JP2002125683A - Method for predicting effectiveness of interferon and primer and probe for the method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To establish a method for measuring the expression of human genes involved in the signal transduction induced by an interferon(INF), and to find a gene whose expression correlates with the effectiveness of the treatment by the INF administration to a hepatitis C chronic patient among these genes. SOLUTION: The objective method for predicting the effectiveness of the treatment by administrating an interferon to a patient comprises measuring the expression amount of JAK-bound protein gene and/or CIS3 gene in a subject hepatic cell collected from a hepatitis C patient.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to an interferon in chronic hepatitis C (hereinafter referred to as "IFN").
A method for predicting the effectiveness of therapy. Also,
It relates to primers and probes used in the method.

[0002]

2. Description of the Related Art At present, it has been confirmed that about 1 million people exist in Japan as chronic hepatitis C patients.
It is estimated that about 1 million HCV carriers exist from the HCV positive rate in blood donation. It is said that chronic hepatitis C has a very low rate of spontaneous healing and generally progresses from chronic persistent hepatitis to chronic active hepatitis in about 10 years, and then to cirrhosis and hepatocellular carcinoma in a shorter period of time. (Yasuda et al., Medical Practice, Vol. 14, No. 11, 1767-1770, 1997).

[0003] Since the hepatitis C virus (herein referred to as "HCV") was cloned in 1989,
Research on HCV has been energetically advanced, and the pathology of hepatitis C is being elucidated. However, the only treatment for chronic hepatitis C is interferon (IFN), which has been used since 1992. IFN therapy is known to have high cost and severe side effects, but is widely adopted because it is the only treatment at present. However, the effect is only 30% of C type chronic hepatitis cases
(Kurosaki et al., Molecular
Medicine 36, 2, 154-159, 19
99).

[0004] In IFN therapy, a liver biopsy is generally performed in advance. Since liver biopsy requires at least 6 hours of rest, the patient will be hospitalized for a total of 3 days, including 2 days before and after the test. In addition, once administration of IFN is started, it is almost always daily and for a long time (3-6 months), so that the burden on the patient becomes enormous. Also,
Depending on the type of IFN, IFN treatment costs 14
It is expensive from ¥ 100,000 to ¥ 6,000,000 ("Hepatitis C and interferon therapy", Medical Review), and in most cases, fever (about 93% of the administered patients) and hair loss (3%)
4%), general malaise (31%), leukopenia (about 92%)
%), Thrombocytopenia (91%) and various other side effects. As described above, although the INF therapy imposes a great physical and economic burden on the patient, as described above, its effect is not always expected, and a problem remains.

[0005] Until now, IF in chronic hepatitis C
Various attempts have been made to increase the effectiveness of N therapy. For example, they are classified into groups based on the difference in antibody reaction using a protein corresponding to the NS4 region of HCV as an antigen (SG: serological group),
The above method is further classified by genotype (subtype), or the method of quantifying the amount of virus (RNA) in blood, etc., and the treatment is predicted by analyzing HCV (Hino, Medical Practicing).
e, Vol. 14, No. 11, 1771-1775, 1997
Year). However, in these tests, about 60% of the patients judged to have a significant effect were actually effective, and about 60% of the patients had any effect.
It is only about 30% higher than when treatment was given.

As described above, the difference between the effectiveness and ineffectiveness of IFN therapy has been pursued as a difference on the HCV side.
It was possible to increase the effectiveness of some IFN therapy by analyzing V. But the rise is IF
Compared with the large physical and economic burden of patients on N therapy and the large burden of medical expenses in the country, it was not enough, and it was an issue to be further elucidated by researchers.

[0007] Therefore, as a part of several factors that determine the effectiveness of IFN therapy, the possibility of not a virus but a factor on the patient side, particularly a signaling pathway induced by interferon, has begun to be considered. .

[0008] In the last few years, IFN-induced signaling has been dramatically elucidated. Cytoki in 1995
ne-inducible SH2 protein
(Hereinafter referred to as "CIS") has been cloned (Yoshimura et al., EMBO J.
14, 2816-2826, 1995), JAK-binding protein (hereinafter referred to as "JAB") (Endo et al., N.
Other CIS families (CIS2 to CIS6), including the atrature, vol. 387, 921-924, 1997), have been cloned and their function has been analyzed. As a result, when IFN binds to the IFN receptor on the cell surface, it activates Janus kinase (hereinafter referred to as “JAK”) 1 and Tyk2 in the cell,
STAT (signal transducers a
nd activators of transcri
ption) 1 and STAT2 to phosphorylate C
IFN-inducible factors such as IS family and JAB (IF
N-stimulated response element
ment; ISRE). In addition, the expressed JAB and CIS
3 was also found to have a negative feedback effect, inhibiting the kinase activity of JAK.

[0009] From these facts, it can be concluded that IFN administration is not necessarily effective for all patients with chronic hepatitis C. The cause on the patient side is due to any of the above-mentioned signal transduction systems, especially JAB and CIS3. Sex was being discussed. However, there are few examples of actually measuring these.

The only exception is the IFNα / β receptor (referred to herein as “IFNα / βR”). Used a liver biopsy tissue sample from a chronic hepatitis C patient before IFN treatment to label IFNα / βR in tissue sections with peroxidase.
Reaction with α / βR antibody was performed to quantify color development. As a result, patients with chronic hepatitis C who were non-reactive or responded to the administration of INF and in which HCV RNA reappeared immediately after the end of the administration were compared with those who had responded to IFN. βR levels were significantly lower (Yats
Uhashi et al. of Hepatology, 3
0, 995-1003, 1999). However, this method stains pathological specimens, so the procedure is complicated, it takes a long time to obtain the results, such as preservation in paraffin for one month before staining, and the measured value is also a rough value, Is also big.

In addition to the IFN-induced signal transduction proteins, one of the few tests that examined the effectiveness of IFN therapy not from the virus side but from the HCV host, that is, the patient side, is as follows. It has 5A synthase (herein referred to as "2-5AS") activity, which has already been established as a clinical test. However, this test does not examine the liver, which is the target organ of the virus, but measures the amount of protein in peripheral blood.
Since the state after treatment is predicted from the ratio of N before and during treatment, it is inappropriate for prediction before the start of treatment.

