oligonucleotide and the first region of the target nucleic acid, and the inserted oligonucleotide and the second region of the target nucleic acid can each be annealed. Specifically, although it depends on the length of each oligonucleotide, it is usually 5 to 5.
Preferably it is 80 ° C.

Next, the mixture of the immobilized oligonucleotide, the sample nucleic acid, and the inserted oligonucleotide was locally added to the mixture.
A protein having a 5 ′ nuclease activity that recognizes and cleaves a heavy chain is allowed to act. Examples of the protein having a 5 ′ nuclease activity that recognizes and cleaves a local triplex include, for example, a DNA polymerase, preferably a thermostable DN.
A polymerase. DNA polymerase
A modified enzyme having reduced or eliminated polymerase activity may be used (WO94 / 29482).

In order to cause a protein having 5 'nuclease activity to act on the mixture, the protein solution may be added to the mixture and reacted at an appropriate temperature. Less than,
This reaction is also called “recognition reaction”.

When the target site of the target nucleic acid is paired with the base of the immobilized oligonucleotide corresponding to the target site, that is, the nucleotide at the 3 'end of the flap portion is complementary to the nucleotide at the target site of the target nucleic acid. In some cases, the mixing and reaction result in the immobilized oligonucleotide, the target nucleic acid and the inserted oligonucleotide forming a local triplex at the target site, and the immobilized oligonucleotide is cleaved. This cleavage occurs between the base of the immobilized oligonucleotide corresponding to the target site of the target nucleic acid (the 3 'end of the flap portion) and the recognition sequence portion. On the other hand, when the target site of the target nucleic acid and the base of the immobilized oligonucleotide corresponding to the target site do not pair, the immobilized oligonucleotide, the target nucleic acid and the inserted oligonucleotide do not form a local triplex. ,
The immobilized oligonucleotide is not cleaved.

Under preferable conditions, the recognition sequence portion, the inserted oligonucleotide and the target nucleic acid, which have been separated from the immobilized oligonucleotide by the cleavage reaction, are released into the reaction solution. The released insertion oligonucleotide and the target nucleic acid are annealed again with the immobilized oligonucleotide which has not been used yet, and local triplex formation, recognition and cleavage reaction by the protein occur. This series of reactions is repeated until the reaction is stopped, until there is no unreacted immobilized oligonucleotide, or until protein inactivation occurs. To facilitate cleavage of the released recognition reaction moiety, insertion oligonucleotide and target nucleic acid and annealing with the new immobilized oligonucleotide, the reaction temperature is between 5 and 100 ° C., preferably 4 ° C.
It is preferable to repeatedly raise and lower between 0 and 95 ° C.

(2) Step (b) In this step, each nucleic acid and oligonucleotide used in step (a) are dissociated, and the carrier is washed. The dissociation of the nucleic acid and the oligonucleotide is performed, for example, by increasing the temperature of the reaction solution. Thereafter, it is preferable to rapidly lower the temperature of the reaction solution so that the dissociated nucleic acid and oligonucleotide do not anneal again.

Subsequently, the carrier is washed. If the recognition sequence portion of the target nucleic acid and the immobilized oligonucleotide remains in the reaction system, a polymerase reaction using the target nucleic acid as a template occurs in the subsequent operation, and it becomes impossible to distinguish from the polymerase reaction using the template oligonucleotide as the template. It is.

(3) Step (c) In the present invention, this step is also called "detection reaction". The template oligonucleotide is added to the carrier washed in the above step, and the immobilized oligonucleotide on the carrier and the template oligonucleotide are annealed. The template oligonucleotide has a sequence complementary to the flap portion of the immobilized oligonucleotide. It is preferable that the 3 'end of the template oligonucleotide is located inside the 5' end of the flap portion. The 3 ′ side of the template oligonucleotide has a sequence protruding from the 3 ′ end of the flap portion. The length of this protruding portion is usually 10 to 100.
Bases, preferably 15-80 bases, more preferably 20 bases
塩 基 60 bases, and the sequence can be arbitrary.

