JP2002165531A - Transgenic plant prepared by new vector - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a transgenic plant which is prepared without using a plant cell growth inhibitor to reduce plant cell activity and without passing through a preparation process of F1 or its posterity by hybridization and from which the influence of a marker gene is eliminated, and further to provide a plant from which the influence of a marker gene is eliminated and into which genes are transferred in a multiple mode. SOLUTION: This transgenic plant is prepared by using a vector for gene transfer to a plant, which contains an objective gene, a morphogenetic abnormality inducer gene as a marker gene and a DNA factor having eliminating ability, in which the morphogenetic abnormality inducer gene exists at a position at which it takes the same behavior with the DNA factor having eliminating ability and the objective gene exists at a position at which it does not take the same behavior with the DNA factor having the eliminating ability.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a plant into which a target gene has been introduced using a novel vector.

[0002]

2. Description of the Related Art Transformation of microorganisms, cultured cells, and the like utilizing genetic engineering techniques has been applied to the production of physiologically active substances useful as pharmaceuticals, and has made a great contribution to the actual industry. . In the field of plant breeding,
Because the life cycle of plants is much longer than that of microorganisms, etc., the application of genetic engineering technology to the actual industry is slightly delayed, but this technology directly targets the target gene for breeding. (A) only the trait to be modified can be introduced,
(B) traits of species other than plants (such as microorganisms) can be introduced into plants, and (c) breeding period can be significantly shortened. Its application is expected to bring about breakthroughs in plant breeding, and this expectation is becoming a reality.

Specifically, to introduce a target gene into a target plant to prepare a transgenic plant, (1) introduction of the target gene into a plant cell (including a case where the target gene is introduced into a chromosome, a nucleus, etc.); (2) Selection of a plant tissue consisting only of cells into which the target gene has been introduced, and (3) Regeneration of a plant from the selected plant tissue, necessarily go through three stages. In selecting the target gene-introduced tissue, a tissue in which the target gene is expressed (a tissue in which the target gene is expressed is, of course, a tissue composed of cells into which the gene has been introduced) is generally selected from plants. Since it is difficult to visually confirm without regeneration, the target gene is introduced into plant cells together with a marker gene whose expression can be easily detected at the stage of cell culture, and the presence or absence of marker gene expression (ie, The presence or absence of a marker gene) is usually used as an index for introducing a target gene. For example,
Examples of such marker genes include a kanamycin resistance gene (NPTII; neomycin kinase gene) conferring antibiotic resistance, a hygromycin resistance gene (HPT; hygromycin kinase gene), and nopaline involved in amino acid synthesis. Examples include a synthase gene (NOS), an octopine synthase gene (OCS), and a sulfonylurea resistance gene (ALS; acetolactate synthase gene) that imparts pesticide resistance.

[0004] However, the expression of a marker gene is also a serious obstacle when such transgenic plants are intended to be used for food or the like. In other words, it is extremely difficult to ensure the safety of the gene product generated by the expression of such a marker gene in the human body.
Therefore, when a transgenic plant prepared using these marker genes as an indicator is sold as a food, a detailed investigation is required on the effect of the gene product on the human body. For example, the NPTII gene has been used extensively at the laboratory level as a marker gene since the early 1980s, but only in 1994,
The gene product was approved as a food additive by the U.S. Food and Drug Administration (FDA), and this was used as a marker gene, and the transformed transgenic plant was used for food and the like. However, at the level of the consumer who really wants to say this, such anxiety about the NPTII gene product is still hard to wipe off.

At present, only the NPTII gene and other genes that contribute to the detoxification of growth inhibitors on plant cells, such as the NPTII gene, have been put to practical use. Is performed by culturing the cells in a medium containing these growth-inhibiting substances, and evaluating the presence or absence of the marker gene, that is, the resistance to such substances, and using this as an index.
However, in this case, it is only a matter of concern that plant tissue grows in the presence of resistance, i.e. in the presence of such substances, and culturing in the presence of such inhibitors is not preferred for plant cells. Influence is inevitable, and in fact, side effects such as a decrease in the rate of regeneration and regeneration of the transgenic tissue due to a decrease in the activity of the plant cells have become a problem.

[0006] Furthermore, the expression of a marker gene in a plant cell after selection of a transgenic tissue causes a serious obstacle in plant breeding by transfection. That is, when another gene is to be newly introduced into a transgenic plant created using a certain marker gene, the gene cannot be introduced again using the same marker gene. Since the marker gene is already present in the plant, even if it is introduced again into the same plant together with a new target gene, whether the new target gene is introduced or not, the cells or the plant This is because this marker gene is always expressed in the tissue, and it can no longer be used as an index for introducing the target gene. Therefore, such multiple introduction of genes
Different marker genes will be used each time each transfer step is repeated. However, the effectiveness of the marker gene varies depending on the plant species, and each use of the marker gene requires a preliminary experiment for setting conditions (for example, in rice, the HPT gene is more effective than the NPTII gene). (K. Shima
moto et al. , Nature (Londo
n), 338: 274, 1989). In addition, since the types of marker genes are limited in the first place, it is impossible to repeat the multiple introduction of genes indefinitely only by changing the marker genes. In other words, the number of times gene transfer can be repeated for a certain plant is naturally limited by the number of types of marker genes that can be used for that plant. In addition, the types of marker genes that can be used at present are extremely limited as described above. Therefore, after selection of the transgenic plant tissue, the marker gene used at that time is removed from DNA such as chromosome where it exists and functions, and the influence of this is removed from the cells, tissues, and even the plant body. It can be said that the exclusion technique is essential for the new development of plant breeding using genetic engineering technology.

At present, as such a technique for eliminating the effect of a marker gene, a method of integrally using a marker gene and a plant transposon and removing the transposon together with the transposon from the introduced plant chromosome (International Publication WO92 / 92). / 01370) and a method using a site-specific recombination system of P1 phage instead of this transposon (WO 93/01283). According to these methods,
Although the probability is fairly low, cells in which a certain percentage of marker genes have been removed from plant chromosomes after gene transfer,
That is, transgenic plant cells in which only the target gene remains expressed in the chromosome and the function of the marker gene is lost can be obtained.

[0008] However, even if these methods result in a plant cell in which the marker gene has been removed from its chromosome, this cell is scattered among cells in which it is still present and expressing. Moreover, since these two types of cells cannot be distinguished with the naked eye, they cannot be separated as they are. When trying to select cells expressing the marker gene, such as when introducing the target gene, this is the drug resistance and conferring effect on the plant cells.
Selection can be performed using nutritional requirements as an index,
At the time of this selection, cells without expression of the marker gene cause severe growth disorders, and many of them can be killed. Cannot be applied at all.

Therefore, in order to obtain a plant in which the marker gene has been removed from the chromosome by these methods and only the target gene has remained, a cell in which the marker gene has been removed from the chromosome and this still exists there. After the cells are mixed and grown to some extent by culturing and growing, the plant tissues obtained by redifferentiating the cultured tissues are subjected to Southern hybridization or polymerase chain reaction techniques. It is conceivable to select by analyzing. The premise in this case is that such a redifferentiated individual is derived from a single cell and therefore all of the constituent cells are of equal character, for example, from a cell from which the marker gene has been removed. It goes without saying that the assumption is that every individual consists of only these cells. However, in many cases, it is already well known that the cells constituting such a redifferentiated individual are not always homogeneous, and even if the marker gene is used, the cell from which this has been removed from the chromosome and the cell that is still present This means that the regenerated plants coexist and coexist completely irregularly, even within the same individual, and even within the same tissue. Therefore, with these methods, it is very difficult to obtain an individual consisting only of cells whose marker gene has been removed from the chromosome at the stage of merely regenerating a cultured tissue and regenerating a plant individual. In addition, in the analysis for selecting this, no matter what method is used, all of the currently known methods, including the above-described analysis method, are used as co-test samples even for the whole individual when applied. Since a tissue having an appropriate mass, such as a single leaf, is used instead of a single cell, the result is nothing more than measuring and analyzing the overall tendency of the marker gene in one leaf. . Therefore, in the same individual / tissue, the cell where the marker gene has been removed and the cell where the marker gene is present are present in a mixed state rather than in a normal state. Even if an individual consisting solely of the removed cells occurs accidentally, it must be said that it is almost impossible to select that individual based on the analysis results. Even if the presence of the marker gene was not detected in this result, there is no guarantee that the same applies to tissues at other parts of the same individual, and the presence of the marker gene was not detected in the first place. In other words, this merely indicates that the abundance or the like is below the detection limit, and in this case, it cannot be said that the sample does not contain any cells in which the marker gene is present. Because.

[0010] After all, in such a case, only through germ cells such as pollen and egg cells,
An individual from which the influence of the marker gene has been eliminated can be obtained. That is, since these germ cells are unicellular, for example, if this is an egg cell in which the marker gene has been removed from the chromosome of the cell, when self-pollination is performed using this cell, a certain rule according to the classical genetic rule By chance, a fertilized egg will be obtained that does not contain the marker gene in its chromosome, and the fertilized egg will give rise to an individual consisting only of cells having the same characteristics. Selection by an analysis technique such as the Southern hybridization method may be performed on this individual. In other words, according to the method described in the report mentioned above, even if a cell in which the marker gene has been removed from the chromosome is obtained, the plant is re-differentiated from the cultured tissue in which the cell is present, and the re-differentiated plant is further regenerated. And an individual consisting of only such cells is obtained only after obtaining a F1 or progeny progeny thereof,
Then, it can be selected as an individual from which the influence of the marker gene has been eliminated.

In Japanese Patent Application Laid-Open No. Hei 6-276872, in order to eliminate the influence of the marker gene, the marker gene is inserted into a plasmid vector separate from the target gene when the gene is introduced. Although a technique for removing Escherichia coli from cells has been reported, even in this case, it is necessary to go through a mating process for the removal, which is similar to the above two reports.