[0012]

The problem to be solved by the present invention is to establish a method for quantifying the expression of a group of human genes involved in the signal transduction induced by IFN. The purpose of the present invention is to find a gene linked to the efficacy of treatment by IFN administration for patients with chronic hepatitis C. By examining the expression of these genes, the effects of expensive and burdensome IFN treatment can be predicted, and both physicians and patients can be informed whether IFN treatment should be performed or not. Useful for

[0013]

Means for Solving the Problems As a result of intensive studies, the inventors of the present invention have found that the expression levels of JAB and CIS3 are completely opposite to those initially thought in relation to the effectiveness / ineffectiveness of IFN treatment. Indicating the value, ie, JAB and CIS
Despite the fact that IFN treatment was thought to be ineffective in patients with high levels of these genes because 3 negatively affected IFN-induced signaling, actual data indicate that It was found that patients in the ineffective group showed low values, and that the efficacy of IFN treatment could be predicted by examining the expression levels of these JAB or CIS3 genes.

[0014] The inventors of the present application have used a high-sensitivity and accurate quantification method of the real-time detection PCR method for HCV (Japanese Patent Laid-Open No.
As a result of earnest studies utilizing the experience of establishing (1-1103899), it has become possible to measure mRNA of genes involved in IFN signaling with sufficient sensitivity and quantification. In addition, when the mRNA of several signal transduction genes was measured using the method, JAB in hepatocytes was found in patients with chronic hepatitis C who were effective and ineffective in IFN therapy. The present inventors have found that there is a significant difference between the mRNA amounts of IFNα / βR and CIS3 gene, and completed the present invention.

That is, the first aspect of the method for predicting the efficacy of IFN therapy according to the present invention is that the CIS3 gene or JS3 in a test hepatocyte collected from a hepatitis C patient is used.
It is a method for predicting the efficacy of treatment by administering interferon to the patient, comprising measuring the expression level of at least one of the AK binding protein genes.

The second aspect of the method for predicting the efficacy of IFN therapy according to the present invention is the above-described CIS3 gene or JA.
A method for predicting the efficacy of treatment by interferon administration, wherein the measurement of the expression level of a K-binding protein gene is a measurement of mRNA.

A third aspect of the method for predicting the efficacy of IFN therapy according to the present invention is to measure the amount of mRNA of the interferon α / β receptor gene in a test hepatocyte collected from a hepatitis C patient. And a method for predicting the efficacy of treatment by interferon administration to the patient.

In a fourth aspect of the method for predicting the efficacy of IFN therapy of the present invention, the measurement of the mRNA of the JAK binding protein gene, CIS3 gene, or interferon α / β receptor gene is a real-time detection PCR method. A method for predicting the efficacy of treatment by interferon administration.

The JAK binding protein gene mR of the present invention
The embodiment of the forward-side primer used for NA measurement is as follows: 15 to 46 consecutive nucleotides, preferably 24 nucleotides, of the nucleotide sequence represented by ID NO: 1 in the sequence listing.
An oligonucleotide having a base sequence consisting of bases to 28 bases. Among them, particularly preferred is an oligonucleotide having a base sequence consisting of 26 bases, represented by ID NO: 2 in the base sequence list. The base sequence represented by ID NO: 2 in the sequence listing corresponds to the JAK shown in ID NO: 19 in the sequence listing.
The nucleotide at position 1011 of the mRNA sequence of the binding protein gene (hereinafter referred to as “1011 nt”) to 1
It is equivalent to 036 nt. The JAK binding protein gene mRNA is known and described in GenBank accession number GI: 4507232.

The JAK binding protein gene mR of the present invention
An embodiment of the reverse-side primer used for NA measurement is an oligo having a nucleotide sequence consisting of 15 to 40, preferably 18 to 22 consecutive nucleotides in the nucleotide sequence represented by ID NO: 3 in the sequence listing. Nucleotides. Of these, particularly preferred are:
An oligonucleotide having a base sequence consisting of 20 bases, represented by ID NO: 4 in the base sequence list, can be mentioned. The nucleotide sequence represented by ID No. 4 in the sequence listing is 1137 nt to 1156 of the JAK binding protein gene mRNA sequence shown in ID No. 19 in the sequence listing.
nt.

The JAK binding protein gene mR of the present invention
An embodiment of the probe used for NA measurement is a continuous one of the base sequences represented by ID No. 5 in the sequence listing.
5 to 146 bases, preferably 14 to 3 bases
It is an oligonucleotide having a base sequence consisting of 4 bases. Among them, particularly preferred is an oligonucleotide having a base sequence consisting of 24 bases, represented by ID NO: 6 in the base sequence list.
The base sequence represented by ID No. 6 in the sequence listing hybridizes to 1053 nt to 1076 nt of the JAK binding protein gene mRNA sequence shown in ID No. 19 in the sequence listing.

The embodiment of the forward primer used for the measurement of CIS3 gene mRNA according to the present invention is a continuous base sequence represented by ID NO: 7 in the sequence listing of 15 to 40 bases, preferably 18 to 40 bases. An oligonucleotide having a base sequence of 22 bases. Among them, particularly preferred is an oligonucleotide having a base sequence of 20 bases represented by ID NO: 8 in the base sequence list. The base sequence represented by ID NO: 8 in the sequence listing corresponds to 198 nt to 217 nt of the CIS3 gene mRNA sequence shown in ID NO: 20 in the sequence listing. CIS3 gene mRNA is known and is described in Gen.
It is described in Bank access number GI: 2463522.

The embodiment of the reverse primer used for measuring the CIS3 gene mRNA of the present invention is a continuous base sequence represented by ID No. 9 in the sequence listing of 15 to 44 bases, preferably 22 to 44 bases. 2
It is an oligonucleotide having a base sequence consisting of 6 bases. Among them, particularly preferred is an oligonucleotide having a base sequence consisting of 24 bases, represented by ID NO: 10 in the base sequence list. The base sequence represented by ID NO: 10 in the sequence listing hybridizes to 364 nt to 387 nt of the CIS3 gene mRNA sequence shown in ID NO: 20 in the sequence listing.

The embodiment of the probe used for measuring the CIS3 gene mRNA according to the present invention is as follows:
O: It is an oligonucleotide having a base sequence of 10 to 166 bases, preferably 15 to 35 bases in the base sequence represented by 11. Among them, particularly preferred is IDN in the base sequence list.
O: An oligonucleotide having a base sequence of 25 bases represented by 12 can be exemplified. The base sequence represented by ID No. 12 in the sequence listing hybridizes to 224 nt to 248 nt of the CIS3 gene mRNA sequence shown in ID No. 20 in the sequence listing.

