JP2002085059A - Novel tsp1 domain-including polypeptide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To discover a novel TSP1 domain-including protein that can be expected to be useful for elucidation, prophylaxis, therapy and diagnosis of the diseases relating to the vascularization. SOLUTION: The cDNA encoding a novel TSP1 domain-including protein originating from human brain is isolated to obtain a novel TSP1 domain- including protein that has 8-time recurred thrombospondin domain-encoded by the cDNA. Further, this invention provides this cDNA, the protein and polypeptide or peptide as an originate peptide, an antibody against the protein a method for screening the inhibitor, antagonist and activator of this protein, the screened compounds and medicinal composition and the diagnostic method using these screened substance.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a polypeptide or protein containing a novel thrombospondin (TSP) domain derived from human brain, and a polynucleotide encoding the polypeptide. . For more information, see New T
Peptides having all or part of the amino acid sequence of SP1 domain-containing polypeptides or proteins, polynucleotides encoding the peptides or polypeptides, recombinant vectors containing the polynucleotides, and traits transformed with the recombinant vectors A transformant, a method for producing a peptide or polypeptide using the transformant, an antibody against the peptide or polypeptide, a method for screening a compound using the same, an action on the screened compound, the polypeptide or the polynucleotide The present invention relates to an activity inhibiting compound or an activity activating compound, a pharmaceutical composition related thereto, and a disease diagnosis method related thereto.

[0002]

2. Description of the Related Art Angiogenesis refers to the formation of new capillaries from existing blood vessels, and is distinguished from vasculogenesis in the fetus.
Physiological angiogenesis occurs in the ovary and uterine mucosa in response to the estrous cycle and is also seen during placental formation. Also, granulation tissue during the wound healing process, blood vessels are blocked by myocardial infarction, etc.
It is also seen later when collateral circulation is created. These physiological angiogenesis are all temporary, and when the purpose of angiogenesis (supply of oxygen and nutrients to tissues) is fulfilled, the growth of capillaries stops. In contrast, the growth of capillaries may not be stopped with the disease.

In diabetic retinopathy and retinopathy of prematurity, pathologically excessive angiogenesis occurs in the retina, leading to blindness. In psoriasis vulgaris, abnormal neovascularization in the dermis causes epidermal proliferation and shedding. In rheumatoid arthritis, capillaries invade articular cartilage and destroy joints. Angiogenesis in solid tumors causes the tumor to grow rapidly and cause metastasis, causing worsening of the symptoms that the tumor causes to the host. In recent years, various studies have revealed that tumor cells produce substances that induce angiogenesis.

At present, solid malignant neoplasms, ophthalmic diseases (proliferative diabetic retinopathy, retinopathy of prematurity, iris rubeosis, sickle cell retinopathy, retinopathy) are diseases caused by angiogenesis (so-called neovascular diseases). Central vein occlusion, branch retinal vein occlusion, central retinal artery occlusion, senile discoid macular degeneration, and other ophthalmic diseases that cause ischemia), rheumatoid arthritis, hemangiomas, hemangiofibromas, psoriasis vulgaris And an abnormal capillary network of atherosclerotic lesion outer membrane. Conversely, angiogenesis deficiencies with insufficient angiogenesis include ischemic heart disease, collateral dysgenesis in obstructive arteriosclerosis of the lower limbs, and insufficient angiogenesis during the wound healing process Intractable skin ulcers, intractable gastric ulcers, and postoperative dysplasia (Folkman J., et al., Science (1987) 235: 442-44)
7, Hideki Ito: The latest medicine (1995) 50 (6): 1121-1125).

[0005] In the process of angiogenesis, when angiogenesis is stimulated, cells constituting the tissue release angiogenic factors, and the angiogenic factors act on vascular endothelial cells in the nearby post-capillary vein, Endothelial cells secrete proteolytic enzymes such as plasminogen activator (PA) and collagenase. These enzymes degrade the basement membrane, opening a small hole in the vessel wall from which one endothelial cell sprouts outward. Subsequently, migration of the endothelial cells begins, and at the same time the matrix of the stroma is degraded. As they migrate, the endothelial cells proliferate and then differentiate to form tubes, forming lumens and luminal formation. Endothelial cells secrete basement membrane components and create a basement membrane outside the lumen.
Pericytes begin to migrate thereon, and the tips of the buds of the new blood vessels continue to form a loop, through which blood flows and is completed. It is considered that such angiogenesis is not controlled by a single factor, but is formed by various kinds of angiogenesis-promoting factors and angiogenesis-suppressing factors in complex intertwining. As shown in Table 1, many angiogenesis promoting factors and angiogenesis inhibiting factors have been reported so far.

[0006]

[Table 1]

[0007] Among them, thrombospo
ndin (TSP) is a heparin-binding glycoprotein released by the aggregation of platelets and has a molecular weight of 140-150k.
It is a trimer of the same chain of Da. TSP is synthesized not only by platelets but also by various cells such as vascular endothelial cells, fibroblasts, monocytes / macrophages. TSP suppresses proliferation and angiogenesis of vascular endothelial cells. Although its mechanism of action is unknown, it has binding properties to fibronectin, collagen and the like in addition to heparin, and therefore has a basic fibroblast growth factor (bFG).
In addition to modifying the action of growth factors such as F), it may also be due to altering cell adhesion. On the other hand, the tumor suppressor gene product p53 induces the expression of various genes,
One of the gene products was found to be TSP (Dameron KM, et al., Science (1994) 265: 1582-158).
Four).

[0008] TSP includes TSP1, TSP2 / CIS
Five families of P, TSP3, TSP4, TSP5 / COMP have been found. Among them, TSP typ
The 385-522 amino acid region containing e1 repeats is T
It has been confirmed that this is an SP1 domain-containing region (TSP / type 1) (Tolsma SS, et al., J. Cell Biol. (1)
993) 122: 497-511). Recently, the above TSP / type1
Searching for novel cDNAs using the region, it was reported that METH-1 and METH-2 having thrombospondin (TSP / type1 region), metalloprotease and desintegrin domains and having angiogenesis inhibitory action were found. (Vazquez F., etal., J. Biol. Chem.
(1999) 274: 23349-23357).

[0009] It is known that the CSVTCG motif of the TSP1 domain binds to the CD36 / LIMPII receptor and the like. CD36 is known as one of the receptors that take in oxidized LDL as well as the scavenger receptor that is considered to be the key to atherosclerosis, and is an important glycoprotein such as platelets and monocytes. It is thought that platelets function at the initial stage of adhesion to collagen, and it has been reported that malaria-infected erythrocytes also bind to CD36 when they adhere to vascular endothelial cells. (R. Crombie and R. Silverstein, J. Biol. Ch
em. (1998) 273: 4855-4863).

[0010] Furthermore, it is also known that the WSXW motif of the TSP1 domain binds to heparan sulfateproteoglycan on the cell surface, and is involved in wound healing, hemostasis, phagocytosis, biological defense, differentiation, cytoskeleton construction, and the like as physiological functions. Involvement in integrin function, which is thought to be involved, has also been suggested (JMSipes, et al., J. Biol. Che.
m. (1999) 274: 22755-22762).

Therefore, searching for a novel cDNA and a protein using the presence of the TSP / type 1 region as an index makes it easy to obtain a novel cDNA containing the TSP1 domain and thus a protein, and elucidates biological functions involving TSP. It is expected to be very useful in elucidating the process of neogenesis and in elucidating, preventing, treating and diagnosing diseases related to angiogenesis (such as angiogenesis disease or angiogenesis dysfunction).

[0012]

One of the problems to be solved by the present invention is to find a novel substance relating to a TSP1 domain-containing protein which can be a causative substance of various actions as described above, It is possible to control proteins. More specifically, an object of the present invention is to provide a novel TS having novel characteristics.
An object of the present invention is to provide a P1 domain-containing protein, and to provide a useful peptide or polypeptide derived from a novel TSP1 domain-containing protein. Another object of the present invention is to provide a polynucleotide encoding a peptide or polypeptide derived from a novel TSP1 domain-containing protein, and to provide a method for producing a novel TSP1 domain-containing protein by genetic engineering techniques. Still another object of the present invention is to provide a novel T
An object of the present invention is to provide an antibody against an SP1 domain-containing protein, peptide or polypeptide. Another object of the present invention is to screen for inhibitors, antagonists, and activators of the action of the novel TSP1 domain-containing protein using the above-mentioned compounds, and to provide a screened compound. Another object of the present invention is to provide a pharmaceutical composition and a diagnostic method using the same.

[0013]

Means for Solving the Problems As a result of intensive studies, the present inventors have succeeded in isolating a cDNA encoding a novel TSP1 domain-containing protein derived from human brain and analyzing the entire nucleotide sequence. . Then, when this base sequence was translated into an amino acid sequence, a thrombospondin domain (TSP1 domain: TSP / type1 re
peats) was repeatedly stored eight times, and the protein encoded by these cDNAs was TS
It was confirmed to be a novel protein containing the P1 domain. The present inventors have further studied based on these findings, and as a result, have completed the present invention.

That is, the present invention provides: A TSP1 domain-containing polypeptide selected from the following group or a protein having the polypeptide; a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or 3 in the sequence listing; a polypeptide containing the polypeptide; A polypeptide having at least about 70% amino acid sequence homology with the peptide and having at least eight repeats of the TSP1 domain; and a deletion, substitution, addition, or deletion of one to several amino acids in the amino acid sequence of 1. a polypeptide having a mutation such as an insertion and having eight or more repeats of the TSP1 domain; 2. A partial peptide having a part of the amino acid sequence shown in SEQ ID NO: 1 or 3 in the sequence listing, and having at least about 8 consecutive amino acid sequences; 3. a polynucleotide encoding the polypeptide or peptide according to the above 1 or 2, or a complementary strand thereof; 4. a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 or 4 or a complementary strand thereof; 5. a polynucleotide that hybridizes under stringent conditions to the polynucleotide according to the above 3 or 4 or a complementary strand thereof; 6. a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 or 4 in the sequence listing or a polynucleotide having at least about 15 consecutive nucleotide sequences of its complementary nucleotide sequence; 7. a recombinant vector containing any one of the polynucleotides according to 3 to 6 above; 8. a transformant transformed with the recombinant vector according to the above item 7, 10. The method according to item 1, which comprises a step of culturing the transformant according to item 8 above.
Or the method for producing a polypeptide, protein or peptide according to or 2, 10. an antibody that immunologically recognizes the polypeptide, protein or peptide according to the above 1 or 2; 11. the antibody according to the above item 10, which recognizes at least a TSP1 domain-containing polypeptide; A compound having an activity of inhibiting or promoting its activity by interacting with the polypeptide or protein of the preceding item 1, and / or inhibiting or promoting its expression by interacting with the polynucleotide of the above item 3 to 5 A method for screening a compound having an action, comprising the polypeptide, protein or peptide according to the above 1 or 2, the polynucleotide according to the above 3 to 6, the vector according to the above 7 or the transformation according to the above 8 12. A screening method, characterized by using at least one of the antibody described in the above item 10 or 11. 13. A compound that interacts with the polypeptide or protein according to item 1 to inhibit or activate the activity thereof;
Or a method for screening a compound that interacts with the polynucleotide according to the above 3 to 5 to inhibit or promote its expression, under conditions that allow the interaction between the compound and the polypeptide or protein; The interaction of the compound is evaluated by contacting the polypeptide or protein with the compound to be screened (a second component capable of providing a detectable signal in response to the interaction of the polypeptide or protein with the compound). The compound then interacts with the polypeptide or protein and activates its activity by detecting the presence or absence of a signal resulting from the interaction of the compound with the polypeptide or protein. Or determining whether to inhibit or inhibit. 14． A compound to be screened by the method according to the above item 12 or 13, wherein the TSP1 according to the above item 1 or 2 is used.
A compound or a salt thereof that interacts with a domain-containing protein or polypeptide to inhibit or promote its activity. 15. 14. A compound to be screened by the method according to the above 12 or 13, which interacts with the polynucleotide according to the above 3 to 5 to inhibit or promote its expression, or a salt thereof. 16. The polypeptide, protein or peptide according to the above 1 or 2, the polynucleotide according to the above 3 to 6, the vector according to the above item 7, the transformant according to the above item 8, the antibody according to the above item 10 or 11, Or a pharmaceutical composition comprising at least one of the compounds according to the above 14 or 15. 17． A method for diagnosing a disease associated with expression or activity of the polypeptide or protein according to item 1 in an individual,
A method comprising (a) analyzing a nucleic acid sequence encoding the polypeptide or protein, and / or (b) using the polypeptide or protein in a sample derived from an individual as a marker. It is about.

[0015]

BEST MODE FOR CARRYING OUT THE INVENTION (Novel TSP1 Domain-Containing Protein) The novel TSP1 domain-containing protein provided in the present invention is a protein derived from mRNA in human brain cells.
From the DNA library, an expression sequence tag (EST) analysis (Adams, MD, et al., Science (1991) 252: 1651-1656; A
dams, MD et al., Nature (1992) 355: 632-634; Adams, M.
D., et al., Nature (1995) 377 Supp: 3-174)
It was caught using the TSP1 domain as a marker.
A is the one obtained. The novel TSP1 domain-containing protein according to the present invention is used for human brain, lung,
In the stomach, testis, placenta, adrenal gland, pancreas, prostate, leukocytes,
That there is a "human RAPID-SCAN ^TM GENEEXPRESSION PANE
L "method. Its main function is its ability to suppress angiogenesis. As shown in Example 3, the novel TSP1 domain-containing protein of the present invention has about 40% homology with the known genomic sequence AC004877 (GenBank ID) in the amino acid sequence. In the present invention, TS
The P1 domain is a domain composed of about 60 amino acids having conserved tryptophan and cysteine indicated by an asterisk mark as shown in Table 7 of Example 4 (P. Bork, FEBS lett (1993) 327). : 125-130 ； JM.H
iggins, et al., J. Immunol. (1995) 155: 5777-5785). The novel TSP1 domain-containing protein of the present invention
There are at least eight SP1 domains (eight regions).