However, such a method is difficult to apply to a slow-growing woody plant, a sterile individual, or a hybrid individual that is valuable as F1 itself. In addition, even if not, a DNA element having a detachment ability such as a transposon,
Since these are present and the probability of their removal from functional chromosomal DNA, viral vector DNA, etc. is very low in many cases, their removal, that is, loss of function of the marker gene, is practically at least at the stage of cultured tissue. It must be easy to detect. If this cannot be detected without certainty without redifferentiation of the cultured tissue and creation of progeny by crossing the redifferentiated individuals, it is almost impossible to put it to practical use.

[0013]

SUMMARY OF THE INVENTION An object of the present invention is to provide a transgenic plant which can be prepared using a novel vector without using a plant cell growth inhibitor or the like which reduces the activity of a plant cell.

Further, the present invention provides a transgenic plant prepared by using a novel vector without the process of producing F1 or progeny by crossing and excluding the effects of marker genes. It is another object of the present invention to provide a plant in which genes have been eliminated and into which multiple genes have been introduced.

[0015]

SUMMARY OF THE INVENTION An object of the present invention is to use a morphological abnormality-inducing gene as a marker gene, wherein the morphological abnormality-inducing gene is located at a position where it is integrated with a detachable DNA element. In addition, the target gene can be achieved by using a vector which is located at a position where the behavior of the DNA element having the detaching ability and the behavior of the DNA element are not united.

Here, the morphological abnormality-inducing gene refers to an unusual morphology such as dwarfism, collapse of apical dominance, pigment change, apical carcinoma, hairy root, leaf waving, etc. It means a gene that causes differentiation. For example, these morphological abnormality induction gene, already, ipt gene (A.C.Smigocki, L.D.Owens, P
rc. Natl. Acad. Sci. USA, 85:
5131, 1988), iaa M (tryptopha)
n monooxygenase) gene (HJK).
Lee et al. , GENES & DEVELO
PMENT, 1:86, 1987), the gene 5 gene (H. koerber et al., EMBO J.
original, 10: 3983, 1991), gene
6b gene (PJJJ Hoyaas et a)
l. Plant Mol. Biol. , 11:79
1, 1988), and the rol gene group of rols A to D (FF White et al., J. Bacte).
riol. 164: 33, 1985), each of which is present in Agrobacterium, which is a bacterium that causes carcinoma and teratoma (ie, formation of adventitious buds and adventitious roots) in various plants. And Pseudomonas syringae subspecies ( Pse
udomonas syringae subsp. s
avastanoi ), iaa L ( indoleac )
etic acid-lysine syntheta
se) gene (A. Spena et al., Mo.
l. Gen. Genet. 227: 205,199
The presence of 1) and the presence of homeobox genes and phytochrome genes have been reported from various plants.

Any of these genes can be used in the present invention. Among them, in particular, the ipt gene which causes the collapse of apical dominance, the formation of hairy roots, and the dwarf of plants regenerated from hairy roots The rol gene group that causes morphogenesis and leaf undulations is preferable as a marker gene used in the present invention because it causes characteristic morphological abnormalities among various morphological abnormality-inducing genes. Furthermore, they can also be designed to combine them to redifferentiate specific structures, such as adventitious buds and adventitious roots, into specific plants into which they have been introduced. In the present invention, utilizing such a combination of genes, such as the type of plant targeted for gene transfer, such as constructing a morphological abnormality induction gene according to the conditions for creating a transgenic plant,
It can also be used.

Since the tissue having an abnormal morphology caused by the introduction of such a morphological abnormality-inducing gene into cells comprises only cells having this gene, a vector is constructed together with the target gene using this as a marker gene. As long as this vector is introduced into a plant cell and this cell is cultured, the marker gene, that is, only the cell into which the target gene has been introduced, can be obtained only by visually selecting a tissue exhibiting an abnormal morphology that arises from the cell. The organization can be selected. Here, a vector refers to a DNA sequence used for the purpose of introducing a foreign gene into a host cell and having a function necessary for expressing the foreign gene in the host cell. Genes are often introduced into host cells in an integrated form.

That is, if gene transfer is carried out using the vector of the present invention, the cells into which the target gene has been introduced can be obtained by simply culturing the cells after gene transfer in a normal medium such as an MS medium under normal culture conditions. The selection of the plant tissue consisting only of the naked eye becomes possible. Therefore, in the selection, it is not necessary to use a special substance for selecting a gene-transferred tissue such as a plant cell growth inhibitor, which not only simplifies the operation but also reduces the activity of the plant cell due to these effects. There is no danger of lowering.

On the other hand, a DNA element capable of detachment refers to a DNA sequence capable of detaching itself from chromosomal DNA or the like in which these exist and function. In plants, such a factor is known as a transposon present on the chromosome, its structure and function,
And its behavior is almost completely known. In other words, in order for the transposon to function, in principle, it is expressed from a gene inside it and catalyzes its own elimination and transfer (transferase), and it is also present in its internal terminal region. Two components are required: the DNA sequence to which the transferase binds and acts. Due to these actions, the transposon is detached from the chromosome where it is present, and then usually translocates to a new position on the DNA, but sometimes loses its function without a certain probability of transposition and loses its function. Therefore, the present invention utilizes such transposon transposition errors. The transposon has such an autonomous transposon, namely, a transferase and a DNA-binding sequence, and the transferase expressed from the inside of the transposon binds to the DNA sequence present in the terminal region and acts. By doing so, in addition to those that can autonomously detach from the chromosome where they exist and transfer, there is also a type called a non-autonomous transposon. This non-autonomous transposon is an autonomous transposon that, while retaining the DNA sequence at the end where the transferase binds and acts, has a mutation in the internal transferase gene and no expression of the transferase. Non-autonomous transposons cannot be detached from the chromosome.However, non-autonomous transposons are also referred to as autonomous transposons when a transferase is supplied from an autonomous transposon or a transferase gene that exists independently of this. It will show similar behavior.

At present, the isolated autonomous transposons include Ac and Spm isolated from maize.
Has been analyzed in detail (A. Gieri
and H. Saedler, Plant Mol. B
iol. 19:39, 1992). In particular, Ac
It can be obtained by cutting out the wx-m7 locus in the maize chromosome with the restriction enzyme Sau 3A (U. Behrenset et al., Mol. Gen.
Genet. , 194: 346, 1984) among plant transposons, which are the most analyzed autonomous transposons, and whose DNA sequence has already been elucidated (M. Mueller-Neumanne).
t al. , Mol. Gen. Genet. , 198:
19, 1984) can be easily obtained by those skilled in the art,
Suitable as a DNA factor for use in the present invention. The non-autonomous transposons include Ac and Spm , respectively.
, Including Ds and dSpm (H-P. Doering and P. Star)
Ringer, Ann. Rev .. Genet. , 20:
175, 1986), and other than corn, it has been isolated from many plants such as snapdragon and morning glory (for example, Y. Inagaki et al., Plant).
Cell, 6: 375, 1994). Incidentally, it is known in many cases that these transposons exert their abilities and are detached and translocated even when introduced into the chromosome of a plant of a different kind from the plant from which they are derived (for example, B Baker et al., Proc.
Natl. Acad. Sci. USA, 83: 484
4, 1986).

In the present invention, any of autonomous and non-autonomous transposons can be used.
When a non-autonomous transposon is used, a transferase gene obtained or synthesized from an autonomous transposon or the like may be inserted and used in addition to the morphological abnormality-inducing gene.

Further, as a DNA element having an elimination ability which exists outside of a plant, a site-specific recombination system (site
-Specific recognition s
ystem) are known. This site-specific recombination system comprises a recombination site having a characteristic DNA sequence (corresponding to a DNA element having the elimination ability of the present invention), and a sequence which specifically binds to this DNA sequence and has a sequence of 2 When present, it consists of two elements, an enzyme that catalyzes recombination between the sequences, and
If two NA sequences are present on the same DNA molecule at a certain interval in the same direction, a region sandwiched between them is detached from the DNA molecule (plasmid, chromosome, etc.), In addition, when this arrangement is present at two locations facing each other, the behavior is that this area is inverted. In the present invention, the former elimination action is utilized, but such elimination / inversion inside the recombination site occurs as a result of so-called homologous recombination by a site-specific recombination system. This is the most different point from the mechanism using a transposon, which causes its detachment as a process of transposition. The gene coding for the recombinase does not necessarily need to be present on the same DNA molecule as the recombination site. It is known that inversion can occur (NL Craig, Annu.
Rev .. Genet. , 22:77, 1988).

At present, site-specific recombination systems use C-isolated from microorganisms such as phage, bacteria (for example, E. coli),
re / lox system, pSR1 system, FLP system, cer system, f
im system and the like are known (for a review, see NL Cr
aig, Annu. Rev .. Genet. , 22: 1
7, 1988), its presence in higher organisms is not yet known. However, site-specific recombination systems isolated from these microorganisms are also described in WO 93/0128 mentioned above.
In Publication No. 3, Cre / lox derived from P1 phage
When a system is introduced into a different species (including a plant) from the species from which it is derived, as in the case of using a system for a gene transfer vector into a plant, the same behavior as that in the original organism is obtained. It is clear that it can be taken. Incidentally, in one embodiment of the present invention, yeast ( Zygos)
The pSR1 system (H. Matsuzuki ), which is a site-specific recombination system of S. accharomyces rouxii.
et al. J. Bacteriology, 17
2: 610, 1990), with the use of a recombination enzyme inserted between its recombination sites, but this pSR1 system has also been reported to maintain its original function in higher plants (H Onouchi et al, N
ucleic Acid Res. , 19: 6373,
1991).

In the present invention, the site where the morphological abnormality-inducing gene is inserted may be, together with a DNA element capable of detachment,
It only needs to be a position where this can be detached. For example,
When a transposon is used as a DNA element having an elimination ability, the transposon is upstream of the promoter region of the transferase gene and downstream of the terminal region to which the transferase binds.
It can be inserted at a location that does not affect transposon detachment. When the pSR1 system is used, it can be inserted anywhere as long as it does not inhibit the expression of the recombinase within the region between the recombination sites.