The embodiment of the forward primer used for the measurement of the interferon α / β receptor gene mRNA of the present invention is a continuous 15 to 40 bases, preferably 15 to 40 bases in the base sequence represented by ID No. 13 in the sequence listing. Is an oligonucleotide having a base sequence of 18 to 22 bases. Among them, particularly preferred is an oligonucleotide having a base sequence consisting of 20 bases and represented by ID NO: 14 in the base sequence list. ID of sequence listing
The base sequence represented by NO: 14 corresponds to ID N in the sequence listing.
O: It corresponds to 442 nt to 461 nt of the interferon α / β receptor gene mRNA sequence shown in 21. Interferon α / β receptor gene mRNA is known and is described in GenBank accession number GI: 11447571.

The reverse primer used for the measurement of the mRNA of the interferon α / β receptor gene of the present invention is composed of 15 to 42 consecutive nucleotides in the base sequence represented by ID NO: 15 in the sequence listing.
It is preferably an oligonucleotide having a base sequence consisting of 20 to 24 bases. Among them, particularly preferred is an oligonucleotide having a base sequence consisting of 22 bases, which is represented by ID NO: 16 in the base sequence list. ID N of the sequence listing
The base sequence represented by O: 16 corresponds to ID NO:
It hybridizes to 670 nt to 691 nt of the mRNA sequence of the interferon α / β receptor gene shown in 21.

The embodiment of the probe used for the measurement of the mRNA of the interferon α / β receptor gene according to the present invention is a continuous nucleotide sequence of 10 to 270 nucleotides, preferably 14 nucleotides, in the nucleotide sequence represented by ID No. 17 in the sequence listing. An oligonucleotide having a base sequence consisting of bases to 34 bases. Among them, particularly preferred are those represented by ID No. 18 in the base sequence list,
An oligonucleotide having a base sequence consisting of bases can be mentioned. The base sequence represented by ID NO: 18 in the sequence listing hybridizes to 485 nt to 508 nt of the mRNA sequence of the interferon α / β receptor gene shown in ID NO: 21 in the sequence listing.

The embodiment of the primer or the probe in the present invention is a primer or a probe characterized in that it is used for real-time detection PCR. The second embodiment of the probe of the present invention is A reporter fluorescent dye and a quencher fluorescent dye are bound to each other, and the reporter fluorescent dye emits its fluorescence by fluorescence resonance energy transfer when the reporter fluorescent dye is bound to the same probe as the quencher fluorescent dye. Real-time detection P, wherein the intensity is suppressed and the fluorescence intensity is not suppressed in a state where it is not bound to the same probe as the quencher fluorescent dye.
This is a probe used in the CR method.

[0029] The real-time detection PCR in the present invention is known per se, and devices and kits for the real-time detection PCR are also commercially available. Therefore, the PCR can be carried out using such commercially available devices and kits.

[0030]

DESCRIPTION OF THE PREFERRED EMBODIMENTS As described above, in the first method of the present invention, the expression level of at least one of the JAK binding protein gene and the CIS3 gene in test hepatocytes collected from a hepatitis C patient Is measured. The expression levels of these genes can be easily determined by conventional methods such as measurement of mRNA in cells and measurement of the produced protein by, for example, immunoassay. Above all,
The nucleotide sequences of mRNAs of these genes are already known (Ge
nBank No. 4507232 and GenBank
No. 2463522) (ID NO: 19 and ID
NO: 20), so that RT-PCR, which is a common method, is used.
Alternatively, mRNA can be easily measured by real-time detection PCR or the like. Among them, the method based on the measurement of mRNA is preferable because once the measurement method is established, the measurement does not require much skill and the subject can be measured with high sensitivity in a short time. In particular, real-time detection PCR
Is preferred because of its excellent sensitivity, reproducibility, and accuracy.

However, besides the real-time detection PCR, a preferable method is, for example, PNPP (p-nitrophenyl p
For example, there is a method in which the color is developed by using a phosphate and the like, and quantification is performed within an amplification concentration range showing linearity. This method is inferior in sensitivity and measurement range, but can be used as a screening for confirming the presence of a certain amount of DNA amount because the method can be performed with simple and simple equipment.

LAMP recently announced by Eiken Chemical Co., Ltd.
Method (Loop-mediatedisothermal)
amplification) (Natomi et al., N)
ucleic Acids Res. 28 volumes, 63, 2
000) and the ICAN method published by Takara Shuzo (WO0
0/56877) has a larger linear amplification range until reaching a plateau compared to the PCR method.
By quantifying the amount of amplification, for example, by inserting a luminescent intercalator (such as ethidium bromide) into the reaction solution, quantitative detection similar to the real-time detection PCR method can be performed. Therefore, when a reverse transcription reaction is necessary, first, mRNA is converted to DNA by the reverse transcription reaction,
By combining the A quantification method, INFα / βR,
It is possible to use each mRNA quantification method for the JAB and CIS3 genes.

Further, there is a possibility of application to a DNA microarray (DNA chip) which has recently become popular. At present, microarrays that can be detected in real time are not yet in practical use. However, for example, a method of performing the above-mentioned screening on a microarray together with other related genes can relatively easily create a system using existing techniques. It is theoretically possible to hybridize the target mRNA or DNA to the attached nucleic acid and perform amplification on the microarray, and further, it is hybridized to the probe attached on the microarray, which is currently under development. Since the method for electrically detecting the amount of nucleic acid has a very high sensitivity, it may be possible to perform measurement without the step of amplification.

In the second method of the present invention, IFNα / βR mRNA in a test hepatocyte is measured to obtain INF.
Predict the effect of treatment. The nucleotide sequence of the mRNA of IFNα / βR was obtained from GenBank No. 1147571 and is known, so that the mR of IFNα / βR
NA can be easily measured by conventional methods such as RT-PCR, real-time detection PCR, and the other methods described above.

As described above, among these methods, in particular,
Real-time detection PCR is preferred because it is excellent in sensitivity, reproducibility, and accuracy. In the real-time detection PCR method, it is generally known that subtle differences in the settings of primers and probes for amplification greatly affect the sensitivity and reproducibility. As a result, the inventors have found primers and probes suitable for real-time detection PCR, which can measure IFNα / βR mRNA particularly with high sensitivity, good reproducibility, and accurate measurement. As a result, the reverse transcription reaction and its product DN
A two-step amplification reaction of A was performed in the same test tube using only one kind of rTth DNA polymerase, and the detection limit was 100 copies per test tube.

In the present invention, INFα / βR, JAB,
Measurement of mRNA of each CIS3 gene can be performed by tests that predict existing IFN therapy, such as HCV RNA quantification, subtyping, HCV RNA hypervariable region (HCV-HVR).
By combining with the inspection such as 1), more accurate prediction can be made. The INFα verified in the present invention
/ ΒR, JAB, CIS3, IFR1, IFR2, PK
Further validation of genes other than the R, 2-5AS gene will create a more accurate INF therapy sensitivity panel.

