JP2002095481A - Gene involved in high accumulation of cadmium - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for identifying and isolating a new protein and a gene encoding the protein that can largely contribute to the high accumulation of heavy metals and is involved in Cd detoxification mechanism. SOLUTION: The objective gene has (A) a base sequence encoding one of ten specific amino acid sequences derived from Brassica juncea, (B) a base sequence encoding an amino acid sequences that is modified by deleting, adding or substituting one or more amino acids from, to or in any of the above amino acid sequences and gives a Cd resistance activity, (C) any of ten specific base sequences derived from B. juncea, (D) a base sequence that is modified by deleting, adding or substituting one or mole base sequences from, to or in the above base sequence and encodes a protein that gives a Cd resistance activity, or (E) a base sequence that hybridizes to the above base sequence under a stringent condition and encodes a protein that gives a Cd resistance activity.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel protein involved in Cd resistance and its gene, a transformant having the above gene, and a method for purifying soil using the above transformant.

[0002]

BACKGROUND OF THE INVENTION Cadmium (Cd) is a potentially toxic heavy metal with a biological half-life of more than 10 years when accumulated in the human body. The major human pathologies include emphysema and damage to the renal tract (Ryan JA, et al. (1982) Environ R
es 28: 251-302). Cd has been shown to cause severe osteoporosis and softening in women with Itai-Itai disease in Japan. The main route by which Cd is incorporated into the human body is to eat crops that absorb and concentrate soil Cd.

[0003] Pollution of the biosphere by harmful metals has accelerated dramatically since the early days of the industrial revolution (Nriago JO (1979) Nature 27).
9: 409-411). At present, the accumulation of Cd in the soil and water environment is a problem relating to the environment and human health, and an efficient and economical solution is required. A possible solution to this problem is to use microorganisms.
There is a problem that microorganisms are small and difficult to recover. On the other hand, the use of plants that accumulate metals was proposed in 1995 by Salt et al. Phytoremediation (phytoremediatio)
n).

[0004] When considering the influx of Cd into plants, the main point is the root, but efficient removal of Cd from soil requires accumulation in the aerial parts, where it is easily recovered.
It has been reported that some plant species transport and accumulate Cd in the above-ground parts of plants (Wagner GJ (1994) Adv A
gron 51: 173-2123).

[0005] Brassicaceae plants (B) which have been identified as potentially usable plants for phytoremediation
anuelos GS, et al. (1990) J Environ Qual 19: 772-7774)
Of which is high biomass crop, B.juncea
Is highly developed C because it can accumulate a high concentration of Cd
d The existence of a detoxification mechanism is considered. However, genes involved in the Cd detoxification mechanism in mustard (B. juncea) have not been identified so far.

[0006]

In putting phytoremediation to practical use, it is a major problem to improve the accumulation of heavy metals in plants. Therefore, it has been desired to isolate a large number of genes involved in heavy metal accumulation in plants, and to find a gene capable of highly accumulating heavy metals in particular. That is, an object of the present invention is to identify and isolate a novel protein involved in Cd detoxification mechanism and its gene, which may greatly contribute to high accumulation of heavy metals. Furthermore, an object of the present invention is to construct a transformant having a gene involved in the Cd detoxification mechanism, and to provide a soil purification method using the transformant.

[0007]

Means for Solving the Problems In order to solve the above-mentioned problems, the present inventors have prepared a cDNA library from the above-ground part of mustard, and used a budding yeast expression mechanism to express Cd.
Attempts to isolate genes involved in the detoxification mechanism revealed that a gene with approximately 92% homology in amino acid sequence to Arabidopsis phytochelatin syntase (PCS1), metallothionei
n Succeeded in isolating a gene with approximately 90% homology to type3 (MT3) and a gene with 86-91% homology to the kinetochore protein SKP1. Increased Cd resistance of S. cerevisiae. The present invention has been completed based on these findings.

That is, according to the present invention, the following inventions are provided. (1) A gene having any one of the following nucleotide sequences. (A) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1; (B) an amino acid sequence in which one or more amino acids have been deleted, added or substituted in the amino acid sequence of SEQ ID NO: 1; A nucleotide sequence encoding an amino acid sequence that confers Cd resistance activity; (C) a nucleotide sequence according to SEQ ID NO: 1; (E) a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 1 which is a nucleotide sequence encoding a protein that confers Cd resistance activity; A nucleotide sequence encoding a protein that confers resistance activity.

(2) A protein having any one of the following amino acid sequences: (A) an amino acid sequence represented by SEQ ID NO: 1; or (B) an amino acid sequence in which one or more amino acids are deleted, added or substituted in the amino acid sequence represented by SEQ ID NO: 1; Amino acid sequence to be assigned. (3) A vector containing the gene according to (1). (4) A transformant having the gene according to (1) or the vector according to (3). (5) The transformant according to (4), which is a transformed plant. (6) A method for purifying soil, comprising using the transformant according to (4) or (5) to accumulate cadmium in soil in the transformant.

(7) A gene having any one of the following nucleotide sequences: (A) a base sequence encoding the amino acid sequence of SEQ ID NO: 2, 3 or 4; (B) one or more amino acids are deleted, added or substituted in the amino acid sequence of SEQ ID NO: 2, 3 or 4 (C) the nucleotide sequence of SEQ ID NO: 2, 3 or 4, and (D) the nucleotide sequence of SEQ ID NO: 2, 3 or 4. A nucleotide sequence in which one or more nucleotides are deleted, added or substituted in the nucleotide sequence of SEQ ID NO: 2, which encodes a protein that confers Cd resistance activity; or (E) SEQ ID NO: 2, 3, or 4. A nucleotide sequence that hybridizes with the nucleotide sequence described under stringent conditions and encodes a protein that confers Cd resistance activity.

(8) A protein having any one of the following amino acid sequences: (A) the amino acid sequence of SEQ ID NO: 2, 3 or 4; or (B) the amino acid sequence of SEQ ID NO: 2, 3 or 4 in which one or more amino acids are deleted, added or substituted An amino acid sequence that confers Cd resistance activity. (9) A vector comprising the gene according to (7). (10) A transformant having the gene according to (7) or the vector according to (9). (11) The transformant according to (10), which is a transformed plant. (12) A method for purifying soil, comprising using the transformant according to (10) or (11) to accumulate cadmium in soil in the transformant.

(13) A gene having any one of the following nucleotide sequences: (A) a base sequence encoding the amino acid sequence of any of SEQ ID NOs: 5 to 10; (B) one or more amino acids are deleted or added in the amino acid sequence of any of SEQ ID NOs: 5 to 10 Or a substituted amino acid sequence that encodes an amino acid sequence that confers Cd resistance activity; (C) a nucleotide sequence according to any of SEQ ID NOS: 5 to 10; A base sequence in which one or more bases are deleted, added or substituted in any one of the base sequences, and which codes for a protein that confers Cd resistance activity; or 11. A nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence according to any of 10 above, which encodes a protein that confers Cd resistance activity.

(14) A protein having any one of the following amino acid sequences: (A) the amino acid sequence of any of SEQ ID NOs: 5 to 10; or (B) one or more amino acids in the amino acid sequence of any of SEQ ID NOs: 5 to 10, which are deleted, added, or substituted. An amino acid sequence that confers Cd resistance activity. (15) A vector comprising the gene according to (13). (16) A transformant having the gene according to (13) or the vector according to (15). (17) The transformant according to (16), which is a transformed plant. (18) A method for purifying soil, comprising using the transformant according to (16) or (17) to accumulate cadmium in soil in the transformant.

(19) cDNA from cruciferous plants
Transforming the library into a host under conditions that allow expression in the host, culturing the resulting transformant in the presence of Cd,
A method for screening a gene involved in high cadmium accumulation, which comprises selecting a transformant having Cd resistance. (20) The screening method according to (16), wherein the cruciferous plant is B. juncea and the host is yeast. (21) A gene involved in high cadmium accumulation obtained by the screening method according to (19) or (20).

[0015]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Embodiments and a method of the present invention will be described below in detail. (1) Gene and protein of the present invention The present invention relates to a gene having any one of the following nucleotide sequences. (A) a base sequence encoding the amino acid sequence of any of SEQ ID NOs: 1 to 10; (B) one or more amino acids are deleted or added in the amino acid sequence of any of SEQ ID NOs: 1 to 10 Or a substituted amino acid sequence that encodes an amino acid sequence that confers Cd resistance activity; (C) a nucleotide sequence according to any of SEQ ID NOs: 1 to 10; A base sequence in which one or more bases are deleted, added or substituted in any one of the base sequences, and which codes for a protein that confers Cd resistance activity; or 11. A nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence according to any of 10 above, which encodes a protein that confers Cd resistance activity.

The present invention also relates to a protein having any one of the following amino acid sequences. (A) the amino acid sequence of any of SEQ ID NOs: 1 to 10; or (B) the amino acid sequence of any of SEQ ID NOs: 1 to 10, wherein one or more amino acids are deleted, added, or substituted. An amino acid sequence that confers Cd resistance activity.

In the present specification, "amino acid sequence in which one or more amino acids are deleted, added or substituted"
For example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, and still more preferably 1 to 5 amino acids of an amino acid sequence in which any number of amino acids are deleted, added or substituted. Say that. As used herein, the term "base sequence in which one or more bases have been deleted, added or substituted" means, for example, 1 to 20, preferably 1 to 15,
More preferably, it refers to a base sequence in which an arbitrary number of 1 to 10, more preferably 1 to 5, bases has been deleted, added or substituted.

As used herein, the term "base sequence hybridizing under stringent conditions" refers to a method using colony hybridization, plaque hybridization, or Southern blot hybridization, using DNA as a probe. Means a DNA sequence obtained by using a filter on which DNA derived from colonies or plaques or a fragment of the DNA is immobilized, in the presence of 0.7 to 1.0 M NaCl at 65 ° C. After the hybridization, 0.
About 1 to 2 times SSC solution (The composition of 1 times concentration SSC solution is
150 mM sodium chloride, 15 mM sodium citrate)
And DNA that can be identified by washing the filter under 65 ° C. conditions. Hybridization is performed using Molecular Cloning: A laboratory Ma
^{nnual, 2 nd Ed., Cold} Spring Harbor Laboratory, Col
d Spring Harbor, NY., 1989. Hereinafter, it is abbreviated as "Molecular Cloning 2nd Edition") and the like.

The DNA that hybridizes under stringent conditions includes the DNA used as a probe.
The homology is, for example, 70% or more, preferably 80% or more, more preferably 90% or more, and even more preferably 93% or more.
% Or more, particularly preferably 95% or more, most preferably 9% or more.
8% or more.

As used herein, "to confer Cd resistance activity" means that the gene is expressed in a host to express the Cd resistance activity. The type of host is not particularly limited, and examples include yeast and plants. More specifically, expression of the Cd resistance activity means that growth inhibition of the host does not occur or does not occur in the presence of Cd at a certain concentration or more such that growth inhibition occurs in a host having no gene of the present invention. It says that the degree decreases.