(Protein, Polypeptide or Peptide) The novel TSP1 domain-containing protein of the present invention comprises:
It is a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or 3 in the sequence listing. The TSP1 domain-containing protein of the present invention may be a protein derived from any human or mammalian cell, or any tissue in which those cells are present, or may be a synthetic protein.

The amino acids substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or 3 in the sequence listing include, for example,
About 50% or more, preferably about 70% or more, more preferably about 80% or more of the amino acid sequence represented by SEQ ID NO: 1 or 3
Above, more preferably about 90% or more, most preferably about 95% or more amino acid sequences having homology.

The protein having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or 3 of the present invention includes, for example, a protein substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or 3 Containing the amino acid sequence of
Further, a protein having substantially the same activity as a protein having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or 3 is exemplified.
As a substantially equivalent activity, any method may be used as long as it exhibits angiogenesis inhibition.
o The method is chorioallantoic m.
embrane) (Moses MA, et al., Pro
c. Natl. Acad. Sci. USA (1999) 96: 2645-2650), cut a small cut into the cornea of the rabbit or rat eye, insert the sample into it, and direct new blood vessels extending from nearby venules toward it. Corneal method for observing blood (Gaudric A., et al., Ophthalmic
Res. (1992) 24: 181-188) and the like.
Migration in a Boyden chamber using cultured vascular endothelial cells, observation of cell growth in a monolayer culture, and formation of a lumen using a three-dimensional collagen gel or matrigel (type IV collagen, laminin, nidogen / entactin, and heparan sulfate). (Haas reconstituted basement membrane gel)
TL, et al., J. Biol. Chem. (1998) 273: 3604-3610).

Techniques for determining the homology of amino acid sequences include:
Known per se, for example, a method for directly determining an amino acid sequence, a method for determining a nucleotide sequence of cDNA and then estimating an amino acid sequence encoded by the same are possible.

The protein containing the novel TSP1 domain-containing polypeptide of the present invention may be in the form of a "mature" protein or may be a part of a larger protein such as a fusion protein. Secretory or leader sequence,
It may include a prosequence, a sequence that facilitates purification such as multiple histidine residues, or additional sequences for stability during recombinant production.

The polypeptide or peptide of the present invention includes a polypeptide or peptide having a partial sequence of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or 3 in the Sequence Listing. Can be used as an immunogen. The minimum unit is an amino acid sequence composed of 8 or more amino acids, preferably 10 or more amino acids, more preferably 12 or more amino acids, still more preferably 15 or more consecutive amino acids, and Polypeptides or peptides that can be identified in the present invention are the subject of the present invention. These peptides may be used alone or as a carrier (eg, keyhole limped hemocyanin or ovalbumin) as an antigen for producing an antibody specific to a reagent or a standard substance or a novel TSP1 domain-containing protein as described below. Although they can be used as such, those bound with other kinds of proteins or substances are also included in the scope of the present invention.

[0022] The partial sequence is defined as "independently existing (fr
ee standing) "or contained within a larger polypeptide, wherein the subsequences may form part or a region. Most preferably, it is contained in a larger polypeptide as a single continuous region.

Further, based on the polypeptide or peptide specified in this way, the ability to inhibit angiogenesis is used as an index, whereby one or more, for example, 1 to 100, preferably 1 to 30, more preferably 1 to 30, There is also provided a polypeptide or peptide comprising an amino acid sequence having a mutation such as deletion, substitution, addition or insertion of 1 to 20, more preferably 1 to 10, and particularly preferably 1 to several amino acids. Means for deletion / substitution / addition or insertion are known per se, and include, for example, site-directed mutagenesis, homologous recombination, primer extension or polymerase chain amplification (PCR) alone or as appropriate in combination. , Molecular Cloning; A Laboratory Manual, 2nd
Edition, Sambrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, 1989; [Lab Manual Genetic Engineering], Masami Muramatsu, Ed., Maruzen Co., 1988; [PCR Technology, Principles and Applications of DNA Amplification], Ehrlich, HE.
Ed., Stockton Press, 1989, etc., or by modifying those methods. For example, the method of Ulmer (Science (1983) 21
9: 666).

For example, a series of residues containing the amino terminus is deleted, or a series of residues containing the carboxy terminus are deleted, or two kinds of residues containing one amino terminus and the other containing the carboxy terminus. The new T
Includes truncated polypeptides having the amino acid sequence of the SP1 domain containing protein. Also, subsequences characterized by structural or functional attributes, such as alpha helices and alpha helix forming regions, beta sheets and beta sheet forming regions, turns and turn forming regions, coils and coil forming regions, hydrophilic regions,
Partial sequences including a hydrophobic region, an alpha-amphiphilic region, a beta amphipathic region, a variable region, a surface-forming region, a substrate-binding region, and a high antigenic index region are also preferable. Also,
Biologically active regions are also preferred, such as subsequences with similar or improved activity, or with reduced undesirable activity. Also included are subsequences that are antigenic or immunogenic in animals, especially humans.

The amino acid sequences of the proteins, polypeptides and partial sequence peptides of the present invention include those changed by conservative amino acid substitution. Such typical substitutions include between Ala, Val, Leu and Ile; between Ser and Thr; between Asp and Glu; between Asn and Gln;
And between the basic residues Lys and Arg; or between the aromatic residues Phe, Trp and Tyr. Particularly preferred are those in which several, 5 to 10, 1 to 5, or 1 to 2 amino acids are substituted, deleted or added in any combination.

From the viewpoint of not changing the basic properties (physical properties, activity, immunological activity, etc.) of the protein in the introduction of the above mutation, for example, homologous amino acids (polar amino acids, nonpolar amino acids) , Hydrophobic amino acids, hydrophilic amino acids, positively charged amino acids, negatively charged amino acids, aromatic amino acids, etc.) are easily assumed.

The novel TSP1 domain-containing protein of the present invention means any peptide containing two or more amino acids linked to each other by a peptide bond or a modified peptide bond. In the present specification, a short chain, also called a peptide, an oligopeptide or an oligomer, may be called a polypeptide, and a long chain may be called a protein.

[0028] The novel TSP1 domain-containing protein of the present invention can also contain amino acids different from the amino acids encoded by the 20 genes. "Proteins" include those modified by natural processing, such as processing and other post-translational modifications, but also by chemical modification techniques well known to those skilled in the art. Such modifications are well described in basic reference books and more detailed articles and in numerous research literatures, which are well known to those skilled in the art.

Modifications can be made at any site in the polypeptide, such as the peptide backbone, amino acid side chains, and amino or carboxyl termini. The same type of modification may be present at the same or varying degrees at several sites in the polypeptide. Proteins can also contain many types of modifications. The protein may be branched as a result of ubiquitination, or it may be cyclic, with or without branching. Cyclic, branched and branched and cyclic proteins may result from natural post-translational processing or may be produced by synthetic methods.

The modification includes acetylation, acylation, ADP
-Ribosylation, amidation, flavin covalent bond, heme moiety covalent bond, nucleotide or nucleotide derivative covalent bond, lipid or lipid derivative covalent bond, phosphotidylinositol covalent bond, cross-crosslinking, cyclization, disulfide bond Formation, demethylation, cross-link covalent bond formation, cystine formation, pyroglutamate formation, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, protein hydrolysis Degradation processing, phosphorylation, prenylation, racemization, glycosylation, lipid binding, sulphation,
Gamma-carboxylation of glutamate residues, hydroxylation and ADP-ribosylation, selenoylation, sulphation, addition of amino acids to transfer RNA-mediated proteins such as arginylation, and ubiquitination.

For example, Proteins-Structure and Molecul
ar Properties, 2nd edition, TECreighton, WHFreeman
and Company, New York, 1993 and Post-translat
ional Covalent Modification of Proteins, BC Johns
on, Academic Press, New York, 1983 Wo
ld, F., Posttranslational Protein Modifications: Per
spective and Prospects, pp. 1-12; Seifter et al., M
eth.Enzymol. (1990) 182: 626-646 and Rattan et al., Pr.
otein Synthesis: Post-translational Modifications a
nd Aging, Ann. NY Acad. Sci. (1992) 663: 48-62.

Further, in order to facilitate detection or purification of the polypeptide or the like of the present invention, or to add another function, another protein such as alkaline phosphatase or β-terminal is added to the N-terminal or C-terminal side. Galactosidase, I
immunoglobulin Fc fragment such as gG or FLAG-tag
It is easy for those skilled in the art to add a peptide such as directly or indirectly via a linker peptide or the like using a genetic engineering technique or the like. Included in the scope. In addition, homologous gene products of animal species other than human are naturally included in the scope of the present invention.

(Recovery of Novel TSP1 Domain-Containing Protein and Its Derived Product) Recovery of peptides and polypeptides comprising the novel TSP1 domain-containing protein and its derived product from human or other mammalian cells or tissues, and culture media is performed by vascular treatment. Using the ability to inhibit the formation of newborn as an index, molecular sieving, ion column chromatography, affinity chromatography, etc., or ammonium sulfate based on solubility difference,
Purification and recovery can also be performed by fractionation means such as alcohol. Thus, widely known methods for purifying proteins, such as ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and Lectin chromatography and the like can be used in appropriate combination. Also, when the protein is denatured during isolation and / or purification,
To regain the active conformation, well-known techniques for protein regeneration can be used.

For purification, preferably, a method is used in which an antibody against the amino acid sequence is prepared based on the information on the amino acid sequence, and the antibody is specifically adsorbed and recovered using a polyclonal antibody or a monoclonal antibody. Conveniently, affinity chromatography using heparin can be used.

(Polynucleotide) In one embodiment, the polynucleotide of the present invention and the complementary strand thereof may be a polynucleotide encoding a polypeptide such as the polypeptide of the present invention, for example, a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 in the Sequence Listing. It means a nucleotide and a complementary strand to the polynucleotide. These provide, for example, genetic information useful for producing the above-mentioned novel TSP1 domain-containing protein, or can be used as reagents and standard products for nucleic acids. A preferable nucleotide sequence of the polynucleotide is shown in SEQ ID NO: 2 in the sequence listing. In addition, the existence of the polymorphism of the base sequence by the human individual was recognized. One example is the base sequence of SEQ ID NO: 4 which encodes a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3 in the sequence listing.

In another aspect, the present invention provides a polynucleotide encoding a polypeptide comprising the amino acid sequence of the polypeptide or peptide of the present invention, for example, the amino acid sequence of SEQ ID NO: 1 or 3 in the sequence listing, preferably the sequence of the sequence listing. Provided is a polynucleotide comprising the nucleotide sequence of No. 2 or 4, or a polynucleotide which hybridizes under stringent conditions to a corresponding region of a complementary strand thereof.
Hybridization conditions include, for example, Molecular
Cloning; A Laboratory Manual, 2nd edition, edited by Sambrook et al., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York, 1989 etc. can be followed. Stringent hybridization conditions are generally known, and include, for example, 50% formamide, 5 × S
SC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.
6) 5x Denhardt's solution, 10% dextran sulfate,
And 20 microgram / ml denatured sheared salmon sperm D
Conditions may include washing in a solution containing NA at 42 ° C. overnight, then at about 65 ° C. in 0.1 × SSC.

These polynucleotides need not necessarily be complementary sequences as long as they hybridize to the target polynucleotide, particularly a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 or 4 in the sequence listing or a complementary strand thereof. For example, in homology to the nucleotide sequence of SEQ ID NO: 2 or 4 in the sequence listing or its complementary sequence, at least about 40%, for example, about 70% or more, preferably about 80%
% Or more, more preferably about 90% or more, and still more preferably about 95% or more. Further, the polynucleotide of the present invention comprises 10 continuous nucleotides corresponding to the designated nucleotide sequence region.
A polynucleotide consisting of at least 20 nucleotides, preferably at least 15 and more preferably at least 20 sequences,
Oligonucleotides and their complementary strands.

The polynucleotide of the present invention is used as a probe or primer for detecting a nucleic acid encoding a novel TSP1 domain-containing protein, for example, its gene or mRNA in the production of the polypeptide or the like of the present invention. Or an antisense oligonucleotide for regulating gene expression. In that sense, the polynucleotides and oligonucleotides of the present invention include those corresponding to untranslated regions as well as translated regions. For example, in order to specifically inhibit the expression of a novel TSP1 domain-containing protein by antisense, it is assumed that a nucleotide sequence of a region unique to the novel TSP1 domain-containing protein is used. On the other hand, it is considered that the expression of a plurality of TSP1 domain-containing proteins including the novel TSP1 domain-containing protein can be simultaneously suppressed by using the conserved sequence. Here, the nucleotide sequence of a polynucleotide encoding a novel TSP1 domain-containing protein or a polypeptide having a similar activity is determined by, for example, confirming the expressed protein using a known protein expression system, and determining its physiological activity, particularly its vascularity. The selection can be performed by using the ability to inhibit newborn growth as an index. When a cell-free protein expression system is used, for example, ribosome-based techniques derived from embryos, rabbit reticulocytes and the like can be used (Nature (1957) 179: 16).
0-161).