[0037]

EXAMPLES Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

Example 1 Establishment of Measurement Method (1) Preparation of Primers and Probes A pair of PCR primers and a Taqman probe were synthesized for use in quantifying the RNA level of each gene. At the 5 'end of each probe, a fluorescent substance, 6-carboxyfluorescei, is used as a reporter.
n (FAM) is a quencher at the 3 ′ end, 6-
carboxy-tetramethyl-rhoda
min (TAMRA) was covalently bound.

As a primer for JAB, 5'-ggttgttgt
a gcagcttaac tgtatc-3 '(forward primer)
(ID No: 2), 5'-ggattctgca cagcagaaaa-3 '(reverse primer) (ID No: 4), 5'-actcgcacct cctacctctt catg-3' (ID No:
6) was produced. As described above, the mRNA sequence of JAB (ID NO: 19) is known, and GenBank 4
507232.

As a primer for CIS3, 5'-cacctt
tctg atccgcgaca-3 '(forward primer) (ID
No. 8), 5′-cggcatgtag tggtgcacca gctt-3 ′ (reverse primer) (ID No. 10), and 5′-accagcgcca cttcttcacgc tcag-3 ′ (IDN) as a probe
o: 12). As described above, mRN of CIS3
The A sequence (ID NO: 20) is known and can be found in GenBa.
nk24646322.

As a primer for IFNα / βR, 5 ′
-gtgacctcac agatgagtgg-3 '(forward primer) (ID No: 14) and 5'-ccctctgact gttcttcaat g
a-3 '(reverse primer) (ID No: 16), 5'-caccgtccta gaaggattca gcgg-3' (ID
No: 18) was produced. The mRNA sequence of the IFNα / β receptor gene (ID NO: 21) is known as described above, and is registered in GenBank 1147571.

As a primer for 2-5AS, 5'-ctcag
aaata ccccagccaa atc-3 '(forward primer)
And 5'-gtggtgagag gactgaggaa-3 '(reverse primer), 5'-ccaggtcagc gtcagatcgg cctc-
3 ′ was prepared. The sequence of 2-5AS mRNA is known and is registered in GenBank 220080.

As a primer for PKR, 5'-cctgtcctc
t ggttcttttg-3 '(forward primer) and 5'-tgtc
Aggaag gtcaaatctg-3 '(reverse primer) and 5'-ctacgtgtga gtcccaaagc aac-3' were prepared as probes. The PKR mRNA sequence is known and is described in GenBank.
k4505062.

As a primer for IFR-1, 5'-gca
aggccaa gaggaagtca-3 '(forward primer)
5'-tcatcaggca gagtggagct-3 '(reverse primer), 5'-ttccagccct gataccttct ctgat as probe
gg-3 'was prepared. The mRNA sequence of IFR-1 is known and is registered at GenBank4504720.

As a primer for IFR-2, 5'-att
gctgtgtccaactccagt-3 '(forward primer)
5 ''-gcaggctcta gaaacacacg tc -3 '(reverse primer), 5'-agcttctctt taactcagga ctcca as probe
gccca-3 'was prepared. The mRNA sequence of IFR-2 is known and is registered in GenBank 4755144.

GAPDH (Glyceraldehyd)
e-3-phosphate dehydrogena
se) as primer for 5'-gaaggtgaag gtcgga
gt-3 '(forward primer) and 5'-gaagatggtg at
gggatttc-3 ′ (reverse primer) and 5′-caagcttccc gttctcagcc-3 ′ were prepared as probes. GAPD
H mRNA sequence is known and GenBank 766
9491.

(2) Preparation of Standard RNA For each gene, cDNA clones or amplicons obtained by RT-PCR were
ript (Strategene) or pGEM-
It was integrated into Teasy (Promega) and subcloned. Cut the 3 'end of the inserted part with a restriction enzyme,
Proteinase K (200 μg / ml) and SDS
(50%, 1 hour), and phenol / chloroform extraction and ethanol precipitation were performed. This D
Using 1 μg of NA as a template, transcription was performed using an in vitro transcription kit MEGAscript (Ambion), and then the template DNA was removed. The product, synthetic RNA, was combined with 50 units of deoxyribonuclease 1 (d
eoxyribonuclease1) (Roche
Diagnostics) at 37 ° C. for 10 minutes and an RNeasy column (Qiagen).
Was purified. The absence of template DNA in the purified RNA was confirmed by performing PCR without reverse transcription and by not showing amplification.

The purified synthetic RNA is quantified by a colorimetric method,
The length and purity of the molecule were confirmed by electrophoresis. This RNA
With 0.2 μg / μl of baker's yeast transfer RNA
(Roche Diagnostics), 10 nm
ol / L dithiothreitol, and 200 units / m
0.1 ribonuclease inhibitor (Takara Shuzo).
Diluted with 01% diethyl pyrocarbonate treated water.

(3) RNA Extraction RNA was extracted from liver tissue using an ISOGEN RNA extraction system (Nippon Gene). RNA extracted
Was diluted with 0.01% diethylpyrocarbonate-treated water containing 10 nmol / L dithiothreitol and 200 units / ml ribonuclease inhibitor (Takara Shuzo). Furthermore, JAB, CIS3, IRF-1,
As a pretreatment for quantification of each mRNA of IRF-2, this extracted RNA was treated with 2 units of deoxyribonuclease 1 (Roc
He Diagnostics) at 37 ° C. for 10 minutes to decompose genomic DNA and perform 2-propanol precipitation. The absence of template DNA in the purified RNA was confirmed by performing PCR without reverse transcription and by not showing amplification. In the case of IFNα / βR, 2-5AS, and PKR, the primer is set over the boundary between the intron and the exon, so that this deoxyribonuclease treatment is unnecessary.

(4) Quantification by RTD-PCR (a) 2-5AS, PKR, IRF-1, IRF-2,
IFNα / βR, GAPDH mRNA levels and HCV
RTD-PCR was performed using the ABI Prism 7700 Sequence Detection System (Applied Biosys).
tem) and TaqMan EZ rTthRT-P
CR kit (IFNα / βR, 2-5AS, PKR, I
RF-1, IRF-2, GAPDH mRNA) or TaqMan PCR core reagent
A kit (JAB and CIS3 mRNA) was used.

