JP2002107364A - Biological reagent array for detecting non-label and its preparing method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a biological reagent array and its preparing method, for detecting interaction of a target sample as an object of detection or analysis and a biological reagent for analysis on an array, e.g. nucleic acid, peptide or protein, without having to label the target proteins or nucleic acids. SOLUTION: A biological reagent array is formed on a substrate by bonding fluorescent pigment, having fluorescent characteristics varying between associated state and non-associated state, to one end of the molecular chain of a biological reagent and arranging spots which are fixed with the biological reagent in a prescribed arrangement.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a biological reagent array in which spots containing biological reagents are arranged in a predetermined arrangement on a substrate, and a method for manufacturing the same. This biological reagent array
As a peptide array for the presence or absence of interaction with proteins such as viruses, microorganisms and humans, identification of interacting amino acid sequences, evaluation of DNA binding ability, and sequence identification,
Alternatively, it can be suitably used as a nucleic acid array for detecting the presence or absence of a gene base sequence (nucleotide sequence) by hybridization.

[0002]

2. Description of the Related Art In recent years, worldwide projects for decoding various genes, particularly all human gene sequences, have been carried out. As a result, genes related to diseases have been clarified one after another. I have. Following such a move, instead of the conventional method of examining the genes of the items to be examined one by one by PCR or hybridization, an attempt to determine the presence or absence (mutation) of multiple items of genes on the same substrate has been made. It has been developed as a DNA array.

Have reported a method of synthesizing a DNA probe on a glass substrate and producing probes having different base sequences one by one on the same substrate (Nuclei).
c Acids Research, Vol. 22, p. 1368, 1994).

Further, Affymetrix arranges 400,000 types of DNA probes on a 1/2 inch square substrate to detect genes (Science, vol. 274, p. 61).
0, 1996). They apply the method of photolithography and synthesize a 15-base long DNA by repeating the reaction of linking nucleotides on a substrate.

Further, Japanese Patent Application Laid-Open No. H11-187900 discloses a method of immobilizing an oligonucleotide probe previously synthesized by an ink-jet method on a substrate surface by conjugate bonding.

On the other hand, instead of oligonucleotides, cDN
The DNA array on which A is immobilized has attracted much attention as a monitor for gene expression. Capturing intracellular changes, such as changes over time in each tissue or the same tissue, from the expression status of a plurality of proteins provides important information not only in research but also in the field of drug discovery. In conjunction with the movement to examine the expression of a protein using cDNA, it has become important to express the cDNA in Escherichia coli and examine its properties and functions at the protein level. For example, Anal. Biochem., 270 (1), 1
03-111 and 1999, in order to examine such expressed proteins in large quantities, a large number of lysates of Escherichia coli expressing cDNA were arranged on a membrane filter in very small amounts, and a DNA array-like structure was constructed. A method for producing a protein array is disclosed. Such a protein array is useful for antibody screening and receptor screening.

[0007] Like proteins, arrays using peptides are also useful for various applications. In particular, when a detailed study at the amino acid sequence level is required, such as control of a protein by a protein or identification of an interaction site between proteins,
Peptide arrays that can simultaneously test very small amounts of proteins on multiple items are considered to play an important role.

JP-A-11-21293 discloses a method for synthesizing a peptide on a substrate using photolithography as a method for producing a peptide array. In this method, a mask is attached to a substrate provided with a light-sensitive protective group, and the protective group is removed only at a site to be reacted.
Therefore, this method is a method of performing peptide synthesis, and is advantageous in that many types of peptides can be synthesized.

In addition to the method of synthesizing a peptide on a substrate,
There is also a method of preparing a peptide array by adsorbing and fixing a previously synthesized peptide by an inkjet method or a method using a pin.

A biological reagent array in which biological reagents such as a DNA array, a peptide array, and a protein array are immobilized on a substrate as described above is considered to be important as a nuclear technology in the medical diagnostic field. For detection, it is necessary to label a sample or a probe to be detected.

Various methods are already known for labeling nucleic acids. For example, a system in which an amino group or a thiol group is introduced into the terminal and a fluorescent dye is bound using the functional group is generally used. Alternatively, a method of incorporating a fluorescent dye or isotope during amplification by PCR,
There are various methods such as a method of incorporating a label in the process of synthesizing single-stranded RNA based on the R amplification product. In the case of proteins and peptides, many utilize the amino group of the amino acids that constitute them, and as the labeling dye, in addition to well-known fluorescent dyes such as fluorescein and rhodamine, compounds such as Cy3 and Cy5 are used. . Also, many simple kits are commercially available.

As a method of not directly labeling, there is a method in which the bound substance is labeled with an antibody and evaluated with a secondary antibody. In this case, the secondary antibody is often labeled with a fluorescent label or conjugated with an enzyme that induces color development.

[0013]

All of the above nucleic acid labeling methods have advantages and disadvantages. In the end labeling method, one labeling substance is used for one target DNA.
Although the quantitative property can be maintained, there is a problem that the sensitivity is often low. On the other hand, in the PCR method and the method of incorporating a labeling substance at the time of producing single-stranded RNA, although the sensitivity increases due to the increase in the number of labeling substances, there is a one-to-one correspondence between the number of hybridized target DNAs. Since there is no correspondence, quantification is lacking, and if there is a weak signal such as in the case of a single base mismatch, it may interfere with the determination.