[0039] The polynucleotide of the present invention may generally be unmodified RNA or DNA, or modified RNA or DNA. "RNA
Or DNA "for stability or other reasons
Includes DNA or RNA having a modified backbone, as well as DNA or RNA having a modified backbone.
"Modified" bases include, for example, tritylated bases and unusual bases such as inosine. Various modifications have been made to DNA and RNA, and the chemical,
Includes enzymatically or metabolically modified forms, as well as chemical forms of DNA and RNA characteristic of viruses and cells. "RNA or DNA" also includes short polynucleotides, often referred to as "oligonucleotides".

The polynucleotide of the present invention comprises a subject RN.
A, which may change an amino acid sequence having a nucleotide sequence encoded by DNA, wherein amino acid substitution in a polypeptide encoded by the subject sequence;
Additions, deletions, fusions and truncations may occur, but the invention also encompasses these. These changes are those in which one or more substitutions, additions, and deletions can occur in any combination, resulting in a change in the amino acid sequence.
These changes can be made by mutagenesis techniques, direct synthesis, and other recombinant techniques known to those skilled in the art.

The identity between the nucleotide sequence of the polynucleotide of the present invention and the amino acid sequence of the polypeptide is determined by the RN of the present invention.
A, a measure of the identity of DNA or the protein of the invention. Generally, the sequences are juxtaposed for best match. Identity has its own art-recognized meaning and can be calculated using published methods.

For example, Computational Molecular Biolog
y, Lesk, AM, Oxford University Press, New York, 1988; Biocomputing: Info
rmatics and Genome Projects, Smith, DW ed., Academic Press, New York, 1993; Computer Ana
lysis of Sequence Data, Part I, Griffin, AM and
Griffin, HG, Human Press, New Jersey, 1994; Sequence Analysis in Molecular Biology,
von Heinje, G., Academic Press, 1987;
Sequence Analysis Primer, Gribskov, M. and Devereux,
J. Ed., M Stockton Press, New York, 19
91). Although there are many ways to determine the identity of two sequences, the term “identity” is well known to those skilled in the art (Sequ
ence Analysis in Molecular Biology, von Heinje,
G., Academic Press, 1987; Sequence Analysi
s Primer, Gribskov, M. and Devereux, J. eds., M Stockton Press, New York, 1991; and Carill
o, H. and Lipman, D., SIAMJ.Applied Math. (1988) 48:10
73).

Methods commonly used to determine identity or similarity between sequences are described in Carillo, H. and Lipman, D., SIA.
M J. Applied Math. (1998) 48: 1073, but is not limited thereto. Methods for determining identity and similarity are codified in publicly available computer programs. A preferred computer program method for determining the identity and similarity between two sequences includes the GCG program package (Devereux, J., et al.).
l., Nucleic Acids Research (1984) 12 (1): 387), BLAST
P, BLASTN, and FASTA (Atschul, SF et al., J. Molec.
Biol. (1990) 215: 403), but are not limited thereto.

(Transformant) The present invention relates to Escherichia coli, yeast,
The DNA of the present invention can also be obtained by a gene recombination technique using a host known per se such as Bacillus subtilis, insect cells, and animal cells.
The novel TSP1 domain-containing protein of the present invention and peptides and polypeptides derived from the same can be provided by a cell-free protein synthesis method using a derived RNA. In the specific example of the present invention, insect cells were used, but it is needless to say that the present invention is not limited thereto.
Production of recombinant baculovirus expression vector and synthesis of polypeptide).

Transformation is carried out by a means known per se,
For example, a host is transformed using a plasmid, chromosome, virus, or the like as a replicon. A more preferable system is an integration method into a chromosome in consideration of the stability of the gene, but a simpler method is the use of an autonomous replication system using an extranuclear gene. The vector is selected according to the type of the selected host, and comprises a gene sequence to be expressed and a gene sequence carrying information on replication and control as components. Combinations are sorted by prokaryotic or eukaryotic cells and include promoters, ribosome binding sites, terminators, signal sequences, enhancers, marker sequences, transcribed sequences, untranslated sequences, splicing and polyadenylation signals, and mRNA stabilizing sequences. The coding 5 'and 3' sequences can be used in combination by a method known per se. The marker sequence is pQ
Hexa as provided in the E vector (QIAGEN)
Histidine peptide (Gentz et al., Proc. Natl. Acad. S
ci., USA (1989) 86: 821-824) or HA tag (Wilson et al., Cell (1984) 37: 767).

The introduction of DNA into a host cell is performed, for example, by using Da
vis et al., Basic Methods in Molecular Biology, 1986
Year; Molecular Cloning; A Laboratory Manual, 2nd
Edition, Sambrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, 1989, can be performed by methods described in many standard laboratory manuals, such as calcium phosphate transfection, DEAE
-Dextran mediated transfection, transfection, microinjection, cationic lipid mediated transfection, electroporation, transduction, scrape loading, ballistic introduction and infection and the like.

Representative of suitable hosts include bacterial cells, such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtili.
s) cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells, such as Drosophila S2 and Spodoptera Sf9 (S
podoptera Sf9) cells; animal cells such as CHO, CO
S, HeLa, C127, 3T3, BHK, 293 and Bows melanoma cells; and plant cells.

The vectors include those derived from chromosomes, episomes and viruses, such as bacterial plasmids, bacteriophages, transposons, yeast episomes, insertion elements, yeast chromosomal elements such as baculoviruses, papovaviruses such as SV40, etc. Vaccinia virus, adenovirus,
There are vectors derived from viruses such as fowlpox virus, pseudorabies virus and retrovirus, and vectors combining them, such as vectors derived from genetic elements of plasmids and bacteriophages, such as cosmids and phagemids.

The expression system constructs can contain regulatory regions that control and cause expression. Usually, in order to maintain, extend or express DNA in a host, it is necessary to select any system or vector suitable for expressing the protein. These can insert an appropriate DNA sequence into an expression system by well-known techniques.
lecular Cloning; A Laboratory Manual, 2nd edition, Sambr
ook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. In addition, a translation protein can be incorporated into a protein that expresses an appropriate secretion signal in order to secrete the translated protein into the endoplasmic reticulum lumen, periplasmic space, or extracellular environment. These signals may be intrinsic to the protein or may be heterologous signals.

The transformant is cultured under conditions suitable for the culture conditions of each host known per se. The culture may be carried out using the biological activity of peptides and polypeptides comprising the novel TSP1 domain-containing protein expressed and produced and its derived product as a marker, but may be subcultured using the amount of transformants in the medium as an index. It may be produced by batch culture.

When expressing a novel TSP1 domain-containing protein for screening assays, it is generally preferred to produce the protein on the cell surface. In this case, the cells may be collected before use in the screening assay. When a novel TSP1 domain-containing protein is secreted into the medium, the medium can be recovered, and the protein can be recovered and purified. Furthermore, when it is produced intracellularly, the target protein can be obtained by first lysing the cell and then collecting the protein.

The novel TSP1 domain-containing proteins can be recovered and purified from recombinant cell culture by well-known protein purification methods, including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography. , Phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is used for purification. If the protein is denatured during isolation and / or purification, well-known techniques for protein regeneration can be used to regain the active conformation.

(Antibody) An antibody is prepared by selecting an antigenic determinant of a peptide or polypeptide comprising the novel TSP1 domain-containing protein of the present invention and its derivative. The antigen may be a novel TSP1 domain-containing protein or a fragment thereof, wherein at least 8, preferably at least 10
, More preferably at least 12, more preferably at least 15 amino acids. In order to prepare an antibody immunospecific for the novel TSP1 domain-containing protein, it is preferable to use a region consisting of a sequence unique to the novel TSP1 domain-containing protein. This amino acid sequence does not necessarily need to be homologous to SEQ ID NO: 1 or 3 in the sequence listing, and is preferably an exposed site on the three-dimensional structure of the protein. A continuous amino acid sequence is also effective. The antibody is not particularly limited as long as it immunologically binds or recognizes a peptide or polypeptide consisting of a novel TSP1 domain-containing protein and its derivative. The presence or absence of this binding or recognition is determined by a known antigen-antibody binding reaction. "Immunospecific" means that the affinity for the protein of the invention is substantially greater than the affinity for other related proteins of the prior art.

In order to produce antibodies, the novel T
SP1 domain-containing protein, a peptide or polypeptide consisting of a derivative thereof, alone or in combination with a carrier in the presence or absence of an adjuvant, to induce immunity such as a humoral response and / or a cellular response to an animal. Is performed. The carrier is not particularly limited as long as it does not cause harmful effects on the host, and examples thereof include cellulose, polymerized amino acids, and albumin. As the animal to be immunized, a mouse, a rat, a rabbit, a goat, a horse and the like are suitably used. The polyclonal antibody is obtained by a known antibody recovery method from serum. A preferred means is an immunoaffinity chromatography method.

In order to produce a monoclonal antibody,
Antibody-producing cells (for example, spleen or lymph node-derived) are recovered from the animal to which the above-mentioned immunization has been applied, and a means for transforming a perpetually proliferating cell (for example, myeloma strain such as P3X63Ag8 strain) known per se is introduced. It is done by doing. For example, a hybridoma is cloned, an antibody that specifically recognizes the TSP1 domain-containing protein of the present invention is selected, and the antibody is recovered from a culture of the hybridoma. As an example, the hybridoma method (Kohler, G. an
d Milstein, C., Nature (1975) 256: 495-497); Trioma method (Kozbor et al., Immunology Today (1983) 4: 7).
2); and the EBV-hybridoma method (Cole et al., Mon.
oclonal Antibodies and Cancer Therapy, Alan R Lis
s, Inc., (1985): 77-96).

The techniques described for the production of single-chain antibodies (US Pat. No. 4,946,778) are applicable for producing single-chain antibodies against the proteins of the present invention. In addition, a humanized antibody may be expressed by a method for inducing an immunological reaction in a mammal using a transgenic mouse or other organisms including other mammals. Using the above antibodies, clones expressing the protein may be isolated or identified, or the protein may be purified by affinity chromatography.

Using the novel antibody against the TSP1 domain-containing protein of the present invention, collateral circulation in ischemic heart disease and obstructive arteriosclerosis of the lower limb as angiogenesis insufficiency in which angiogenesis is insufficient. It may be used to treat dysplasia, intractable skin ulcer due to insufficient angiogenesis during wound healing, intractable gastric ulcer, incomplete healing after surgery, and the like.

(Identification and Screening) Based on the information on the thus prepared novel TSP1 domain-containing protein and the peptide or polypeptide comprising the derivative thereof, the polynucleotide encoding them and their complementary chains, their amino acid sequences and base sequences. Transformed cells, protein synthesis systems using them, and novel T
An antibody that immunologically recognizes a peptide or polypeptide consisting of the SP1 domain-containing protein and its derivative can be used as a novel T-protein by alone or in combination of a plurality of means.
An effective means for identification and screening of an activity inhibitor or an activity activator for a peptide and a polypeptide comprising an SP1 domain-containing protein and its derived product is provided. For example, selection of antagonists by drug design based on the three-dimensional structure of the peptide or polypeptide, selection of expression regulators at the gene level using a protein synthesis system,
Selection of an antibody recognizing substance using an antibody can be performed using a drug screening system known per se.

The peptide or polypeptide comprising the novel TSP1 domain-containing protein of the present invention and its derived product is selected by selecting conditions enabling interaction between the screening candidate compound and these peptides or polypeptides. By introducing a system using a signal and / or a marker capable of detecting the presence or absence of this interaction and detecting the presence / absence of this signal and / or marker, the novel TSP1 domain-containing protein of the present invention Compounds that activate or inhibit the activity of peptides and polypeptides derived from the derivatives can be screened.

The proteins of the invention may be used to evaluate the binding of small molecule substrates and ligands, for example, in cells, cell-free preparations, chemical libraries and natural product mixtures. These substrates and ligands may be natural substrates and ligands, or may mimic structure or function (Coligan et al., CurrentP.
rotocols in Immunology (1991) 1 (2): Chapter 5).

The novel TSP1 domain-containing proteins are widely present in mammalian hosts, are involved in many biological functions, and are involved in many diseases. Therefore, the novel TSP1 domain-containing protein of the present invention is also useful for screening for finding a compound having an activity of inhibiting or promoting its activity.

[0062] Using the cDNA and protein of the novel TSP1 domain-containing protein and an antibody against the protein, an assay for examining the effect of the added compound on the production of mRNA and protein of the novel TSP1 domain-containing protein in cells can be performed. Good. For example,
Enzyme-linked immunosorbent assay (ELISA: Enzyme Linked Immunoassay) for measuring the secretion or cell binding level of novel TSP1 domain-containing protein using monoclonal and polyclonal antibodies by general methods known in the art.
Sorvent Assay), and it can be used to find factors capable of inhibiting or promoting the production of a novel TSP1 domain-containing protein from appropriately treated cells or tissues. General methods for performing screening assays are well-known in the art.

(Compounds, Diagnostic Agents, Pharmaceutical Compositions) The compounds screened in this manner can be used as activity inhibitors, antagonists, It can be used as a candidate compound for an activator. It can also be used as a candidate compound for an expression inhibitor, an expression antagonist, or an expression activator for a system of a novel TSP1 domain-containing protein and its derivative at the gene level.
The effect can be expected to prevent and treat various symptoms derived from the TSP1 domain-containing protein.