TaqMan EZ rTth RT-P
The composition of the reaction solution when using the CR kit is TaqMa
nEZ buffer (50 mmol / L Bicine,
115 mmol / L potassium acetate, 0.01 mmol
/ L EDTA, 60 nmol / L 6-carbonyl-
X-rhodamine, 8% glycerol, pH 8.2), d
ATP, dGTP, dCTP were each 200 μmol / L,
500 μmol / L dUTP, 3 mmol / L manganese acetate, 0.1 units / μl rTth DNA polymerase, 0.01 units / μl AmpErase ur
acil-N-glycosylase (UNG), and template RNA. The concentration of the primer and the probe was 200 nmol for IFNα / βR for each of the forward primer, reverse primer and probe.
/ L, 200 nmol / L, 200 nmol / L, 2-
300 nmol / L, 50 nmol / L, 1 for 5AS
00 nmol / L, 50 nmol / L for PKR, 30
0 nmol / L, 200 nmol / L, 200 nmol / L, 200 nmol / L, 100 nm for IRF-1
ol / L, 200 nmol / L, 200 for IRF-2
nmol / L, 100 nmol / L, 2 for GAPDH
00 nmol / L, 200 nmol / L, 200 nmo
1 / L.

2-5AS, PKR, IRF-1, IRF
-2, the determination of the amount of each mRNA of IFNα / βR and GAPDH was performed as follows. That is, UNG was activated at 50 ° C. for 2 minutes, and reverse transcription (RT) was performed at 60 ° C. for 30 minutes.
UNG was inactivated at 5 ° C. for 5 minutes. Followed by PCR
Amplification at 95 ° C. for 20 seconds and annealing and extension reaction at 60 ° C. (2-5AS, PKR, IRF-1, IRF-1
RF-2) or 62 ° C (IFNα / βR, GAPD
H,) for 50 cycles under the condition of 1 minute.

(B) Determination of the mRNA amounts of JAB and CIS3 The determination of the mRNA amounts of JAB and CIS3 was performed by a two-step RT-PCR method. That is, ThermoS
60 ° C. with 1 μmol / L reverse primer using scriptRT-PCR (GIBCO BRL)
After performing a reverse transcription reaction for 30 minutes and treating with RNaseH, TaqMan PCR core reagent was used.
The kit was used for PCR amplification.

The composition of the PCR reaction solution of JAB and CIS3 was TaqMan core reagent buffer, dATP, dGTP, and dCTP each having a volume of 200 μm.
1 / L, 400 μmol / L dUTP, 200 nmo
1 / L forward primer, 200 nmol / L reverse primer, 1.5 mmol / L magnesium chloride, 0.05 units / μl AmpliTaq Go
ld, 0.01 units / μl AmpErase ura
cil-N-glycosylase (UNG), and 1/10 amount of reverse transcribed cDNA.

In the first step, UNG was activated at 50 ° C. for 2 minutes, followed by reverse transcription reaction, followed by inactivation of UNG and activation of AmpliTaq Gold at 95 ° C. for 9 minutes. After amplification at 95 ° C. for 20 seconds, annealing and extension reaction were performed for 6 seconds.
0 ° C. (JAB) for 1 minute, or annealing at 62 ° C. for 1 minute
The extension reaction was performed at 72 ° C. for 1 minute (CIS3) for 50 cycles.

(C) Data analysis After amplification, real-time data analysis was performed. A threshold was chosen, the point at which the amplification plot crossed the threshold was defined as Ct, and the number of RNA copies in the sample was calculated. These were corrected for GAPDH mRNA copy number.

(7) Statistical Processing Statistical analysis is based on Student's Student's
Performed by st-test. Statistical significance is P <
The level was 0.5.

(8) Verification of System Effectiveness The sensitivity and the quantification of the RTD-PCR were verified using the standard RNAs adjusted as described above. In the reaction using rTth DNA polymerase, IFNα / β
R, PKR, IRF-1, IRF-2 and GAPDH
Was measurable up to a minimum of 100 copies per tube. The correlation coefficient between the RNA copy number and the number of cycles exceeding the threshold ranged from 0.999 to 1.000 at a copy number of 100 to 10 8.

Regarding the mRNA quantification of JAB and CIS3, the detection sensitivity was J
AB was 10 6 or more, and CIS 3 was 10 5 or more.
CR, reverse transcription by ThermoScript RT-PCR, followed by RNaseH treatment and Ampli
Quantification was by PCR amplification with Taq Gold.
As a result, in both cases, detection of 1,000 copies per tube became possible. The correlation coefficients for JAB and CIS3 were 0.996 and 0.995, respectively.

In order to confirm the effectiveness of these RTD-PCR methods, mRNA of 2-5AS and PKR in HepG cell lines stimulated with INF-α or IFN-γ was examined.
Was measured. When each mRNA value was corrected with GAPDH, it was confirmed that both increased in response to the concentration of IFN (FIG. 1). From the above, the measurement system was used for IFNα / βR, PKR, IRF-1, IRF-
2. It was shown to be effective as an mRNA quantification method for each gene of JAB and CIS3.

Example 2 (1) Liver biopsy tissue sample Tissue from liver biopsy before IFN treatment from 23 patients (average age 48.3 +/- 14.1 years) consisting of 13 males and 10 females Samples were obtained (Table 1). All were diagnosed with chronic hepatitis C, and this diagnosis was confirmed histopathologically. HCV RNA levels in the table are measured on the day of liver biopsy. In these patients, natural IF
N-α (Sumitomo Pharmaceutical) was administered at 6 million units daily for 16 weeks, and a monthly checkup was conducted for at least 12 months after treatment. Patients can use CR-Sus (sus
(tained responder), CR-Rel
(Relapped responder), NR (n
(on-responder). That is, in the CR-Sus, HCV RNA is eliminated from serum by treatment, and ALT (alanine transa) is obtained.
minase) returned to a normal value and the condition was maintained for 6 months after the treatment.
RNA disappeared from serum and ALT returned to normal, but recurred immediately after the end of IFN administration (HCV R
Patient group, which showed the appearance of NA and high ALT value), NR was IF
A group of patients who did not show any response to N. As a control, liver biopsy samples were obtained from six healthy persons other than the above patients.

[0062]

[Table 1]

(2) Measurement Using Liver Tissue Samples and Results Using the liver tissue of a chronic hepatitis C patient as a sample, the relationship between the administration of IFN and the expression of the above-described IFN-related genes was examined.
HCV RNA levels are lower in CR-Sus patients
-Compared to the Rel and NR patient groups, they showed significantly lower values (Fig. 2a). IFNα / βR is a healthy person (non-HC
Although no significant difference was observed between V) and the CR-Sus patient group, CR-Sus showed a higher value than the CR-Rel or NR patient group (FIG. 2, b). JAB, C
Also in IS3, CR-Sus was significantly higher than CR-Rel or NR patients (FIG. 3a,
b). On the other hand, 2-5AS, PKR, IRF-1 and IR
For F-2, the CR-Sus patient group and CR-R
No differences between the el or NR patient groups were seen (FIGS. 2c, d, 3c, d).