The method for obtaining the gene of the present invention is not particularly limited. Suitable probes and primers are prepared based on the nucleotide sequence and the amino acid sequence of SEQ ID NOs: 1 to 10 disclosed in the present specification, and the
The desired gene can be isolated by screening the cDNA library. DNA having the nucleotide sequence of SEQ ID NOs: 1 to 10 can also be obtained by PCR. Mustard chromosomal DNA or cDN
Using the A library or the like as a template, PCR is performed using a pair of primers designed to amplify any of the nucleotide sequences of SEQ ID NOS: 1 to 10.

The reaction conditions of the PCR can be appropriately set. For example, the reaction conditions are, for example, 94 ° C. for 30 seconds (denaturation), 55%
The reaction process includes 30 seconds to 1 minute (annealing) at 72 ° C. and 2 minutes (extension) at 72 ° C. as one cycle. For example, after 30 cycles, the reaction is carried out at 72 ° C. for 7 minutes. Next, the amplified DNA fragment can be cloned into an appropriate vector that can be amplified in a host such as E. coli. Preparation of probes and primers as described above, preparation of a cDNA library, screening and cloning of a cDNA library are known to those skilled in the art. For example, Molecular Cloning 2nd Edition, Current Protocols in Molecular Biology, Suppl.
ement 1-38, John Wiley & Sons (1987-1997)
Current protocols in molecular biology) and the like.

(B) an amino acid sequence in which one or more amino acids are deleted, added or substituted in the amino acid sequence of any one of SEQ ID NOs: 1 to 10 described above and which has Cd resistance A nucleotide sequence encoding an amino acid sequence imparting activity; or (D) SEQ ID NOS: 1 to 10
A base sequence in which one or more bases are deleted, added or substituted in the base sequence according to any of
(mutant gene) having a base sequence encoding a protein conferring d-resistance activity can also be prepared by any method known to those skilled in the art, such as chemical synthesis, genetic engineering techniques, and mutagenesis. Specifically, mutant DNAs can be obtained by using DNAs having the nucleotide sequences of SEQ ID NOs: 1 to 10 and introducing mutations into these DNAs.

For example, the method can be carried out using a method of bringing a DNA having the nucleotide sequence of SEQ ID NOS: 1 to 10 into contact with a drug as a mutagen, a method of irradiating ultraviolet rays, a genetic engineering technique, or the like. Site-directed mutagenesis, which is one of the genetic engineering techniques, is useful because it is a technique that can introduce a specific mutation at a specific position. Molecular cloning, 2nd edition, Current Protocols in Molecular Co., Ltd. It can be performed according to the method described in biology and the like.

(2) Involved in high accumulation of cadmium of the present invention
Vectors Containing Genes of the Present Invention The genes of the present invention can be used as recombinant vectors by incorporating them into appropriate vectors. The type of vector may be an expression vector or a non-expression vector, and can be selected according to the purpose. As the cloning vector, those capable of autonomous replication in Escherichia coli K12 strain are preferable,
Escherichia coli expression vectors, which can be used as phage vectors or plasmid vectors, may be used as cloning vectors. Specifically, ZAP Express
(Strategies, 5, 58 (1992), manufactured by Stratagene)
pBluescrlpt II SK (+) (Nuclelc Acids Research, 17,
9494 (1989)), Lambda ZAP II (Stratagene),
λgt10, λgt11 (DNA Cloning, A Practical Approach,
1, 49 (1985)), λTriplEx (Clontech), λE
xCell (Pharmacia), pT7T318U (Pharmacia), pcD2 (Mo1.Cen.Bio1,3,280 (1983)), pMW21
8 (manufactured by Wako Pure Chemical Industries), pUC118 (manufactured by Takara Shuzo), pEG400 (J.Ba
c., 172, 2392 (1990)], pQE-30 (manufactured by QIAGEN) and the like.

The expression vector can be selected in consideration of the combination with the host. Preferably, the expression vector can replicate autonomously in the host cell or can be integrated into the chromosome, and contains a promoter at a position where the gene of the present invention can be transcribed. Is used. When a bacterium is used as a host cell, an expression vector for expressing the DNA is capable of autonomous replication in the bacterium, and at the same time, a recombinant vector comprising a promoter, a ribosome binding sequence, the DNA and a transcription termination sequence. It is preferred that A gene that controls the promoter may be included.

Examples of expression vectors for bacteria include, for example,
pBTrP2, pBTac1, pBTac2 (all commercially available from Behringer Ringermannheim), pKK233-2 (Pharmacia), pSE280 (I
nvitrogen), pGEMEX-1 (Promega), pQE-8 (QIAGE
N), pQE-30 (QIAGEN), pKYP10 (JP-A-58-11060)
0), pKYP200 (Agrc. Biol. Chem., 48, 669 (1984)), PLS
A1 [Agrc. Blo1. Chem., 53, 277 (1989)], pGEL1 [Pro
c. Natl. Acad. Sci. USA, 82, 4306 (1985)], pBlues
crlptII SK +, pBluescriptII SK (-) (Stratagene),
pTrS30 (FERMBP-5407), pTrS32 (FERM BP-5408), pGEX (Ph
armacia), pET-3 (Novagen), pTerm2 (US468619
1, US4939094, US5160735), pSupex, pUB110, pTP5, pC
194, pUC18 (Gene, 33, 103 (1985)), pUC19 (Gene, 3
3, 103 (1985)), pSTV28 (Takara Shuzo), pSTV29 (Takara Shuzo), pUC118 (Takara Shuzo), pPA1 (JP-A-63-233798),
pEG400 (J. Bacterio 1., 172, 2392 (1990)), pQE-30 (Q
IAGEN) and the like. Examples of promoters for bacteria include trp promoter (P trp), la
c promoter (P lac), P _L promoter, P _R promoter, promoters from P _SE such promoters, E. coli or phage, such as, SP01 promoter, can be cited SP02 promoter, penP promoter and the like.

As an expression vector for yeast, for example, YE
p13 (ATCC37115), YEp24 (ATCC37051), Ycp5O (ATCC3741
9), pHS19, pHS15 and the like. Examples of promoters for yeast include PHO5 promoter, PG
K promoter, GAP promoter, ADH promoter, g
Examples of the promoter include an al1 promoter, a gal10 promoter, a heat shock protein promoter, an MFα1 promoter, and a CUP1 promoter.

As expression vectors for animal cells, for example, pcDNAI, pcDM8 (commercially available from Funakoshi), pAGE107 (JP-A-3-22979; Cytotechnology, 3, 133, (1990)), pAS3
-3 (Japanese Patent Application Laid-Open No. 2-227075), pCDM8 (Nature, 329, 840, (198
7)], pcDNAI / AmP (manufactured by Invitrogen), pREP4 (Invitrogen
PAGE103 (J. Blochem., 101, 1307 (1987)), pAG
E210 etc. can be illustrated. As a promoter for animal cells, for example, cytomegalovirus (human CM
V) promoter of the IE (immediate early) gene, SV40
Early promoter, retroviral promoter,
Examples include a metallothionein promoter, a heat shock promoter, and an SRα promoter.

As an expression vector for plant cells, for example, pIG121-Hm [Plant Cell Report, 15 , 809-814 (199)
5)] and pBI121 [EMBO J. 6 , 3901-3907 (1987)]. Examples of promoters for plant cells include the cauliflower mosaic virus 35S promoter [Mol. Gen. Genet (1990) 220 , 389-392], the rubulose bisphosphate carboxylase small subunit promoter, and the like.

(3) Involved in high accumulation of cadmium of the present invention
A transformant having a gene involved in high cadmium accumulation of the present invention can be prepared by introducing the above-described recombinant vector (preferably an expression vector) into a host. Specific examples of bacterial host cells include Escher
genus ichia, Corynebacterium, Brevibacterium, Baci
genus llus, Microbacterium, Serratia, Pseudomonas
Genus, Agrobacterium, Alicyclobacillus, Anabaena
Genus, Anacystis, Arthrobacter, Azobacter, Chro
genus matium, genus Erwinia, genus Methylobacterium, Phormidiu
m, Rhodobacter, Rhodopseudomonas, Rhodospiri
11um, Scenedesmun, Streptomyces, Synnecoccus
And microorganisms belonging to the genus Zymomonas. Methods for introducing a recombinant vector into a bacterial host include, for example, a method using calcium ions and a protoplast method.

Specific examples of yeast hosts include Saccharomyces cerevisae, Schizosaccharomyces pombe, Kluyveromyces lactis,
Trichosporon pu11ulan
s), Schwanniomyces albius
1uvius) and the like. As a method for introducing a recombinant vector into a yeast host, any method for introducing DNA into yeast can be used, and examples thereof include an electroporation method, a spheroblast method, and a lithium acetate method. .

As animal cell hosts, Namalva cells, CO
S1 cells, COS7 cells, CHO cells and the like can be mentioned.
As a method for introducing the recombinant vector into animal cells, any method capable of introducing DNA into animal cells can be used, for example, an electroporation method, a calcium phosphate method, a lipofection method, or the like.

When transforming plant cells,
The host can be arbitrarily selected depending on the purpose of use of the transformant (for example, phytoremediation or mass production of protein). For example, in the case of phytoremediation, the gene of the present invention is isolated. In addition to plants belonging to the genus Brassica to which the mustard belongs, it is possible to select plants suitable for the environment. As a method for introducing a recombinant vector into a plant cell, any method capable of introducing DNA into a plant cell can be used, for example,
Agrobacterium method, electroporation method, particle gun method and the like can be used. In order to obtain a plant from the transformed plant cell, a method usually used may be performed depending on the plant species to be used, but in the case of mustard, which has a high accumulation of heavy metals and a large biomass, for example, Methods.

Transformation of mustard (B. juncea) can be performed as follows (Narashimhulu, SB an).
d VLChopra, Plant Cell Report (1988) 7: 104-10
6). Seeds are aseptically germinated in MS medium containing 0.8% agarose. Hypocotyls and cotyledons are separated 4 to 6 days later. At this time, the cotyledons are cut so that a petiole of 1 to 2 mm remains and no growth point remains on the hypocotyl. The excised hypocotyl and cotyledons are immersed in an Agrobacterium culture solution containing the target plasmid, which is grown overnight by culturing for 10 to 30 minutes. Thereafter, the liquid was thoroughly wiped off, and BAP (2.0
５5.0 μM) and a co-culture with MS medium containing NAA (0.5-3.0 μM) for 2-3 days. Thereafter, the cells are cultured in a selective medium obtained by adding 10 to 50 mg / L of kanamycin and 20 to 100 mg / L of carpenicillin to the above medium composition. Individuals regenerated in the medium were treated with 3% sucrose, 0.
1 mg / L BAP, carpenicillin at the above concentration, 0.
Replace with MS medium containing 2% gellite. further,
To promote rooting, the following composition (1/2 times R2marc)
o, 3% sucrose, 0.1 mg / L BAP, 0.1 mg
/ L NAA, 0.4% gellite) to obtain a transformed plant.