DN having the ability to remove a morphological abnormality-inducing gene
If a vector is constructed in such a manner in combination with factor A, when a gene is introduced into a plant using this vector, the morphological abnormality-inducing gene used as a marker gene after the introduction will be used together with a DNA factor capable of detachment. , Such as plant chromosomes, which are detached from the DNA into which they have been introduced and function, and lose their functions with a certain probability, although their frequency varies, but this is a target gene that does not unite in behavior Will remain on the same DNA. Therefore, this vector can be used repeatedly indefinitely for multiple introduction of a gene into a single plant simply by changing the configuration of the target gene to be introduced. In addition, the loss of the function of the morphological abnormality-inducing gene can be detected by the naked eye as a change in its form, which occurs during the culture of the transgenic tissue, as in the case of gene transfer, so that only the target gene remains on the chromosome, etc. A tissue consisting only of cells having the function can be reliably and easily selected by merely culturing the tissue without performing any special operation. Therefore, even if the probability that such cells are actually generated is low, this vector can be used sufficiently, and the multiple transfer of a gene using the vector can be repeated not only as many times as possible, but also a complete plant can be obtained. Since this can be repeated at the stage of the cultured tissue before regeneration, it can be performed efficiently. In addition, in order to obtain a transgenic individual consisting only of such cells, it is only necessary to regenerate a plant from the tissue selected as described above, and it is not necessary to go through a mating process. And the transgenic individual thus obtained has just been completely freed from fears that the gene product of the marker gene may cause harm to the human body. In addition, this vector has other characteristics derived from using a morphological abnormality induction gene as a marker gene, namely,
It goes without saying that in the process of selecting a gene-transfected tissue, there is no need to use a cell growth inhibitor or the like, which may cause a decrease in cell activity.

The vector of the present invention can be used in any plant into which a gene can be introduced by genetic engineering techniques. The target gene that can be introduced into a plant by the vector of the present invention is an agriculturally excellent trait. Various genes can be selected depending on the purpose, such as genes that can be imparted, and genes that are not necessarily agriculturally excellent traits, but genes required for studying gene expression mechanisms.

In general, in order to produce a protein such as an enzyme from a gene, in addition to the structural gene sequence encoding information on these polypeptides, a promoter sequence (expression start sequence) and a terminator sequence (terminator sequence) of the structural gene are used. A regulatory sequence such as an expression termination sequence is required. For example, a promoter sequence that functions in plants includes the cauliflower mosaic virus 35S promoter (JT Od
ell et al. , Nature (Londo
n), 313: 810, 1985), the promoter of nopaline synthase (WHR Langridge e).
t al. , Plant Cell Rep. 4: 3
55, 1985), the promoter of the ribulose diphosphate carboxylase / oxygenase small subunit (R. Fluhret al., Proc. Natl.
Acad. Sci. USA, 83: 2358, 198.
6) and the like, and the terminator sequence includes a polyadenylation signal of nopaline synthase (A. Depick).
er et al. J. Mol. Appl. Ge
n. 1: 561, 1982), polyadenylation signal of octopine synthase (J. Gielen et a).
l. EMBO J .; 3: 835, 1984). Therefore, when simply referred to as a gene in the present invention, it indicates a structural gene and a gene expression regulatory sequence.
Incidentally, in the present invention, various gene expression control sequences as described above can be used without being limited to the gene expression control sequences used in the examples. Furthermore, the gene, that is, DNA, can be obtained by cloning cDNA or genomic DNA, and if its sequence is known in advance, it can also be obtained by chemical synthesis.

The vector of the present invention can be introduced indirectly into plant cells via viruses or bacteria that infect plants (I. Potrykus, Annu. Rev.
Plant Physiol. Plant Mol. B
iol. , 42: 205, 1991). In this case, for example, cauliflower mosaic virus, gemini virus, tobacco mosaic virus, brom mosaic virus and the like can be used as viruses, and bacteria such as Agrobacterium tumefaciens (hereinafter abbreviated as A. tumefaciens) and Agrobacteria can be used. Um rhizogenes (hereinafter abbreviated as A. rhizogenes) and the like can be used. In general, Agrobacterium does not infect monocotyledonous plants, but only dicotyledonous plants.Recently, there have been reports of cases in which these are transmitted to monocotyledonous plants and transfected. (For example, international publication W
O94 / 00977 publication).

The vector of the present invention can also be directly introduced into plant cells by a physical or chemical method such as a microinjection method, an electroporation method, a polyethylene glycol method, a fusion method, and a high-speed ballistic penetration method. (I. Potryku)
s, Annu. Rev .. Plant Physiol.
Plant Mol. Biol. , 42: 205, 19
91). For many monocotyledonous plants and dicotyledonous plants that are not easily infected by Agrobacterium, indirect transfection using Agrobacterium, which is widely used for gene transfer, cannot be used. It is.

[0031]

In the present invention, the morphological abnormality-inducing gene used as a marker gene, when expressed, causes abnormalities in the intracellular physiological state, such as abnormal production of plant growth hormone, in the introduced plant cells. As a result, the direction of growth and differentiation is changed, and various morphological abnormalities are caused. In other words, the abnormally morphologically occurring tissues, such as disordered bud aggregates (polyblasts) and hairy roots in which apical dominance is lost, are derived from cells into which such morphological abnormality-inducing genes have been introduced. Since this is the result of abnormal growth and differentiation, it consists only of cells having this gene. Therefore, if this is introduced into a plant cell together with the target gene as a marker gene and this cell is cultured, the marker gene, that is, the target gene is introduced only by selecting the resulting tissue showing an abnormal morphology with the naked eye. Thus, it is possible to select a tissue consisting of only cells that have been lost, so that a gene-transfected tissue can be selected by the naked eye without performing any special operation such as adding a plant cell growth inhibitor to the medium.

Further, in the present invention, a DNA having an elimination ability
The factor is combined with this morphological abnormality-inducing gene, and is used by incorporating it at a position where the morphological abnormality-inducing gene and the DNA element capable of detachment unite with one another. When a gene is introduced into a plant using a vector having such a configuration, after the introduction, the morphological abnormality-inducing gene, which is a marker gene, has a detachable D-type.
The DNA into which they were introduced and functioned along with the NA factor
From the top, the target gene is desorbed with a certain probability and loses its function, while the target gene whose behavior does not become one remains on the same DNA and keeps its function. Therefore, this vector is used for multiple gene transfer into a single plant without changing the structure of the marker gene or any other structure only by changing the structure of the target gene to be introduced. In addition, it can be used repeatedly without limitation. In a transgenic tissue or the like in which a marker gene has lost its function, the expression of that marker gene can no longer occur, so the expression of the same marker gene can be repeated as many times as an index for introducing a new target gene. It is.

Moreover, since the loss of the function of the marker gene, that is, the morphological abnormality-inducing gene, can be detected by the naked eye as a change in the morphology of the transgenic tissue, as in the case of the gene transfer, it consists only of cells having lost this function. Tissues, in other words, tissues consisting only of cells in which only the target gene remains on its chromosome or the like and retains its function, can be reliably and easily selected. That is, in order to obtain a tissue consisting of only such cells, first, the cells after the gene transfer treatment are cultured to remove abnormal morphologies such as polyblasts and hairy roots caused by the expression of the morphological abnormality induction gene. The tissue to be shown may be selected with the naked eye, separated from the tissue, and further cultured, and then the tissue, which is generated from the tissue having a morphological abnormality and has a normal morphology, may be selected with the naked eye. In other words, it is only necessary to repeat culture, selection with the naked eye, and separation without performing any special operation for selection.Therefore, even if the transposon has a large transfer ability and is unlikely to be completely detached from DNA, In addition, the DNA element of the present invention can be sufficiently used as a DNA element having a detachment ability, and multiple gene transfer can be performed efficiently. Furthermore, a plant consisting solely of such cells can be obtained by simply regenerating the plant from the obtained transgenic tissue without going through a mating process.

[0034]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Embodiments of the present invention will be described below based on examples. In the following examples, more detailed experimental procedures were performed using Molecular Cloning 2nd Edition (Sambrook) unless otherwise specified.
et al. eds. , Cold Spring Ha
rbar Laboratory Press, New
York, 1989) or according to the manufacturer's instructions.

[0035]

[Embodiment 1]I. Creating a vector  Pathogenic A. T-DNA of Tumefaciens PO22 strain
(Hiroetsu Gahiko, Chemical regulation of plants, 24:35, 1989,
(See Fig. 1))iptGene restriction enzymeP
stI and excised from the plasmid pUC7 (Molec
(2nd edition, Volume 1, 4.10)P
stBy connecting to the I restriction enzyme site,
Smid pIPT1 was obtained. From this plasmid, the promoter
Data and polyadenylation signaliptgene
The restriction enzymeBamHI andPstCut out with I
Plasmid pUC119 (purchased from Takara Shuzo Co., Ltd.)B
amHI-PstBy linking between the I restriction enzyme sites.
To obtain the plasmid pIPT2,iptRemains
Restrict structural genes and polyadenylation signals among genes
enzymeRsaI and excised with plasmid pUC11.
9 ofSmaRecombination by ligation with restriction site I
The plasmid pIPT3 was obtained. And furthermore, pIP
Inserted in T3iptGene restriction enzymeBamHI and
AndSacVector for gene transfer into plants
Plasmid pBI121 (purchased from CLONTECH)
In)BamHI-SacConnects between I restriction sites
Thereby, a plasmid pIPT4 was prepared. This
A. with Rasmid Tumefaciens infected plants
When this is done, the structure is called a so-called T-DNA region.
Inside LB site and RB site, here NPT
II gene andiptAbout 5 kb region containing the gene is planted
Will be integrated into the product chromosome.

The plasmid pIPT4 was introduced into Escherichia coli JM109 strain, and this E. coli was transformed into E. coli. coli JM109 (p
IPT4) (Accession number: FERM BP-5063)
As an international deposit.

FIGS. 2 to 4 show a scheme for preparing pIPT4, and FIG. 5 shows a restriction enzyme map of its T-DNA region.
In FIGS. 2 to 4 and FIG. 5, P and T circled are respectively i
The promoter of the pt gene itself and the polyadenylation signal, 35S-P indicates the cauliflower mosaic virus 35S promoter, and Nos-P indicates the promoter of the nopaline synthase gene, T (FIG. 4) or Nos-T (FIG. 5) Indicates the polyadenylation signal of the nopaline synthase gene.