Another problem is that amplification by PCR does not always reflect the amount of target DNA in the initial state. P
As a result of the fact that there are sequences that are easily amplified by the CR reaction and sequences that are hardly amplified, a control experiment using a standard gene is always required for comparison between the two.

Further, in terms of detection operation, PCR reaction,
Alternatively, the reaction for labeling is a time-consuming operation as a whole including the purification step.

[0016] On the other hand, there is a case where a trouble occurs due to binding of a fluorescent dye to DNA. Fluorescent dyes are generally hydrophobic and are prone to interact with the base moiety. This may cause the efficiency of the hybridization reaction to vary depending on the probe sequence.

Further, the fluorescent dye has a property of easily adsorbing to the substrate. This causes the background at the time of detection to rise, resulting in a problem of lowering the detection sensitivity.

[0018] Labeling a protein with a fluorescent dye sometimes changes the original properties of the protein. It is said that a protein has a three-dimensional complicated three-dimensional structure based on its amino acid sequence, and that the structure accurately recognizes another protein or a substrate molecule. Hydrophobic structures such as fluorescent dyes change the surrounding environment by binding to proteins, and as a result, affect the three-dimensional structure or the intensity of interaction with other substances, and Interactions may not be accurately extracted.

Furthermore, when performing fluorescent labeling, whether a functional group capable of reacting with the fluorescent dye is present on the protein surface, the probability that the fluorescent dye is present on the protein surface, the time required for the labeling operation, or The required conditions differ depending on the combination of each protein and the fluorescent dye, such as the solubility of the dye, and in reality, include a rather complicated element.

As a method for solving the problem associated with such labeling, there is a method using an antibody. In this method, an unlabeled protein is used for the detection of the interaction, and then an antibody of the protein is reacted, and a secondary antibody that reacts with the antibody is labeled, an enzyme is conjugated, and fluorescence or display is performed. Quantitative detection is performed as a color reaction. The method using this antibody is often used for detecting various proteins and active substances. However, since the antibodies required for such an antigen-antibody reaction are produced using mice, rats, etc., there are problems such as unstable production and variations between antibody rods. Sometimes occurred.
In addition, it takes time until the antibody is produced.
Furthermore, when a heterogeneous system is used as a sample, such as a cell extract, it is necessary to prepare antibodies corresponding to each of the various proteins contained in this system. It is not practical as a method for detecting a sample to be performed.

An object of the present invention is to provide a target sample as a detection or analysis control, for example, a target protein, a target nucleic acid, or the like without labeling the target sample, a biological reagent for analysis on an array,
For example, an object of the present invention is to provide a biological reagent array for detecting the presence or absence of an interaction with a nucleic acid, a peptide, a protein, and the like, and a method for producing the same.

[0022]

A biological reagent array according to the present invention is a biological reagent array in which a plurality of spots containing a reactive biological reagent to which a fluorescent dye is covalently bonded are arranged in a predetermined arrangement on a substrate. Wherein the fluorescent dye changes its fluorescence characteristics between an associated state and a non-associated state, and the spot includes the associated state of the fluorescent dye, and the association state is such that the biological reagent is used as another sample. Characterized in that it is eliminated when it reacts with.

Further, the method for producing a biological reagent array according to the present invention is characterized in that a plurality of spots containing a reactive biological reagent to which a fluorescent dye is covalently bonded are arranged in a predetermined arrangement on a substrate. A method of manufacturing, wherein a fluorescent dye is covalently bonded to one end of a molecule of a biological reagent, and a sample-side functional group for binding to the substrate surface is formed at the other end; A step of preparing a substrate having a substrate-side functional group that is covalently bonded to a functional group, and the biological reagent having the fluorescent dye and the sample-side functional group, the surface of the substrate having the substrate-side functional group, And supplying the spots so that the spots are arranged in a predetermined arrangement, and fixing the biological reagent on the substrate by covalently bonding the substrate-side functional group and the biological reagent-side functional group, Fluorescent dyes are not associated with the associated state Are those fluorescent properties change in on purpose, the association state of the fluorescent dye contained in the spot,
The association state is eliminated when the biological reagent has reacted with another sample.

According to the present invention, a biological reagent on an array without labeling a target protein or a target nucleic acid to be detected,
For example, it is possible to provide a biological reagent array capable of detecting an interaction with a nucleic acid, a peptide, a protein, a sugar chain or the like, and analyzing the presence or absence and properties of these target proteins and target nucleic acids, and a method for producing the same. it can.

That is, by using the biological reagent array according to the present invention, the operation of labeling the target protein or the target nucleic acid is not required, and not only can the detection time be significantly reduced, but also the labeling is accompanied. This has the advantage of avoiding structural changes in the target protein. In addition, problems such as an increase in background due to nonspecific adsorption of the dye used for labeling to the substrate can be solved.

In the present invention, when a peptide having a predetermined amino acid sequence and having a fluorescent end labeled as a reagent is used, it is immobilized on the substrate by terminal bonding instead of adsorption. It is possible to accurately detect a complex due to binding to the sample protein and the sample DNA. That is, in the present invention, since the end of the biological reagent bound to the substrate is fluorescently labeled, there is no need to label the sample protein or DNA, and an array for non-label detection of the sample can be provided.

[0027]

BEST MODE FOR CARRYING OUT THE INVENTION The fluorescent dye used in the present invention is a dye whose fluorescent characteristics change when associated. When the same molecule is arranged in a spot at a high density, such as a DNA array or a peptide array, when labeled with a fluorescent dye having the above properties, the fluorescent dye bound to the end of the molecule is extremely close in position. In the state, the association occurs, the fluorescence characteristics change, and quenching and a change in the fluorescence characteristics can be obtained according to the change in the association state. This association includes a state in which the molecules are close to each other.