(4) Involved in high accumulation of cadmium of the present invention
Confers Cd resistance activity encoded by the gene
Culturing the transformant having a gene involved in a high accumulation of cadmium production invention click, protein to produce and accumulate the imparting Cd resistance activity in the culture, and recovering the protein from the culture that As a result, the protein imparting the Cd resistance activity of the present invention can be obtained.

The method for culturing the transformant having the gene of the present invention can be performed according to a usual method used for culturing a host. When the transformant of the present invention is a prokaryote such as Escherichia coli or a eukaryote such as yeast, the culture medium for culturing these microorganisms contains a carbon source, a nitrogen source, inorganic salts, and the like that can be assimilated by the microorganism. Any of a natural medium and a synthetic medium may be used as long as the medium can efficiently culture the transformant. The cultivation is preferably performed under aerobic conditions such as shaking culture or deep aeration stirring culture.
4040 ° C., and the culture time is usually 16 hours to 7 days. During the culture, the pH is maintained at 3.0 to 9.0. The pH is adjusted using an inorganic or organic acid, an alkaline solution, urea, calcium carbonate, ammonia, or the like. If necessary, an antibiotic such as ampicillin or tetracycline may be added to the medium during the culture.

As a medium for culturing a transformant obtained by using an animal cell as a host cell, a commonly used RP
M11640 medium (The Journal of the American Medical As
sociation, 199, 519 (1967)), Eagle's MEM medium (Scienc
e, 122, 501 (1952)), DMEM medium (Virology, 8, 396 (19
59)), 199 medium (Proceeding of the Society for the B
iological Medicine, 73, 1 (1950)], or a medium obtained by adding fetal bovine serum or the like to such a medium. Culture is usually pH6~8,30~40 ℃, 1 under conditions such as 5% C0 ₂ presence
Do for ~ 7 days. If necessary, antibiotics such as kanamycin and penicillin may be added to the medium during the culturing.

As a medium for culturing a transformant obtained by using a plant cell as a host cell, a medium usually used according to the plant species, such as an MS medium or an R2P medium, is used. The cultivation is usually performed under the conditions of pH 6 to 8, 15 to 35 ° C, etc.
Perform for ~ 21 days. If necessary, antibiotics such as kanamycin and hygromycin may be added to the medium during the culture.

In order to isolate and purify a protein imparting Cd resistance activity from a culture of a transformant, a conventional protein isolation and purification method may be used. For example, when the protein of the present invention is expressed in a dissolved state in a cell,
After completion of the culture, the cells are collected by centrifugation, suspended in an aqueous buffer, and then crushed with an ultrasonic crusher, a French press, a Mantongaulin homogenizer, a Dynomill or the like, to obtain a cell-free extract. From the supernatant obtained by centrifuging the cell-free extract, a normal protein isolation and purification method, that is, a solvent extraction method, a salting out method using ammonium sulfate, a desalting method, a precipitation method using an organic solvent, Diethylaminoethyl (D
EAE) Sepharose, anion exchange chromatography using a resin such as DIAION HPA-75 (manufactured by Mitsubishi Chemical Corporation), S-Se
Cation exchange chromatography using a resin such as pharose FF (manufactured by Pharmacia), butyl sepharose,
Hydrophobic chromatography using resin such as phenyl sepharose, gel filtration using molecular sieve, affinity chromatography, chromatofocusing, electrophoresis such as isoelectric focusing, etc. are used alone or in combination. And a purified sample can be obtained.

When the protein is expressed in an insoluble form in the cells, the cells are similarly recovered, crushed, and centrifuged to obtain a precipitate fraction obtained by a conventional method. After recovering the protein, the insoluble form of the protein is solubilized with a protein denaturant. After diluting the lysate into a solution containing no protein denaturing agent or a solution in which the concentration of the protein denaturing agent is so small that the protein is not denatured, or dialyzed to form the protein into a normal three-dimensional structure, A purified sample can be obtained by the same isolation and purification method.

When the protein of the present invention or its derivative such as a modified sugar is secreted extracellularly, the protein or its derivative such as a sugar chain adduct can be recovered in the culture supernatant. That is, the culture is treated by a method such as centrifugation as described above to obtain a soluble fraction, and a purified sample is obtained from the soluble fraction by using the same isolation and purification method as described above. be able to.

The protein of the present invention can also be produced by a chemical synthesis method such as the Fmoc method (fluorenylmethyloxycarbonyl method) and the tBoc method (t-butyloxycarbonyl method). Also, Kuwawa Trading (US Advanced Ch.
em Tech), Perkin-El Marjaban (Perkins, U.S.A.)
-Elmer), Pharmacia Biotech (Sweden P
harmacia Biotech), Aloka (U.S. Protein Technolo
gy Instrument), Kurabo Industries (U.S.A., Synthecell-Vega), Nippon Perceptive Limited (U.S.A.
can also be synthesized using a peptide synthesizer manufactured by e-Company or Shimadzu Corporation.

(5) Soil using the transformant of the present invention
Purification method The present invention also relates to a soil purification method, comprising using a transformant having the gene of the present invention involved in high cadmium accumulation to accumulate cadmium in soil in the transformant. Also concerns. The transformant of the present invention can accumulate cadmium in cells since it contains a gene involved in high cadmium accumulation. By placing such a transformant in cadmium-containing soil (e.g., growing a transformed plant in cadmium-containing soil), cadmium can be incorporated into the transformant,
Thereby, cadmium can be removed from the soil to purify the soil. The transformant of the present invention is useful for phytoremediation, which is a method using plants for environmental restoration.

(6) Genetics involved in high cadmium accumulation
The present invention also relates to a method for transforming a cDNA library derived from a cruciferous plant into a host under conditions that allow expression in the host,
The obtained transformant is cultured in the presence of Cd, and a transformant having Cd resistance is selected. A method for screening a gene involved in high cadmium accumulation, and a method obtained by the screening method It also relates to genes involved in high cadmium accumulation. In the screening method of the present invention, first, a Brassicaceae plant such as mustard is cultivated in a hydroponic solution, Cd stress is applied, and thereafter, the plant is collected and mRNA is extracted. Then
CDNA is synthesized using the extracted mRNA as a template,
Build a library.

Next, a gene involved in high cadmium accumulation is screened using a host expression system. It is possible to obtain a Cd-resistant transformant by transforming the cDNA library constructed above into an appropriate host such as yeast and selecting a transformant capable of growing on a medium containing a constant concentration of Cd ions. it can. By extracting a plasmid from these Cd-resistant transformants, genes involved in high cadmium accumulation can be isolated. Further, after extracting the plasmid from the Cd-resistant transformant obtained by the screening, the host was transformed again,
By culturing in a medium containing a constant concentration of Cd ions, reproducibility of Cd resistance can be confirmed. Also,
A novel gene can be identified by examining homology between the obtained gene and a known gene by homology search. The present invention will be described more specifically with reference to the following examples, but the present invention is not limited to the examples.

[0047]

EXAMPLES Example 1: Observation of growth inhibition of mustard by Cd. Young seedlings of mustard were treated with 0, 1, 10, 100, and 1000 μM Cd for 14 days, and changes in the fresh weight of mustard during that period were examined. The results are shown in FIG. When the mustard was cultivated in a hydroponic solution containing 1 μM Cd ²⁺ , growth was not inhibited by Cd. No change in leaf color or shape was observed. Ten
When grown at μM Cd ²⁺ concentrations, there was only a slight increase in live weight. At 10 μM Cd ²⁺ concentration, the leaves were yellowed (FIG. 2). When cultivated at a concentration of 100 μM Cd ²⁺ , no increase in live weight was observed at all, and conversely, a decrease in live weight was confirmed by cotyledon withering. On the other hand, the green color of the leaves was darker than the control (0 μM). When cultivated at a concentration of 1000 μM Cd ²⁺ , almost all died on the fifth day. Based on the above, mustard must have Cd around 1 μM Cd ²⁺ concentration.
Was found to be completely unaffected by the toxicity of the drug. 10 to 10
0μM Cd ²⁺ concentrations before and after is believed that it can not grow in my best to live, in the before and after 1000μM Cd ²⁺ concentration mustard has been found that can not grow.

Example 2: Preparation of cDNA library of mustard mustard. After growing mustard in a hydroponic solution for 10 days, 1 ppm was added for 10 hours.
Cd ²⁺ stress was applied, and the aerial part and root of the plant were collected separately. First, mRNA was extracted from the aerial part, and cDNA was synthesized using it as a template. After inserting the cDNA into the pYES2 vector, E. coli DH5α was transformed. As a result, the completed mustard cDNA library contained about 2.2 × 10 ⁵ independent clones.When plasmids were extracted from 10 independent clones, the size of the cDNA inserted into pYES2 was 770 on average.
bp.

Example 3 Screening of Cd-Resistant Strains Screening for genes involved in the Cd ²⁺ resistance mechanism in plant cells was performed using the yeast expression system as follows.
The mustard cDNA library was transferred to INVsc1
Strain and ANY21 strain, respectively, and 150 μM (or 200,
Transformants capable of growing on MCGS-ura medium containing (300, 350 μM) CdCl ₂ were selected. As a result of a total of 10 screenings,
A total of 55 transformants having Cd resistance were obtained from about 1.6 million independent colonies (Table 1).

[0050]

[Table 1]

After extracting a plasmid from these Cd-resistant clones and determining the nucleotide sequence, a homology search was performed using a BLAST search. As a result, 6 clones each showing about 92% homology in amino acid sequence with Phytochelatin syntase (PCS1) of Arabidopsis, Metallothione
4 clones showing about 90% homology with in type3 (MT3)
And 10 clones showing 86-91% homology with the kinetochore protein SKP1 (Table 2).

[0052]

[Table 2]

FIG. 3 shows that about 2 × 10 ⁴ transformants were treated with 200 μM C
FIG. 4 is a photograph in which the cells are spread on an MCGS-ura medium containing dCl ₂ and cultured at 30 ° C. for 4.6 days. Two large colonies indicated by arrows
Cd resistant colonies. CDNA was isolated from this colony and sequence analysis revealed high homology with the Arabidopsis centromere protein SKP1.

Example 4 Confirmation of Reproducibility of MT3 and SKP1 After extracting a plasmid from the Cd-resistant transformant obtained by the screening, the wild-type budding yeast was transformed again.
The cells were cultured in MCGS-ura medium containing 150 μM CdCl ₂ at 30 ° C. for 2 days, and reproducibility was confirmed (FIG. 4). Vector (pYES2)
When only INVsc1 strain was transformed, the transformant was
Although the cells could not grow on the medium containing Cd, when they were transformed with mustard SKP1 or mustard MT3, they grew well on the medium containing Cd (FIG. 4). From these results, it was confirmed that the expression of the cDNA inserted in the plasmid was involved in the enhancement of the Cd resistance performance of the yeast.