The candidate compound thus selected can be prepared as a pharmaceutical composition by selecting in consideration of the balance between biological utility and toxicity. Further, a novel TSP1 domain-containing protein and a peptide or polypeptide comprising the same, a polynucleotide encoding the same or a complementary chain thereof, a vector containing the nucleotide sequence thereof, a novel TSP1 domain-containing protein and a derivative thereof An antibody that immunologically recognizes a peptide or polypeptide consisting of a diagnostic marker, a reagent or other disease diagnostic means, or a function of inhibiting, antagonizing, or activating a novel TSP1 domain-containing protein can be used by itself. There is a possibility that it can be used as a pharmaceutical means such as a therapeutic agent. In the formulation, known peptides or polypeptides, proteins, polynucleotides,
What is necessary is just to introduce the formulation means according to each object, such as an antibody.

As a diagnostic means, the novel TSP1 of the present invention is used.
It is useful as a means for diagnosing a disease in relation to the expression or activity of a peptide or polypeptide consisting of a domain-containing protein and a derivative thereof. Determining the abundance of the corresponding nucleic acid sequence and / or determining the biodistribution of the peptide in an individual, and / or determining the presence of the peptide in an individual-derived sample This is done by: For more information,
The novel TSP1 domain-containing protein is assayed as a diagnostic marker. The measurement method may use a known antigen-antibody reaction system, enzyme reaction system, PCR reaction system, or the like.

The nucleic acid for diagnosis may be obtained from cells of an infected individual, such as blood, urine, saliva, tissue biopsy or autopsy material. Genomic DNA may be used directly for detection, or may be amplified enzymatically by using PCR or other amplification methods prior to analysis. RNA or cDNA may be used as well. In comparison with the normal genotype,
Deletions and insertions can be detected by changes in the size of the amplification product. Point mutations can be identified by hybridizing the amplified DNA to DNA encoding a novel labeled TSP1 domain-containing protein. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence differences can also be detected by detecting changes in electrophoretic mobility of the DNA fragments in gels, with or without denaturants, or by direct DNA sequencing (eg, Meyers et al.).
al., Science (1985) 230: 1242). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S1 protection or chemical cleavage methods (eg, Cotton et al., Pro.
c. Natl. Acad. Sci., USA (1985) 85: 4397-4401). In addition, by constructing an array of oligonucleotide probes containing DNA encoding a novel TSP1 domain-containing protein or a fragment thereof, for example, effective screening for genetic mutation can be performed. Array methods are well known, have a wide range of applications, and can be used to investigate various problems in molecular genetics, including gene expression, genetic linkage, and genetic variability (eg, , M. Chee et al., Science (1
996) 274: 610).

The diagnostic assay detects a mutation in a DNA encoding a novel TSP1 domain-containing protein by the method described in the present specification, and detects a solid malignant neoplasm as a disease caused by angiogenesis (so-called angiogenic disease). , Ophthalmic diseases (proliferative diabetic retinopathy, retinopathy of prematurity, iris rubeosis, sickle cell retinopathy, central retinal vein occlusion, branch retinal vein occlusion, central retinal artery occlusion,
Senile discoid macular degeneration, other ophthalmic diseases causing ischemia), rheumatoid arthritis, hemangiomas, angiofibroma, psoriasis vulgaris, abnormal capillary network of atherosclerotic lesion outer membrane, and vice versa Insufficient angiogenesis due to ischemic heart disease, collateral dysplasia in lower limb obstructive arteriosclerosis, and inadequate angiogenesis during wound healing It is intended to provide a method for diagnosing skin ulcer, intractable gastric ulcer, incomplete fusion after surgery, or a method for diagnosing susceptibility to such diseases.

Furthermore, a method characterized by examining the abnormally elevated or decreased novel TSP1 domain-containing protein or the mRNA level of the novel TSP1 domain-containing protein in a sample derived from a subject, particularly causes angiogenesis. Solid malignant neoplasms as diseases (so-called neovascular diseases), ophthalmic diseases (proliferative diabetic retinopathy, retinopathy of prematurity, iris rubeosis, sickle cell retinopathy, central retinal vein occlusion, branch retinal vein occlusion) , Central retinal artery occlusion, senile discoid macular degeneration, and other ophthalmic diseases that cause ischemia), rheumatoid arthritis, hemangiomas, hemangiofibromas, psoriasis vulgaris, abnormal capillaries of atherosclerotic lesions Vascular network, etc.
Conversely, insufficiency of angiogenesis such as ischemic heart disease, collateral dysgenesis in obstructive arteriosclerosis of the lower limbs, and insufficient angiogenesis in the wound healing process It can diagnose intractable skin ulcer, intractable gastric ulcer, incomplete union after surgery, and the like.

Increasing or decreasing the expression of the DNA encoding the novel TSP1 domain-containing protein can be determined by any method known in the art for quantifying polynucleotides, including amplification, PCR, RTPCR, RNase protection, Northern It can be measured at the RNA level using blotting and other hybridization methods. Assay techniques that can be used to determine levels of a novel TSP1 domain-containing protein, in a sample derived from a host are well-known to those of skill in the art. Such assays include radioimmunoassays, competitive binding assays, western blot analysis, and ELISA assays.

The polynucleotides of the present invention are also valuable for chromosome identification (chromosome assays). The sequences can target and hybridize to specific locations on individual human chromosomes. Mapping important sequences to chromosomes according to the present invention is an important first step in linking those sequences to gene-related diseases. Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data is available, for example, from V. McKusick, Mendelian I
nheritance in Man (Johns Hopkins University Welch
(Available online at the Medical Library). The association (co-inheritance of physically close genes) is then analyzed to identify the relationship between the gene mapped to the same chromosomal region and the disease. Differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. If the mutation is observed in some or all of the affected individuals but not in normal individuals, then the mutation may be responsible for the disease.

The present invention relates to a method for treating a mammal by inoculating a mammal with a novel TSP1 domain-containing protein or a fragment thereof sufficient to produce antibodies and / or T cells, and inducing an immunological response in the mammal. In particular, ischemic heart disease as angiogenesis deficiency with insufficient angiogenesis, collateral dysgenesis in lower limb obstructive arteriosclerosis, and intractable angiogenesis during wound healing process It can also be used to protect the animal from irritable skin ulcers, intractable gastric ulcers, postoperative union, and the like.

The present invention further provides a novel TSP of the present invention.
It can also be used to deliver a nucleic acid vector for expressing a one-domain containing protein in vivo to induce such an immunological response and raise antibodies that protect the animal from disease.

Further, the present invention also relates to an immunological vaccine formulation (composition) which, when introduced into a mammalian host, induces a mammalian immunological response to the novel TSP1 domain-containing protein. Can be. The composition comprises a novel TSP1 domain-containing protein or a gene encoding a novel TSP1 domain-containing protein. The vaccine formulation may further include a suitable carrier. Since the novel TSP1 domain-containing protein may be degraded in the stomach, it is preferably administered parenterally (including subcutaneous, intramuscular, intravenous, intradermal etc. injection). Formulations suitable for parenteral administration include sterile injectable aqueous or non-aqueous solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the recipient; Or sterile aqueous or non-aqueous suspensions which may also contain a thickening agent. Formulations may be presented in single or multiple doses in containers, for example, provided in sealed ampules and vials, and may require only the addition of a sterile liquid carrier immediately before use. It may be stored in a dry state. Vaccine formulations may also include adjuvant systems to increase the immunogenicity of the formulation, such as oil-in-water and other systems known in the art. The dose will depend on the activity of the particular vaccine and can be readily determined by routine experimentation.

The present invention is intended to elucidate the biological functions involved in TSP, particularly to elucidate the angiogenesis process and elucidate, prevent, treat and diagnose angiogenesis-related diseases (angiogenesis disease or angiogenesis dysfunction). It is expected to be very useful in making it possible. In addition, the present invention relates to a disease associated with an excessive or insufficient amount of angiogenesis inhibitory activity of TSP, that is, a solid malignant neoplasm, an ophthalmic disease (proliferation) as a disease caused by angiogenesis (so-called angiogenesis disease). Diabetic retinopathy, retinopathy of prematurity, iris rubeosis, sickle cell retinopathy, central retinal vein occlusion, branch retinal vein occlusion, central retinal artery occlusion, senile discoid macular degeneration,
Other ophthalmological diseases causing ischemia), rheumatoid arthritis, hemangiomas, hemangiofibromas, psoriasis vulgaris, abnormal capillary networks in the outer membrane of atherosclerotic lesions, and blood vessels with insufficient angiogenesis Insufficiency of ischemic heart disease, collateral dysplasia in obstructive arteriosclerosis of the lower limbs, intractable skin ulcer due to insufficient angiogenesis during wound healing, intractable gastric ulcer, after surgery The present invention provides a method for treating unhealthy dysfunction.

When the novel TSP1 domain-containing protein and its activity are in excess, an effective amount of the inhibitor compound is administered to a subject together with a pharmaceutically acceptable carrier to inhibit the activity of the novel TSP1 domain-containing protein; This can also improve abnormal symptoms.

Furthermore, the expression of the gene encoding the novel endogenous TSP1 domain-containing protein may be inhibited by using the expression blocking method. Produced in the cell,
Alternatively, separately administered antisense sequences are used in such known methods (eg, Oligodeoxynucleoti
des as Antisense Inhibitors of Gene Expression, CR
O'Coccor, J. Neuroch in C Press, Boca Raton, FL (1988)
em (1991) 56: 560). Alternatively, oligonucleotides that form a triple helix with the gene may be used (eg, Lee et al., Nucleic Acids Res (1979) 6: 307).
3; Cooney et al., Science (1988) 241: 456; Dervan et.
al., Science (1991) 251: 1360). These oligonucleotides can be administered per se or the relevant oligomers can be expressed in vivo.

For treating abnormal conditions associated with the novel TSP1 domain-containing protein and the under-expression of its activity, a therapeutically effective amount of a compound (promoter) that activates the novel TSP1 domain-containing protein is pharmaceutically acceptable. Administered together with a carrier, thereby improving abnormal symptoms. Alternatively, gene therapy may be used to effect the production of novel TSP1 domain-containing proteins in cells by cells in the subject. For example, the polynucleotide of the present invention may be processed and processed into a replication-defective retroviral vector for expression as described above. The retroviral expression construct is then isolated and RN encoding the protein of the invention.
A may be introduced into a packaging cell transduced with a retroviral plasmid vector containing A so that the packaging cell in turn produces infectious virus particles containing the gene of interest. These producer cells may be administered to a subject for processing of the cells in vivo and expression of the protein in vivo. For an overview of gene therapy, see Human Molecular Genetics, T. Strac.
han and APRead, BIOS Scientific Publishers Ltd (19
86), Chapter 20, Gene Therapy and other Molecular
See Genetic-based Therapeutic Approaches (and references therein). Another method is to administer a therapeutic amount of a novel TSP1 domain-containing protein in admixture with a suitable pharmaceutical carrier.

The formulation and administration of the novel TSP1 domain-containing protein or compound of the present invention are preferably combined with a suitable pharmaceutical carrier. Such formulations comprise a therapeutically effective amount of the protein or compound, and a pharmaceutically acceptable carrier or excipient. Such carriers include saline, buffered saline, dextrose,
Water, glycerol, ethanol, and mixtures thereof. The formulation should suit the route of administration and is well known to those skilled in the art.
The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the above-mentioned components of the invention.

The proteins and compounds of the present invention may be used alone or in combination with other compounds required for therapy. A preferred form of systemic administration of the pharmaceutical composition is injection, especially intravenous. Other injection routes, such as subcutaneous, intramuscular or intraperitoneal, can also be used. Another means for systemic administration is transmucosal or transdermal administration using penetrants such as bile salts or fusidic acid or other surfactants. In addition, oral administration is possible, provided that an enteric or capsule formulation is successfully formulated. Administration of these proteins or compounds may be topical or in the form of salves, pastas, gels and the like.

The required dosage range depends on the peptide, route of administration,
It depends on the nature of the prescription, the nature of the subject's symptoms, and the judgment of the attending physician. However, suitable doses range from 0.1 to 100 μg / kg body weight of the subject. However, the required dosage is still broader, given the different proteins and compounds used and the different efficiencies of different routes of administration. For example, oral administration requires higher doses than intravenous injection. Variations in these dosages can be made using routine experimentation for optimization well known in the art.

In gene therapy, the protein to be used for therapy can be produced in a subject. For example, cells derived from a subject can be processed and processed ex vivo using DNA or RNA encoding a protein, for example, by using a retroviral plasmid vector, and then the cells can be introduced into the subject.

[0082]

EXAMPLES Hereinafter, the present invention will be specifically described based on examples, but the present invention is not limited to the following examples.

Example 1 (Construction of cDNA library derived from human brain and isolation of gene) A cDNA library was obtained by a conventional method using a commercially available human fetal brain-derived polyA + RNA (Clontech: Catalog No. 6525-1) as a starting material. And construct d
The cDNA fragment was isolated by bEST (database of Expressed Sequence Tags) analysis, the nucleotide sequence was determined, and a DNA carrying the nucleotide sequence encoding the novel TSP1 domain-containing protein of the present invention was obtained.