In this embodiment, as is apparent from FIG.
Among the morphological abnormality-inducing genes as marker genes, ipt which causes collapse of apical dominance and contributes to multibud formation
The gene was used as a model, and the NPTII gene was used as a target gene as a model. The ipt gene is pathogenic A. It is a member of a tumorigenic gene maintained by Tumefaciens. Into a plant cell into which this gene has been introduced, the overexpression of cytokinin, which is a kind of plant hormone, causes the differentiation direction to move toward multibud formation.

[0039] In the present embodiment, the expression control sequences of ipt gene, the promoter sequence of the 35S promoter of cauliflower mosaic virus, terminator sequence was used polyadenylation signal ipt gene itself.

[0040]II. PIPT4 for Agrobacterium
Introduction of  A. Tumefaciens LBA4404 strain (CLONTE
CH), 10 ml of YEB liquid medium (B
Extract 5g / l, yeast extract 1g / l, peptone 1g
/ L, sucrose 5g / l, 2mM MgSO₄At 22 ° C
PH 7.2 (hereinafter, unless otherwise indicated, at 22 ° C.)
pH. )) And inoculate OD630 from 0.4
Cultured at 28 ° C. to a range of 0.6. Culture solution
Was collected by centrifugation at 6900 × g, 4 ° C. for 10 minutes.
Thereafter, the cells were lysed with 20 ml of 10 mM Tris-HCl (p
H8.0) and again 6900 × g, 4 ° C., 10 ° C.
The cells were collected by centrifugation for
Suspended in an EB liquid medium, this was used as a bacterial solution for plasmid introduction.
And

In a 15 ml tube (Falcon),
200 μl of the bacterial solution for plasmid introduction and 6 μg of the plasmid pIPT4 prepared in I were mixed, and this was immersed in ethanol, which had been cooled in liquid nitrogen for 30 to 40 minutes, together with the tube for 5 minutes. The plate was placed in a water bath for 25 minutes, and then 750 μl of YEB liquid medium was added thereto and cultured at 29 ° C. for 1 hour with shaking. This bacterial solution was inoculated on a 50 mg / l kanamycin-added YEB agar medium (agar 1.2 w / v%, other composition is the same as described above) and cultured at 28 ° C. for 2 days.
After transplanting to a liquid medium and further culturing, a plasmid was extracted from the cells by an alkaline method. The extracted plasmid was digested with restriction enzymes Pst I, Bam HI and Eco RI, and analyzed by agarose gel electrophoresis. Claw facade LBA4404
It was confirmed that the plasmid pIPT4 was introduced into the strain.

[0042]III. Agrobacterium to tobacco
Introduction of pIPT4  Tobacco grown in a greenhouse (Nicotiana ta
bacum cv. xanthi, especially if
Except below, the same applies. ) Is replaced with 1 v / v% sodium hypochlorite
Sterilize by immersing in thorium aqueous solution for 5 minutes, sterile water 3 times
After washing, the middle vein is removed to form leaf pieces of about 8 mm square
Was prepared as follows. The tobacco leaf pieces were subjected to pIP in II.
A. Introducing T4 Tumefaciens LBA4404 strain
Bacterial solution (OD630 = 0.25, YEB liquid medium
After culturing overnight, dilute with sterile water to prepare the cell concentration. About 1)
After soaking for a minute, infect it and place it on sterile filter paper.
After removing excess bacterial solution, acetosyringone 50m
g / l without plant hormones (hormone
Lee) MS agar medium (T. Murashige and
 F. Skoog, Physiol. Plant. , 1
5: 473, 1962, but with agar 0.8 w / v%
Addition. ), The leaves were placed so that the backs of the leaves were facing up. This is 2
5 ° C, Zenmei (Explants and plants unless otherwise noted)
The culture of the woven / plant was performed under these conditions. ) For 3 days
Later, a hormone containing only 500 mg / l carbenicillin
When transplanted to a free MS agar medium and continued to culture,
22 adventitious shoots are regenerated and the adventitious shoots are separated and
As a result of culturing in a medium having the composition, six lines of multiblasts were obtained.
These are subcultured to the same medium every month, and for the third month
Is a hormone-free MS cold that does not contain carbenicillin
Propagation of Agrobacterium was repeated several times in a supernatant medium.
After confirming that the kanamycin resistance test and PC
It was subjected to R analysis.

[0043]IV. Analysis of transgenic tobacco  A. Kanamycin resistance test The polyblasts of the six lines obtained in III were
By culturing as it is, leaves that have developed in the future
And cut it into approximately 3 mm square.
MS agar medium containing 200 mg / l of BA (1 mg / BA
l, NAA 0.2mg / l added) and culture for 1 month
Observations were made later. As a result, even in the same medium
From all leaf pieces obtained from the multibud line, multibud formation was observed.
Admitted.

B. PCR analysis Chromosomal DNA was extracted from all of the 6 multiblasts obtained in III, and the transgene was confirmed by PCR.

The extraction of chromosomal DNA was performed using the following improved CTA
This was performed using the B method. First, about 1 g of the leaves of the multi-bud was crushed using a mortar under liquid nitrogen, and this was previously crushed at 60 ° C.
2% w / v CTAB (hexad)
ecyltrimethylammonium bro
mid), 1.4 M NaCl, 0.2 v / v% β
-Mercaptoethanol, 20 mM EDTA, 100
Buffer solution 5 consisting of mM Tris-HCl (pH 8.0)
The suspension was suspended in ml. The suspension was warmed at 60 ° C. for 30-60 minutes with gentle shaking and then cooled to room temperature, to which was added an equal volume of chloroform: isoamyl alcohol (24: 1) and gently mixed. . Subsequently, the supernatant was collected by centrifugation at 1600 × g for 5 minutes, ２ volume of isopropyl alcohol was added to the supernatant, mixed gently again, and allowed to stand on ice for 10 minutes. Chromosomal DNA was precipitated and this was
Sedimented by centrifugation for minutes. Precipitated chromosomal DNA
After washing with 70 v / v% ethanol, vacuum drying was performed, and 300 μl of TE (10 mM Tris-HCl,
(1 mM EDTA).

On the other hand, since the ipt gene is detected by the PCR method, the primer (oligonucleotide) used is combined with a DNA synthesizer (Appl) so that the interval between the two primers is about 800 bp when the ipt gene is bound.
ied Biosystems). i
For amplification of the pt gene, 1 μm of the extracted chromosomal DNA
g of 10 mM T containing 0.2 μM of this primer.
ris-HCl (pH 8.8 at 25 ° C.), 50 mM
KCl, 1.5 mM MgCl ₂ , 1 w / v% Trit
onX-100, 0.1 mM dNTP, and 1.25
The unit was dissolved in 50 μl of a mixed solution having a composition of Taq polymerase (purchased from CETUS), heated at 94 ° C. for 1 minute and 30 seconds, and then heated at 94 ° C. for 1 minute.
A heating cycle was repeated 30 times at 55 ° C. for 2 minutes and at 72 ° C. for 3 minutes for reaction. The resulting reaction mixture was analyzed using agarose gel electrophoresis, and the ipt in chromosomal DNA was analyzed.
The presence of the gene was confirmed by amplification of an approximately 800 bp gene derived therefrom.

The results are shown in FIG. 6. As is apparent from the figure, the gene amplification of about 800 bp was observed in all of the six lines of polyblasts. In addition, the numerical value shown on the left in the figure represents the number of bases of each band component detected when the DNA size marker is electrophoresed.

[Comparative Example 1]
A. Analyzes were also performed on 16 buds having no ability to form multiple shoots, obtained from adventitious buds regenerated from Tumefaciens-infected leaves. That is, as a result of isolating and culturing 22 adventitious buds in the same III, when the 6 buds were selected, they were not budded but normal buds (hereinafter referred to as normal bodies). In the same manner as in the case of the multibud line in III and IV, bacteria were removed and a kanamycin resistance test was carried out.
An R analysis was performed. However, in these normal strains, all leaf pieces placed on a kanamycin-supplemented medium turned brown and died in about 3 months, and in the PCR analysis,
Amplification of a DNA fragment of about 800 bp indicating the presence of the ipt gene could not be detected in any of the nine lines analyzed. FIG. 6 shows the results of the PCR analysis.

Embodiment 2I. Creating a vector  Plasmid pHSG398 (purchased from Takara Shuzo Co., Ltd.)
Restriction enzymeBamCut with HI and the protrusion caused by the cut
T4 DNA polymerase I (Large subunit)
After blunting, the ends are ligated again and the plasmid
pNPI100 was obtained. That is, this pNPI100
Is the pHSG398BamElimination of HI restriction enzyme sites
It was made. On the other hand, plasmid pCKR97
(T. Izawa et al., Mol. Gen. G.
enet. 227: 391, 1991)P
stCut with corn transposonAcTo
Cut it out and put it on the PNPI100PStI restriction enzyme
At the site to obtain the plasmid pNPI102.

Next, the plasmid pI prepared in Example 1 was used.
From PT4 (Fig. 5), cauliflower mosaic virus 3
The 5S promoter and the ipt gene linked to it are
Restriction cut with the enzymes Hin dIII and Sac I, then the protruding ends were smoothed with T4DNA polymerase I, which was inserted into the Hin cII restriction enzyme site of plasmid pUC119, resulting in plasmid PNPI101. From this plasmid PNPI101, again cauliflower mosaic virus 35S promoter and the ipt gene, now cut out with restriction enzymes Pst I and Eco RI, after which the cohesive end was blunted by T4DNA polymerase I,, cleaved with restriction enzymes Bam HI Then, the protruding ends were ligated to plasmid pNPI102, which was similarly blunt-ended, to obtain plasmid pNPI103. That is, in this plasmid PNPI103, the ipt gene linked to 35S promoter, transposon A
c will be present at the old Bam HI restriction enzyme site.