As the fluorescence characteristics, there can be used those in which the fluorescence is quenched by the formation of the association state and those in which the fluorescence is emitted by the association. Among them, the association due to the binding of other molecules is eliminated, and the fluorescent molecules that have been quenched by the association are dissociated due to the association rather than the existing system where the fluorescence is quenched. The system that emits light is preferable from the viewpoint of simplicity of the detection operation and the like.

In the present invention, examples of the biological reagent fixedly arranged on the substrate include nucleic acids, peptides, proteins, sugar chains, and derivatives thereof, which have known properties or known structures (such as amino acid sequences and DNAs). And the like, and can be used to detect the characteristics and structure of the target sample to be detected.

The case where probe DNA is used as a biological reagent will be described. Since the end of the probe DNA is labeled, there is no need to label the target DNA. The fluorescent dye used as the label causes quenching of fluorescence by association. Therefore, when the probe DNA molecules are arranged at a high density as in a DNA array, the fluorescent dye bound to the end is in an extremely close position, so that association occurs and the fluorescence is quenched. Due to the association between the fluorescent dyes, the probe DNA itself can avoid problems such as secondary structure formation due to interaction with the dye.

In the hybridization reaction, the binding constant is larger for the formation of a hybrid than the association of the fluorescent dye, and thus the target DNA complementary to the DNA probe on the substrate binds to form a hybrid. If the target DNA is much longer than the probe DNA, the probe DN
The association between the fluorescent dyes bound to A is eliminated by the intervention of the target DNA, and the original fluorescence of the fluorescent dye is restored. As a result, fluorescence is observed only in the portion where the hybrid is formed.

In the binding reaction between a protein and a peptide using either one as a reagent and the other as a target sample, the binding constant based on the interaction between the two is larger than the association of the fluorescent dye. The association between the fluorescent dye bound to the peptide is eliminated by the intervention of the protein molecule bound to the peptide, and the original fluorescence of the fluorescent dye is restored. As a result, fluorescence is observed only in the portion of the peptide that has interacted with the protein.

In any case, the feature of the present invention is that the binding constant between the biological reagent and the biological sample is higher than the reaction constant for forming an association, such as mismatched hybrids in nucleic acids and static electricity between peptides and proteins. Weak bindings such as general interactions are eliminated.

The fluorescent dyes suitable for the present invention include, for example, pyran fluorescent dyes, particularly coumarin derivative fluorescent dyes,
Monomers such as xanthene-based fluorescent dyes, particularly fluorescein derivative fluorescent dyes, generate fluorescence, but they easily form aggregates, and the aggregates include self-quenching and quenching fluorescent dyes.

Such a property of the fluorescent dye can be examined by plotting the fluorescence intensity of a solution prepared by varying the concentration of the fluorescent dye with respect to the concentration. In the case of a fluorescent dye that produces strong fluorescence in a dilute solution, if the fluorescence decreases as the concentration increases, formation of an aggregate and quenching of the fluorescence accompanying the association are suspected. However, it must be distinguished from so-called density quenching. In concentration quenching, the absorption intensity is proportional to each concentration, but the formation of aggregates is observed as a decrease in the absorption intensity. Occasionally, the absorption maximum shifts to a longer wavelength region than the monomer with the formation of the aggregate.

Fluorescent dyes exhibiting such properties include:
In addition to the well-known dyes such as the coumarin derivative and the fluorescein derivative, pyrylium dyes can be mentioned. According to the study of the present inventors, the following formulas (1) to
It has been newly found that the pyrylium dye having the structure shown in (3) easily forms an aggregate, and the fluorescence is quenched with the formation of the aggregate.

[0037]

Embedded image

The above three types of compounds have been exemplified as examples of pyrylium dyes of the type that cause self-association and cause quenching of fluorescence. However, pyrylium dyes having similar properties and usable in the present invention are not limited thereto. Not done.

The methyl group (R) of the pyrylium dye
Can be used for binding to biological reagent molecules. That is, a covalent bond with the biological reagent molecule can be formed via the functional group introduced into the methyl group. This methyl group is
For example, a form in which the probe is substituted with a functional group effective for binding to a nucleic acid or peptide used as a probe can be used. Specifically, when an amino group introduced at the terminal of a molecule of a nucleic acid or peptide is used as a functional group on the reagent side, a carboxyl group is introduced into the above-mentioned methyl group portion and used as a functional group. Can be. When a thiol group at the terminal of a nucleic acid molecule or a thiol group of a cysteine residue of a peptide is used, a maleimide group or the like can be introduced into the methyl group of the pyrylium dye and used for bonding. However, the selection of these functional groups is not limited to the above method, and a method suitable for each nucleic acid and peptide is selected.

Further, compounds selected as fluorescent dyes also
It is not limited to the above compounds, and any fluorescent dye can be used as long as it exhibits such properties.

The interaction between a biological reagent and a biological sample to which the analysis method using the biological reagent array of the present invention can be applied includes reagents selected from nucleic acids, peptides, proteins, sugar chains and derivatives thereof, and nucleic acids, peptides. Reaction and interaction with a target sample selected from proteins, sugar chains and derivatives thereof. As nucleic acids, DNA, R
Examples thereof include NA and PNA, and single-stranded or double-stranded ones can be used.