Subsequently, a polymerase reaction is performed. This means that a mixture of DNA polymerase and its substrate, deoxynucleotide (dATG, dGTP, dCTP,
dTTP). The addition of the DNA polymerase and its substrate may be prior to or at the same time as the addition of the template oligonucleotide.

To facilitate detection of the polymerase reaction, it is preferable to mix a labeled nucleotide with the mixture of deoxynucleotides. As a sign, Cy5,
There is no particular limitation as long as it is used for the detection of ordinary nucleic acids, such as fluorescent substances such as fluorescein, various enzymes, and radioactive substances, and does not inhibit the polymerase reaction.

(5) Step (e) In the above step, when cleavage occurs between the flap portion of the immobilized oligonucleotide and the recognition sequence portion, the flap portion becomes a primer of the template oligonucleotide, and the polymerase reaction proceeds. Proceed (FIG. 2). On the other hand, when no cleavage occurs, the recognition portion of the immobilized oligonucleotide does not anneal to the template oligonucleotide, so that no polymerase reaction occurs.

When the polymerase reaction proceeds and the flap portion is extended, the base at the 3 'end of the flap portion is determined to be the same as the base at the target site of the target nucleic acid. In the opposite case, it is determined that the base at the target site of the target nucleic acid is different from the base at the 3 ′ end of the flap portion.

By the above steps, the base at the target site of the target nucleic acid can be determined. Thereby, the polymorphism of the gene can be examined.

<3> Kit of the Present Invention The kit of the present invention is a kit for detecting the presence of a target nucleic acid having a specific sequence, comprising at least an immobilized oligonucleotide immobilized on a carrier, and an insertion oligonucleotide. Nucleotides and template oligonucleotides. A plurality of immobilized oligonucleotides are immobilized on the carrier.
These oligonucleotides differ in at least one of the oligonucleotide at the 3 ′ end of the flap portion and the recognition sequence.

The kit of the present invention comprises a blocking solution, 5 'nuclease, DN
It may contain one or more of A polymerase, a deoxynucleotide mixture, a reaction buffer, a washing solution, and the like.

[0066]

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples.

[0067]

Example 1 Preparation of Oligonucleotide-Immobilized Carrier (1) Synthesis of Oligonucleotide According to a conventional method, an oligonucleotide synthesizer (Perkin-Elmer) was used.
Using Applied Biosystems), oligonucleotides having the nucleotide sequences shown in Table 1 were synthesized, deprotected, and dried. This dried oligonucleotide is
The oligonucleotide was dissolved using 10 mM Tris-HCl (pH 7.5) to prepare a 100 pmol / μl oligonucleotide solution. This synthesis method was applied to all oligonucleotides. The uppercase nucleotide in the fixed oligonucleotide shown in Table 1 indicates a polymorphic site.

[0068]

[Table 1] Table 1 Base sequence of oligonucleotide ──────────────────────────────── SEQ ID NO: Base sequence 5 '→ 3 '──────────────────────────────── 1 atgcggacaggtccaactgcAtaaccactttggcgtattg 2 atgcggacaggtccaactgcCtaaccactttggcgtattg fixed 3 EitijishijijieishieijijitishishieiactgcGtaaccactttggcgtattg orico Bu Nukureochito Bu 4 atgcggacaggtccaactgcTtaaccactttggcgtattg 5 atgcggacaggtccaactgcAcgggtcttggtcttttaca 6 atgcggacaggtccaactgcCcgggtcttggtcttttaca 7 atgcggacaggtccaactgcGcgggtcttggtcttttaca 8 atgcggacaggtccaactgcTcgggtcttggtcttttaca 挿入 Insertion 9 attgcttcggaagatatcgg Orico ゛ nucleotide ゛ 10 gatggttggcttttcattaa オ リ鋳 型 Mold 11 gctaggacgaagag cggacgacttgtctgcggtgggagag Orico ゛ nucleotide ゛ gcagttggacctgtccgcat オ リ