The desired vector is the plasmid p
From NPI103, cauliflower mosaic virus 35
Transposon containing S promoter and ipt gene
The Ac, restriction enzyme Pst cut out with I, which Sse for vector plasmid pBI121 gene transfer into plants
Obtained by insertion into the I restriction enzyme site, this was designated as plasmid pNPI106.

The plasmid pNPI106 was also introduced into E. coli JM109 strain, and c
oli JM109 (pNPI106) (Accession number: F
(ERMBP-5064).

The construction scheme of plasmid pNPI106 is shown in FIGS. 7 to 9, and the restriction map of its T-DNA region is shown in FIG. 7 to 9 and FIG. 10, the range of the transposon Ac is indicated by opposing black triangles. FIG.
Among them, Ac-P indicates a promoter inherent in Ac . Other symbols are the same as in FIGS.

As is clear from FIG. 10, this plasmid contains an ipt gene as a marker gene and a NPTII gene and GUS (β -Galactosidase) gene, and the ipt gene exists in a form inserted inside the transposon Ac . The GUS gene is used for the analysis of gene expression in plants, since cells having the GUS gene metabolize a special substrate and produce a blue pigment. Is a gene that has been

[0055]II. Introduction and introduction of pNPI106 into tobacco
Of transgenic and transgenic tobacco  A. Introduction of pNPT106 into tobacco and transgene
Expression test As in II and III of Example 1, pNPI106 was
A. Introduced into Tumefaciens LBA4404 strain,
A. After infecting tobacco leaf pieces with Tumefaciens,
The infected leaves were treated with acetosyringone 50 mg / l added hormone.
Culture on free MS agar medium, then carbenicillin
Cultured in the same medium supplemented with only 500 mg / l,
At the second month of the culture, 63 buds were isolated.

These cells were further transplanted to a medium of the same composition (hormone-free MS agar medium supplemented with carbenicillin 500 mg / l) and continued to be cultured. One month later, the shoots of slightly elongated polyblasts (hereinafter referred to as polyblasts) were obtained. that the individual bud occurring in, is referred to as a chute from a.), as compared to other chute extends above about twice the size, and also not recognized development of lateral buds, ipt Nine shoots which seem to have a weakened effect of the gene were visually selected, and the leaves attached to the shoots were used for the kanamycin resistance test similar to IV-A of Example 1, and Jeff.
A GUS gene expression test (GUS activity test) was performed according to the method of Erson et al. As for the shot was cut out leaves, further continue the culture were transplanted in hormone-free MS agar medium, and observed the form of after one month, multiple shoots forming ability of the shot, i.e. the ipt gene Expression was assayed.

Table 1 shows the results.

[Table 1]

As is clear from Table 1, No. In the shoot of No. 8, despite the fact that the obtained leaf had kanamycin resistance and GUS activity, it did not
It does not form multiple shoots even after culturing for months. This is the vector pNPI106 used here, ipt gene which contributes to formation of multiple shoots because exists internally inserted forms of transposon Ac, holds the vector A. When Tumefaciens was infected with tobacco leaf pieces and culture was started, the ipt gene, which was introduced into the chromosome of tobacco and expressed, was transformed into the Ac gene during the subsequent culture.
It is probable that this function was eliminated due to the action of this and the function was lost. On the other hand, even on the same vector,
Since the NPTII gene and the GUS gene are inserted at positions that do not combine Ac with the behavior, they are No. Even in the shoots of No. 8, they are still expressed in the chromosome.

In Table 1, No. In shoots 3, 5, and 6, only GUS activity was negative despite kanamycin resistance and polyblast formation ability. That is, among these shoots, only the GUS gene among the genes introduced using pNPI106 was not expressed, which was attributed to an integration error that occurred when these genes were introduced into the plant chromosome. Conceivable. That is, A. When a gene is introduced through Tumefaciens, in a plasmid having a structure such as pNPI106, the entire T-DNA region, that is, the entire region inside the RB site and LB site should be integrated into the plant chromosome. As a result, the integration may not be completely performed, and may be incorporated in a state where a part of the LB terminal side is broken. In the pNPI106 used here, among the genes inserted into the T-DNA region, the GUS gene is located at the position closest to the LB site. It was considered that the GUS gene was not expressed in these shoots and their activity was not observed in these shoots because they were integrated into the chromosome in a state where they were cut and lost their functions, or were not integrated at all. Here, No. 2 and No. 2 The morphology of the eight shoots after one month of culture is shown in FIGS.

At this time, No. The leaves obtained from 8 shoots and subjected to the kanamycin resistance test were continuously cultured after the test. As a result, five adventitious buds were obtained from these leaves, all of which were normal.

B. PCR analysis After observing the multiple shoot formation ability of the shoots 1 to 9, PCR analysis was performed in the same manner as in IV-B of Example 1 to further examine the presence of the ipt gene in the chromosome. However, here, in addition to the primer used in IV-B of Example 1, NPTII
Although primers designed to bind on the GUS gene and the GUS gene were also used, PCR using these primers gave pN
From T-DNA region of PI106, Ac, and if the elimination of ipt gene inserted therein occurred, about 3
Since the DNA fragment of kb is amplified, the removal of the Ac and ipt genes from the chromosomal DNA can be detected using the amplification as an index. Among the PCR analyzes performed here, The results for the 8 shots are shown in FIG. In the figure, the numerical values shown on the left are the same as in FIG.

As is clear from FIG. In the chromosomal DNA extracted from the No. 8 shoot, amplification of a DNA fragment of about 3 kb indicating the detachment of the ipt gene and Ac was observed, while about 800 bp indicating the presence of the ipt gene.
No amplification of the DNA fragment was observed. This means that the ipt gene was detached and disappeared from the chromosomal DNA of this shoot together with Ac .

In contrast, No. 1-7 and 9
In this shoot, no DNA amplification of about 3 kb was detected from any of the chromosomal DNA samples, while amplification of about 800 bp was detected in all. Therefore, in these shoots, it is considered that the ipt gene is still present in the chromosomal DNA together with Ac .

[Comparative Example 2] In the culture of Tumefaciens-infected leaves, three of the normal bodies that had differentiated together with the multiple buds were separated, and these were subjected to the kanamycin resistance test, GU
S activity test, morphological observation one month after culture, and PC
An R analysis was performed.

The results are shown in Table 1. None of them have kanamycin resistance, GUS activity, and ability to form multiple buds. Furthermore, the DNA fragments of about 800 bp and about 3 kb showed no The amplification was not detected.

[Example 3] Polyblast 6 isolated in Example 2
A part of each of the three lines was further subcultured on a hormone-free MS agar medium, and the culture was continued. After about 2 months, a normal morphology that was visually distinguishable from the two lines of multiple shoots, that is, apical dominance was superior. Shoot, No. 13-1-3, 14-
1 to 4 were obtained in total. When this shoot was separated and transplanted to a medium having the same composition, an elongating rooted individual in a normal form was obtained. When the individuals obtained from 13-1 and 14-1 were subjected to PCR analysis in the same manner as in II-B of Example 2, amplification of a DNA fragment of about 800 bp was not detected from either. 3 kb
Amplification of the DNA fragment was detected by both, and it was confirmed that the ipt gene was removed and eliminated from the chromosomal DNA of these individuals together with Ac . FIG. 14 shows the results. In the figure, the numerical values shown on the left are the same as in FIG. GUS gene expression was detected in all individuals obtained from the seven shoots. Here, the state in which normal shoots differentiated from the multiple shoots is shown in FIG.
Shown in

Example 4 Of the nine shoots selected in Example 2, in Table 1, No. The leaves obtained from the shoot No. 7 were cultured on a hormone-free MS agar medium for about one month, and one normal body was visually selected and separated from the six adventitious buds differentiated therefrom. When this is transplanted to a medium of the same composition, a normal form of elongating rooted individual is obtained,
Further, as in II-B of Example 2, PC
When R analysis was performed, the chromosomal DNA was lost due to the disappearance of the approximately 800 bp DNA fragment and the amplification of the approximately 3 kb fragment.
From this, it was confirmed that the ipt gene was eliminated / disappeared together with Ac . FIG. 16 shows the results. In the figure, the numerical values shown on the left are the same as in FIG. For the same individual,
GUS gene expression was also confirmed.

[Embodiment 5]I. Site-specific recombination system (pSR1 system) from yeast
Separation  yeast(Zygosaccharomyces roux
ii, Purchased from Fermentation Research Laboratories)
Liquid medium (yeast extract 10 g / l, polypeptone 20 g
/ L, adenine 0.4g / l, glucose 20g / l)
And inoculated at 30 ° C. overnight. Culture medium was added to 690
Centrifuge at 0 × g, 20 ° C. for 3 minutes to collect cells (hereinafter referred to as cell
All yields were obtained under the same conditions. ).
ml of 0.2 M Tris-HCl (pH 8.0) -5
v / v% suspended in β-mercaptoethanol, occasionally
After leaving at 25 ° C for 30 minutes with gentle stirring, collect
Was. Zymolyase-20T (Seikagaku Corporation)
10 w / v% containing 2.5 mg / ml
 Sorbitol-5w / v% KPO4 (pH 6.8)
Add 1 ml and suspend, leave at 30 ° C. for 90 minutes,
After collecting cells by centrifugation, 1 ml of the lysate
(0.2M NaCl, 0.1M EDTA, 5w / v
% SDS, 50 mM Tris-HCl, pH8.
5) and further suspended in Proteinase K (20 m
g / ml), mixed and left at 60 ° C. for 1 hour.
The mixture is then brought to room temperature and phenol: chloropho
And then purified by extraction with chloroform and chloroform.
Equal amount of isopropanol to the supernatant,
And plasmid pSR1 was precipitated, and 6900 × g, 4
This was centrifuged at 10 ° C. for 10 minutes to precipitate it. Precipitated D
NA was washed with 70 v / v% ethanol and dried in vacuum.
Dried and dissolved in 100 μl of TE.