The length of the nucleic acid used as the reagent is 3
Those having a length of 0 bases or less are preferable, and those having a length of 8 to 20 bases are more preferable. If the length of the nucleic acid chain is too long, the rate of formation of aggregates between fluorescent dyes at the ends of nucleic acids adjacent at high density may be reduced due to the formation of the secondary structure of the nucleic acid itself.

When a nucleic acid is immobilized on a substrate as a reagent, each spot (or each spot group) is so arranged that nucleic acids contained between at least two spots (or between spot groups) have different base sequences (nucleotide sequences). Can be produced. For example, spots (or spot groups) of any combination of base sequences having a length of 30 nucleotides or less can be arranged and used for detection of base sequences in a sample.

As the peptide used as a reagent, 20
Those having a length of not more than the number of amino acid residues are preferable, and
Those having a length of the number of amino residues are more preferred, and those having a length of 5 to 7 amino acid residues are still more preferred. Since a very short peptide chain may not reproduce the structure actually taken by the protein, at least 5 amino acid residues are required to extract the interaction with the target protein more accurately. Preferably.

When the peptide is immobilized on the substrate as a reagent, each spot (or each spot group) is prepared so that the peptides contained in at least two spots (or between the spot groups) have different amino sequences. be able to. For example, spots (or spot groups) of any combination of amino acid sequences having a length of 20 amino acid residues or less (or 5 to 15 or 5 to 7 amino acid residues) are arranged to detect sample characteristics. Can be used.

As an amino acid sequence of a peptide array using a peptide as a reagent, a part of an amino acid sequence of an antibody for detecting a specific disease can be used. When serum collected from a sample is used as a sample for such a peptide array, a disease is identified from the amino acid sequence at a position where binding is detected, and the sample can be diagnosed.

Further, by forming a peptide library formed using a peptide as a reagent as an array and examining the binding to a certain nucleic acid, it becomes possible to specify the amino acid sequence binding to the nucleic acid. As a result, DN
The binding position of the A-binding protein can be specified. Further, when a protein is used as a sample, it is possible to specify a protein-protein interaction site.

Hereinafter, a method for producing the biological reagent array according to the present invention will be described.

As a method for preparing a biological reagent array according to the present invention, DNA or peptide having one end fixed to the substrate is synthesized during the synthesis of DNA or peptide on the substrate by the phototriso method. In the last stage, a method of binding a fluorescent dye to the other open end of DNA or peptide by a chemical reaction may be used.

Further, a solution containing a reagent having a structure capable of binding to the substrate at one end of the molecular chain and having a fluorescent dye covalently bonded to the other end is applied as a droplet to a predetermined surface of the substrate to contain the reagent. A method of arranging spots in a predetermined arrangement can be used, and from the viewpoint of simplicity of spot arrangement operation, etc.
This method is preferred. Various methods can be used to form the droplet, but an ink jet method that can easily achieve an accurate landing position and a high-density spot arrangement is preferable. As the ink jet method, a method using a bubble jet method in which droplets are formed by thermal energy can be suitably used.

For immobilization of the biological reagent on the array forming surface of the substrate, a covalent bond by a reaction between functional groups can be suitably used. Examples of the combination of the functional groups include a combination of an epoxy group disposed on the glass surface and an amino group on the reagent side when glass is used as the substrate, a maleimide group disposed on the glass surface, and a thiol group (-SH) on the reagent side. Can be mentioned. When the reagent is a peptide, the amino group of the amino acid residue at the end of the molecular chain can be used for bonding to the epoxy group, and when the reagent is a cysteine residue, the thiol group contained therein can be used on the substrate side. It can be used for bonding with a maleimide group.

For introducing an epoxy group to the glass surface, a method using polyglycidyl methacrylate in addition to an aminosilane coupling agent can be used. In particular, a resin such as polyglycidyl methacrylate has wide versatility in that it can be applied as a coating to any substrate, unlike a silane coupling agent reacting specifically to a glass plate.

In the case of applying a resin, a plate made of plastic, for example, acrylic resin can be used in addition to a glass plate.

As the amino group to be reacted with the epoxy group on the substrate side, when a peptide is used as a reagent, its N-terminal can be used as described above. In the case of a nucleic acid, an amino group is introduced into a predetermined terminal during synthesis. Can be used for bonding to a substrate.

As a method for introducing a maleimide group into a substrate, first, an aminosilane coupling agent is reacted with a glass substrate, and then the amino group and an EMCS reagent (N- (6
-Maleimidocaproyloxy) succinimide; N- (6-M
aleimidocaproyloxy) succinimide; manufactured by Dojin
A maleimide group can be introduced by the reaction with

The introduction of the SH group into the peptide can be carried out, for example, by introducing a cysteine residue at the terminal of the peptide group. In the case of a nucleic acid, an SH group can be introduced by introducing a cysteine residue at a predetermined terminal during synthesis. In the case of a sugar chain, an SH group is introduced during synthesis.

The introduction of the fluorescent dye or the functional group into the terminal of the molecular chain of the reagent does not need to be strictly at the forefront or the last of the molecular chain. The position may be any position in the region including.