(2) Spotting of Oligonucleotide to Substrate 10 μl of a microspotting solution (TeleChem International Inc.) was mixed with 10 μl of the oligonucleotide solution of the immobilized oligonucleotide prepared in Example 1, and the mixture was mixed with a microtiter plate (Greiner). Labotechnik
Ltd.). A slide glass having a carbodiimide group was placed at a predetermined position of the spotting machine, and the spotting machine was operated so as to be spotted at the position shown in FIG.

After spotting, slide glass is removed.
Placed in dryer at 37 ° C. for 30 minutes. Slide glass 3% BSA
(Bovine serum albumin) containing 100 mM Tris-HCl (pH 7.
5) Blocking was performed by soaking in 100 mM NaCl, 0.1% Triton X-100 at room temperature for 30 minutes. Thereafter, the slide glass was dried at room temperature, and then washed with 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA buffer. Dry the slide glass again at room temperature,
Stored in a dry and cool, dark place until use.

(3) Preparation of Native Tetracycline (TET) Resistance Gene Specimen A tetracycline resistance gene was inserted into a multicloning site of a plasmid vector pUC18 (Takara Shuzo) by a conventional method, and a plasmid containing a natural tetracycline resistance gene (WT) was prepared. -TET). Specifically, WT-TET
Was cut with the restriction enzyme EcoRI and inserted into the EcoRI site of the multicloning site of pUC18. WT-TE
The nucleotide sequence of T is shown in SEQ ID NO: 1.

This plasmid was amplified and purified in a conventional manner using Escherichia coli to prepare a 5 μg / ml WT-TET plasmid solution, which was used as a WT-TET solution.

[0073]

[Example 2] Preparation of mutant tetracycline (TET) resistance gene specimen 1 µl of the WT-TET solution obtained in Example 1 (3) was added to QuikChange ^™.
Using the Site-Directed Mutagenesis Kit (STRATAGENE), a mutant TET in which nucleotide 119 at nucleotide 119 in SEQ ID NO: 1 has been replaced with A and nucleotide G at nucleotide 751 has been replaced with T
(MT-TET) plasmid was prepared. This plasmid was amplified and purified by Escherichia coli by a conventional method, and a 5 μg / ml MT-TET plasmid solution was prepared to obtain an MT-TET solution.

[0074]

Example 3 Detection of Mutant TET Gene (1) Preparation of Reaction Solution Each of the plasmid solutions prepared in Example 1 (3) and Example 2
Dispense 1 μl into separate 1.5 ml centrifuge tubes, 999
μl of water was added to make a 5 ng / ml solution. This operation was further repeated twice to prepare a WT-TET diluted solution (5 fg / ml) and an MT-TET diluted solution (5 fg / ml).

Next, 1 μl of each of the diluted WT-TET solution and the diluted MT-TET solution was added to separate 1.5 ml centrifuge tubes, and further, 10 × Reactio
n Buffer (STRATAGENE) 2.5 μl, water 17.5 μl, Pfu DNA P
olymerase (STRATAGENE) 2 μl (5 units), SEQ ID NO: 1
Alternatively, 1 μl of the solution of the insertion oligonucleotide shown in 2 was added to obtain a WT-TET reaction solution and an MT-TET reaction solution.

On the other hand, a reaction solution containing both WT-TET and WT-TET plasmids was prepared as follows. Take 0.5 μl of each of the WT-TET diluted solution and MT-TET diluted solution, add them to a 1.5 ml centrifuge tube, and further add 10 × Reactio
n Buffer (STRATAGENE) 2.5 μl, water 17.5 μl, Pfu DNA P
olymerase (STRATAGENE) 2 μl (5 units), SEQ ID NO: 1
1 and 2 of the solution of the inserted oligonucleotide shown in
μl was added to prepare a WT-MT mixed reaction solution.