Specifically, the method of Ohara et al. (DNA Research
(1997) 4:53), about 50,000 recombinants were randomly selected from a human brain-derived cDNA library, and c
The nucleotide sequences of the 5 'end and 3' end of the DNA were determined. About 1,100 were selected mainly by in vitro transcription / translation experiments, and their cDNA sequences were determined according to the method of Ohara et al. (Id.). For the cDNA clones for which the entire nucleotide sequence was determined, the protein coding region (O
RF) and Pfam HMM Search for this area
A domain search was performed using (HMMPFAM) to identify a cDNA having a TSP1 domain (TSP1).

In this way, the present inventor has made eight TSPs.
No. TSP1 consisting of the deduced amino acid sequence represented by SEQ ID NO: 1 (961 total amino acids) in the sequence listing carrying No. 1
CDNA encoding domain-containing protein (FG0
6969) (SEQ ID NO: 2 in Sequence Listing). The sequence is UPAC-IUB Commision on Biochemical Nomenclature
, Or an abbreviation commonly used in the art, and when an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified.

[0085]

Example 2 (Determining the nucleotide sequence of each clone) FG06969 and the clone No. 5 which was considered to be derived from the same gene based on the sequence at the 5 ′ end. FG06883, FG06492, FG
02529, FG01896 and the like were performed by the following operations.

As primers, oligonucleotide primers having the nucleotide sequences shown in Table 2 were prepared based on the sequence information of FG06969 and the plasmid pBlueScriptII SK (+).

[0087]

[Table 2]

The cDNA of each clone was converted into a cloning vector pBlueScriptII SK (+)
(Stratagene) and used to transform competent cells E. coli DH5α (Toyobo).
The resulting transformant was cultured overnight in a Terrific Broth medium containing ampicillin (Nacalai Tesque, Inc.) at a final concentration of 50 μg / ml, and each plasmid was converted to CONCERT ^™ (High
purity plasmid maxiprep system: LifeTechnologies
Company).

The extracted plasmid, the primers and
BigDye Terminator Cycle Sequencing FS Ready Reacti
Samples for nucleotide sequence determination of each plasmid were prepared using on Kit (PE Biosystems). This was analyzed by capillary electrophoretic nucleotide sequence analyzer ABI PRISM ^® 310 Gene Thich Analyzer (PE Biosystems, Inc.), using the sequence of the obtained nucleotide sequence data Assembling soft Sequencher3.1 (Gene Codes Corp.) After ligation, the entire nucleotide sequence of each plasmid was determined.

As a result of determining the entire nucleotide sequence of each clone, F
The base sequences of G06969 and FG06883 completely matched. The nucleotide sequences of FG06492 and FG02529 were completely identical. FG01896 has its cDNA
The entire base sequence is FG06492 and FG02
529. FG06969 and FG018
No. 96 had a difference in base sequence at one position in the 5 ′ untranslated region, two positions in the amino acid coding region, and at least one position in the 3 ′ untranslated region, which is considered to be due to a difference in splicing.

[0091]

Embodiment 3 (Ge of FG06969 and FG01896)
Identification of nomic gene) Analysis program for known sequences using amino acid sequence information of FG06969 (BLAST2.
0), the sequence of the chromosomal fragment AC004877 (GenBa
nk ID). FG06969 and FG01896
The cDNA sequence of AC004877 was compared with the Genomic DNA sequence of AC004877 (FIGS. 7a to 7v), and the FG06969 gene was identified as the chromosomal DNA fragment 6 contained in AC004877.
It was found to be encoded from 7867 bp. Further, since the FG01896 gene was also entirely encoded in this fragment, it was revealed that both were clones generated by Alternative Splicing.

[0092]

Example 4-1 (Analysis of FG06969) FG069
When 69 amino acid sequences were searched for the known sequence using an analysis program (BLAST 2.0), it was found that the amino acid sequence had homology to the sequence shown in Table 3. Of these, A
C004877 was the genomic sequence of FG06969, but the sequence of the gene encoded by AC004877 was
The homology with the amino acid sequence registered in GenBank is 4
It was 0%.

[0093]

[Table 3]

Using the amino acid sequence of FG06969 as a query, analysis was performed using a search tool Pfam HMM Search (HMMPFAM) (Nucleic Acids Res. (1998) 26 (1): 320-32).
2). As a result, as shown in Tables 4 and 6, the TSP
1 domain (tsp _- 1) and Trypsin Inhibitor-li
It was found to have ke cysteine rich domain (TIL). Since the region from the 696th amino acid to the 774th amino acid also has conserved tryptophan and cysteine like other TSP1 domains, TSP1
Turned out to be a domain. Therefore, FG06969
CDNA sequence of TSP1 was repeatedly stored 8 times.

[0095]

[Table 4] (Pfam HMM Search (HMMPFAM) of FG06969)
search results)

The meaning of each term in the table is as shown in Table 5 below.

[0097]

[Table 5]

The domain analysis of FG06969 is shown in Table 6. In Table 6, the underlined portion indicates the TSP1 domain, and the italic indicates the TIL domain.

[0099]

[Table 6]

From the result obtained by the above domain analysis, TS
The P1 domains were compared and the results are shown in Table 7. *
Indicates an amino acid that is common between domains.

[0101]

[Table 7] (Comparison of TSP1 domains)

[0102]

Example 4-2 (Analysis of FG01896) FG018
When the 96 amino acid sequences were searched for the known sequences using an analysis program (BLAST 2.0), it was found that they had homology to the sequences shown in Table 8. Of these, A
C004877 was the genomic sequence of FG01896, but the sequence of the gene encoded by AC004877 was
The homology with the amino acid sequence registered in GenBank is 3
7%.

[0103]

[Table 8]

Using the amino acid sequence of FG01896 as a query, a search tool Pfam HMM Search included in Pfam ver3
(HMMPFAM). As a result, as shown in Table 9, FG01896 contained TSP1 domain (tsp_1) and Trypsin Inhibitor-like cysteine rich domain (TI
L). The meaning of each term in the table is as shown in Table 5 above.

[0105]

[Table 9]

Table 10 shows the results of domain analysis of FG01896. In Table 10, the underlined portion indicates the TSP1 domain, and the italic indicates the TIL domain.

[0107]

[Table 10]

Based on the analysis results of FG06969 and FG01896, the alignment of FG06969 and FG01896 was determined by ClustalW1.7 (Felsenstein, J. 1993. PHYLIP
(Phylogeny Inference Package) version 3.5c.Distri
butec by the author.Department of Genetics, Unive
rsity of Washington, Seattle.). FIG.
a and FIG. 8b, FG06969 was TSP-1
FG with 8 domains and 2 TIL domains
01896 has nine TSP-1 domains and two TIL domains. FG06969 and FG01896 had seven TSP-1 domains and TIL domains having the same sequence, and one TSP-1 domain had a different sequence from each other.

[0109]

Example 5 (Analysis of tissue expressing FG06969 gene) In order to analyze the tissue expressing FG06969 gene,
The PCR primers in Table 11 below were synthesized.

[0110]

[Table 11]

Next, cDNAs derived from mRNAs of 24 human organs were prepared in 96-well plates at four different concentrations in “Human RAPID-SCAN ^™ GENE EXPRESSION PANEL” (Ori
(GeneTechnologies, Inc., Rockville, Maryland, USA)
Using as a template, an enzyme solution (25 μl / well) shown in Table 12 below was added, and an appropriate amount (about 25 μl) of mineral oil was overlaid. As a primer, a DNA fragment of 106 bp is amplified by a combination of FG5S / FG5A.

[0112]

[Table 12]

After the enzyme solution was added to each well, the plate was covered with a plastic cover sheet, and allowed to stand for 15 minutes.
Thermal cycler (PCR Thermal Cycler MP: Takara Shuzo)
And set at 94 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 30 seconds.
[Sec] / 40 cycle operation program.

After completion of the PCR reaction, 10 μL of the PCR product was added to 2 μL of 10 × electrophoresis buffer (attached to Takara Shuzo restriction enzyme).
3% agarose gel (SeaKem GTG agarose: FMC) set on a migration device Mupid (Cosmo Bio: Tokyo)
BioProducts, Rockland, ME, USA: 1 μg / mL containing ethidium bromide), electrophoresed at a constant voltage of 50 V for about 75 minutes, and observed electrophoretic images under ultraviolet irradiation. The buffer for electrophoresis was Tris-borate buffer (Takara Shuzo).
Was used. The result is shown in FIG. Note that the PCR product was 1.0 ng of cd in a RAPID-SCAN plate.
It was observed only in the concentration series containing NA, and could not be obtained in the concentration series lower than that.

As shown in FIG. 1, the expression of the gene corresponding to the FG06969 clone is abundant in the brain, lung, stomach, testis, placenta, adrenal gland, pancreas, prostate, leukocytes, heart, spleen, liver,
The thyroid, ovaries, skin, bone marrow, skeletal muscle, salivary glands, and small intestine were followed, with less than detectable levels in kidney, colon, and uterus.
Therefore, the FG06969 gene was considered to be a gene having low tissue specificity of its expression. The expression of this gene was also observed in fetal brain and liver.

[0116]

Example 6 (Construction of FG06969 and FG01896 Expression Vectors)
An expression vector for mammalian cells that fusion-expresses the cHis tag sequence was prepared by the following procedure. (1) All amino acid coding regions excluding the termination codon of human FG06969 (1399 to 42 of SEQ ID NO: 2 in the sequence listing)
PC of Table 13 below that anneals to both ends (81 bases)
An R primer pair was designed.

[0117]

[Table 13]

The N-terminal primer had a 4-base spacer and a recognition sequence for the restriction enzyme Nhe I (Takara Shuzo), and the C-terminal primer had a 4-base spacer and a recognition sequence for the restriction enzyme Hind III (Takara Shuzo). Were designed and synthesized.

[0119]

[Table 14]

(2) PCR was carried out with a heat-resistant DNA polymerase KOD DNA Polymerase (Toyobo) using NHTP-S01 and HDTP-A01 as primers and a plasmid containing human FG06969 as a template. The obtained DNA of about 2.9 Kbp was obtained as a main amplification product. PCR conditions are KOD DNA Polyme
Rase attached protocol was followed.

(3) Mammalian cell expression vector pcDNA
After digesting 3.1 (-) / MycHisA (Invitrogen) and the amplified human full-length cDNA with restriction enzymes Nhe I and Hind III,
Agarose gel electrophoresis was performed, and the target DNA fragment was recovered from the gel using a QIA Quick Gel Extraction Kit (QIAGEN) according to the attached protocol. Human full-length cDNA recovered from the gel and pcDNA3.1 (-) / MycHis
The A fragment was ligated using Ready-To-Go T4 DNA ligase (Amersham Pharmacia Biotech) according to the attached protocol. The ligated plasmid was introduced into DH5α competent cells (Toyobo) to obtain an E. coli transformant.
This was cultured in a terrific Broth medium containing ampicillin (Nacalai Tesque, Inc.) at a final concentration of 50 μg / mL, and complex DN was added.
Plasmid containing A is replaced with QIAprep® ^{registered trademark} Spin Miniprep K
It was extracted with it (QIAGEN).

(4) Primers shown in Table 15 below were synthesized for the sequence of the prepared plasmid.

[0123]

[Table 15]

The above primers and the primers used for FG06969 base sequence determination (see Example 2) and “BigDye Terminator Cycle Sequencing FS Ready Reac
An extraction kit "(PE Biosystems) was used to prepare a sample for nucleotide sequence determination of the extracted plasmid. Prepared samples, capillary electrophoretic sequencing apparatus ABI PRISM ^® 310 Genetic Analyzer (PE
Biosystems), and the obtained nucleotide sequence data was analyzed using the sequence assembly software Sequencher 3.1 (Gene C
odes) to determine the entire nucleotide sequence. Of the two clones whose base sequences were determined, one clone was a plasmid having an amino acid coding region in which the desired FG06969 and MycHis tag were fused to the C terminal,
The clone was named pcDNA3.1 (-) / FG06969 / MycHis.

(5) For FG01896, FG06
Expression vector for mammalian cells that fusion-expresses the MycHis tag sequence at the C terminal in the same manner as 969: pcDNA3.1 (-) / FG01896 / M
In order to prepare ycHis, a portion having a different sequence between FG01896 and FG06969 was replaced by restriction enzyme treatment based on pcDNA3.1 (−) / FG06969 / MycHis. That is, the restriction enzymes Bpu1102 I (Takara Shuzo) and BamH I (Takara Shuzo), each having one recognition site outside the portion where the sequence differs between FG01896 and FG06969, are used for FG0.
Plasmid containing 1896 and pcDNA3.1 (-) / FG06969 / M
After digesting ycHis, agarose gel electrophoresis was performed, and about 1.1 kbp FG01896 cDNA fragment and about 7.2 kbp pcDNA3.1 (-) / FG06969 / MycHis cDNA fragment were separated from the gel.
It was collected using QIA QuickGel Extraction Kit (QIAGEN) according to the attached protocol. FG01896 collected
The fragment and pcDNA3.1 (-) / FG06969 / MycHis fragment were ready-to-
Ligation was performed using -Go T4 DNA ligase (Amersham Pharmacia Biotech) according to the attached protocol. Connect the ligated plasmid to DH5α competent cells (Toyobo)
Introduced to. E. coli transformants were obtained. The obtained Escherichia coli transformant was cultured in Terrific Broth medium containing ampicillin (Nacalai Tesque, Inc.) at a final concentration of 50 μg / mL.
A plasmid containing the A and extracted with QIAprep ^® Spin transformed Miniprep Kit (QIAGEN Inc.).