[0064]

<Sequence List> <110> Yatsuhashi, Hiroshi The Tokyo Metropolitan Institute of Medical Science Chugai Pharmaceutical Co., LTD SRL, Inc. <120> Method to predict responsibility to IFN therapy in hepatitis C and its primers and probes <160> 21 < 210> 1 <211> 46 <212> DNA <213> Artificial Sequence <223> forward primer for JAK binding protein <400> 1 gggtccccct ggttgttgt gcagcttaac tgtatctgga gccagg 46

<210> 2 <211> 26 <212> DNA <213> Artificial Sequence <223> forward primer for JAK binding protein <400> 2 ggttgttgta gcagcttaac tgtatc 26

<210> 3 <211> 40 <212> DNA <213> Artificial Sequence <223> reverse primer for JAK binding protein <400> 3 atataaaata ggattctgca cagcagaaaa ataaagccag 40

<210> 4 <211> 20 <212> DNA <213> Artificial Sequence <223> reverse primer for JAK binding protein <400> 4 ggattctgca cagcagaaaa 20

<210> 5 <211> 146 <212> DNA <213> Homo sapiens <223> probe for JAK binding protein <400> ttatat 146

<210> 6 <211> 24 <212> DNA <213> Artificial Sequence <223> probe for JAK binding protein <400> 6 actcgcacct cctacctctt catg 24

<210> 7 <211> 40 <212> DNA <213> Artificial Sequence <223> Forward primer for CIS3 <400> 7 agcccgccgg cacctttctg atccgcgaca gctcggacca 40

<210> 8 <211> 20 <212> DNA <213> Artificial Sequence <223> Forward primer for CIS3 <400> 8 cacctttctg atccgcgaca 20

<210> 9 <211> 44 <212> DNA <213> Artificial Sequence <223> Reverse primer for CIS3 <400> 9 ctccaggggg cggcatgtag tggtgcacca gcttgagcac gcag 44

<210> 10 <211> 24 <212> DNA <213> Artificial Sequence <223> Reverse primer for CIS3 <400> 10 cggcatgtag tggtgcacca gctt 24

[0074] <210> 11 <211> 213 <212> DNA <213> Homo Sapience <223> probe for CIS3 <400> 11 agcccgccgg cacctttctg atccgcgaca gctcggacca gcgccacttc ttcacgctca 60 gcgtcaagac ccagtctggg accaagaacc tgcgcatcca gtgtgagggg ggcagcttct 120 ctctgcagag cgatccccgg agcacgcagc ccgtgccccg cttcgactgc gtgctcaagc 180 tggtgcacca ctacatgccg ccccctggag ccc 213

<210> 12 <211> 25 <212> DNA <213> Artificial Sequence <223> probe for CIS3 <400> 12 accagcgcca cttcttcacg ctcag 25

<210> 13 <211> 40 <212> DNA <213> Artificial Sequence <223> Forward primer for IFN alpha / beta receptor <400> 13 agatcatttt gtgacctcac agatgagtgg agaagcacac 40

<210> 14 <211> 20 <212> DNA <213> Artificial Sequence <223> Forward primer for IFN alpha / beta receptor <400> 14 gtgacctcac agatgagtgg 20

<210> 15 <211> 42 <212> DNA <213> Artificial Sequence <223> Reverse primer for IFN alpha / beta receptor <400> 15 cttaacaatt ccctctgact gttcttcaat gacgagagat aa 42

<210> 16 <211> 22 <212> DNA <213> Artificial Sequence <223> Reverse primer for IFN alpha / beta receptor <400> 16 ccctctgact gttcttcaat ga 22

<210> 17 <211> 270 <212> DNA <213> Hommo sapience <223> probe for IFN alpha / beta receptor <400> accagagttt gagattgttg gttttaccaa ccacattaat 180 gtgatggtga aatttccatc tattgttgag gaagaattac agtttgattt atctctcgtc 240 attgaagaac agtcagaggg aattgttaag 270

<210> 18 <211> 24 <212> DNA <213> Artificial Sequence <223> probe for IFN alpha / beta receptor <400> 18 caccgtccta gaaggattca gcgg 24

<210> 19 <211> 1216 <212> DNA <213> Homo sapience <221> mRNA <223> JAK binding protein mRNA <308> GI: 4507232 <400> cggcgtcccg cgccccgccg ccagcgcacc cccggacgct 120 atggcccacc cctccggctg gccccttctg taggatggta gcacacaacc aggtggcagc 180 cgacaatgca gtctccacag cagcagagcc ccgacggcgg ccagaacctt cctcctcttc 240 ctcctcctcg cccgcggccc ccgcgcgccc gcggccgtgc cccgcggtcc cggccccggc 300 ccccggcgac acgcacttcc gcacattccg ttcgcacgcc gattaccggc gcatcacgcg 360 cgccagcgcg ctcctggacg cctgcggatt ctactggggg cccctgagcg tgcacggggc 420 gcacgagcgg ctgcgcgccg agcccgtggg caccttcctg gtgcgcgaca gccgccagcg 480 gaactgcttt ttcgccctta gcgtgaagat ggcctcggga cccacgagca tccgcgtgca 540 ctttcaggcc ggccgctttc acctggatgg cagccgcgag agcttcgact gcctcttcga 600 gctgctggag cactacgtgg cggcgccgcg ccgcatgctg ggggccccgc tgcgccagcg 660 ccgcgtgcgg ccgctgcagg agctgtgccg ccagcgcatc gtggccaccg tgggccgcga 720 gaacctggct cgcatccccc tc aaccccgt cctccgcgac tacctgagct ccttcccctt 780 ccagatttga ccggcagcgc ccgccgtgca cgcagcatta actgggatgc cgtgttattt 840 tgttattact tgcctggaac catgtgggta ccctccccgg cctgggttgg agggagcgga 900 tgggtgtagg ggcgaggcgc ctcccgccct cggctggaga cgaggccgca gaccccttct 960 cacctcttga gggggtcctc cccctcctgg tgctccctct gggtccccct ggttgttgta 1020 gcagcttaac tgtatctgga gccaggacct gaactcgcac ctcctacctc ttcatgttta 1080 catataccca gtatctttgc acaaaccagg ggttggggga gggtctctgg ctttattttt 1140 ctgctgtgca gaatcctatt ttatattttt taaagtcagt ttaggtaata aactttatta 1200 tgaaagtttt tttttt 1216