(2) Recognition reaction The three slide glasses prepared in Example 1 (2) were covered with 25 μl of Geneflame (Nippon Genetics) so as to surround the spots. The TET reaction solution and the WT-MT mixed reaction solution, 25 μl each, were poured and covered with a cover film. Each of these slide glasses is
del PTC-100 Thermacycler (MJ Research)
Heated at 95 ° C for 5 minutes. Then, the temperature was rapidly cooled to 43 ° C., and left for 5 minutes for annealing. Then rapidly 6
The mixture was heated to 3 ° C. and left for 120 minutes to complete the recognition reaction and the cleavage reaction. After removing the cover film and thoroughly washing the slide glass surface with water, the slide glass was dried at room temperature for 30 minutes.

(3) Detection reaction Take 10 μl each of 10 mM dATP, 10 mM dGTP, and 10 mM dTTP solutions, add them to a 1.5 ml centrifuge tube, and further add 10 mM Cy5-dCTP.
(Amersham Pharmacia Biotech) 10 μl was added and mixed to prepare a d5-NTP mixed solution containing Cy5-dCTP.

Take 3 μl of the template oligonucleotide solution prepared in Example 1 (1) and add it to a 1.5 ml centrifuge tube.
In addition, 78 μl of water, 10x Pyrobest Buffer II (Takara Shuzo) 10
μl, 8 μl of dNTP mixed solution containing Cye5-dCTP, Pyrobest DNA p
1 μl (5 units) of olymerase (Takara Shuzo) was added to prepare a detection reaction solution.

The detection reaction solution was dispensed into the grooves of each Geneflame of the three slide glasses prepared in Example 5 by 25 μl at a time, and covered with a cover film. Each of these slide glasses
Set at M-JModel PTC-100 thermacycler, 95 ℃ 5
The mixture was allowed to stand for 5 minutes at 43 ° C. and for 20 minutes at 75 ° C. to perform a detection reaction.
Remove both the cover film and Geneflame, wash the slide glass surface well with water, dry, and then use ScanArray 4000 (Gs
i Lumonics).

(4) Fluorescence Detection and Typing Fluorescence of Cy5 was detected at positions 1 and 7 from the slide glass treated with the WT-TET reaction solution. Thus, the TET gene in the WT-TET reaction solution has the 121st base with C
And the nucleotide at position 764 has a natural sequence of G, and can be typed as a natural type.

From the slide glass treated with the MT-TET reaction solution, Cy5 fluorescence was detected at positions 2 and 8.
From this, the TET gene in the WT-TET reaction solution was determined to have an unnatural sequence in which the 121st base was A and the 764th base was T, and could be typed as a mutant.

From the slide glass treated with the WT-MT reaction solution, fluorescence of Cy5 was detected at positions 1, 2, 7, and 8. From this, TET gene in WT-MT reaction solution,
It is determined that the 121st base is A and C and the 764th base is T and G, and it is possible to type with a mixture of a natural type and a mutant type.

[0084]

According to the present invention, a plurality of polymorphisms in a chromosome or a gene can be simultaneously and simply detected in the same specimen.

[0085]

[Sequence List] SEQUENCE LISTING <110> Nisshinbo Industries, Inc. <120> Target nucleic acid detection method and kit <130> P-7735 <140> <141> 2000-12-11 <160> 11 <170> PatentIn version 3.0

<210> 1 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 1 atgcggacag gtccaactgc ataaccactt tggcgtattg 40

<210> 2 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 2 atgcggacag gtccaactgc ctaaccactt tggcgtattg 40

<210> 3 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 3 atgcggacag gtccaactgc gtaaccactt tggcgtattg 40