Example 5: Sequence analysis of PCS Of the cDNA clones isolated in the above example, six cDNAs
The clone encoded one gene with approximately 95% homology to Arabidopsis PCS1 (AtPCS1). (FIG. 5). Therefore the cDNA BjPCS1 (B rassica j uncea PCS
1). The nucleotide sequence of BjPCS1 and the amino acid sequence encoded thereby are described in SEQ ID NO: 1 in the sequence listing.
The translated region of BjPCS1 encoded 449 amino acid residues 3 amino acid residues shorter at the 5 'end than AtPCS1. This is BjP
Since the mRNA of CS1 is as long as 1.6 kbp or more, it is considered that the full-length cDNA contained in the library is small. BjPCS1
Had an estimated molecular weight of 54 kD. The cysteine residue in the N-terminal region predicted to be the catalytic site of PCS1 is BjPCS1.
In addition, a number of cysteine residues found in the C-terminal region of PCS1 were also present in BjPCS1 (FIG. 5).

Example 6: Sequence analysis of MT3 Four cDNAs among the cDNA clones isolated in the above Example
The clones encoded three different isoforms with approximately 90% homology to Arabidopsis MT3 (FIG. 6). These cDNAs were used for BjMT3-31 / 60, BjMT3-50, BjM
T3-64 was named (B rassica j uncea MT3). BjMT3-31 / 6
The nucleotide sequences of 0, BjMT3-50, and BjMT3-64 and the amino acid sequences encoded thereby are described in SEQ ID NOs: 2, 3, and 4, respectively. The BjMT3 cDNA translation region is 201
bp, encoding 67 amino acid residues, estimated molecular weight
7.2 kD. In addition, two cysteine-rich regions specific to MT3 (Cys-Xaa-Xaa-Cys-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xa
a-Cys, Cys-Xaa-Cys-Xaa-Xaa-Xaa-Cys-Xaa-Cys-Xaa-Xaa
-Cys-Xaa-Cys) was completely conserved in mustard MT3 (FIG. 6).

Example 7: Sequence analysis of SKP1 Of the cDNA clones isolated in the above example, 9 cDNAs
The clones encoded six different isoforms with 86-91% homology to Arabidopsis SKP1 (ASK1) (FIG. 7). These cDNAs were converted to BjSKP1-1, BjSKP1-27 /
51, BjSKP1-39, BjSKP1-45, BjSKP1-48 / 49/56, BjSKP1-
63 named (B rassica j uncea SKP1). BjSKP1-1, Bj
SKP1-27 / 51, BjSKP1-39, BjSKP1-45, BjSKP1-48 / 49/5
6, and the nucleotide sequences of BjSKP1-63 and the amino acid sequence encoded thereby are described in SEQ ID NOs: 5 to 10 in the sequence listing, respectively. The translation region of the cDNA of BjSKP1 is 450 to 483 bp,
It codes for 150 to 161 amino acid residues and has a predicted molecular weight of 17.7 to 17.9 kD.

Example 8: Comparison of Cd-tolerance of yeast expressing isolated mustard cDNA What degree of Cd-resistance can be obtained when isolated mustard cDNA is expressed using budding yeast? First, a comparative study was performed using an agar medium (FIG. 8). Vector (pYES2)
When only INVsc1 strain was transformed, 100 transformants were obtained.
Can grow weakly on medium containing μM CdCl ₂ but ANY
When transformed into 21 strains, no growth was possible on the medium containing 100 μM CdCl ₂ . This suggests that wild-type budding yeast strains have different susceptibility to Cd. This was also reflected in the Cd tolerance of yeast expressing mustard cDNA. For example, when observing the growth on medium containing 600 [mu] M CdCl ₂ in yeast expressing BjPCS1, AN
Transformants using the Y21 strain as a host had smaller colonies than those using the INVsc1 strain as a host (FIG. 8). The yeast expressing BjPCS1 also grew on a medium containing 600 μM CdCl ₂ . In addition while the yeast with the BjSKP1-39 can not grow only up to 150μM CdCl _2, yeast with a BjSKP1-1 is 200μM C
The ability to grow on a medium containing dCl ₂ indicated that the SKP1 protein had a slight difference between the isoforms in the ability to enhance the Cd tolerance of yeast (FIG. 8). On the other hand, yeast having BjMT3-31 grew to a medium containing 200 μM CdCl ₂ . From the above results, it was found that BjPCS1 was most effective for detoxifying Cd when the cDNA isolated this time was expressed in yeast.

Next, the yeast expressing each mustard cDNA was cultured in a liquid medium for 30 hours, and the Cd concentration giving 50% growth inhibition was examined (FIG. 9). 75% of Cd concentration giving 50% growth inhibition of yeast expressing BjSKP1-27 / 51
M, 115 μM when expressing BjMT3-64, vector (pYE
In the case of only S2), it was 65 μM (FIG. 9). From the above results, the expression of BjSKP1-27 / 51 was 1.2 compared to the vector alone.
It was found that BjMT3-64 improved Cd resistance 1.8 times. In addition, the Cd concentration that gives 50% growth inhibition after culturing the transformed yeast for 66 hours was also examined (FIGS. 10 and 11). ANY21
When the vector alone was expressed in the strain and the INVsc1 strain, the Cd concentrations giving 50% growth inhibition were 50 μM and 72 μM, respectively. When BjPCS1 was expressed, 455 μM and 740 μM, respectively
(FIG. 10). When expressing only the vector,
The Cd resistance of the yeast host was strong in the INVsc1 strain, and the same was observed when BjPCS1 was expressed. Furthermore, both the ANY21 strain and the INVsc1 strain expressing BjPCS1 had improved Cd resistance about 10 times that of the control. On the other hand, the Cd concentration giving 50% growth inhibition of yeast expressing BjSKP1-51 was 163 μM, and BjMT3-
64 was 180 μM, and that of the vector alone was 102 μM (FIG. 11). From these results, BjSKP1-27 /
It was found that 51 increased the Cd resistance of yeast by 1.6 times and BjMT3-64 by 1.8 times. From Fig9 and Fig11, the yeast expressing BjSKP1-27 / 51 showed a time-dependent increase in Cd tolerance,
Constant Cd regardless of time in yeast expressing MT3-64
It has been found that it has resistance performance.

Example 9: Northern analysis Bj in the aerial part and root of mustard depending on the presence or absence of Cd treatment
Northern analysis was performed to examine how the expression level of MT3 changes. The result is shown in FIG. To the probe
About 550 bp of BjMT3-64 was used. As a result, BjMT3-64 becomes Cd
Regardless of the presence or absence of stress, it was constantly expressed better in the aerial part than in the root. Since BjMT3-64 is constantly expressed, it is considered that MT3 is a gene involved in regulation of heavy metal concentration in cells (heavy metal homeostasis) in the Cd detoxification mechanism. On the other hand, it was found that the expression level of BjMT3-64 was slightly induced by Cd in the root, although the expression level was considerably smaller than that in the above-ground part (FIG. 12).

Example 10: RT-PCR Further, the difference between the expression levels of BjPCS1, BjSKP1, and BjMT3 in the presence of Cd was examined using the RT-PCR method for BjPCS1, BjSKP1, and BjMT3. FIG. 13 shows the results. BjPCS1 and BjSKP1,
All of BjMT3 was found to be expressed in both roots and aerial parts, with or without Cd.

(Summary of Examples) In plant cells, Cd
The existence of several defense mechanisms that avoid harmful heavy metals such as (1) Phytokeratin Currently, phytokeratin (PC) is considered to play a major role in the defense mechanism of plant cells to avoid harmful heavy metals. The presence of PC has not yet been confirmed in animals. PC is present in plants, fission yeast and fungi, and Cd
²⁺ , Cu ²⁺ , and other heavy metal ion chelating peptides (Grill E, et al. (1985) Science 230: 674-676; and R
auser WE (1995) Plant Physiol 109: 1141-1149). PC
Is a thiol group-rich peptide having a primary structure shown in FIG. 14, and is a secondary metabolite synthesized from glutathione (GSH) by an enzymatic reaction. In evidence, both GSH-deficient mutants of fission yeast and Arabidopsis were PC-deficient and Cd-sensitive (Mutoh N, et al. (1988) Bioche.
m Biophys Res Commun 151: 32-39; and CobbettCS and others
(1998) Plant J 16: 73-78). In addition, GSH was found to be the substrate for the activity of PC synthase in cultured cells of Silene cucubalis (Antema spp.) (9. Grill
E et al (1989) Proc Natl Acad Sci USA 86: 6838
-6842). GSH-dependent PC synthase activity then binds the γ-Glu-Cys motif of the GSH molecule to a second GSH molecule to form PC2, or to a PCn molecule to form a PCn + 1 oligomer. It is believed to catalyze the transition. Thus, PC synthase activity was defined as γ-Glu-Cys dipeptidyl transpeptidase (EC 2.3.2.15). PC synthase is constantly expressed and metal ions (Cd ²⁺ ,
Active only when Cu ²⁺ , Zn ²⁺ , Ag ²⁺ , Hg ²⁺ , Pb ²⁺ ) are present (Grill E et al. (1989) Proc Natl Acad SciU.S.
A. 86: 6838-6842; Chen J, et al. (1997) Physiol Plant 1
01: 65-172; and Klapheck S, et al. (1995) Plant Physiol
107: 515-521). Similar activity has been observed in tomato, Arabidopsis, and pea (Chen J, et al. (1997) Phy
siol Plant 101: 65-172; Howden R et al. (1995) Plant P
hysiol 107: 1059-1066; and Klapheck S, et al. (1995) P
lant Physiol 107: 515-521). Ten years ago, PC synthase was identified, but the identification of the gene for PC synthase and the understanding of the PC biosynthetic pathway at the molecular level remained opaque to date. Recently, at the same time, three groups have used different approaches to identify PC synthase genes (PCS) from Arabidopsis, wheat, fission yeast, etc. (Vatamaniuk
OK et al. (1999) Proc Natl Acad Sci USA 96: 7110-711
5; Clemens S et al. (1999) EMBO J 18: 3325-3333; and H
a SB. et al. (1999) Plant Cell 11: 1153-1164). A comparison of Arabidopsis PCS (AtPCS1) and fission yeast PCS (SpPCS) at the amino acid level showed similarities in the N-terminal region (45% homology) but no conserved regions in the C-terminal region. However, one of the most striking common features of the C-terminal region was found to include a large number of cysteine residues, with a high probability that the cysteine residues exist in pairs. In addition, molecular analysis using Arabidopsis cad1 mutant strain is predicted to have a catalytically active site in the conserved N-terminal region (Ha SB. Et al. (1999) Plant Cell 11: 1153-116).
Four).