The DNA extracted as described above (chromosome D
PC (including both NA and plasmid pSR1)
Using the R method, only the site-specific recombination system present in the plasmid pSR1 (this is called the pSR1 system) was amplified. The pSR1 system is composed of an R gene, which is a recombinase gene, and a recombination sequence Rs, and its nucleotide sequence has already been clarified (H. Araki et a).
l. J. Mol. Biol. , 182: 191,19.
85). In the present invention, in order to amplify the R gene, a primer (5'-CCTCTAGAATGCA having an XbaI restriction enzyme site added at the 5 'position of 22 bases corresponding to positions 5596 to 5617 in the sequence of plasmid pSR1 is used.
ATTGACCAAGGATACTG-3 ') and 41
At the 5 'position of 22 bases corresponding to positions 26 to 4147, Sa
A primer (5'-CCG) having a cI restriction enzyme site added thereto
AGCTCTTAATCTTGTCAGGAGGGTGT
CA-3 ′) was synthesized and used. On the other hand, for amplification of Rs, two sets of 30 bases each (four types in total) of primers were synthesized and used. That is, one set contains the plasmid pSR
In the base sequence of No. 1, a primer (5'-AGGGATTGA) having a base sequence in which three bases of the sequence corresponding to positions 287 to 316 are replaced to introduce an SseI restriction enzyme site
GCTACTGGACGGGAATCCTGCA-
And 3 '), by substituting 4 bases of 690-719-numbered sequence, Hin dIII restriction enzyme site and Xho I
A primer (5′-
CAACTCGAGCAATCAAAGCTTCTCG
(TAGTC-3 ') (Rs amplified by this primer set is referred to as Rs1), and the other set is composed of 287 to 287 in the base sequence of plasmid pSR1.
By replacing 3 bases in the sequence corresponding to position 316, Xh
o I restriction enzyme site and a primer having the nucleotide sequence was introduced Eco RI restriction site (5'-AGGATTGA
GCTACTCGAGGGGAATTCTGGA-
And 3 '), by substituting 5 bases of 688-717-numbered sequence, is introduced in the Sse I restriction enzyme site primer (5'-ACTGGACCAATCCC
TGCAGGTCGTAGTCAA-3 ') (Rs amplified by this primer set is Rs
Call it 2. ).

For amplification of the R gene and Rs, 1 μl of 100 μl of the extracted DNA in the form of a TE solution was mixed with 0.2 μM of each primer set, and the IV-B of Example 1 was used.
Mix in each 50 μl of the mixture used in
The reaction was carried out in 30 heating cycles of 5 ° C. for 30 seconds, 55 ° C. for 30 seconds, and 72 ° C. for 1 minute and 30 seconds. The obtained reaction mixture was analyzed using agarose gel electrophoresis to confirm the amplification of the R gene and Rs.

[0071]II. Creating a vector  Rs1 amplified by the PCR method is replaced with a restriction enzymepstI and
AndXhoI and cut it with pSL1180 (Pharma
(Purchased from Shea Biotech Co., Ltd.)PstI andXh
oI restriction site and the plasmid pNPI126
I got

Next, in order to eliminate the EcoRI restriction enzyme site and the HindIII restriction enzyme site of pHSG398, cleavage with these restriction enzymes, blunting of the cleaved end with T4 polymerase I (large subunit), and further blunting were performed. Re-ligation of the ends was sequentially repeated to obtain a plasmid pNPI121 in which these restriction enzyme sites had disappeared.
The Sal I and Pst I restriction enzyme sites, inserts the Rs2 amplified by the PCR method was digested with restriction enzymes Xho I and Pst I, generating plasmid PNPI127.

[0073] and Sma I and of this pNPI127
In Xba I restriction enzyme sites, restriction enzyme from pNPI126
Rs1 cut out with Sma I and Spe I was inserted to obtain plasmid pNPI128.

The R gene was obtained by digesting the fragment amplified by the PCR method with restriction enzymes Xba I and Sac I,
It was inserted into Xba I and Sac I restriction enzyme sites HSG398. The resulting plasmid was designated as pNPI12
And 4.

[0075] Then, pBI221 was cut (purchased from CLONTECH Co.) with restriction enzymes pst I, the cut ends smoothed consolidated by a conventional method, the Sse I and Ps
t I restriction enzyme site of the lost plasmid pNPI111
I got Then, Xba I and S of this pNPI111
The restriction enzymes Xba I and Sac I were replaced with the GUS gene at the ac I restriction enzyme site by pNPI124.
Insert the R gene cut out by
Create an I125, further, now, cauliflower mosaic virus 35S promoter and the R gene linked to it, and Roh polyadenylation signal of nopaline synthase was excised with restriction enzymes Hin dIII and Eco RI, which Hin of PNPI128 dIII and E
By inserting the co RI restriction enzyme sites to give the plasmid pNPI129.

[0076] In addition, pNPI101 restriction enzyme Sma I
In cut, 5 'phosphorylated Hin dIII to the cleavage site
A linker (purchased from Takara Shuzo Co., Ltd.) was inserted to obtain a plasmid pNPI122. That is, this pNPI122
Is, Hin the Sma I restriction enzyme site of the pNPI101 d
It has been replaced with a III restriction enzyme site. Further, the pNPI122 was digested with restriction enzymes Pst I and the cut ends is smoothed consolidated by a conventional method, the Sse I及<br/> beauty Pst I restriction enzyme site is lost, the plasmid pNP
I123 was made and then the cauliflower mosaic virus 35S promoter and the i linked thereto
the pt gene, cut out with the restriction enzyme Hin dIII,
It was inserted into Hin dIII restriction enzyme sites of PNPI129, to obtain a plasmid pNPI130.

The vector of interest is the pNPI13
From 0, ipt gene and R gene linked respectively to the cauliflower mosaic virus 35S promoter, and the Rs in these ends, cut with restriction enzyme Pst I, obtained by inserting the Sse I restriction enzyme site of pBI121 This is called plasmid pNPI132.
It was named.

The plasmid pNPI132 was also introduced into E. coli JM109 strain, and c
oli JM109 (pNPI132) (Accession number: F
(ERMBP-5065).

The creation scheme of pNPI 132 is shown in FIGS.
9 and the restriction map of the T-DNA region is shown in FIG.
0 is shown. 17-19 and 20, the shaded triangles indicate the recombinant sequence R derived from the yeast plasmid pSR1.
s and its arrangement direction. Others are the same as FIG.

[0080] As Figure 20 more clearly, this plasmid, the ipt gene as a marker gene in the T-DNA region, than that it has a NPTII gene and the GUS gene as a model of the desired gene is the same as the pNPI106 . However, in this case, to function as a DNA element having a leaving Hanareno is recombination sequences of pSR1 system is a site-specific recombination system of yeast, a region between Rs, therefore, ipt gene in the same direction It is inserted in a form sandwiched between these two recombination sequences Rs.

[0081]III. Introduction of pNPI132 into tobacco
Of transgenic and transgenic tobacco  Similar to II and III in Example 1, pNPI132 was
A. Introduced into Tumefaciens LBA4404 strain,
A. Claw fascination is tobacco leaf pieces (here,Ni
cotiana tabacumcv. Material SR1
Used as After infection, the infected leaves are
Lingon 50mg / l supplemented hormone-free MS agar medium
And then only carbenicillin 500 mg / l
Was added to the same medium. One month later this composition
And continued cultivation for another month.
Eight strains were separated.

When these were transplanted again to a medium having the same composition and continued to be cultured, about 1 month later (ie, about 3 months after infection with A. tumefaciens), 7 out of the 48 strains showed When a shoot showing a normal morphology occurs with the naked eye, this is separated and transplanted to a medium of the same composition,
Eventually, 10 normal individuals could be obtained.

For these, the results of PCR analysis performed in the same manner as in Example II-B are shown in FIGS.
Shown in However, in this case, in addition to the primer used in II-B of Example 2, a primer capable of confirming the presence of the GUS gene was also used. By performing PCR analysis using these, when the ipt gene is present, about 8
00bp, T-DNA of the ipt gene is pNPI132
Approximately 3 kb when the portion sandwiched by Rs is removed from the region (up to this point is the same as the case where the analysis was performed by II-B in Example 2), and the GUS gene is present. In this case, a DNA fragment of about 1.7 kb is amplified. The numerical values shown on the left in FIGS. 21 to 23 are the same as those in FIG.

[0084]

[Table 2]

As is clear from Table 2, the presence of the ipt gene, which is a marker gene, was not detected from any of the chromosomes of individuals selected only by observing their morphology with the naked eye. DNA showing its detachment
Fragment amplification was detected. On the other hand, the presence of the GUS gene used as the target gene was detected in all individuals.

On the other hand, the apical bud of an individual obtained from a normal body (having a normal bud morphology) almost simultaneously with the 48 multibud lines and showing normal elongation and rooting was also obtained. When kanamycin resistance was assayed using the same (using a hormone-free MS agar medium supplemented with 200 mg / l kanamycin), it was found that two of the 16 individuals had kanamycin resistance.

Therefore, in order to further examine this kanamycin-resistant individual, another kanamycin-nonresistant one was selected.
PCR analysis was carried out together with three of the four individuals in the same manner as in the case of those obtained from the multi-bud. The result is shown in FIG. Numerical values shown on the left side of the figure are the same as in FIG.

As is clear from FIG. 24, in the two individuals showing kanamycin resistance, detachment of the region flanked by Rs containing the ipt gene and amplification of a DNA fragment showing the presence of the GUS gene were detected, respectively. It was confirmed that genes considered to be derived from pNPI132 were integrated in these chromosomes. Incidentally, the amplification according in three individuals kanamycin intolerance is not detected at all, also, i
No amplification of the DNA fragment indicating the presence of the pt gene was detected in any of the individuals.

These individuals originally obtained from a line that does not have the ability to form multiple shoots are A. cerevisiae in the first place. At the time of T. faecalis infection, pNPI132 should have originated from a cell that was not introduced into the chromosome, but assuming so, it is unlikely that the gene from this vector is present on that chromosome. Furthermore, among the genes derived from this chromosome, only the ipt gene does not exist, and N
The presence of the PTII gene (which is evident from the fact that these individuals exhibit kanamycin resistance) and the GUS gene are unlikely to occur at such frequencies in individuals who are present in perfect form.