When a liquid solution of a reagent solution is applied onto a substrate by an ink jet method, especially a bubble jet method, water is mainly used, and glycerin, urea, thiodiglycol, ethylene glycol, monoethanolamine, dimethylethanol A solution containing at least one selected from the group consisting of amine, triethanolamine, 2-pyrrolidone, N-methylpyrrolidone and acetylenol can be used as a preferred solvent. Particularly preferred solvents are 5 to 10% by weight of urea and 5% of glycerin in water.
Examples include a solution containing 10 to 10% by weight, 5 to 10% by weight of thiodiglycol and 1 to 5% by weight of acetylene alcohol. The acetylene alcohol is represented by the following general formula (I):

[0059]

Embedded image

(In the above formula, R ₁ , R ₂ , R ₃ and R ₄ represent an alkyl group, m and n each represent an integer, and m =
0 and n = 0 or 1 ≦ m + n ≦ 30, and m
When + n = 1, m or n is 0. ) Can be used.

More preferred solutions include 7.5% glycerin, 7.5% urea, 7.5% thiodiglycol,
A solution containing 1% (all wt%) of acetylenol EH can be mentioned.

Further, based on this composition, a study is conducted in view of the properties such as the hydrophobicity of the fluorescent dye bonded to each end, and a composition in which the composition of the solution is changed can be further used. In the case of a peptide, a method of solubilizing by adding trifluoroacetic acid or the like as necessary may be used. The above composition may be changed in consideration of the addition of a component for solubilization and the properties of the fluorescent dye.

When the reagent is a peptide, the concentration of the reagent in the solution is not more than 300 μM, preferably 5 to 10 μM.
It can be in the range of μM. If the reagent is a nucleic acid,
The concentration can be set to 300 μM or less, preferably 5 to 10 μM.

By drying the droplet containing the biological reagent applied on the substrate, a biological reagent array in which spots formed at positions corresponding to the droplet are arranged in a predetermined arrangement can be obtained on the substrate. A target sample can be analyzed using this biological reagent array.

[0065]

EXAMPLES Example 1 (Preparation of Peptide Array Conjugated with Pyrylium Dye (having Structure of Formula (1)) and Detection of Cytochrome Using It) Glass substrate treatment 1) Substrate cleaning A 1-inch square glass plate was put in a rack and immersed in a detergent for ultrasonic treatment overnight. Thereafter, ultrasonic cleaning was performed in a detergent for 20 minutes, and then the detergent was removed by washing with water. After rinsing with distilled water, sonication was further performed for 20 minutes in a container containing distilled water. Next, it was immersed for 10 minutes in a 1N sodium hydroxide solution preheated to 80 ° C. Subsequently, washing with water and washing with distilled water were performed.

2) Surface treatment 1% aqueous solution of silane coupling agent (Shin-Etsu Chemical Co., Ltd.
After preparing a brand name KBM603) and hydrolyzing the methoxy group in the molecule by stirring in advance, the glass substrate was immersed at room temperature for 20 minutes. Thereafter, nitrogen gas was sprayed on both sides to remove moisture and dried. The silane coupling treatment was completed by baking for 1 hour in an oven heated to 120 °. Then, EMCS (manufactured by Dojin)
Was weighed and dissolved in a 1: 1 solution of DMSO / ethanol (final concentration 0.3 mg / ml). A glass substrate treated with a silane coupling agent is treated with this EMC.
The solution was immersed in the S solution for 2 hours to react the amino group of the silane coupling agent with the carboxyl group of EMCS. In this state, a maleimide group derived from EMCS exists on the surface of the glass. The glass plate reacted with the EMCS solution is washed with distilled water, dried with nitrogen gas, and used for a binding reaction with DNA.

2. Peptide labeling 1) Search for peptides with affinity for cytochrome C Search for peptides with affinity for cytochrome C
Phase Display Peptide Li available from Lab
Performed with the brary Kit. The kit used was a library in which a 12-mer peptide was bound to phage.
This is a library containing ⁰⁹ peptides with different sequences. The cytochrome C used was derived from Bovine Heart, commercially available from Sigma. Using this kit, one kind of 12-mer peptide having affinity for cytochrome C was found according to a predetermined operation. The amino acid sequence of the found peptide is as follows. (N-terminal) Tr
p-Pro-Ser-Pro-His-Tyr-Ser-Phe-Tyr-Asn-Tyr-Thr (C
Terminal) 2) Synthesis of Peptide Synthesis of a peptide in which Cys having an SH group for binding to a substrate was linked to the C-terminal of the peptide having the above amino acid sequence was performed by the Fmoc solid phase peptide synthesis method. (N-terminal) Trp-Pro-Ser-Pro-His-Tyr-Ser-Phe-Tyr-Asn-
The Tyr-Thr-Cys (C-terminal) peptide was cleaved from the resin using trifluoroacetic acid according to a conventional method. The resulting peptide product was purified by HPLC and recovered by lyophilization.

3) Binding reaction of pyrylium dye to peptide 3-1) Synthesis of 2- (3-carboxypropyl) -4,6-diphenylpyrylium iodide 163 mg of acetophenone and 456 mg of glutaric anhydride
Was added to 3 ml of concentrated sulfuric acid in an ice bath and completely dissolved. Subsequently, the mixture was heated to 120 ° C. in an oil bath, stirred for about 3 hours, and allowed to cool at room temperature. This reaction solution is added to 100
After adding to 50 ml of water and stirring, 50 ml of chloroform was added, and the mixture was washed by an extraction operation, and an aqueous layer was collected. This washing with chloroform was repeated a total of four times to remove unreacted acetophenone. Subsequently, 1.50 g of sodium iodide was added, stirred, and cooled in a refrigerator overnight. The deposited yellow precipitate was separated by filtration and collected to obtain a crude crystal. The obtained crude crystals were recrystallized with an appropriate amount of water to obtain 66 mg of 2- (3-carboxypropyl) -4,6-diphenylpyrylium iodide as crystals.