In this study, six cDNAs isolated from mustard as genes involved in Cd resistance showed a high homology of 92% at the amino acid level with AtPCS1 (FIG. 5). When the isolated mustard cDNA was expressed in budding yeast, Bj
PCS1 increased the Cd resistance of yeast most (more than 7 times). From this, it was understood that PC is significantly important for detoxification of Cd in plant cells as in the conventional theory. In addition, cysteine residues in the N-terminal region predicted as catalytic sites
Conserved at 1, there were also multiple cysteine residues in the C-terminal region (FIG. 5). On the other hand, the start codon position of BjPCS1 is AtPC
It was 3 amino acids shorter than S1. This is because BjPCS mRNA
Since it is as long as 1.6 Kbp or more, it is presumed that the full-length cDNA contained in the library is small. However, expression of BjPCS1 in yeast increases Cd resistance, indicating that the three amino acids in the N-terminal region are not important for PCS enzyme activity.

(2) Metallothionein The second defense mechanism for avoiding harmful heavy metals in plant cells is a mechanism using metallothionein (MT). Recently, it has become clear that some genes encoding proteins similar to animal MT proteins also exist in plants. Until 1997, the only protein explicitly designed as plant MT was the wheat Ec protein, but in 1997 Murphy et al. Purified and identified a Cu-inducible MT protein from Arabidopsis (Lane B, et al. (1987 ) Cell Bi
ol 65: 1001-1005). Plant MT can be classified into three types, MT1, MT2, and MT3, based on the sequence of the cysteine motif. MT3 is isolated from Arabidopsis by RT-PCR using primers designed from the database.MT3 has low homology to the MT1 and MT2 genes,
uits found homology to the MT group (Mu
rphy A, et al. (1997) Plant Physiol. 113 : 1293-1301).

It has been shown to date that the role of plant MT may be involved in metal tolerance, developmental processes and homeostasis of metals under environmental stress (Robinson NJ,
Et al. (1993) Plant metallothioneins. Biochem J 295: 1
-Ten). MT3, like phytic acid, is also involved in regulating cation concentrations in developing buckwheat seeds (BrkljacI
c M, et al. (1999) J plant physiol 154: 802-80419), but the function of plant MT is not yet fully understood. In addition, higher plants induced by Cd
There is no certain description about MT yet. Therefore, the role of plant MT in detoxifying Cd is also thought to be secondary compared to PC and stress proteins.

In this example, four cDNAs isolated from mustard greens as genes involved in Cd resistance showed high homology with Arabidopsis MT3 (FIG. 6). And it turned out that mustard MT3 consists of at least three isoforms. The MT3-specific cysteine-rich region was completely conserved in mustard MT3 (FIG. 6). Mustard m
The yeast expressing T3 (BjMT3) had a 1.7-fold increase in Cd resistance (FIG. 11). Since this time, it was confirmed that the mustard MT3 contains many cysteine residues, it is thought that the SH group of the cysteine residue in MT1 and MT2 suppresses the toxicity of Cd in the same way as chelating heavy metals such as Cu. Can be

(3) Centromeric protein SKP1 Chromosome aggregation and segregation are fundamental processes in cell division. The centromeric protein complex is essential for the association of kinetochore microtubules and mediates chromosome migration that ensures ordered separation of sister chromatids to daughter cells during mitosis and meiosis I do. Recently, the SKP1 gene has been isolated as the fourth protein constituting the kinetochore protein complex of yeast (Connelly C, et al. (1996) Cell 86: 275-285;
And Skowyra D, et al. (1997) Cell 91: 209-219), SKP1
Regulates the mitotic cell cycle (Hoyt MA (1997) Cell 91: 149-151). It has been reported that human SKP1 protein (Skp1p) forms a complex with cyclin A-cdK2 and regulates the transition to S phase (Zhang H, et al. (1995) Cell 82: 915-925). . Analysis of yeast skp1 mutants also revealed that the yeast SKP1 gene is essential for completion of M phase and transition to S phase (Connelly C,
(1996) Cell 86: 275-285; and Bai C, et al. (1996) Cel.
l86: 263-274). In yeast, Skp1p binds to components of the Cdc4 protein and kinetochore proteins other than mitotic Skp1p (Connelly C, et al. (1996) Cell 86: 275-2).
85; and Bai C, et al. (1996) Cell 86: 263-274).

On the other hand, Skp1p is an essential component of the ubiquitin ligase complex SCF that specifically degrades proteins (Feldman RMR, et al. (1997) Cell 91: 221-230;
kowyraD, et al. (1997) Cell 91: 209-219; Kaplan KB, et al.
(1997) Cell 91: 491-500; Porat R, et al. (1998) Plant
a 204: 345-351; and Gray WM, et al. (1999) Genes Dev1
3: 1678-1691). The SCF complex is a complex consisting of a protein having an F box, Skp1p, and Cdc53p / cullin (Sk
owyra D, et al. (1997) Cell 91: 209-219; KaplanKB, et al. (1
997) Cell 91: 491-500; and Porat R, et al. (1998) Pla.
nta 204: 345-351). And it is known that the SCF complex regulates the cell cycle through direct proteolysis by phosphorylation.

From the above, it is thought that Skp1p binds to the centromere in M phase, mediates phosphorylation and degradation of other centromere components, and subsequently promotes separation of sister chromatids. (Feld
manRMR, et al. (1997) Cell 91: 221-230; and Gray WM,
(1999) Genes Dev 13: 1678-1691). ASK1, an Arabidopsis SKP1 homolog, has recently been shown to be well expressed in dividing cells such as meristems and primordial tissues (Yang M, et al. (1999) Proc Natl Acad Sci USA 96: 1
1416-11421). In addition, the Arabidopsis cDNA and Genome Sequencing Project revealed that at least nine SKP1 homologs are present in Arabidopsis (Isao Shimamoto, Takuji Sasaki (1997) New Edition Plant PCR Experiment Protocol Shujunsha). Failure of the ask1-1 mutant of Arabidopsis resulted in failure to segregate homologous chromosomes in male cells in late meiosis and uneven distribution of chromosomes. Given these findings and the fact that yeast Skp1p is an essential component of the ubiquitin ligase complex SCF that specifically degrades proteins, Ask1p is directly or indirectly required for homologous chromosome aggregation before late cell division. It was speculated that the degradation and modification of proteins control the separation of homologous chromosomes (Yamamoto Masayuki (1994) Biomanual Series 10 Yeast Gene Experiments with Yodosha).

In this example, nine cDNAs isolated from mustard greens as genes involved in Cd resistance showed high homology with Arabidopsis SKP1 (Table 2). And it turned out that mustard SKP1 (BjSKP1) consists of at least six isoforms. It was found that when BjSKP1 was expressed in yeast, the yeast became resistant to Cd, and this increased in a time-dependent manner. Furthermore, it was found that the influence on the Cd resistance performance of yeast differs depending on the isoform (FIG. 8).

In addition, this example revealed that the susceptibility to Cd differs depending on the wild type of budding yeast (FIG. 8), so that it is expected that the Cd resistance mechanism differs slightly depending on the yeast strain. This expected that the cDNAs of Cd-resistant colonies obtained by transforming the cDNA library into budding yeasts having different genotypes would also differ. Mustard cD
As a result of transforming the NA library into the ANY21 strain and the INVsc1 strain, when using the ANY21 strain, BjPCS1 was replaced with INVsc.
When one strain was used, BjMT3, BjSKP1 and the like were successfully isolated (Table 2), and expected results were obtained. Also, Bj
When PCS1 was transformed into the INVsc1 strain, the Cd resistance increased as in the case of transforming the ANY21 strain. However, 600 μ
l On the CdCl ₂ medium, the INVsc1 strain expressing BjPCS1 (BjPCS1
Comparing the growth levels of PCS1 / INVsc1) and the ANY21 strain (BjPCS1 / ANY21), BjPCS1 / ANY21 had smaller colonies than BjPCS1 / INVsc1 (FIG. 8). This result indicates that only the vector
When the Y21 strain (vector / ANY21) and the INVsc1 strain were transformed, respectively, the results were consistent with the results that the vector / ANY21 was more Cd-sensitive. In other words, the ANY21 strain has a higher Cd than the INVsc1 strain.
Due to the sensitivity, expression of the exogenous gene also reflected that sensitivity. Therefore, by using a plurality of yeasts as hosts and comparing and examining the size of Cd-resistant colonies of the obtained transformants for each host, it is also possible to screen for a gene having higher Cd-resistant performance.

From this, the screening method of the Cd resistance gene by the yeast expression mechanism used in the present example is not only intended to isolate the Cd resistance gene but also to complement the gene inactivated by Cd. It has been found that this is a useful technique for isolating Cd, that is, elucidating the mechanism of where Cd exerts toxicity in cells. This method can be applied as a method to elucidate the toxicity mechanism of other harmful substances.

[0073]

According to the present invention, a novel protein involved in Cd resistance and its gene have been identified and isolated. The transformant having the gene related to Cd resistance of the present invention is useful for phytoremediation.

[0074]

[Sequence List] SEQUENCE LISTING <110> Mitsubishi Chemical Corporation <120> Genes which are involved in high accumulation of cadmium <130> A01382MA <160> 10