<210> 4 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 4 atgcggacag gtccaactgc ttaaccactt tggcgtattg 40

<210> 5 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 5 atgcggacag gtccaactgc acgggtcttg gtcttttaca 40

<210> 6 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 6 atgcggacag gtccaactgc ccgggtcttg gtcttttaca 40

<210> 7 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 7 atgcggacag gtccaactgc gcgggtcttg gtcttttaca 40

<210> 8 <211> 40 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 8 atgcggacag gtccaactgc tcgggtcttg gtcttttaca 40

<210> 9 <211> 20 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 9 attgcttcgg aagatatcgg 20

<210> 10 <211> 80 <212> DNA <213> Artificial / Unknown <220> <221> misc_feature <222> () .. () <223> Description of Artificial Sequence: artificial oligonucleotide <400> 10 gatggttggc ttttcattaa gctaggacga agagcggacg acttgtctgc ggtgggagag 60 gcagttggac ctgtccgcat 80

[0096] <210> 11 <211> 1206 <212> DNA <213> Escherichia coli <400> 11 atgaatagtt cgacaaagat cgcattggta attacgttac tcgatgccat ggggattggc 60 cttatcatgc cagtcttgcc aacgttatta cgtgaattta ttgcttcgga agatatcgct 120 aaccactttg gcgtattgct tgcactttat gcgttaatgc aggttatctt tgctccttgg 180 cttggaaaaa tgtctgaccg atttggtcgg cgcccagtgc tgttgttgtc attaataggc 240 gcatcgctgg attacttatt gctggctttt tcaagtgcgc tttggatgct gtatttaggc 300 cgtttgcttt cagggatcac aggagctact ggggctgtcg cggcatcggt cattgccgat 360 accacctcag cttctcaacg cgtgaagtgg ttcggttggt taggggcaag ttttgggctt 420 ggtttaatag cggggcctat tattggtggt tttgcaggag agatttcacc gcatagtccc 480 ttttttatcg ctgcgttgct aaatattgtc actttccttg tggttatgtt ttggttccgt 540 gaaaccaaaa atacacgtga taatacagat accgaagtag gggttgagac gcaatcgaat 600 tcggtataca tcactttatt taaaacgatg cccattttgt tgattattta tttttcagcg 660 caattgatag gccaaattcc cgcaacggtg tgggtgctat ttaccgaaaa tcgttttgga 720 tggaatagca tgatggttgg cttttcatta gcgggtcttg gtcttttaca ctcagtattc 780 caagcctttg tggcaggaag aatagccact aaatggggcg aaaaaacggc agtactgctc 840 gaatttattg cagatagtag tgcatttgcc tttttagcgt ttatatctga aggttggtta 900 gatttccctg ttttaatttt attggctggt ggtgggatcg ctttacctgc attacaggga 960 gtgatgtcta tccaaacaaa gagtcatgag caaggtgctt tacagggatt attggtgagc 1020 cttaccaatg caaccggtgt tattggccca ttactgttta ctgttattta taatcattca 1080 ctaccaattt gggatggctg gatttggatt attggtttag cgttttactg tattattatc 1140 ctgctatcga tgaccttcat gttaacccct caagctcagg ggagtaaaca ggagacaagt 1200 gcttag 1206

[Brief description of the drawings]

FIG. 1 is a diagram schematically showing a recognition reaction in the method of the present invention.

FIG. 2 is a diagram schematically showing a detection reaction in the method of the present invention.

FIG. 3 is a diagram showing an arrangement of immobilized oligonucleotides spotted on a slide glass. Numbers indicate sequence numbers, and circles indicate spot positions.