(6) The extracted plasmid was subjected to restriction enzyme treatment and nucleotide sequencing to determine the desired pcDNA3.1 (-) / FG01896.
/ MycHis. That is, the restriction enzyme Pvu I
(Takara Shuzo), Bln I (Takara Shuzo) and Aor51H I (Takara Shuzo)
After digestion with agarose gel, perform agarose gel electrophoresis.
About 2.8 kbp and about 5.5 for DNA3.1 (-) / FG06969 / MycHis
The two DNA bands of kbp are pcDNA3.1 (-) / FG01896 / M
In ycHis, it was confirmed that the number of lines was about 2.8 kbp, about 2.4 kbp, and about 3.1 kbp.

The nucleotide sequence was determined by using the primers used for FG06969 and “BigDye Terminator Cycle Se
quencing FS Ready Reaction Kit ”(PE Biosystems)
Was used to prepare a sample for determining the nucleotide sequence of pcDNA3.1 (−) / FG01896 / MycHis. Prepared samples, capillary electrophoretic sequencing apparatus ABI PRISM ^{registered trademark} 3
10 Analyze with a Genetic Analyzer (PE Biosystems) and ligate the obtained base sequence data using the sequence assembling software Sequencher 3.1 (Gene Codes) to obtain the desired pc
It was confirmed to be DNA3.1 (-) / FG01896 / MycHis. PcDNA3.1 (-) / FG06969 / MycHis and pcDNA3.1 (-) / F
G01896 / MycHis is illustrated (FIGS. 2, 3).

[0128]

Example 7 (FG06969 gene expression in insect cells)

1. Preparation of recombinant baculovirus vector FG06969 gene animal cell expression vector, pcDNA
3.1 (-) / FG06969 / MycHis with restriction enzyme Nhe I (Takara Shuzo, C
ode.No. 1162A) and Afl II (Takara Shuzo, Code.No. 1003)
A), cut with “DNA Blunting Kit” (Takara Shuzo Code.N
o. 6025) to blunt the cut ends. After completion of the reaction, the DNA sample was subjected to agarose gel electrophoresis, and FG06969 / MycH
A DNA fragment of about 3.0 kb, which is an is fragment, was separated and purified from an agarose gel. Next are commercial cloning vectors
pENT ^™ 1A (GIBCO BRL, Code. No. 11813-011) was replaced with restriction enzymes Dra I (Takara Shuzo, Code. No. 1037A) and EcoRV.
(Takara Shuzo, Code. No. 1042A), add alkaline phosphatase (Takara Shuzo, Code. No. 2120A) to prevent self-ligation, react at 60 ° C for 30 minutes, dephosphorize the terminal Oxidation was performed. After the reaction,
By agarose gel electrophoresis, the vector fragment
2 kb DNA was separated from the gel and purified. Both DNA fragments were mixed at a molar ratio of about 1: 3 (= vector: insert), and a “DNA Ligation Kit” (Takara Shuzo, Code. No. 602) was used.
After ligation in 1), E. coli competent cell DH5α
(Takara Shuzo, Code. No. 9057).

The transformed Escherichia coli was spread on an LB plate containing kanamycin (final concentration; 50 mg / l) and cultured at 37 ° C. overnight. Arbitrarily select several colonies that appeared,
After inoculating about 2 ml of LB liquid medium (50 mg / l kanamycin),
From cells cultured overnight at 37 ° C, commercially available “QIAprep Spin M
Each plasmid DNA was extracted and purified using an "iniprep Kit" (QIAGEN, Code. No. 27106). Each plasmid D
The target plasmid was selected by analyzing the digestion pattern of NA digested with the restriction enzymes Psh BI or Nhe I and Hind III by agarose gel electrophoresis, and the obtained plasmid was analyzed.
pENTR1A / FG06969 / MycHis. (FIG. 4)

Next, “Baculovirus Expression Syste
m "(GIBCO BRL, Code. No. 11827-001) to perform an in vitro recombination reaction, and transfer the FG06969 / MycHis gene subcloned into pENTR1A / FG06969 / MycHis to pDEST, a baculovirus transfer plasmid.
It was cloned into the ^TM 8. "Baculovirus Expression Sy
pDEST ^TM 8 and pENTR1A /
After performing an in vitro recombination reaction of FG06969 / MycHis, Escherichia coli competent cell DH5α (Takara Shuzo, Code.No.9057)
Was transformed.

The transformed Escherichia coli was spread on an LB plate containing ampicillin (final concentration; 50 mg / l) and cultured at 37 ° C. overnight. Arbitrarily select several colonies that appeared,
Suspended in 0.1 ml of LB liquid medium (50 mg / l ampicillin)
Colony PCR was performed using 1 μl of the template as a template. As a primer, two kinds of primers (TP-S05 and TP-A06; sequences are as described above) for amplifying the FG069689 gene were used, and a commercially available amplification enzyme KOD Dash (manufactured by Toyobo Co., Code. No. KOD-10)
1) PCR reaction (98 ° C for 3 minutes / 1 cycle → [98 ° C
20 seconds, 20 seconds at 60 ° C, 2.5 minutes at 75 ° C] / 35 cycles → 75
C. for 10 minutes / 1 cycle), and a clone in which a DNA amplification band of 630 dp was detected by agarose gel electrophoresis was selected. The selected clones were inoculated into about 2 ml of LB liquid medium (50 mg / l ampicillin), and cultured at 37 ° C overnight.
t "(manufactured by QIAGEN, Code. No. 27106), each plasmid DNA was extracted and purified, and the nucleotide sequence of the FG06969 gene was confirmed using the aforementioned sequence primers. Transfer the obtained transfer plasmid to pDES
T8 / FG06969 / MycHis (FIG. 5).

For FG01896 / MycHis, FG06969 / MyHis
In order to prepare a transfer plasmid for baculovirus: pDEST8 / FG01896 / MycHis, pDEST8 / FG
FG01896 and FG069 based on 06969 / MycHis
Parts having different sequences among 69 were replaced by restriction enzyme treatment. That is, plasmids containing FG01896 with restriction enzymes Bpu1102 I (Takara Shuzo) and BamHI (Takara Shuzo) each having one recognition site outside the portion where the sequence differs between FG01896 and FG06969, and pDEST8 / F
After digesting G06969 / MycHis, agarose gel electrophoresis was performed, and about 1.1 kbp of FG01896 cDN
The A fragment and the approximately 6.6 kbp pDEST8 / FG06969 / MycHis cDNA fragment were recovered using a QIA Quick Gel Extraction Kit (QIAGEN). The recovered FG01896 fragment and pDEST8 / F
The G06969 / MycHis fragment was ligated using Ready-To-Go T4 DNA ligase (Amersham Pharmacia Biotech), and then introduced into DH5α competent cells (Toyobo),
E. coli transformants were obtained.

The resulting E. coli transformant had a final concentration of 50 μl.
Terrif containing g / ml ampicillin (Nacalai Tesque)
cultured in ic Broth medium, QIAprep ^{registered trademark} plasmid
SpinMiniprep Kit "(manufactured by QIAGEN). The extracted plasmid was confirmed to be the target pDEST8 / FG01896 / MycHis by restriction enzyme treatment and nucleotide sequencing. That is, after digestion with restriction enzymes Pvu I (Takara Shuzo), Bln I (Takara Shuzo) and Aor51H I (Takara Shuzo), agarose gel electrophoresis was performed, and for pDEST8 / FG06969 / MycHis, about 1.4 Kbp and about 6.4 kbp of 2 The book DNA band is pD
In EST8 / FG01896 / MycHis, about 1.4 kbp, about 1.7 kbp and about 4.7 kbp
It was confirmed that kbp became three.

For nucleotide sequence determination, see FG06969
Primers and "BigDyeTerminator Cycle S"
equencing FS Ready Reaction Kit ”(PE Biosystems
), A sample for determining the nucleotide sequence of pDEST8 / FG01896 / MycHis was prepared. Prepared samples, capillary electrophoretic sequencing apparatus ABI PRISM ^® 310
Genetic analyzer (PE Biosystems) is used for analysis, and the obtained nucleotide sequence data is ligated using sequence assembling software Sequencher 3.1 (Gene Codes) to obtain the desired pDES
It was confirmed to be T8 / FG01896 / MycHis.

The transfer plasmids prepared in the previous section, pDEST8 / FG06969 / MycHis and pDEST8 / FG01896 / MycHis
To produce FG06969 / MycHis and FG01896 / MycHis gene expression viruses by recombination with baculovirus DNA,
A commercially available E. coli competent cell incorporating Bacmid "MAX
"EFFICIENCY DH108AC Competent Cells" (GIBCO BRL, Code. No. 10361-012) was transformed with pDEST8 / FG06969 / MycHis and pDEST8 / FG01896 / MycHis, respectively. The transformed E. coli was spread on LB medium (50 mg / l; kanamycin, 10 mg / l; tetracycline, 7 mg / l; gentamicin, 100 mg / l; X-gal, 40 mg / l; lPTG). , 37
C. overnight. White clones were selected from the colonies that appeared, cultured in 50 ml of LB liquid medium (50 mg / l; kanamycin, 10 mg / l; tetracycline, 7 mg / l; gentamicin) overnight at 37 ° C, and then commercially available “ CONCERT High Pur
ity Maxiprep System ”(GIBCO BRL, Code.No.114
52-018) to purify the recombinant Bacmid DNA. The obtained recombinant Bacmid DNA was used for Bacmid / FG06969 / MycHis and Bacmi.
Two clones were each selected as d / FG01896 / MycHis (for FG06969, Clone No. 8 and Clone No. 1
0, FG01896, Clone No. 1, Clone No.
2), DNA for insect cell transfection.

2. Expression of FG06969 / MycHis Protein by Recombinant Baculovirus Vector Bacmid / FG06969 / MycHis (Clone No.8 and Clone No.10) DNA obtained in the previous section was commercially available as “CELLFECTIN Reagent”
(GIBCO BRL, Code. No. 10362-01 O) was used to transfect insect cells Sf9 cells. The transfection method was performed according to the standard protocol attached to “CELLFECTIN Reagent”, and on the third day after transfection, the culture supernatant was collected as a recombinant virus solution (about 2 ml). 50 m to further amplify the virus solution
l-volume culture flask (FLASK50, manufactured by Sumitomo Bakelite, Cod
e.No. MS-20050), 3.0 × 10 ⁶ Sf9 cells were allowed to adhere thereto, the medium was removed by suction, and then 0.5 ml of the above-mentioned virus solution was added. After leaving at room temperature for 1 hour, 5 ml of medium (Sf-900 II
Serum-Free Medium, GIBCO BRL, Code.No. 10902-
096) was added, and the cells were cultured at 28 ° C. for 4 days. After the culture, collect the supernatant (about 5 ml) and centrifuge (3000 rpm, 5 minutes,
The solution from which cells were removed by KUBOTA5200 at room temperature was stored at 4 ° C. as a “recombinant virus solution”.

FG by recombinant baculovirus prepared
The following experiment was performed to examine the expression of 06969 / MycHis protein. First, 6 Well Tissue Culture Plate (φ35m
m) (Multiplate 6F, manufactured by Sumitomo Bakelite Co., Ltd., Code.
No. MS-80060), 1.0 × 10 ⁶ Sf9 cells were adhered per well, and the medium was removed by suction, followed by infection with 0.3 ml of the above “recombinant virus solution”. After leaving at room temperature for 1 hour, 2 ml of medium (Sf900 II Serum-Free Medium, GIBCO B
RL, Code.No. 10902-096) was added, and the cells were cultured at 28 ° C. After the start of culture, take out the plate on the second and third day,
Using a CELL LIFTER (Costar, Code. No. 3008), scrape all the attached cells and collect them in a centrifuge tube (about 2 m).
l), centrifugation (3000 rpm, 5 minutes, room temperature, KUBORTA5200)
To separate the cells and the culture supernatant (about 2 ml). The precipitated cells were washed with 0.2 ml of TE Buffer (10 mM Tris-HCI, pH = 8.0,
(1 mM EDTA).

Next, FG06 in the culture supernatant and the cell suspension was
To detect 969 / MycHis protein, Western blot analysis using a His-Tag antibody (western blotting a
nalysis). Culture supernatant (Extra
cellular) and cell suspension (Intracellular) respectively
For 0.1 ml, use an equal volume (0.1 ml) of SDS sample Buffer (T
(ris-SDS-BME Sample Loading Buffer, Code No. ER33, manufactured by Daiichi Pure Chemicals Co., Ltd.) and heated at 100 ° C. for 5 minutes. 10 μl of 0.2 ml of each sample was subjected to SDS-polyacrylamide electrophoresis. SDS-polyacrylamide electrophoresis is commercially available `` Multi Gel 4/20 '' manufactured by Daiichi Kagaku,
Code.No. 211010) to “Cassette electrophoresis tank“ Daiichi ”DPE
-120, Code. No. 130472 ", and the electrophoresis was performed according to the attached standard protocol. The electrophoresis buffer used was Takara Shuzo's "Tris-Glycine-SDS Powder, Code.No.T901" and the molecular weight marker was BIO-RAD's "Prestained SDS-
PAGE Standards, Low Range (Code.No. 161-0305, Cont
rol; 86580), High Range (Code.No. 161-0309, Contr.
ol; 86878).