Therefore, in these individuals, pNPI13
It is reasonable to assume that 2 was not introduced into the chromosome, but was introduced once. That is, pNPI13
The T-DNA region of A.2 Introduced into these chromosomes by infection with Tumefaciens. Here, the performance of the pSR1 system used for detachment of the marker gene was too good. After the infection with Tumefaciens and before the formation of multiple buds, its action would have led to the detachment of the ipt gene from the chromosome, eventually leaving only the NPTII and GUS genes to remain there. PCR analysis, in such kanamycin resistance individuals, were observed simultaneously with the presence of the GUS gene ipt
The elimination of the region flanked by Rs containing genes also supports this.

[Embodiment 6]I. Creating a vector  pBluescript II SK + (Toyobo Co., Ltd.
Made)EcoInserted into the RI restriction enzyme site,rol
A,lolB,as well asrolC7.6 kb in length
rolGene group (S. Kiyokawa, Plant
Physiol. , 104: 801, 1994)
enzymeEcoIt is cut out with RI, and this is pNPI129.E
coInserted into the RI restriction enzyme site, the plasmid pNPI
700 was created.

Next, from the pNPI700, the rol gene group, the cauliflower mosaic virus 35S promoter and the R gene linked thereto, and the Rs at both ends thereof were cut out with the restriction enzyme SseI , and this was cut out with the SseI restriction enzyme of pBI121. By inserting into the site, the desired plasmid pNPI702 was obtained.

This plasmid pNPI702 was also introduced into E. coli JM109 strain, and c
oli JM109 (pNPI702) (Accession number: F
(ERMBP-5066).

FIG. 25 shows a scheme for creating pNPI 702.
FIG. 26 shows a restriction enzyme map of the T-DNA region. The symbols used in these figures are the same as those in FIGS.

[0095] As apparent from FIG. 26, this plasmid is obtained by replacing the ipt gene of pNPI132 a marker gene, the rol genes. The rol gene group used in the present example is naturally A. It is known that it is present on the T-DNA of lysogenes, and when it is introduced into plant cells, it causes hairy roots in the plant tissue, and also causes morphological abnormalities such as dwarfing in the regenerated plants. ing.

[0096]II. Introduction and introduction of pNPI702 into tobacco
Of transgenic and transgenic tobacco  Similarly to II and III of Example 1, pNPI702 was
A. Introduced into Tumefaciens LBA4404 strain,
A. Infects Tumefaciens with tobacco leaf fragments and infects
Leaves acetosyringone 50mg / l hormone free
The cells were cultured on an MS agar medium for 3 days in a dark place. Then tikal
Cultured in the same medium supplemented with 400 mg / l of cillin only
However, hairy root differentiation was observed around 15 days after the start of culture.
The hairy roots were separated sequentially and the shoots were induced.
Medium (α-naphthaleneacetic acid 0.1 mg / l, benzyl
Denin 2.0 mg / l, ticarcillin 400 mg / l
MS adsorbed on MS agar) to differentiate adventitious buds
18 of which appear to be in normal form
Were visually selected. For these, II-B of Example 2
PCR analysis was performed in the same manner as in
And from that chromosome,rolSandwiched by Rs containing the gene
Region was desorbed. Note that here
As a primer, a primer in which such desorption is detected
(The same as those used in Examples 2 to 5 and Comparative Example 2.
That is, it was detected by amplification of a DNA fragment of about 3 kb. )
When,rolPrimers for detecting the presence of genes
(Detected by amplification of a DNA fragment of about 1.1 kb)
Was.

[Example 7] Using the vector prepared in Example 2 and pNPI106, a hybrid woodpecker (Populus sieboldii x Populus grandidenta: Populus Sieboldii x) was used as a woody plant.
Populus grandientata ).

The stem of a sterile flask seedling of the hybrid Yamanashi Y63 strain (collected from an experimental forest in Akita Jujo Chemical Co., Ltd.) was cut to a length of 5 mm so as not to include nodes, and this was further divided vertically into two parts. Used to introduce pNPI106. Tumefaciens was infected as in Example 1, III. After infection, the stem sections were purified from hormone-free modified MS supplemented with 40 mg / l acetosyringone.
Agar medium (Sucrose 2 w / v%, agar 0.8 w / v
v%) and cultured for 3 days, then transplanted to the same medium supplemented with only 500 mg / l of carbenicillin and continued to culture. The modified MS medium used here is one in which the concentrations of ammonia nitrogen and nitrate nitrogen are changed to 10 mM and 30 mM, respectively, in the composition of a normal MS medium.

After about 2 months, the adventitious buds generated from these sections were separated, and cultured for further 2 months to obtain polyblasts 6
Although the strains were obtained, they were continuously subcultured, and after about 4 months (about 8 months after the infection with A. tumefaciens), the strains elongated from this multibud.
Normal morphology shoots began to be observed. These shoots were diluted 2/3 times with MS gellan gum medium (2% w / v sucrose, 0.05 mg / l IBA).
By transplanting and culturing the cells into gellan gum (0.3 w / v%), the rooted individuals can be made normal.
By the tenth month of Tumefaciens infection, a total of seven normal individuals could be obtained from the two lines of polyblasts.

When PCR analysis was performed on them in the same manner as in Example III, the ipt gene was not detected in all the individuals, and the presence of the GUS gene was detected in two of the individuals. It was confirmed that the vector of the present invention functions effectively also in woody plants. In addition, in the remaining five normal individuals, only a part of the GUS gene was detected, but the individual used was the vector used here, p
The transposon Ac introduced by NPI106 is
It is thought that this was caused as a result of involving the GUS gene in the vicinity when the gene was detached from the chromosome together with the ipt gene, and detaching the GUS gene in such a manner as to cut it apart. Here, FIG. 27 shows a state in which normal shoots have differentiated from the multiple shoots.

[Embodiment 8] In Example 5, pNPI
A normal individual (through multiple buds) into which the gene was introduced by 132 was further transfected with the vector of the present invention.

Only the GUS gene of pNPI132 was HP
The T gene (hygromycin resistance gene) was replaced, and using this (pNPI140, FIG. 28), a gene transfer operation was performed on the above normal individual in the same manner as in II and III of Example 1. Multiple shoots were obtained from A. cerevisiae transfected with this vector. Forty days after the infection with T. faecalis, 10 strains were obtained. These strains were isolated, transplanted to a medium of the same composition (hormone-free MS agar medium supplemented with carbenicillin 500 mg / l), and continued to be cultured. That is, about 2 months after the infection of A. tumefaciens)
In one of them, shoot differentiation showing a normal morphology with the naked eye was observed.

FIG. 29 shows the results of PCR analysis performed on one of the differentiated normal shoots in the same manner as in Example IV-B. However, here, Example 1
In addition to the primers used in IV-B, a primer designed to bind to the NPTII gene and the HPT gene in order to detect detachment of the region flanked by Rs containing the ipt gene from chromosomal DNA, and Primers for detecting the presence of the HPT gene were also used (detected by amplification of a DNA fragment of about 4 kb and about 1 kb, respectively). In the figure, the numerical values shown on the left are the same as in FIG.

As apparent from FIG. 29, in the PCR analysis of the chromosomal DNA extracted from this shoot, R
While ipt gene with the region flanked by s a DNA fragment of about 4kb indicating that desorbed, and amplification of DNA fragment of about 1kb indicating the presence of the HPT gene is observed, i
No amplification of a DNA fragment of about 800 bp indicating the presence of the pt gene was observed. This is the chromosome DN of this shoot
A, the once introduced ipt gene is
While it has desorbed and disappeared from the region between the s
The HPT gene remains in the DNA, that is, the target gene (NPTII
Gene and GUS gene), a new target gene (HPT gene) is repeatedly introduced using the same gene as the ipt gene as a marker by using a vector in which only the configuration related to the target gene is changed. This indicates that the third, fourth, or more target genes can be introduced again using the same marker gene.

As is evident from the above examples, the line of the multibud obtained here always has the ipt gene in its chromosome (FIG. 6). All tissues that show significant morphological abnormalities that can be identified are ipt
N, a model target gene introduced with the gene
Kanamycin resistance by PTII gene expression was demonstrated without exception. This is because such a morphological abnormality-inducing gene can be sufficiently applied as a marker gene when introducing a gene into a plant, and the vector of the present invention using this as a marker gene is also useful as a vector for introducing a gene into a plant. It proves that

Further, this ipt gene is used as a transposon
When a gene, pNPI106, incorporated into Ac is used to introduce a gene into a plant, the target gene (NPTII gene and / or while properties imparted was held by GUS gene), obtained chute such that ipt gene loses lost by multiple shoots forming ability from the chromosome (Table 1, Fig. 13, 14, 16), moreover, such chutes And other forms can be identified with the naked eye (FIG. 1).
5, 27), these were selected, separated, and cultured to obtain an elongating rooted individual having a normal morphology. Also,
All the tissues further regenerated from the tissues obtained from the shoots did not have the ability to form polyblasts and exhibited normal morphology, demonstrating that such shoots and the like consisted of uniform cells.

Further, the same result was obtained from DN having desorption ability.
It was also observed when factor A was derived from a site-specific recombination system and when the rol gene was used as a morphological abnormality-inducing gene. That is, when transposons or transposons and the configuration related to the ipt gene in the vectors used in Examples 1 to 4 and 7 were replaced with these vectors, gene transfer into plants was performed (implementation). Also in Examples 5 and 6), from the tissue that formed an abnormal morphology until a certain time after the gene transfer operation, the morphological abnormality-inducing gene disappeared from its chromosome while the target gene was retained, and the tissue showed a normal morphology. Individuals were obtained (FIGS. 21 to 23, Table 2), and the same individuals were selected by a gene transfer operation, culture, and visual inspection using the same morphological abnormality-inducing gene as a marker by using a vector in which only the configuration related to the target gene was changed. By repeating this, it was also possible to introduce the target gene multiple times (Example 8, FIG. 29).