The obtained compound (40 mg) and N-hydroxysuccinimide (46 mg) were dissolved in dry DMF (1 ml). After confirming complete dissolution, it was transferred to an ice bath and cooled. Next, 80 mg of N, N-dicyclohexylcarbodiimide (DCC) was added, and the mixture was stirred in a dark place for 24 hours.
The first 2 hours were performed in an ice bath, and then stirred at room temperature. Subsequently, after the floating DCC urea was removed with a membrane filter, it was dropped into about 50 ml of diethyl ether. The operation of collecting the precipitated precipitate and washing again with 50 ml of diethyl ether was repeated several times, and the obtained powder was dried with a vacuum pump.

3-2) Preparation of Pyrylium Dye-Binding Peptide 330 μg of the peptide having a Cys residue at the C-terminal synthesized in the above operation 2) was dissolved in 100 μl of pure water, and 16 μl of 1M phosphate buffer (pH 7.0) was dissolved. After adding 2-
50 m of succinimide derivative of (3-carboxylpropyl) -4,6-diphenylpyrylium iodide
60 μl of a M acetonitrile solution was added and reacted at 40 ° C. for 24 hours. By this reaction, the N-terminal amino group was succinimidated. Subsequently, crude purification was performed using a gel filtration column NAP-25 manufactured by Pharmacia to remove unreacted substances, and further purification was performed by HPLC. HPLC
After purification by the above, desalting was performed using the above column to obtain a peptide having 4,6-diphenylpyrylium bound to the N-terminus. Dissolve the obtained pyrylium-labeled peptide in pure water,
When the fluorescence was measured with a Hitachi F-4500 fluorescence spectrophotometer, it emitted 448 nm fluorescence when excited at 386 nm.

3. Binding Reaction to Substrate 1) Optimization of Discharge Solution 0.01% of the peptide prepared in 3) above, which has a pyrylium dye bound to the N-terminal and has a Cys residue at the C-terminal,
Dissolve in trifluoroacetic acid solution, glycerin 7.5%,
Thiodiglycol 7.5%, N-methylpyrrolidone 5
%, Acetylenol EH 1%, and adjusted to a final concentration of 8 μM, and filled into an inkjet recording cartridge. Bubble jet printer (BJC) modified to enable printing on flat plates
620: manufactured by Canon Inc.), a peptide-filled cartridge is set in the ink cartridge portion, and 12
A print pattern was formed so as to be 0 dpi, and the peptide was discharged onto a substrate that had been previously surface-treated. Thereafter, the substrate was left in a humidified chamber for 3 hours to perform a binding reaction between the substrate and the peptide. The liquid volume per drop is 24 pl. As a result, the SH group at the C-terminal of the peptide was immobilized on the substrate by a covalent bond.

As a result of observation with a fluorescence microscope, the fluorescence observed in the solution had disappeared. This is considered to be the result of the quenching caused by the self-association of the pyrylium dye molecules at the terminal of the adjacent peptide.

4. Reaction of Cytochrome C with Peptide Array 1) Binding Reaction The above glass substrate to which the peptide was bound was diluted with 50 mM phosphate buffer (pH 7.5) to 1 μM Bovi
The cells were immersed in a solution of cytochrome C (manufactured by SIGMA) derived from ne Heart and allowed to act for 3 hours at room temperature in a dark place.

2) Fluorescence Observation Thereafter, as a result of observation with a fluorescence microscope, blue fluorescence was observed at the portion where the peptide was fixed. Since this fluorescence has the same color as the fluorescence observed in the solution before being fixed to the substrate, the peptide and cytochrome C form a complex, and the state of association of the fluorescent dye bound to the peptide is eliminated. It is considered to have issued.

3) Control experiment The same fluorescence observation was carried out using insulin as a sample instead of cytochrome C. As a result, as in the case before the reaction with insulin, no fluorescent fluorescence was observed from the substrate after the reaction.

Example 2 (DN having coumarin dyes bound thereto)
A array and detection of M13 gene using the same) 1. Synthesis of Oligonucleotide An 18-mer oligonucleotide having the following base sequence with an amino linker bound to the 3 ′ end was synthesized by an automatic DNA synthesizer. Introduction of an amino acid to the 3 'end is 3'
-Amino Modifier C3 (Glen Research)
This was performed using 5'GTTGTAAAACGACGGCCAGT ^- NH
_{The 2} 3 ′ synthesized DNA was cut out from the CPG support, deprotected according to a standard method, and purified by HPLC.

2. Coupling of Coumarin Dye 330 μg of the above nucleotide is dissolved in 100 μl of pure water, 16 μl of 1 M phosphate buffer (pH 7.0) is added, and then a 50 mM acetonitrile solution of 7-hydroxycoumarin-3-carboxylic acid (manufactured by Sigma). 60 μl was added and reacted at 40 ° C. for 24 hours. Subsequently, crude purification was carried out using a gel filtration column for DNA NAP-25 manufactured by Pharmacia to remove unreacted substances, and further purification was carried out by HPLC. After purification by HPLC, desalting was performed using the above column, and D-labeled with 7-hydroxycoumarin was used.
An NA probe was obtained. The fluorescence of the obtained DNA probe was measured with a Hitachi F-4500 fluorescence spectrophotometer. The probe solution adjusted to 8 μM, when excited at 386 nm,
Excimer fluorescence was emitted at 48 nm.