After completion of the electrophoresis, the electrophoresis was performed using a “blotting system” (TAITEC, Code No. TM-6).
The PVDF membrane (manufactured by TEFCO, Code.
3-056). Electro Transfer
This was performed for 1.5 hours at a constant current of 150 mA in a solution obtained by adding 20% of methanol to "Tris-Glycine Powder, Code. No. T902" manufactured by Takara Shuzo. The blotted PVDF membrane was manufactured using Invitrogen's Anti-His (C-term) Antibody, Code. No. R930-2.
Using "5", an antibody reaction was performed according to the attached standard protocol. For detection of antibody-labeled peroxidase, `` ECL + plus, Code.
No. RPN2132 "according to the attached standard protocol. The results are shown in FIGS. 6A and 6B.

As shown in FIG. 6, CBB staining and His-
In any of the results of the Tag antibody reaction, a clear band of about 120 kDa was detected in the cell fraction from day 2 after the infection with the recombinant virus.
It was shown that the 969 / MycHis protein was expressed.

[0142]

As described above, the present invention provides a new TS
It is intended to provide a P1 domain-containing protein, and to provide a novel pharmaceutical composition and a medical treatment utilizing this property.
It provides great utility in clinical and basic medical fields related to TSP1 domain-containing proteins.

[0143]