<210> 1 <211> 1656 <212> DNA <213> B. juncea <400> 1 gcg agt ctc tac cgt cga tct ctt cct tcc cct ccg gcc att gac ttt 48 Ala Ser Leu Tyr Arg Arg Ser Leu Pro Ser Pro Pro Ala Ile Asp Phe 1 5 10 15 tct tcc gcc gaa ggc aag aaa ata ttc aat gaa gcg ctt cag aaa gga 96 Ser Ser Ala Glu Gly Lys Lys Ile Phe Asn Glu Ala Leu Gln Lys Gly 20 25 30 aca atg gaa gga ttt ttc agg ttg att tct tat ttc cag acg cag tct 144 Thr Met Glu Gly Phe Phe Arg Leu Ile Ser Tyr Phe Gln Thr Gln Ser 35 40 45 gaa cct gct tat tgt ggc ttg gcc agc ctt tct gtc gtc gtc gct 192 Glu Pro Ala Tyr Cys Gly Leu Ala Ser Leu Ser Val Val Leu Asn Ala 50 55 60 ctt tct att gat cct gga cgt aaa tgg aaa ggg cct tgg agg tgg ttt 240 Leu Ser Ile Asp Pro Gly Arg Lys Trp Lys Gly Pro Trp Arg Trp Phe 65 70 75 80 gat gaa tcg atg ctg gac tgc tgc gag cca ctg gaa gca gtc aag gaa 288 Asp Glu Ser Met Leu Asp Cys Cys Glu Pro Leu Glu Ala Val Lys Glu 85 90 95 aag ggc att taaa ttt g gtt gtc tgt ttg gct cac tgt tct gga 336 Lys Gly Ile S er Phe Gly Lys Val Val Cys Leu Ala His Cys Ser Gly 100 105 110 gcc aaa gtg gag gct ttc cgc act aat cag acc acc atc gac gat ttc 384 Ala Lys Val Glu Ala Phe Arg Thr Asn Gln Thr Thr Ile Asp Asp Phe 115 120 125 cgc aag ttt gtg atg aaa tgc tcc acc tct gag aat tgc cat atg atc 432 Arg Lys Phe Val Met Lys Cys Ser Thr Ser Glu Asn Cys His Met Ile 130 135 140 tca aca tat cac aga ggg gtg ttt aag cag act ggg tct ggt cat ttt 480 Ser Thr Tyr His Arg Gly Val Phe Lys Gln Thr Gly Ser Gly His Phe 145 150 155 160 tca cct ata ggt ggc tat aat gct gag aga gat atg gcc ttg att ctt 528 Ser Pro Ile Gly Gly Tyr Asn Ala Glu Arg Asp Met Ala Leu Ile Leu 165 170 175 gat gtt gca cgt ttc aag tat cct ccc cat tgg gtt cct ctt aaa ctt 576 Asp Val Ala Arg Phe Lys Tyr Pro Pro His Trp Val Pro Leu Lys Leu 180 185 190 ctt tgg gaa gcc atg gac agc att gat gat tct aca ggg aaa cgt aga 624 Leu Trp Glu Ala Met Asp Ser Ile Asp Asp Ser Thr Gly Lys Arg Arg 195 200 205 ggg ttc atg ctc ata tct aga ccg cac aga gaa cct gga ttg 672 G ly Phe Met Leu Ile Ser Arg Pro His Arg Glu Pro Gly Leu Leu Tyr 210 215 220 act ctg tcg tgc aaa gat gag agc tgg atc agc ata gcc aaa tat tta 720 Thr Leu Ser Cys Lys Asp Glu Ser Trp Ile Ser Ile Ala Lys Tyr Leu 225 230 235 240 aag gaa gat gtt cct cgt ctt gtg agt tca caa cat gta gat agc gtg 768 Lys Glu Asp Val Pro Arg Leu Val Ser Ser Gln His Val Asp Ser Val 245 250 255 gac aaa atc tta tcg gtt gtg ttc ttc aag tca ctt ccg tca aat ttc aac 816 Asp Lys Ile Leu Ser Val Val Phe Lys Ser Leu Pro Ser Asn Phe Asn 260 265 270 acg ttc atc aga tgg gtg gct gag gtc aga ata gca gag gac aca aaa 864 Thr Phe Ile Arg Trp Val Ala Glu Val Arg Ile Ala Glu Asp Thr Lys 275 280 285 caa aac ctc agc gct gag gag aaa tcg agg ctc aac tta aag caa gtg 912 Gln Asn Leu Ser Ala Glu Glu Lys Ser Arg Leu Asn Leu Lys Gln Val 290 295 gtg ctg aaa gaa gtg cat gaa act gaa ctg ttc aaa cac atc agt aag 960 Val Leu Lys Glu Val His Glu Thr Glu Leu Phe Lys His Ile Ser Lys 305 310 315 320 ttc tta tcc aca gtg ggt tac gaa gac agt ctg g cg gct gca 1008 Phe Leu Ser Thr Val Gly Tyr Glu Asp Ser Leu Thr Tyr Ala Ala Ala 325 330 335 aag gct tgt tgc caa ggt gct gaa atc ttg tct gga tgc tca tca aaa 1056 Lys Ala Cys Cys Gln Gly Ala Ile Le Ser Gly Cys Ser Ser Lys 340 345 350 gag tac tgt tgt cgg gaa act tgt gtc aca tgt gtc aaa ggt cct ggc 1104 Glu Tyr Cys Cys Arg Glu Thr Cys Val Thr Cys Val Lys Gly Pro Gly 355 360 365 gag gca gaa ggc acc gtg gtg act gga gtt gtg gtg cgt gac ggg agc 1152 Glu Ala Glu Gly Thr Val Val Thr Gly Val Val Val Arg Asp Gly Ser 370 375 380 gaa caa aat gtt gat cta ctg gtg cca tcg act caa act gac tgt gaa 1200 Glu Gln Asn Val Asp Leu Leu Val Pro Ser Thr Gln Thr Asp Cys Glu 385 390 395 400 tgt ggt cca gag gca aat ttt ccg gca gga aac gat gtg ttc aca gta 1248 Cys Gly Pro Glu Ala Asn Phe Pro Ala Gly Asn Asp Val Phe Thr Val 405 410 415 ctt ctg ttg gct tta cct cca cag aca tgg tca ggg atc aaa gac caa 1296 Leu Leu Leu Ala Leu Pro Pro Gln Thr Trp Ser Gly Ile Lys Asp Gln 420 425 430 gct ctt atg caa gaa atg aag cag ct c att tcc atg gct tcc ctc cca 1344 Ala Leu Met Gln Glu Met Lys Gln Leu Ile Ser Met Ala Ser Leu Pro 435 440 445 act atg ctt caa gaa gag gta ttg cat ctt cga cgc caa ctt cag ctg 1392 Thr Met Leu Glu Glu Val Leu His Leu Arg Arg Gln Leu Gln Leu 450 455 460 cta aaa aga tgc caa gag aac aag gag gaa gag gat ttc gct gca cct 1440 Leu Lys Arg Cys Gln Glu Asn Lys Glu Glu Glu Asp Phe Ala Ala Pro 465 470 480 gcc ttt tga ttcagctacc caaatgtctc aaattttagc ctctctcttc accaattga 1498 Ala Phe atcccaattt ctcaaaccta aataatccat aattaattat taaagtctct tttattctat 1558 gtatgattaa aactcatgtg tagcatataaaaaa tactactaaaaaa tactactaaaaaa tactactaaaaaaaa

<210> 2 <211> 400 <212> DNA <213> B. juncea <400> 2 aacaaaacac acacaagaaa agaactcaaa aacctttcaa gcctttttca agatcaaatc 60 atg tct tcg tgc gga aac tgc gac tgt gct gac aag acc cag tgc gtt Ser Ser Cys Gly Asn Cys Asp Cys Ala Asp Lys Thr Gln Cys Val 1 5 10 15 aag aag gga acc agc tac acc ttg gac atc gtc gag act cag gag agc 156 Lys Lys Gly Thr Ser Tyr Thr Leu Asp Ile Val Glu Thr Gln Glu Ser 20 25 30 tac aag gaa gcc atg atc atg gaa gtt aat ggt gca gaa gag aac ggg 204 Tyr Lys Glu Ala Met Ile Met Glu Val Asn Gly Ala Glu Glu Asn Gly 35 40 45 tgc caa tgc aag tgt ggc tc agc tg agc tgc gtc aac tgc act tgc 252 Cys Gln Cys Lys Cys Gly Ser Ser Cys Ser Cys Val Asn Cys Thr Cys 50 55 60 tgc ccc aat taaaaaaagc tcctacatac acattttaaa aggggcct 301 Cys Pro Asn 65 tctcttttgtcat tgtcctgattgttgttgttgttgttg tgtcctcgatatt gttg 400

<210> 3 <211> 472 <212> DNA <213> B. juncea <400> 3 aaacaacaaa aacacacaca agaaaagaac tcaaattacc tctcaagatc aaatc 55 atg tct acg tgc gga aac tgc gac tgt gct gac aag acc cag Tgc gtg 103 Ser Thr Cys Gly Asn Cys Asp Cys Ala Asp Lys Thr Gln Cys Val 1 5 10 15 aag aag gta acc agc tac acc ttc gac atc gtc gag act cag gag agc 151 Lys Lys Val Thr Ser Tyr Thr Phe Asp Ile Val Glu Thr Gln Glu Ser 20 25 30 tac aag gaa gcc atg atc atg gac gtt agt ggt gca gaa gag aac ggg 199 Tyr Lys Glu Ala Met Ile Met Asp Val Ser Gly Ala Glu Glu Asn Gly 35 40 45 tgc caa tgc aag tgt ggc tct agc tc agc tgc gtc aac tgc act tgc 247 Cys Gln Cys Lys Cys Gly Ser Ser Cys Ser Cys Val Asn Cys Thr Cys 50 55 60 tgc ccc aat taaaaaaatc ccctacatac acattttaaa 286 Cys Pro Asn 65 aagggaccat gtctcttctg tcattg tcattg tcattg tcattg tg ctgtatgatg 406 taatggtttt atggtccctt atcttctaat acatcatatt atatatctaa aaaaaaaaaa 466 aaaaaa 472

<210> 4 <211> 298 <212> DNA <213> B. juncea <400> 4 aaaacacacacaagaactcaaacaacttcagttaagaaaaacaaaaaaacaaatc 55 atg tcg gac aag tgc gga agc tgc gac tgt gct gac aag acc cag tgs 103 Mer Ser Asly Ser Cys Asp Cys Ala Asp Lys Thr Gln Cys 1 5 10 15 gtg aag aag gga acc agc tac acc ttc gac atc gtc gag act caa gag 151 Val Lys Lys Gly Thr Ser Tyr Thr Phe Asp Ile Val Glu Thr Gln Glu 20 25 30 agc tac aag gaa gcc atg ttc atg gac gtt ggt gca gag gag aac ggg 199 Ser Tyr Lys Glu Ala Met Phe Met Asp Val Gly Ala Glu Glu Asn Gly 35 40 45 tgc caa tgc aag tgt ggc tct acc tgc agt tgc gtcgt act tgc 247 Cys Gln Cys Lys Cys Gly Ser Thr Cys Ser Cys Val Asn Cys Thr Cys 50 55 60 tgc ccc aat taaaaaaaaa aatctcccgg aataagaggc catttctcgt tt 298 Cys Pro Asn 65