3. Binding Reaction to Substrate DNA bound to coumarin was dissolved in an aqueous solution containing 10% urea, 10% thiodiglycol, 10% ethylene glycol, 3% triethanolamine, and 3% acetylenol EH. Using a bubble jet printer, the liquid was discharged onto the substrate. Thereafter, the substrate was left in a humidified chamber for 1 hour to react the DNA with the substrate.

As a result of observation with a fluorescence microscope, the fluorescence observed in the solution had disappeared. It is considered that the coumarin molecule at the end of the adjacent probe self-associated and caused quenching.

4. Hybridization reaction using M13mp18 Using a commercially available M13mp18 phage vector solution, a hybridization reaction was performed by a conventional method. This gene has a sequence complementary to the sequence of the probe immobilized on the substrate.

The substrate is placed in a hybridization chamber (manufactured by Telechem), a 100 mM NaCl solution containing M13mp18 is placed on the edge of the cover glass, and the probe is probed with a cover glass while being careful not to cause air bubbles between the substrate and the substrate. The fixation area was covered so that the solution was covered. In this state, the reaction was performed at 65 ° C. for 6 hours.

Thereafter, as a result of observation with a fluorescence microscope, blue fluorescence was observed at the portion where the probe was fixed. Since this fluorescence has the same color as the fluorescence observed in the solution before being immobilized on the substrate, as a result of hybridization of the probe and M13mp18 DNA, M13mp18 DNA intervenes between the coumarin molecules, and the association of coumarin is eliminated. It is considered to have issued.

[0083]

According to the present invention, it is possible to detect the presence or absence of the formation of a complex between a reagent sample such as a nucleic acid, a peptide or a protein and a target sample without labeling the target sample such as a nucleic acid, a peptide or a protein. An array substrate can be easily manufactured. In addition, by using the inkjet method for forming the spots of the reagent, it is possible to reduce the diameter of each spot and arrange the spots with high density.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12Q 1/68 G01N 21/78 C 4H045 G01N 21/78 31/22 121P 31/22 121 33/566 33 / 566 37/00 102 37/00 102 C12N 15/00 ZNAF F-term (Reference) 2G042 AA01 CB03 FB05 FC01 2G054 EA03 EA07 GA04 GE01 4B024 AA11 BA80 CA01 CA09 4B029 AA07 BB15 BB20 FA12 4B063 QA01 QRAQR QRQ QR32 QB08 QS34 QS36 QX02 4H045 AA10 AA30 BA13 BA14 BA15 BA16 BA17 EA50 FA34

Claims (49)