Continued on the front page F-term (reference) 2G045 AA35 BB14 DA12 DA13 DA14 FB01 FB02 FB15 4B024 AA11 BA80 CA01 CA09 HA12 4B029 AA07 AA21 AA23 BB20 CC03 CC08 FA12 4B063 QA01 QA17 QQ42 QR08 QR42 QR55 QR62 QS06 QS08

Claims (9)

[Claims] 1. a first region, a target site,
And a method for detecting the presence of a target nucleic acid having a specific sequence comprising a second region, comprising the steps of: (a) recognizing a recognition sequence portion having a sequence complementary to the first region to 3 ′; On the terminal side, and on the 5 ′ terminal side, each has a flap portion having a sequence that is non-complementary to the second region,
And a first oligonucleotide having a 5 ′ end immobilized on a carrier, a second oligonucleotide having a sequence complementary to the second region, and a sample nucleic acid, recognizing the first oligonucleotide. The sequence portion and the first region of the target nucleic acid, and the second oligonucleotide and the second region of the target nucleic acid are mixed under annealing conditions, and the mixture recognizes and cleaves a local triplex. A protein having 5 ′ nuclease activity is acted thereon, (b) after dissociating each nucleic acid and oligonucleotide, the carrier is washed, and (c) a sequence complementary to the flap portion of the first oligonucleotide. And annealing the third oligonucleotide having a sequence protruding at the 3 ′ end when annealed with the flap portion, and the first oligonucleotide on the carrier, The oligo nucleotides as primers, performing a polymerase reaction third oligonucleotide as a template, detects the extension of the first oligonucleotide by (d) polymerase reaction. 2. In the step (a), the annealing of the first oligonucleotide, the second oligonucleotide, and the target nucleic acid with the cleavage of the local triple chain caused by the annealing by the protein is performed in parallel. 2. The method for detecting the presence of a target nucleic acid according to claim 1, wherein the method is repeated. 3. The method according to claim 1, wherein the second oligonucleotide comprises a sequence complementary to the second region and the target site of the target nucleic acid. Method. 4. The method according to claim 1, wherein the nucleotides at the 3 ′ end of the flap portion of the first oligonucleotide are complementary to the nucleotides at the target site of the target nucleic acid and these nucleotides and the 3 ′ end of the second oligonucleotide. The method for detecting the presence of a target nucleic acid according to any one of claims 1 to 3, wherein the nucleotide forms a local triple strand. 5. When the first oligonucleotide is extended in the step (e), if a target nucleic acid having a target site corresponding to the nucleotide at the 3 ′ end of the flap portion of the first oligonucleotide is present. A method for detecting the presence of the target nucleic acid according to any one of claims 1 to 4, wherein the determination is performed. 6. The method for detecting the presence of a target nucleic acid according to any one of claims 1 to 5, wherein the target site of the target nucleic acid is a polymorphic site of a gene. 7. The method for detecting the presence of a target nucleic acid according to claim 1, wherein a carrier on which a plurality of types of first oligonucleotides are immobilized is used. 8. The first oligonucleotide has 5 to 15 thymidine residues or an amino linker at the 5 ′ end, and a carrier having a carbodiimide group on its surface is provided with a thymidine residue or an amino linker. 8. The immobilization by reaction of a carbodiimide group.
A method for detecting the presence of the target nucleic acid according to the above. 9. A first region, a target site,
And a kit for detecting the presence of a target nucleic acid having a specific sequence consisting of a second region, wherein a recognition sequence portion having a sequence complementary to the first region is on the 3 ′ end side, and Each having a flap portion having a sequence that is non-complementary to the second region at the 5 ′ end, and
A first oligonucleotide having a 5 ′ end immobilized on a carrier, a second oligonucleotide having a sequence complementary to the second region, and a sequence complementary to a flap portion of the first oligonucleotide. And a third oligonucleotide having a sequence protruding at the 3 ′ end when annealed with the flap portion, wherein the first oligonucleotide has a sequence 3 ′ of the flap portion.
A kit comprising a plurality of types of oligonucleotides, each of which has at least one of a terminal oligonucleotide and a recognition sequence different from each other, and is fixed to the same carrier.