<210> 5 <211> 531 <212> DNA <213> B. juncea <400> 5 aatctctcaaaaacaaatcaaaaag 25 atg tcg acg aag aag att gtg ttg aag agc tcc gac gac gag tct ttc 73 Met Ser Thr Lys Lys Ile Val Leu Lys Ser Ser Asp Asp Glu Ser Phe 1 5 10 15 gag gtt gac gag gcc gtg gct cgc gag tct cag acc cta gct cac atg 121 Glu Val Asp Glu Ala Val Ala Arg Glu Ser Gln Thr Leu Ala His Met 20 25 30 gtc gaa gac gac tgc acc gac aac ggc atc cct ctt ccc aac gtc acc 169 Val Glu Asp Asp Cys Thr Asp Asn Gly Ile Pro Leu Pro Asn Val Thr 35 40 45 ggc aag atc ctc gcc aag gtc atc gag tat tgc aag aag c gtc gac 217 Gly Lys Ile Leu Ala Lys Val Ile Glu Tyr Cys Lys Lys His Val Asp 50 55 60 gcc gct gct gcc aag aca gag gcc acc gcc gat ggt ggc gct ccc tcc 265 Ala Ala Ala Ala Ala Lys Thr Glu Ala Thr Ala Asp Gly Gly Ala Pro Ser 65 70 75 80 gac gag gac ctc aag gct tgg gat gcc gag ttc atg aat atc gat caa 313 Asp Glu Asp Leu Lys Ala Trp Asp Ala Glu Phe Met Asn Ile Asp Gln 85 90 95 gct acc ctc ttc gaa ctc atc ctg gct gct aac tat ctg aac atc aag 361 Ala Thr Leu Phe Glu Leu Ile Leu Ala Ala Asn Tyr Leu Asn Ile Lys 100 105 110 aac ctt ctt gac ctt acg tgc cag acg gtg gct gat atg atc aaa ggc 409 Asn Leu Leu Asp Leu Thr Cys Gln Thr Val Ala Asp Met Ile Lys Gly 115 120 125 aag act cca gac gag att cgc acg acc ttc aac atc aag aac gac ttc 457 Lys Thr Pro Asp Glu Ile Arg Thr Thr Phe Asn Ile Lys Asn Asp Phe 130 135 140 tcg cct gag gag gaa gag gag gtg cgc agg gag aac caa tgg gct ttt 505 Ser Pro Glu Glu Glu Glu Glu Val Arg Arg Glu Asn Gln Trp Ala Phe 145 150 155 160 gaa tga ttgatcaaag agaagccttg 531 Glu

<210> 6 <211> 472 <212> DNA <213> B. juncea <400> 6 ctcgaaatca aaactctcaa ag 22 atg tcg acg aag aag atg gtg ttg aaa agc tcc gac ggc gag tct ttc 70 Met Ser Thr Lys Lys Met Val Leu Lys Ser Ser Asp Gly Glu Ser Phe 1 5 10 15 gag gtc gat gag gcc gtg gct ctc gag tct cag acc ata gcg cac atg 118 Glu Val Asp Glu Ala Val Ala Leu Glu Ser Gln Thr Ile Ala His Met 20 25 30 gtc gaa gac gac ggc gtc gac aac ggg atc cct ctt ccc aac gtc acg 166 Val Glu Asp Asp Gly Val Asp Asn Gly Ile Pro Leu Pro Asn Val Thr 35 40 45 agc aag atc ctc gcg aag gtg att gag tac tg ag aaa cac gtc gac 214 Ser Lys Ile Leu Ala Lys Val Ile Glu Tyr Cys Lys Lys His Val Asp 50 55 60 gcc gcc gct tct aag acc gag gcc gtc gat ggc ggc gct tcc tcc gac 262 Ala Ala Ala Ser Lys Thr Glu Ala Val Asp Gly Gly Ala Ser Ser Asp 65 70 75 80 gat gac ctc aag gcc tgg gac gcc gag ttc atg aag atc gat caa gct 310 Asp Asp Leu Lys Ala Trp Asp Ala Glu Phe Met Lys Ile Asp Gln Ala 85 90 95 acc ctc ttc gaa ctc atc ctg gcg gct aac tat ttg aac a tc aag aac 358 Thr Leu Phe Glu Leu Ile Leu Ala Ala Asn Tyr Leu Asn Ile Lys Asn 100 105 110 ctt ctt gac ttg aca tgc cag acg gtg gct gat atg atc aag ggg aag 406 Leu Leu Asp Leu Thr Cys Gln Thr Val Ala Asp Met Ile Lys Gly Lys 115 120 125 act cca gag gag att cgc acg acc ttc aac atc aag aac gac ttt act 454 Thr Pro Glu Glu Ile Arg Thr Thr Phe Asn Ile Lys Asn Asp Phe Thr 130 135 140 gcc gag gaa gag gag gag 472 Ala Glu Glu Glu Glu Glu 145

<210> 7 <211> 734 <212> DNA <213> B. juncea <400> 7 cacaatc 7 atg tcg acg aag aag atc gtg ttg aag agc tcc gat ggc gag tct ttc 55 Met Ser Thr Lys Lys Ile Val Leu Lys Ser Ser Asp Gly Glu Glu Ser Phe 1 5 10 15 gag gtc gac gag gcc gtg gct ctc gag tct cag acc ata gcc cac atg 103 Glu Val Asp Glu Ala Val Ala Leu Glu Ser Gln Thr Ile Ala His Met 20 25 30 gtc gaa gac gac tgc gtc gac aac gga gtc ccg ctt ccc aac gtc acg 151 Val Glu Asp Asp Cys Val Asp Asn Gly Val Pro Leu Pro Asn Val Thr 35 40 45 agc aag atc ctc gcc aag gtg att gag tag cgag aag gtc gat 199 Ser Lys Ile Leu Ala Lys Val Ile Glu Tyr Cys Lys Lys His Val Asp 50 55 60 gcc gtt gct tcc aag agc gag gcc gtc gat ggc ggt ggc tcc tcc gac 247 Ala Val Ala Ser Lys Ser Glu Ala Val Asp Gly Gly Gly Ser Ser Asp 65 70 75 80 gat gac ctc aag gct tgg gat gct gag ttt atg aag atc gat caa gct 295 Asp Asp Leu Lys Ala Trp Asp Ala Glu Phe Met Lys Ile Asp Gln Ala 85 90 95 acc ctc ttt gag ctc atc ctg gct gct aat tat ttg aac atc aag aac 343 Thr Leu Phe Glu Leu Ile Leu Ala Ala Asn Tyr Leu Asn Ile Lys Asn 100 105 110 ctt ctc gac ctg aca tgc cag aca gtg gct gat atg atc aag ggc aag 391 Leu Leu Asp Leu Thr Cys Gln Thr Val Ala Asp Met Ile G Lys 115 120 125 act ccg gag gag att cgc acg acc ttc aac atc aag aac gac ttt tca 439 Thr Pro Glu Glu Ile Arg Thr Thr Phe Asn Ile Lys Asn Asp Phe Ser 130 135 140 cca gag gaa gaa gag gag gtg cgc agg gag aac caa tgg gct ttt gaa 487 Pro Glu Glu Glu Glu Glu Val Arg Arg Glu Asn Gln Trp Ala Phe Glu 145 150 155 160 tga tgcttgagag agtgggagag atcgttgaag caaaccaacc 530 agtttcttgctttatgttgttgcctttttttttttttttatctctgtggatgatcagtgt 590 ggatgatgactttgtttctctgctattttccttttgaacttcatgactattaagtaccaa 650 tgttggatttgtgcttttcatgtcttaaagattgaggttggtttgccttgcaaaaaaaaa 710 aaaaaaaaaaaaaaaaaaaaaaaa 734

<210> 8 <211> 533 <212> DNA <213> B. juncea <400> 8 ctctcaaaaatcgaaaaaagt 21 atg tcg acg aag aag atc gtg ttg aag agc tcc gat ggc gag tct ttc 69 Met Ser Thr Lys Lys Ile Val Leu Lys Ser Ser Asp Gly Glu Glu Ser Phe 1 5 10 15 gag gtc gac gag gct gtg gct cgc gag tct cag acc cta gct cac atg 117 Glu Val Asp Glu Ala Val Ala Arg Glu Ser Gln Thr Leu Ala His Met 20 25 30 gtc gaa gac gac tgc atc gag aac ggt atc cct ctc cct aac gtc acg 165 Val Glu Asp Asp Cys Ile Glu Asn Gly Ile Pro Leu Pro Asn Val Thr 35 40 45 agc aag atc ctc gcc aag gtc atc gag ag tag cag aag gtc gac 213 Ser Lys Ile Leu Ala Lys Val Ile Glu Tyr Cys Lys Lys His Val Asp 50 55 60 gcc gct gct gcc aag acc gag ggg gcc gtc gat ggt gct gct tca tcc 261 Ala Ala Ala Ala Ala Lys Thr Glu Gly Ala Val Asp Gly Ala Ala Ser Ser 65 70 75 80 gac gat gac ctc aag gcg tgg gat acc gag ttc atg aag atc gat caa 309 Asp Asp Asp Leu Lys Ala Trp Asp Thr Glu Phe Met Lys Ile Asp Gln 85 90 95 gca acc ctc ttc gaa ctc atc ctg gct gct aat tac ctg aac atc aag 357 Ala Thr Leu Phe Glu Leu Ile Leu Ala Ala Asn Tyr Leu Asn Ile Lys 100 105 110 aac ctt ctt gac ctc acg tgc cag acg gtg gct gat atg att aaa ggc 405 Asn Leu Leu Asp Leu Thr Cys Gln Thr Ala Asp Met Ile Lys Gly 115 120 125 aag act cca gaa gag att cgc acg acc ttc aac atc aag aac gac ttt 453 Lys Thr Pro Glu Glu Ile Arg Thr Thr Phe Asn Ile Lys Asn Asp Phe 130 135 140 tca ccc gag gaa gag gag gag gtg cgc agg gag aat caa tgg gct ttt 501 Ser Pro Glu Glu Glu Glu Glu Val Arg Arg Glu Asn Gln Trp Ala Phe 145 150 155 160 gaa taa tgatcaaagc gaggtcgtgg aagtag 533 Glu

<210> 9 <211> 653 <212> DNA <213> B. juncea <400> 9 caaaaaaaaagaaccatctcaaaagt 26 atg tcg acg aag aag att gtg ttg aaa agc tcc gac ggc gag tcc ttc 74 Met Ser Thr Lys Lys Ile Val Leu Lys Ser Ser Asp Gly Glu Glu Ser Phe 1 5 10 15 gag gtc gac gag gcc gtg gcc ctc gag tct cag acc atc gct cac atg 122 Glu Val Asp Glu Ala Val Ala Leu Glu Ser Gln Thr Ile Ala His Met 20 25 30 gtc gaa gac gac tgc gtc gac aac ggg atc cct ctc ccc aac gtc acc 170 Val Glu Asp Asp Cys Val Asp Asn Gly Ile Pro Leu Pro Asn Val Thr 35 40 45 agc aag atc ctc gcc aag gtg att gag tac tgc aag cag gtc gac 218 Ser Lys Ile Leu Ala Lys Val Ile Glu Tyr Cys Lys Lys His Val Asp 50 55 60 gcc gcc gcc tcc aag acc gag gcc gtc gac ggc ggg gct tcc tcc gac 266 Ala Ala Ala Ser Lys Thr Glu Ala Val Asp Gly Gly Ala Ser Ser Asp 65 70 75 80 gat gac ctc aag gcg tgg gac gcc gag ttc atg aag atc gat caa gct 314 Asp Asp Leu Lys Ala Trp Asp Ala Glu Phe Met Lys Ile Asp Gln Ala 85 90 95 acc ctc ttc gag ctc atc ctg gcg gct aac tat ctg aac att aag aac 362 Thr Leu Phe Glu Leu Ile Leu Ala Ala Asn Tyr Leu Asn Ile Lys Asn 100 105 110 ctg ctt gac ctg acg tgc cag acg gtt gct gat atg atc aag ggc aag 410 Leu Leu Asp Leu Thr Cys Gln Thr Val Ala Asp Met Ile Lys Gly Lys 115 120 125 act cca gag gag att cgc acg acc ttc aac atc aag aac gac ttc act 458 Thr Pro Glu Glu Ile Arg Thr Thr Phe Asn Ile Lys Asn Asp Phe Thr 130 135 140 cct gag gaa gag gag gag gtg cgc aga gag aac caa tgg gct ttt gaa 506 Pro Glu Glu Glu Glu Glu Val Arg Arg Glu Asn Gln Trp Ala Phe Glu 145 150 155 160 tga tcaaagagtt gtcattgaag caaaccctct ttatgttatt gtctttctct 559 tctctgtgga tgatgatgac ttggttttta tttattttcg tcctctttat ttaatattaa 619 gaacctatgg ttgctcaaaa aaaaaaaaaa aaaa 653