[Claims] 1. A biological reagent array in which a plurality of spots containing a reactive biological reagent to which a fluorescent dye is covalently bonded are arranged in a predetermined arrangement on a substrate, wherein the fluorescent dye is in an associated state and non-associated state. That the fluorescent property changes with the state, that the spot contains the association state of the fluorescent dye, and that the association state is eliminated when the biological reagent reacts with another sample. Characteristic biological reagent array. 2. The biological reagent array according to claim 1, wherein the fluorescent dye is quenched in an associated state, and generates fluorescence when the association is canceled. 3. The biological reagent array according to claim 3, wherein the fluorescent dye is a pyran-based fluorescent dye. 4. The biological reagent array according to claim 3, wherein the fluorescent dye is a xanthene-based fluorescent dye. 5. The method according to claim 1, wherein the fluorescent dye is at least one selected from pyrylium dye derivatives represented by the following formulas (1) to (3): (In the above formula, R is an alkyl group.) The biological reagent array according to claim 3, wherein each pyrylium derivative is covalently bonded to a biological reagent using R. 6. The method according to claim 1, wherein said biological reagent is a peptide.
6. The biological reagent array according to any one of claims 5 to 5. 7. The biological reagent array according to claim 6, wherein the peptides contained between the at least two spots have different amino acid sequences. 8. The biological reagent array according to claim 6, wherein the peptide has a length of 20 amino acid residues or less. 9. The peptide according to claim 8, wherein the peptide has 5 to 5 amino acid residues.
The biological reagent array according to claim 6 or 7, which has a length of 15. 10. The peptide according to claim 1, wherein the peptide has 5 amino acid residues.
8. The biological reagent array according to claim 6, wherein the array has a length of 7 to 7. 11. The biological reagent array according to claim 8, wherein the spots form a set of peptide libraries composed of all possible amino acid sequences. 12. The method according to claim 1, wherein the biological reagent is a nucleic acid.
6. The biological reagent array according to any one of 5. 13. The method according to claim 13, wherein the nucleic acid is DNA, RNA or PN.
The biological reagent array according to claim 12, which is A. 14. The biological reagent array according to claim 12, wherein the nucleic acids contained between the at least two spots have different nucleotide sequences. 15. The biological reagent array according to claim 12, wherein the length of the nucleic acid is 30 nucleotides or less. 16. The biological reagent array according to claim 12, wherein the length of the nucleic acid is 8 to 20 nucleotides. 17. The biological reagent array according to claim 15, wherein the spots form a set of a nucleic acid library composed of all possible nucleotide sequences. 18. The biological reagent array according to claim 1, wherein the biological reagent is conjugated to the substrate. 19. A method for producing a biological reagent array in which a plurality of spots containing a reactive biological reagent to which a fluorescent dye is covalently bonded are arranged in a predetermined arrangement on a substrate, the method comprising: Forming a sample-side functional group for bonding to the substrate surface at the other end, and a substrate-side functional group covalently bonding to the sample-side functional group on the surface. A step of preparing a substrate, the biological reagent having the fluorescent dye and the sample-side functional group, such that spots containing the biological reagent are arranged in a predetermined arrangement on the surface of the substrate having the substrate-side functional group. Supplying, and covalently bonding the substrate-side functional group and the biological reagent-side functional group to fix the biological reagent on the substrate, wherein the fluorescent dye fluoresces in an associated state and a non-associated state. The characteristics of which change, The association state of the fluorescent dye contained in the pot, the manufacturing method of the biological reagent array, wherein the association state is what organism reagents is eliminated upon reaction with the other samples. 20. The fluorescent dye is quenched in an associated state,
20. The production method according to claim 19, wherein fluorescence is generated when the association is canceled. 21. The method according to claim 19, wherein the fluorescent dye is a pyran-based fluorescent dye. 22. The method according to claim 19, wherein the fluorescent dye is a xanthene-based fluorescent dye. 23. The fluorescent dye according to the following formulas (1) to (3)
At least one selected from pyrylium dye derivatives represented by the formula: (In the above formula, R is an alkyl group.) The method according to claim 19, wherein each pyrylium derivative is covalently bonded to a biological reagent using R. 24. The method according to claim 19, wherein the biological reagent is a peptide. 25. The method according to claim 24, wherein the peptides contained between at least two spots have different amino acid sequences. 26. The production method according to claim 24, wherein the peptide has a length of 20 amino acid residues or less. 27. The peptide according to claim 27, wherein the peptide has 5 amino acid residues.
The method according to claim 24 or 25, wherein the length is from 15 to 15. 28. The peptide according to claim 28, wherein the peptide has 5 amino acid residues.
The method according to claim 24 or 25, wherein the length is from 7 to 27. 29. The method according to claim 26, wherein the spots form a set of peptide libraries composed of all possible amino acid sequences. 30. The method according to claim 19, wherein the biological reagent is a nucleic acid.
23. The production method according to any one of items 23 to 23. The nucleic acid may be DNA, RNA or PN.
31. The method according to claim 30, wherein A is A. 32. The production method according to claim 30, wherein nucleic acids contained between at least two spots have different nucleotide sequences. 33. The method according to claim 30, wherein the length of the nucleic acid is 30 nucleotides or less. 34. The method according to claim 30, wherein the nucleic acid has a length of 8 to 20 nucleotides. 35. The method according to claim 33, wherein the spots form a set of a nucleic acid library composed of all possible nucleotide sequences. 36. The functional group on the biological reagent side is an amino group, and the functional group on the substrate side is an epoxy group.
35. The production method according to any one of 35. 37. The functional group on the biological reagent side is a thiol group, and the functional group on the substrate side is a maleimide group.
The production method according to any one of 9 to 35. 38. The production method according to claim 37, wherein the thiol group is a thiol group of a cysteine introduced into a terminal of the biological reagent molecule. 39. The surface of the substrate is made of glass, and the maleimide group reacts with EMCS (N- (6-maleimidocaproyloxy) succinimide) after the reaction of the glass surface with the silane coupling agent. 40. The production method according to claim 38 or 39, which is obtained by the above method. 40. The application of the biological reagent to the substrate,
The manufacturing method according to any one of claims 19 to 39, wherein the method is performed by a method of supplying a liquid solution of the solution containing the biological reagent to the substrate. 41. The solution is mainly composed of water,
The method according to claim 40, wherein the supply of the solution to the substrate is performed by an inkjet method. 42. The method according to claim 41, wherein the ink jet method is a bubble jet method. 43. The solution is selected from the group consisting of glycerin, urea, thiodiglycol, ethylene glycol, monoethanolamine, dimethylethanolamine, triethanolamine, 2-pyrrolidone, N-methylpyrrolidone and acetylene alcohol. At least one
43. The method according to claim 41 or 42, comprising a seed. 44. The method according to claim 39, wherein the biological reagent is a peptide, and the concentration of the peptide in the solution is 300 μM or less. 45. The method according to claim 45, wherein the concentration of the peptide in the solution is
The method according to claim 44, wherein the amount is in the range of 5 to 10 µM. 46. The production method according to claim 39, wherein the biological reagent is DNA, and the concentration of the DNA in the solution is 300 μM or less. 47. The method according to claim 47, wherein the concentration of the DNA in the solution is 5%.
47. The production method according to claim 46, wherein the concentration is in the range of 10 to 10 µM. 48. The solution as claimed in claim 5, wherein the urea comprises 5-10% by weight,
5 to 10% by weight of glycerin and 5 to thiodiglycol
A solution containing 10% by weight and 1 to 5% by weight of acetylene alcohol, wherein the acetylene alcohol has the following general formula (I): (In the above formula, R ₁ , R ₂ , R ₃ and R ₄ represent an alkyl group, m and n each represent an integer, and m = 0 and n =
0 or 1 ≦ m + n ≦ 30, and when m + n = 1, m or n is 0. Claim 4)
48. The production method according to 6 or 47. 49. The method according to claim 49, wherein the solution is glycerin in water.
48. The production method according to claim 46 or 47, which is a solution containing 5%, urea 7.5%, thiodiglycol 7.5%, and acetylenol EH 1%.