<210> 20 <211> 678 <212> DNA <213> Homo sapience <221> mRNA <223> CIS3 mRNA <308> GI: 2463522 <400> 20 atggtcaccc acagcaagtt tcccgccgcc gggatgagcc gccccctgga caccagcctg 60 cgcctcagacgcccctg tggtgaacgc agtgcgcaag 120 ctgcaggaga gcggcttcta ctggagcgca gtgaccggcg gcgaggcgaa cctgctgctc 180 agtgccgagc ccgccggcac ctttctgatc cgcgacagct cggaccagcg ccacttcttc 240 acgctcagcg tcaagaccca gtctgggacc aagaacctgc gcatccagtg tgaggggggc 300 agcttctctc tgcagagcga tccccggagc acgcagcccg tgccccgctt cgactgcgtg 360 ctcaagctgg tgcaccacta catgccgccc cctggagccc cctccttccc ctcgccacct 420 actgaaccct cctccgaggt gcccgagcag ccgtctgccc agccactccc tgggagtccc 480 cccagaagag cctattacat ctactccggg ggcgagaaga tccccctggt gttgagccgg 540 cccctctcct ccaacgtggc cactcttcag catctctgtc ggaagaccgt caacggccac 600 ctggactcct atgagaaagt cacccagctg ccggggccca ttcgggagtt cctggggagag 660 tacgatgccc cgctttaa 678

<210> 21 <211> 2604 <212> DNA <213> Homo sapience <221> mRNA <223> IFN alpha / beta receptor mRNA <308> GI: 1147571 <400> 21 cgagcgtcgg gtcccagagc cgggcgcggc tggggcccga ggctagcatc tctcgggagc 60 cgcaaggcga gagctgcaaa gtttaattag acacttcaga attttgatca cctaatgttg 120 atttcagatg taaaagtcaa gagaagactc taaaaatagc aaagatgctt ttgagccaga 180 atgccttcat cgtcagatca cttaatttgg ttctcatggt gtatatcagc ctcgtgtttg 240 gtatttcata tgattcgcct gattacacag atgaatcttg cactttcaag atatcattgc 300 gaaatttccg gtccatctta tcatgggaat taaaaaacca ctccattgta ccaactcact 360 atacattgct gtatacaatc atgagtaaac cagaagattt gaaggtggtt aagaactgtg 420 caaataccac aagatcattt tgtgacctca cagatgagtg gagaagcaca cacgaggcct 480 atgtcaccgt cctagaagga ttcagcggga acacaacgtt gttcagttgc tcacacaatt 540 tctggctggc catagacatg tcttttgaac caccagagtt tgagattgtt ggttttacca 600 accacattaa tgtgatggtg cat aaatttccat ctattgttga gagcat gattagat gagga tgacatgatgacatgatgacatgatgacatagtattag t ttcacctata tcattgacaa gttaattcca aacacgaact 780 actgtgtatc tgtttattta gagcacagtg atgagcaagc agtaataaag tctcccttaa 840 aatgcaccct ccttccacct ggccaggaat cagaattttc ataacttttt agcctggcca 900 tttcctaacc tgccaccgtt ggaagccatg gatatggtgg aggtcattta catcaacaga 960 aagaagaaag tgtgggatta taattatgat gatgaaagtg atagcgatac tgaggcagcg 1020 cccaggacaa gtggcggtgg ctataccatg catggactga ctgtcaggcc tctgggtcag 1080 gcctctgcca cctctacaga atcccagttg atagacccgg agtccgagga ggagcctgac 1140 ctgcctgagg ttgatgtgga gctccccacg atgccaaagg acagccctca gcagttggaa 1200 ctcttgagtg ggccctgtga gaggagaaag agtccactcc aggacccttt tcccgaagag 1260 gactacagct ccacggaggg gtctgggggc agaattacct tcaatgtgga cttaaactct 1320 gtgtttttga gagttcttga tgacgaggac agtgacgact tagaagcccc tctgatgcta 1380 tcgtctcatc tggaagagat ggttgaccca gaggatcctg ataatgtgca atcaaaccat 1440 ttgctggcca gcggggaagg gacacagcca acctttccca gcccctcttc agagggcctg 1500 tggtccgaag atgctccatc tgatcaaagt gacacttctg agtcagatgt tgaccttggg 1560 gatggttata taatgagatg actccaaa ac tattgaatga acttggacag acaagcacct 1620 acagggttct ttgtctctgc atcctaactt gctgccttat cgtctgcaag tgttctccaa 1680 gggaaggagg aggaaactgt ggtgttcctt tcttccaggt gacatcacct atgcacattc 1740 ccagtatggg gaccatagta tcattcagtg cattgtttac atattcaaag tggtgcactt 1800 tgaaggaagc acatgtgcac ctttccttta cactaatgca cttaggatgt ttctgcatca 1860 tgtctaccag ggagcagggt tccccacagt ttcagaggtg gtccaggacc ctatgatatt 1920 tctcttcttt cgttcttttt tttttttttt ttgagacaga gtctcgttct gtcgcccaag 1980 ctggagcgca atggtgtgat cttggctcac tgcaacatcc gcctcccagg ttcaagtgat 2040 tctcctgcct cagcctccct cgcaagtagc tgggattaca ggcgcctgcc accatgccta 2100 gcaaattttt gtatttttag tagagacagg attttaccat gttggccagg ctggtctcaa 2160 actcctgacc tcaagtgatc tgccctcctc agcctcgtaa agtgctggga ttacaggggt 2220 gagccgctgt gcctggctgg ccctgtgata tttctgtgaa ataaattggg ccagggtggg 2280 agcagggaaa gaaaaggaaa atagtagcaa gagctgcaaa gcaggcagca agggaggagg 2340 agagccaggt gagcagtgga gagaaggggg gccctgcaca aggaaacagg gaagagccat 2400 cgaagtttca gtcggtgagc cttgggcact cac ccatgtc acatcctgtc tcctgcaatt 2460 ggaattccac cttgtccagc cctccccagt taaagtgggg aagacagact ttaggatcac 2520 gtgtgtgact aatacagaaa ggaaacatgg cgtcggggag agggataaaa cctgaatgcc 2580 atattttaag ttaaaaaaaa

[Brief description of the drawings]

FIG. 1 shows the concentration of IFN-α or IFN-γ,
2-5AS or PKR mRNA with GPDH correction
The relationship between the quantities is shown.