<210> 10 <211> 807 <212> DNA <213> B. juncea <400> 10 tatattataa aaattaggga tctcccttat ctccccttca tcgcttctct caaatatttt 60 ctcttgacgt ttttctcaca atc 83 atg tcg acg aag ag ag agg atg agg atg agg atg agg atg agg atg agg atg agg atg agg atg agg atg agg atg agg atg agg atg tct ttc 131 Met Ser Thr Lys Lys Ile Val Leu Lys Ser Ser Asp Gly Glu Ser Phe 1 5 10 15 gag gtc gac gag gcg gtc gcc ctc gag tct cag acc ata gcc cac atg 179 Glu Val Asp Glu Ala Val Ala Leu Glu Ser Gln Thr Ile Ala His Met 20 25 30 gtt gaa gac gac tgc gtc gac aac ggt gtc cct ctt ccc aac gtc acg 227 Val Glu Asp Asp Cys Val Asp Asn Gly Val Pro Leu Pro Asn Val Thr 35 40 45 agc aag atc ctc gcc aag gtg att gag tac tgc aag aag cac gtc gac 275 Ser Lys Ile Leu Ala Lys Val Ile Glu Tyr Cys Lys Lys His Val Asp 50 55 60 gct gct gct tcc aag agc gag gcc gtc gac ggt ggt ggt tcc tca gac Ala Ala Ala Ser Lys Ser Glu Ala Val Asp Gly Gly Gly Ser Ser Asp 65 70 75 80 gac gac ctc aag gct tgg gat gct gag ttt atg aag atc gat caa gct 371 Asp Asp Leu Lys Ala Trp Asp Ala Glu Phe Met Lys Ile A sp Gln Ala 85 90 95 acc ctc ttc gaa ctc atc ctg gct gct aat tat ctg aac atc aag aac 419 Thr Leu Phe Glu Leu Ile Leu Ala Ala Asn Tyr Leu Asn Ile Lys Asn 100 105 110 ctg ctg gac ctc acatc ca gtg gct gat atg atc aag ggc aag 467 Leu Leu Asp Leu Thr Cys Gln Thr Val Ala Asp Met Ile Lys Gly Lys 115 120 125 act ccg gaa gag att cgc acg acc ttt aac atc aag aac gac ttt tca 515 Thr Pro Glu Glu Ile Arg Thr Thr Phe Asn Ile Lys Asn Asp Phe Ser 130 135 140 ccc gag gaa gaa gag gag gtg cgc agg gag aac caa tgg gct ttt gaa 563 Pro Glu Glu Glu Glu Glu Val Arg Arg Glu Asn Gln Trp Ala Phe Glu 145 150 155 160 tga atgatacgtg agagagcctt tgtgtgggag aggtcgttga 606 agcaaaccaa ccagtttact tgcttttatg ttgttgcctt tttttactgt ggatgatcag 666 tgcggatgat gatgacttgg tttctctctg ttgttttcct tttgttattc atgactatgc 726 tcgtcctccc cgtgctggat atttgctttt aatgtcttta cgagtggtgt tggtttgcct 786 tgcaaaaaaa aaaaaaaaaa a 807

[Brief description of the drawings]

FIG. 1 is a diagram showing the effect of Cd on the growth of mustard.

FIG. 2 shows a state in which mustard is grown in a hydroponic solution containing Cd ²⁺ . ,

FIG. 3 shows an example of screening for a cadmium-resistant strain.

FIG. 4 shows the reproducibility of positive clones.

FIG. 5 shows a comparison of the amino acid sequences of mustard PCS1 and Arabidopsis phytokeratin synthase 1.

FIG. 6 shows M. americana of mustard MT3 and Arabidopsis.
3 shows a comparison of amino acid sequences of T3.

FIG. 7 shows a comparison of the amino acid sequences of mustard SKP1 and the kinetochore protein SKP1 of Arabidopsis.

FIG. 8 shows changes in cadmium tolerance of yeast due to mustard gene expression.

FIG. 9 shows changes in cadmium tolerance of yeast due to mustard gene expression.

FIG. 10 shows changes in cadmium tolerance of yeast by BjPCS1.

FIG. 11 shows changes in cadmium tolerance of yeast due to mustard gene expression.

FIG. 12 shows the results of analysis of BjMT3-64 expression in the aerial part and root of mustard under Cd ²⁺ stress by Northern analysis.

FIG. 13 shows the results of expression analysis of BjPCS1, BjSKP1, and BjMT3 in the aerial part and root of mustard under Cd ²⁺ stress using RT-PCR.

FIG. 14. Phytokeratin (PC) and is
The chemical structure of γ-gulutamylcysteinyl shared by o-PC is shown (Kotrba P, et al. (1999) A review. Collect Czech
Chem Commun 64: 1057-1086).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (reference) // C12P 21/02 C12N 15/00 ZNAA 4H045 (C12Q 1/04 B09B 3/00 ZABE C12R 1: 645) C12N 5/00 CF term (reference) 4B024 AA08 BA80 CA04 DA01 DA12 EA04 GA11 GA17 GA19 HA01 HA03 HA12 4B063 QA01 QA18 QQ04 QQ07 QQ42 QR69 QR76 QS24 QS38 4B064 AG01 CA02 CA06 CA10 CA19 CC24 DA16 4B072AAABAX BB02 CA24 CA46 CA53 CA54 4D004 AA41 AB03 CA17 CA50 CC20 4H045 AA10 AA20 AA30 CA30 FA74

Claims (21)

[Claims] 1. A gene having any one of the following nucleotide sequences: (A) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1; (B) an amino acid sequence in which one or more amino acids have been deleted, added or substituted in the amino acid sequence of SEQ ID NO: 1; A nucleotide sequence encoding an amino acid sequence that confers Cd resistance activity; (C) a nucleotide sequence according to SEQ ID NO: 1; (E) a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 1 which is a nucleotide sequence encoding a protein that confers Cd resistance activity; A nucleotide sequence encoding a protein that confers resistance activity. 2. A protein having any one of the following amino acid sequences: (A) an amino acid sequence represented by SEQ ID NO: 1; or (B) an amino acid sequence in which one or more amino acids are deleted, added or substituted in the amino acid sequence represented by SEQ ID NO: 1; Amino acid sequence to be assigned. 3. A vector comprising the gene according to claim 1. 4. A transformant having the gene according to claim 1 or the vector according to claim 3. 5. The transformant according to claim 4, which is a transformed plant. 6. A method for purifying soil, comprising using the transformant according to claim 4 to accumulate cadmium in soil in the transformant. 7. A gene having any one of the following nucleotide sequences. (A) a base sequence encoding the amino acid sequence of SEQ ID NO: 2, 3 or 4; (B) one or more amino acids are deleted, added or substituted in the amino acid sequence of SEQ ID NO: 2, 3 or 4 (C) the nucleotide sequence of SEQ ID NO: 2, 3 or 4, and (D) the nucleotide sequence of SEQ ID NO: 2, 3 or 4. A nucleotide sequence in which one or more nucleotides are deleted, added or substituted in the nucleotide sequence of SEQ ID NO: 2, which encodes a protein that confers Cd resistance activity; or (E) SEQ ID NO: 2, 3, or 4. A nucleotide sequence that hybridizes with the nucleotide sequence described under stringent conditions and encodes a protein that confers Cd resistance activity. 8. A protein having any one of the following amino acid sequences: (A) the amino acid sequence of SEQ ID NO: 2, 3 or 4; or (B) the amino acid sequence of SEQ ID NO: 2, 3 or 4 in which one or more amino acids are deleted, added or substituted An amino acid sequence that confers Cd resistance activity. 9. A vector comprising the gene according to claim 7. 10. The gene according to claim 7, or 9
A transformant having the vector according to 1. 11. The transformant according to claim 10, which is a transformed plant. 12. A method for purifying soil, comprising using the transformant according to claim 10 to accumulate cadmium in soil in the transformant. 13. A gene having any one of the following nucleotide sequences. (A) a base sequence encoding the amino acid sequence of any of SEQ ID NOs: 5 to 10; (B) one or more amino acids are deleted or added in the amino acid sequence of any of SEQ ID NOs: 5 to 10 Or a substituted amino acid sequence that encodes an amino acid sequence that confers Cd resistance activity; (C) a nucleotide sequence according to any of SEQ ID NOS: 5 to 10; A base sequence in which one or more bases are deleted, added or substituted in any one of the base sequences, and which codes for a protein that confers Cd resistance activity; or 11. A nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence according to any of 10 above, which encodes a protein that confers Cd resistance activity. 14. A protein having any one of the following amino acid sequences: (A) the amino acid sequence of any of SEQ ID NOs: 5 to 10; or (B) the amino acid sequence of any of SEQ ID NOs: 5 to 10, wherein one or more amino acids are deleted, added, or substituted. Amino acid sequence that confers Cd resistance activity. A vector comprising the gene according to claim 13. A transformant comprising the gene according to claim 13 or the vector according to claim 15. 17. The transformant according to claim 16, which is a transformed plant. 18. A method for purifying soil, comprising using the transformant according to claim 16 or 17 to accumulate cadmium in soil in the transformant. 19. A host plant is transformed with a cDNA library derived from Brassicaceae under conditions that allow expression in the host, and the resulting transformant is cultured in the presence of Cd.
Selecting a transformant having resistance,
A method for screening a gene involved in high cadmium accumulation. 20. A cruciferous plant comprising B. junce
20. The screening method according to claim 19, wherein the host is a). 21. A gene involved in high cadmium accumulation obtained by the screening method according to claim 19 or 20.