Therefore, by using such a vector in which a morphological abnormality-inducing gene is used as a marker gene and integrated with a DNA element having an elimination ability at a position where the behavior becomes one, first, after the gene transfer operation, The tissue showing abnormal morphology generated by culturing cells is visually selected, separated and further cultured, and then the resulting tissue showing normal morphology is also selected with the naked eye again. Thus, a tissue consisting only of cells in which only the target gene remains on the chromosome or the like and retains its function, and further, a plant can be obtained.

Further, as a DNA factor having an elimination ability,
With a site-specific recombination system, normal individuals can be obtained from morphologically abnormal tissues with a very high probability. In addition, since the detachment also occurs quickly, a tissue having a normal morphology can be detected more quickly and efficiently.

In the vector of the present invention, when a transposon is used as a detachable DNA element, and when a DNA element derived from a site-specific recombination system is used,
Table 3 shows the efficiency of obtaining a normal individual having the target gene from the resulting morphologically abnormal tissue in comparison with Table 3.

[0111]

[Table 3]

In Examples 1 to 5, in all cases, the tissue containing the transfected cells proliferated, differentiated adventitious buds, and regenerated the plant under the condition where no plant hormone was added. This is thought to be due to the function of the ipt gene integrated into the chromosome of the transfected cell as a marker gene. In other words, due to the expression of these genes, plant hormones are excessively produced in the cells, albeit to some extent due to the action of the linked promoter. Instead, the plant hormones produced by them also acted on adjacent tissues to some extent, resulting in a state similar to that when plant hormones were artificially added to the medium.

[0113]

The vector used in the present invention uses a morphological abnormality induction gene as a marker gene. For this reason, when a gene is introduced into a plant using this, in selecting a target gene-introduced tissue, the cells after the gene introduction operation are cultured in a normal medium using normal culture conditions, resulting in It is only necessary to visually identify the abnormally shaped tissue, and it is not necessary to add chemicals or the like to the medium for selection, which simplifies the operation and reduces the activity of plant cells during the selection. There is no possibility of inviting.

[0114] The morphological abnormality induction gene is ip
When the t gene is used, the tissue containing the transfected cells proliferates and differentiates adventitious buds and the like by its action.
Usually, in the culture of plant cells, the addition of plant hormones to the culture medium, which is essential for growth and differentiation, can be eliminated.

In addition, this vector is used by incorporating a morphological abnormality-inducing gene into a position where it is integrated with a DNA element capable of detachment. Then, with a certain probability after introduction of the gene into the plant cell, this marker gene, together with such a DNA element, is detached from the DNA on which it exists and functions, loses its function, and behaves at the same time as the introduced gene. Only the target gene present in the unrecognized position remains in a state where it can be expressed on the same DNA. For this reason, when such a configuration is adopted, this vector is only required to change the portion relating to the target gene to be introduced, without any change in other configurations including the marker gene. In order to carry out multiple gene introduction into one plant, the gene can be used repeatedly indefinitely.

In this case as well, the loss of the function of the morphological abnormality-inducing gene, which is a marker gene, can be visually detected as a change in the morphology of the transfected tissue, as in the case of gene transfer. Thus, it is possible to reliably and easily select a tissue consisting of only cells that remain in the cell and retain the function. Therefore, multiple gene transfer can be performed efficiently, and the transgenic individual consisting of only such cells, that is, the influence of the marker gene is eliminated,
Individuals who are completely free from the fears posed by the gene product can also be obtained without going through the mating process.

That is, the effect of the marker gene is eliminated, the fear of the gene product is completely released, and the portion other than the structure derived from the vector used for gene transfer is replaced with the parent gene to which the gene was transferred. An individual having the same genetic composition as the plant is created.

[Brief description of the drawings]

1 shows the general structure of the Ti plasmid, and FIG. It is a conceptual diagram containing a Pst I fragment restriction enzyme map of the T-DNA region of the Tumefaciens PO22 strain.

FIG. 2 is a diagram showing up to creation of pIPT2 in a pIPT4 creation scheme.

FIG. 3 is a diagram showing the steps from the creation of pIPT2 to the creation of pIPT3 in the pIPT4 creation scheme.

FIG. 4 is a diagram showing the steps from pIPT3 to pIPT4 creation in the pIPT4 creation scheme.

FIG. 5 is a restriction map of a T-DNA region in the structure of pIPT4.

FIG. 6 is a diagram showing the results of PCR analysis of multiple buds generated from tobacco into which a gene has been introduced using pIPT4.

FIG. 7: pNPI1 of the pNPI106 creation scheme
FIG. 2 is a diagram showing up to the creation of a file No. 02.

FIG. 8: pIPT4 among pNPI106 creation schemes
FIG. 3 is a diagram showing the process from creation of pNPI 102 to creation of pNPI 103.

FIG. 9 shows pNPI1 of the pNPI106 creation scheme.
FIG. 3 is a diagram illustrating steps from 03 to creation of a pNPI 106.

FIG. 10 is a restriction map of a T-DNA region in the structure of pNPI106.

FIG. 11 is a photograph showing a morphology of an organism, 2 shows the state of one shoot after one month of culture.

FIG. 12 is a photograph showing a morphology of an organism. 8 shows the state of one shoot after one month of culture.

FIG. 8 Shooting PC
It is a figure showing an R analysis result.

FIG. 13-1, 14-1
FIG. 10 is a view showing a PCR analysis result of a normal individual obtained from the shoot of Example 1.

FIG. 15 is a photograph showing a morphology of an organism, showing a state in which normal shoots have been differentiated from tobacco polyblasts in Example 3.

FIG. 16 is a diagram showing the operation of the fourth embodiment.
Of normal individuals obtained from leaves produced from the shoots of No. 7
It is a figure showing a CR analysis result.

FIG. 17: pNPI132 creation scheme, pNPI
FIG. 12 is a diagram showing up to the creation of 128.

FIG. 18 shows the pNPI 132 creation scheme, pNPI
FIG. 12 is a diagram showing from 128 to creation of pNPI 129.

FIG. 19: pNPI out of pNPI132 creation scheme
FIG. 10 illustrates steps from 101 and pNPI129 to creation of pNPI132.

FIG. 20 is a restriction map of a T-DNA region in the structure of pNPI132.

FIG. Among the figures showing the results of PCR analysis of normal individuals obtained from 15 to 21 shoots, the figure shows the results obtained by using primers that detect the presence of the ipt gene.

FIG. Among the diagrams showing the results of PCR analysis of normal individuals obtained from 15 to 21 shoots, the results obtained by using primers that detect the detachment of the region sandwiched by Rs containing the ipt gene are shown. is there.

FIG. Among the figures showing the results of PCR analysis of normal individuals obtained from 15 to 21 shoots, the figure shows the results obtained using primers that detect the presence of the GUS gene.

FIG. 24 is a diagram showing the results of PCR analysis of normal individuals generated from a line having no ability to form multiple shoots in Example 5.

FIG. 25 is a diagram showing a creation scheme of pNPI702.

FIG. 26 is a restriction map of a T-DNA region in the structure of pNPI702.

FIG. 27 is a photograph showing the morphology of an organism, showing a state in which normal shoots have been differentiated from the multi-bud of the crossed porcupine in Example 7.

FIG. 28 is a restriction map of a T-DNA region in the structure of pNPI140.

FIG. 29 shows the results of PCR analysis of normal shoots differentiated from multiple buds after multiple gene transfer in Example 8.

 ────────────────────────────────────────────────── ─── Continued on the front page (72) Inventor Etsuko Matsunaga 5-2-1-1, Oji, Kita-ku, Tokyo Nippon Paper Industries Central Research Laboratory (72) Mikiko Yamamon 5-2-1, Oji, Kita-ku, Tokyo F-term in Nippon Paper Industries Central Research Laboratory (reference) 2B030 AA02 AA03 AB03 AD20 CA17 CA19 CB02 CD03 CD07 CD09 CD10 4B024 AA08 AA20 BA80 CA04 CA07 DA01 DA05 EA05 GA11

Claims (4)

[Claims] 1. The following steps (A), (B), (C),
(D) is created without mating process,
Transgenic plants from which the effects of marker genes have been eliminated. (A) a target gene, a morphological abnormality-inducing gene as a marker gene, and a DNA element having a detachment ability; and
The morphological abnormality-inducing gene is located at a position where the behavior is unified with the DNA element having the elimination ability, and the target gene is located at a position where the behavior is not integrated with the DNA element having the elimination ability. (B) culturing plant cells transfected with this vector, detecting abnormal morphology of plant tissue occurring during the culturing, Step of selecting a tissue showing a morphological abnormality (C) A step of culturing the tissue showing a morphological abnormality selected in (B) above, and detecting and selecting a tissue having a normal morphology that appears during the culturing (D) A) a process of culturing the tissue having a normal morphology selected in the above (C) and regenerating a plant body; 2. The effect of the marker gene according to claim 1, wherein the portion other than the structure derived from the vector used for gene transfer has the same gene structure as the parent plant to which the gene has been introduced. Transgenic plants. 3. The following steps (A), (B), (C),
(D) is created without mating process,
A transgenic plant into which two or more target genes have been introduced. (A) a target gene, a morphological abnormality-inducing gene as a marker gene, and a DNA element capable of detachment;
The morphological abnormality-inducing gene is located at a position where the behavior is unified with the DNA element having the elimination ability, and the target gene is located at a position where the behavior is not integrated with the DNA element having the elimination ability. (B) culturing plant cells transfected with this vector, detecting abnormal morphology of plant tissue occurring during the culturing, Step of selecting a tissue showing a morphological abnormality (C) A step of culturing the tissue showing a morphological abnormality selected in (B) above, and detecting and selecting a tissue having a normal morphology that appears during the culturing (D) After repeating the above steps (A) to (C) at least once, culturing the tissue having the normal morphology selected in (C) to regenerate the plant 4. The method according to claim 3, wherein the portion other than the structure derived from the vector used for gene transfer has the same gene structure as the parent plant immediately before the target of gene transfer.
A transgenic plant into which the above target gene has been introduced.