[Fig. 2] Fig. 2 shows that a healthy subject and IFN administration were significantly effective,
HCV RNA (a) in relapsed, ineffective patients
IFNα / β receptor (b), 2-5AS (c), P
9 shows mRNA levels obtained by GPDH correction of KR (d).

FIG. 3 shows JAB (a), CIS3 (b), and IAB in a group of patients who were remarkably effective, relapsed, or ineffective against IFN administration.
The mRNA level of RF-1 (c) and IRF-2 (d) by GPDH correction is shown.

 ──────────────────────────────────────────────────続 き Continued from the front page (71) Applicant 390037006 SRL Co., Ltd. 2-41-19, Akebonocho, Tachikawa-shi, Tokyo (72) Inventor Hiroshi Yahashi 2-1001-1 Kuhara, Omura-shi, Nagasaki Pref. 72) Inventor Asao Katsume 1-135 Komamon, Gotemba City, Shizuoka Prefecture Inside Chugai Pharmaceutical Co., Ltd.Fuji Gotemba Research Laboratories Person Kyoko Ohara 3-18-22 Honkomagome, Bunkyo-ku, Tokyo Tokyo Metropolitan Institute of Medical Science Tokyo Metropolitan Institute of Medical Science (72) Inventor Michiho Ohara 3-182, Honkomagome, Bunkyo-ku, Tokyo Tokyo Metropolitan Institute of Medical Science Tokyo Metropolitan Institute of Medical Science F-term (reference) 4B024 AA14 BA36 CA04 CA09 CA12 DA03 FA01 GA11 HA14 4B063 QA01 QQ02 QQ43 QQ53 QQ58 QR32 QR56 QR62 QS03 QS34 QS36

Claims (24)

[Claims] Claims: 1. Effectiveness of a treatment by administering interferon to a hepatitis C patient, comprising measuring the expression level of at least one of a JAK binding protein gene and a CIS3 gene in a test hepatocyte collected from the patient. How to predict gender. 2. The method according to claim 1, wherein the measurement of the expression level of the CIS3 gene or the JAK binding protein gene is a measurement of mRNA. 3. A method for predicting the efficacy of a treatment by interferon administration to a patient with hepatitis C, the method comprising measuring the mRNA amount of an interferon α / β receptor gene in a test hepatocyte collected from the patient. 4. The method according to claim 2, wherein the measurement of the mRNA is a real-time detection PCR method. 5. A forward side used for measuring a JAK binding protein gene mRNA, which is an oligonucleotide having a nucleotide sequence consisting of 15 to 46 consecutive nucleotides in the nucleotide sequence shown by ID NO: 1 in the sequence listing. Primer. 6. The primer according to claim 5, wherein the oligonucleotide comprises 26 bases having a base sequence represented by ID NO: 2 in the base sequence list. 7. The reverse side used for measuring a JAK-binding protein gene mRNA, which is an oligonucleotide having a nucleotide sequence consisting of 15 to 40 consecutive nucleotides in the nucleotide sequence represented by ID NO: 3 in the sequence listing. Primer. 8. The primer according to claim 7, wherein the oligonucleotide comprises 20 bases having a base sequence represented by ID NO: 4 in the base sequence list. 9. A probe used for measurement of JAK binding protein gene mRNA, which is an oligonucleotide having a nucleotide sequence consisting of 10 to 146 consecutive nucleotides in the nucleotide sequence shown in ID No. 5 in the sequence listing. 10. The probe according to claim 9, wherein the oligonucleotide comprises 24 bases having a base sequence represented by ID NO: 6 in the base sequence list. 11. CIS3, which is an oligonucleotide having a base sequence consisting of 15 to 40 contiguous bases among the base sequence represented by ID NO: 7 in the sequence listing
Forward primer used for gene mRNA measurement. 12. The primer according to claim 11, wherein the oligonucleotide comprises 20 bases having a base sequence represented by ID NO: 8 in the base sequence list. 13. CIS3, which is an oligonucleotide having a base sequence consisting of 15 to 44 consecutive bases in the base sequence represented by ID NO: 9 in the sequence listing
Reverse primer used for gene mRNA measurement. 14. The oligonucleotide having a nucleotide sequence represented by ID NO: 10 in the nucleotide sequence list.
14. The primer according to claim 13, comprising a base. 15. CI, which is an oligonucleotide having a base sequence consisting of 10 to 166 consecutive bases in the base sequence represented by ID NO: 11 in the sequence listing
Probe used for S gene mRNA measurement. 16. The oligonucleotide having a nucleotide sequence represented by ID NO: 12 in the nucleotide sequence list.
17. The probe according to claim 16, comprising a base. 17. An interferon α / β receptor gene mRNA which is an oligonucleotide having a nucleotide sequence consisting of 15 to 40 consecutive nucleotides among the nucleotide sequence shown by ID No. 13 in the sequence listing, and used for measurement of mRNA. Forward side primer. 18. The oligonucleotide has a nucleotide sequence represented by ID NO: 14 in the nucleotide sequence list.
18. The primer according to claim 17, consisting of a base. 19. It is used for measurement of interferon α / β receptor gene mRNA, which is an oligonucleotide having a base sequence consisting of consecutive 15 to 42 bases among the base sequence shown by ID NO: 15 in the sequence listing. Reverse side primer. 20. The oligonucleotide having a nucleotide sequence represented by ID NO: 16 in the nucleotide sequence list.
The primer according to claim 19, comprising a base. 21. An interferon α / β receptor gene mRNA which is an oligonucleotide having a nucleotide sequence consisting of 10 to 270 consecutive nucleotides in the nucleotide sequence represented by ID NO: 17 in the sequence listing and used for measurement of mRNA. probe. 22. The oligonucleotide having a nucleotide sequence represented by ID NO: 18 in the nucleotide sequence list.
22. The probe according to claim 21, comprising a base. 23. The method according to claim 5, wherein the primer or the probe is used in the real-time detection PCR method according to claim 4. Description:
The primer or probe according to item 1. 24. The probe, wherein the reporter fluorescent dye is bound to a quencher fluorescent dye, wherein the reporter fluorescent dye is bound to the same probe as the quencher fluorescent dye. Is used in a real-time detection PCR method, wherein the fluorescence intensity is suppressed by fluorescence resonance energy transfer, and the fluorescence intensity is not suppressed when not bound to the same probe as the quencher fluorescent dye. Claim 10, Claim 15, Claim 16, Claim 2
A probe according to any one of claims 1 to 22.