[Sequence List] SEQUENCE LISTING <110> WelFide Corporation Kazusa DNA Research Institute <120> A novel thrombospondin domain containing protein <130> NP00-1103 <140> <141> <160> 4 <170> PatentIn Ver. 2.1 <210> 1 <211> 961 <212> PRT <213> Homo sapiens <400> 1 Met Ser Trp Thr Gln Ala Arg His Phe Val Gln Ala Val Ala Thr Ala 1 5 10 15 Arg Val His Thr Gly Ser Cys Leu Ala Pro Trp Thr Thr Ala Ser Arg 20 25 30 Pro Met Val Val Ser Val Pro Gly Ala Arg Gly Ala Arg Ala Pro Ala 35 40 45 Pro Val Glu Gly Trp Ala Pro Val Pro Ala Ala Ala Ser Val Cys Ser 50 55 60 Pro Cys Pro Pro Ser Val Val Arg Ala Ala Val Gly Pro Ala Arg Thr 65 70 75 80 Ser Ser Asn Cys Pro Ser Pro Asp Cys Pro Gly Ala Glu Gly Ser Thr 85 90 95 Val Glu Pro Val Thr Gly Leu Pro Gly Gly Trp Gly Pro Trp Ser Ser 100 105 110 Trp Ser Pro Cys Ser Arg Ser Cys Thr Asp Pro Ala Arg Pro Ala Trp 115 120 125 Arg Ser Arg Thr Arg Leu Cys Leu Ala Asn Cys Thr Met Gly Asp Pro 130 135 140 Leu Gln Glu Arg Pro Cys Asn Leu Pro Ser Cys Thr Glu Leu Pro Val 145 150 155 160 Cys Pro Gly Pro Gly Cys Gly Ala Gly Asn Cys Ser Trp Thr Ser Trp 165 170 175 Ala Pro Trp Glu Pro Cys Ser Arg Ser Cys Gly Val Gly Gln Gln Arg 180 185 190 Arg Leu Arg Ala Tyr Arg Pro Pro Gly Pro Gly Gly His Trp Cys Pro 195 200 205 Asn Ile Leu T hr Ala Tyr Gln Glu Arg Arg Phe Cys Asn Leu Arg Ala 210 215 220 Cys Pro Val Pro Gly Gly Trp Ser Arg Trp Ser Pro Trp Ser Trp Cys 225 230 235 240 Asp Arg Ser Cys Gly Gly Gly Gln Ser Leu Arg Ser Arg Ser Cys Ser 245 250 255 Ser Pro Pro Ser Lys Asn Gly Gly Ala Pro Cys Ala Gly Glu Arg His 260 265 270 Gln Ala Arg Leu Cys Asn Pro Met Pro Cys Glu Ala Gly Cys Pro Ala 275 280 285 Gly Met Glu Val Val Thr Cys Ala Asn Arg Cys Pro Arg Arg Cys Ser 290 295 300 Asp Leu Gln Glu Gly Ile Val Cys Gln Asp Asp Gln Val Cys Gln Lys 305 310 315 320 Gly Cys Arg Cys Pro Lys Gly Ser Leu Glu Gln Asp Gly Gly Cys Val 325 330 335 Pro Ile Gly His Cys Asp Cys Thr Asp Ala Gln Gly His Ser Trp Ala 340 345 350 Pro Gly Ser Gln His Gln Asp Ala Cys Asn Asn Cys Ser Cys Gln Ala 355 360 365 Gly Gln Leu Ser Cys Thr Ala Gln Pro Cys Pro Pro Pro Thr His Cys 370 375 380 Ala Trp Ser His Trp Ser Ala Trp Ser Pro Cys Ser His Ser Cys Gly 385 390 395 400 Pro Arg Gly Gln Gln Ser Arg Phe Arg Ser Ser Thr Ser Gly Ser Trp 405 410 415 Ala Pro Glu C ys Arg Glu Glu Gln Ser Gln Ser Gln Pro Cys Pro Gln 420 425 430 Pro Ser Cys Pro Pro Leu Cys Leu Gln Gly Thr Arg Ser Arg Thr Leu 435 440 445 Gly Asp Ser Trp Leu Gln Gly Glu Cys Gln Arg Cys Ser Cys Thr Pro 450 455 460 Glu Gly Val Ile Cys Glu Asp Thr Glu Cys Ala Val Pro Glu Ala Trp 465 470 475 480 Thr Leu Trp Ser Ser Trp Ser Asp Cys Pro Val Ser Cys Gly Gly Gly 485 490 495 Asn Gln Val Arg Thr Arg Ala Cys Arg Ala Ala Ala Pro His His Arg 500 505 510 Ser Pro Pro Cys Leu Gly Pro Asp Thr Gln Thr Arg Gln Gln Pro Cys 515 520 525 Pro Gly Leu Leu Glu Ala Cys Ser Trp Gly Pro Trp Gly Pro Cys Ser 530 535 540 Arg Ser Cys Gly Pro Gly Leu Ala Ser Arg Ser Gly Ser Cys Pro Cys 545 550 555 560 Leu Met Ala Lys Ala Asp Pro Thr Cys Asn Ser Thr Phe Leu His Leu 565 570 575 Asp Thr Gln Gly Cys Tyr Ser Gly Pro Cys Pro Glu Asp Ser Cys Thr 580 585 590 Pro Pro Phe Glu Phe His Ala Cys Gly Ser Pro Cys Ala Gly Ile Cys 595 600 605 Ala Thr His Leu Ser His Gln Leu Cys Gln Asp Leu Pro Pro Cys Gln 610 615 620 Pro Gly Cys TyrCys Pro Lys Gly Leu Leu Glu Gln Ala Gly Gly Cys 625 630 635 640 640 Ile Pro Pro Glu Glu Cys Asn Cys Trp His Thr Ser Ala Ala Gly Ala 645 650 655 Gly Met Thr Leu Ala Pro Gly Asp Arg Leu Gln Leu Gly Cys Lys Glu 660 665 670 Cys Glu Cys Arg Arg Gly Glu Leu His Cys Thr Ser Gln Gly Cys Gln 675 680 685 Gly Leu Leu Pro Leu Ser Glu Trp Ser Glu Trp Ser Pro Cys Gly Pro 690 695 700 Cys Leu Pro Pro Ser Ala Leu Ala Pro Ala Ser Arg Thr Ala Leu Glu 705 710 715 720 720 Glu His Trp Leu Arg Asp Pro Thr Gly Leu Ser Pro Thr Leu Ala Pro 725 730 735 Leu Leu Ala Ser Glu Gln His Arg His Arg Leu Cys Leu Asp Pro Ala 740 745 750 Thr Gly Arg Pro Trp Thr Gly Ala Pro His Leu Cys Thr Ala Pro Leu 755 760 765 Ser Gln Gln Arg Leu Cys Pro Asp Pro Gly Ala Cys Pro Asp Ser Cys 770 775 780 780 Gln Trp Ser Leu Trp Gly Pro Trp Ser Pro Cys Gln Val Pro Cys Ser 785 790 795 800 Gly Gly Phe Arg Leu Arg Trp Arg Glu Ala Glu Ala Leu Cys Gly Gly 805 810 815 Gly Cys Arg Glu Pro Trp Ala Gln Asp Arg Lys Leu Gln Arg Arg Ala 820 825 830 Leu Pro Arg LeuGlu Leu Arg Gly Pro Arg His Cys Ile His Pro Gly 835 840 845 Leu Cys Gln Pro Val Pro Thr Gln Leu Cys Arg Pro Leu Gly Pro Arg 850 855 860 Ser Val Ser Ala Gly Thr Leu Pro Pro Arg Leu Pro Leu Ser Pro Trp 865 870 875 880 Pro Ala Gly Pro Gly Trp Ala Leu Cys Ala Asp Leu Leu Leu Pro Leu 885 890 895 Trp Pro Pro Gln Cys Gln Cys Leu Leu Gly Ala Gly Pro Gly Pro Gly 900 905 910 Gly Ala Ala Gly Leu Pro Lys Leu His Leu Cys Gln Arg Val Pro Gly 915 920 925 val Pro Thr Pro Gly Val Ser Ser Pro Trp Ala Leu Val Ser Leu Glu 930 935 940 Gln Leu Leu Gly Pro Leu Trp Trp Gly His Tyr Gly Ala Thr Ser Asp 945 950 955 960 Leu <210> 2 <211> 5420 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1399) .. (4284) <400> 2 ctgccattga aggggccgag tatagcccct gtggccctcc gtgccctcgc tcctgtgatg 60 acctagtgca ctgcgtgtgg cgctgccagc ctggctgcta ctgcccacca ggccaggtac 120 tgagttccaa cggggccatc tgcgtgcagc cgggtcactg cagctgcctg gacctgctga 180 ccgggcagcg gcaccatccg ggtgctcggc tggcaaggcc tgacggctgc aaccactgca 240 cctgcctgga ggggaggctg aactgcacag acctgccctg cccagtgccc ggaggctggt 300 gcccgtggtc ggagtggaca atgtgctccc agccctgcag gggccagacc aggagccgct 360 ccagggcctg tgcctgcccc actcctcagc acggtggtgc cccgtgcact ggagaggctg 420 gggaggcagg ggcccagcat cagagggagg cctgccccag ctacgccacg tgcccagtgg 480 acggagcctg gggcccatgg gggccatggt ctccctgcga catgtgcttg gggcagtccc 540 accggagccg ggcgtgcagc cggcccccca cccctgaggg agggaggccc tgccctggga 600 gccacacgca gagtcgccct tgccaggaaa attccaccca gtgcacagac tgcgggggtg 660 gccagagtct gcatccctgt gggcagccct gcccccgctc ctgccaggac ctgtcccctg 720 ggagcgtgtg ccagccaggc tctgtgggct gccagcccac ttgtgggtgc cccctgggcc 780 agctctccca ggacgggctg tgcgtgcccc cagcccactg ccgctgccag taccagcctg 840 gagccatggg ga tccctgag aaccagagcc gctcagcagg gtctaggttt agctcctggg 900 agagcctgga acccggagag gtggtcactg ggccatgtga caactgcacc tgtgtggcag 960 gcattctgca atgccaggag gtgcctgact gcccggaccc tggggtgtgg agctcttggg 1020 gcccttggga agactgcagt gtttcgtgtg ggggcgggga gcagctgcgc tcccggcgct 1080 gtgctcgtcc tccctgccca gggcctgccc gccagagccg cacatgcagc acacaggtct 1140 gcagagaggc aggctgcccg gctggccgcc tgtaccgtga atgccagccc ggcgagggat 1200 gccccttctc ctgcgcccac gtcacgcagc aggtgggctg cttctctgag ggctgcgagg 1260 agggctgcca ctgccccgag ggcaccttcc agcaccgcct ggcctgtgtg caggagtgcc 1320 cttgtgtgct gacagcctgg ctgctgcagg agctgggagc caccataggt gaccctggtc 1380 agcccctcgg gcctggag atg agc tgg act cag gc Gt Ag C g t Gag Ag C Gc Ag C Gc Ag C Gc Ag C Gc Ag G agc tgt ctt gct ccc tgg 1479 Ala Val Ala Thr Ala Arg Val His Thr Gly Ser Cys Leu Ala Pro Trp 15 20 25 acg act gct tcg agg ccg atg gtg gtt tcg gtc cct gga gcc cgt ggg 1527 Thr Thr Ala Ser Arg Pro Met Val Val Ser Val P ro Gly Ala Arg Gly 30 35 40 gcc cgt gct ccc gct cct gtg gag ggc tgg gca ccc gta ccc gca gcc 1575 Ala Arg Ala Pro Ala Pro Val Glu Gly Trp Ala Pro Val Pro Ala Ala 45 50 55 gcc agt gtg tgc tca cca tgc cca ccc tca gtg gtc agg gct gcc gtg 1623 Ala Ser Val Cys Ser Pro Cys Pro Pro Ser Val Val Arg Ala Ala Val 60 65 70 75 ggc ccc gcc agg acc tcg agt aac tgc ccc agc cca gac tgc cct ggg 1671 Gly Pro Ala Arg Thr Ser Ser Asn Cys Pro Ser Pro Asp Cys Pro Gly 80 85 90 gct gaa ggg tcc acg gtg gag cca gta aca ggc ctt cca ggt ggc tgg 1719 Ala Glu Gly Ser Thr Val Glu Pro Val Thr Gly Leu Pro Gly Gly Trp 95 100 105 ggc cca tgg tcc tcc tgg tcc ccc tgc tcc aga agc tgc acg gac ccc 1767 Gly Pro Trp Ser Ser Trp Ser Pro Cys Ser Arg Ser Cys Thr Asp Pro 110 115 120 gct cgc cct gca tgg cgc agc cgc acc cgc ctc tgc ctg gct aac tgc 1815 Ala Arg Pro Ala Trp Arg Ser Arg Thr Arg Leu Cys Leu Ala Asn Cys 125 130 135 acc atg ggg gac cca tta cag gag cgc ccc tgc aac ctg ccc tca tgc 1863 Thr Met Gly Asp Pro Leu Glu Arg Pro Cys Asn Leu Pro Ser Cys 140 145 150 155 aca gag ctg ccc gtg tgc cct ggc cct ggc tgt ggg gct ggg aac tgt 1911 Thr Glu Leu Pro Val Cys Pro Gly Pro Gly Cys Gly Ala Gly Asn Cys 160 165 170 170 tcc tgg acc tcc tgg gcc ccg tgg gaa cct tgc tcc cgc agc tgc gga 1959 Ser Trp Thr Ser Trp Ala Pro Trp Glu Pro Cys Ser Arg Ser Cys Gly 175 180 185 gtg ggc cag cag cgc cgc ctg cgg gca tac cgt ccc cct ggg ccc Gly Gln Gln Arg Arg Leu Arg Ala Tyr Arg Pro Pro Gly Pro Gly 190 195 200 ggg cac tgg tgc ccc aac atc ctt act gcc tac caa gag cgc cgc ttc 2055 Gly His Trp Cys Pro Asn Ile Leu Thr Ala Tyr Gln Glu Arg Arg Phe 205 210 215 tgc aac ctg cga gcc tgc cca gtg ccc ggg ggc tgg tca cgc tgg agt 2103 Cys Asn Leu Arg Ala Cys Pro Val Pro Gly Gly Trp Ser Arg Trp Ser 220 225 230 235 ccc tgg tcc tgg tgt gac cgc ac ggg gga ggc caa tcc ctg aga 2151 Pro Trp Ser Trp Cys Asp Arg Ser Cys Gly Gly Gly Gln Ser Leu Arg 240 245 250 agc cgc agc tgc tca agc ccc cca tcc aag aac ggg gga gcc ccc tgt 2199 Ser Arg Ser Cys S er Ser Pro Pro Ser Lys Asn Gly Gly Gly Ala Pro Cys 255 260 265 gct ggg gag cgg cac cag gcc cgc ctc tgc aat ccc atg cct tgt gag 2247 Ala Gly Glu Arg His Gln Ala Arg Leu Cys Asn Pro Met Pro Cys Glu 270 275 280 gcc ggc tgc cca gca ggc atg gag gtg gtc acc tgt gcc aac cgc tgc 2295 Ala Gly Cys Pro Ala Gly Met Glu Val Val Thr Cys Ala Asn Arg Cys 285 290 290 295 ccc cgc cgc tgc tca gac tgt gat gag tg g cag gac gac 2343 Pro Arg Arg Cys Ser Asp Leu Gln Glu Gly Ile Val Cys Gln Asp Asp 300 305 310 315 cag gtc tgc cag aag ggc tgc cgc tgc cca aag ggg tcc ctg gag cag 2391 Gln Val Cys Gln Lyg Gly Cys Pro Lys Gly Ser Leu Glu Gln 320 325 330 gat ggt ggc tgc gtg cca att ggg cac tgt gac tgc acc gat gcc cag 2439 Asp Gly Gly Cys Val Pro Ile Gly His Cys Asp Cys Thr Asp Ala Gln 335 340 345 345 ggc cac agc tgg gcc ccg ggg agc cag cac cag gat gcc tgc aac aac 2487 Gly His Ser Trp Ala Pro Gly Ser Gln His Gln Asp Ala Cys Asn Asn 350 355 360 tgc tca tgc caa gct ggg cag ctc tcc tgc acg gct cag ccc tgc cc 35 Cys Ser Cys Gln Ala Gly Gln Leu Ser Cys Thr Ala Gln Pro Cys Pro 365 370 375 cct ccc acc cac tgt gcc tgg agc cac tgg tcg gcc tgg agt ccc tgc 2583 Pro Pro Thr His Cys Ala Trp Ser His Trp Ser Ala Trp Ser Pro Cys 380 385 390 395 agc cac tca tgc ggg ccc aga ggg cag cag agc cgc ttc cgg tcc tcc 2631 Ser His Ser Cys Gly Pro Arg Gly Gln Gln Ser Arg Phe Arg Ser Ser 400 405 410 acg tcg ggc tcg tgg gccca gag tgt cgg gag gag cag tcc cag agc 2679 Thr Ser Gly Ser Trp Ala Pro Glu Cys Arg Glu Glu Gln Ser Gln Ser 415 420 425 cag ccc tgc cct cag ccc tcg tgc cca ccc ctg tgc ctg cag ggc act 2727 Gln Pro Cys Pro Cys Gln Pro Ser Cys Pro Pro Leu Cys Leu Gln Gly Thr 430 435 440 cgc tcc cgc acc ctg ggg gac agc tgg ctg cag ggg gag tgc cag cgg 2775 Arg Ser Arg Thr Leu Gly Asp Ser Trp Leu Gln Gly Glu Cys Gln Arg 445 450 455 tgc tcc tgc acc ccg gag ggt gtg atc tgc gaa gat acg gag tgt gca 2823 Cys Ser Cys Thr Pro Glu Gly Val Ile Cys Glu Asp Thr Glu Cys Ala 460 465 470 475 gtg cct gag gct tgg acg ctg tgg tcc tcc tcc gac tgc cct gtc 2871 Val Pro Glu Ala Trp Thr Leu Trp Ser Ser Trp Ser Asp Cys Pro Val 480 485 490 tcc tgt gga ggt gga aac cag gtc cga acc cgg gcc tgc agg gcc gca 2919 Ser Cys Gly Gly Gly Asn Gln Val Arg Thr Arg Ala Cys Arg Ala Ala 495 500 505 gcc cct cac cac agg agc cca ccc tgc ctg ggc cct gac acc cag acc 2967 Ala Pro His His Arg Ser Pro Pro Cys Leu Gly Pro Asp Thr Gln Thr 510 515 515 520 agg cag cag cag cct tgc cca ggg ctg ctg gag gcc tgc tcc tgg ggc ccg 3015 Arg Gln Gln Pro Cys Pro Gly Leu Leu Glu Ala Cys Ser Trp Gly Pro 525 530 535 tgg ggg ccc tgt tcc cgc agc tgc ggc ccg ccc ctg ccg ctg ccg ccg ctg Trp Gly Pro Cys Ser Arg Ser Cys Gly Pro Gly Leu Ala Ser Arg Ser 540 545 550 555 ggg tcc tgc ccc tgc ctg atg gcc aag gcc gac ccc acc tgc aac agc 3111 Gly Ser Cys Pro Cys Leu Met Ala Lys Ala Asp Pro Thr Cys Asn Ser 560 565 570 acc ttc ctc cac ctg gac acc cag ggc tgc tac tca ggg ccc tgc cca 3159 Thr Phe Leu His Leu Asp Thr Gln Gly Cys Tyr Ser Gly Pro Cys Pro 575 580 585 gag gac agc tgc acg cct ccc ttt gag ttc cat gcc tgc ggc tcc ccc 3207 Glu Asp Ser Cys Thr Pro Pro Phe Glu Phe His Ala Cys Gly Ser Pro 590 595 600 tgt gct ggg atc tgt gcc aca cac ctg agc cat cag ctc tgc cag gac 3255 Cys Ala Gly Ile Cys Ala Thr His Leu Ser His Gln Leu Cys Gln Asp 605 610 615 ctg cca ccc tgc cag ccg ggc tgc tac tgc ccc aag ggg ctg ctg gag 3303 Leu Pro Pro Cys Gln Pro Gly Cys Tyr Cys Pro Lys Gly Leu Leu Glu 625 630 635 cag gct ggg ggc tgc att ccc cca gag gag tgt aac tgc tgg cat acc 3351 Gln Ala Gly Gly Cys Ile Pro Pro Glu Glu Cys Asn Cys Trp His Thr 640 645 650 tca gca gca gga gcc ggg atg acc ctg gcc cct ggg gac cgc ctg cag 3399 Ser Ala Ala Gly Ala Gly Met Thr Leu Ala Pro Gly Asp Arg Leu Gln 655 660 665 ctg ggc tgt aag gag tgt gaa tgc cgg cgt ggg gag ctg cac tgc acc 3447 Leu Gly Cyslus Cyslus Arg Arg Gly Glu Leu His Cys Thr 670 675 680 agc cag ggc tgt caa ggt ctt ctg cct ctg agt gag tgg tcc gag tgg 3495 Ser Gln Gly Cys Gln Gly Leu Leu Pro Leu Ser Glu Trp Ser Glu Trp 685 690 695 tcg c cc tgt ggg ccc tgc ctg ccg ccc agc gcc ctg gcc cct gcc tcc 3543 Ser Pro Cys Gly Pro Cys Leu Pro Pro Ser Ala Leu Ala Pro Ala Ser 700 705 710 715 agg act gcc cta gag gag cac tgg ctc cga gac cca act ggc ctc tcc 3591 Arg Thr Ala Leu Glu Glu His Trp Leu Arg Asp Pro Thr Gly Leu Ser 720 725 730 ccc acc ttg gcc ccg ctg ctg gct tca gag cag cac cgc cac cgg ctc 3639 Pro Thr Leu Ala Pro Leu Leu Ala Ser Glu Gln His Arg His Arg Leu 735 740 745 tgt ctg gat cct gcg aca ggg agg ccc tgg act gga gcc cct cac ctc 3687 Cys Leu Asp Pro Ala Thr Gly Arg Pro Trp Thr Gly Ala Pro His Leu 750 755 760 tgc acc gca ccc ctc agc cag cag cgc ctc tgc cct gac cct gga gcc 3735 Cys Thr Ala Pro Leu Ser Gln Gln Arg Leu Cys Pro Asp Pro Gly Ala 765 770 775 tgc cct gac tca tgc cag tgg agt ctg tgg ggg cca tgg agc ccc tgc 3783 Ser Cys Gln Trp Ser Leu Trp Gly Pro Trp Ser Pro Cys 780 785 790 795 cag gtg ccc tgc agt ggg ggg ttc agg cta cgc tgg aga gag gca gag 3831 Gln Val Pro Cys Ser Gly Gly Phe Arg Leu Arg Trp Arg Glu Al a Glu 800 805 810 gcc ctc tgt gga gga ggc tgc cgg gag cca tgg gct caa gac aga aag 3879 Ala Leu Cys Gly Gly Gly Cys Arg Glu Pro Trp Ala Gln Asp Arg Lys 815 820 825 ctg caa cgg agg gcc ctg ccc gag ctg cga ggc cca aga cac 3927 Leu Gln Arg Arg Ala Leu Pro Arg Leu Glu Leu Arg Gly Pro Arg His 830 835 840 tgt att cac cct gga ctg tgc caa cca gtg ccc aca cag ctg tgc cga 3975 Cys Ile Pro Cys Gln Pro Val Pro Thr Gln Leu Cys Arg 845 850 855 cct ctg gga ccg cgt tca gtg tct gca ggg acc ctg ccg ccc agg ctg 4023 Pro Leu Gly Pro Arg Ser Val Ser Ala Gly Thr Leu Pro Pro Arg Leu 860 865 870 870 875 ccg ctg tcc ccc tgg cca gct ggt cca gga tgg gcg ctg tgt gcc gat 4071 Pro Leu Ser Pro Trp Pro Ala Gly Pro Gly Trp Ala Leu Cys Ala Asp 880 885 890 890 ctc ctc ttg ccg ctg tgg cct ccc cag tc ca gga gct 4119 Leu Leu Leu Pro Leu Trp Pro Pro Gln Cys Gln Cys Leu Leu Gly Ala 895 900 905 ggc ccc ggc cca ggc ggt gca gct gga ctg cca aaa ctg cac ctg tgt 4167 Gly Pro Gly Pro Gly Gly Ala Ala Gly Le u Pro Lys Leu His Leu Cys 910 915 920 caa cga gtc cct ggt gtg ccc aca cca gga gtg tcc agt cct tgg gcc 4215 Gln Arg Val Pro Gly Val Pro Thr Pro Gly Val Ser Ser Pro Trp Ala 925 930 935 ttg gtc agc ctg gag cag ttg ctc ggc ccc ctg tgg tgg ggg cac tat 4263 Leu Val Ser Leu Glu Gln Leu Leu Gly Pro Leu Trp Trp Gly His Tyr 940 945 950 955 gga gcg aca tcg gac ttg tga ggggggtcct ggggtggcacgcc catg 960 ccaggacaca gagcaacggc aggagtgtaa cctgcagccc tgccctgagt gcccccctgg 4374 ccaggtgctt agtgcctgtg ccacctcatg cccgtgcctc tgctggcatc tgcagcctgg 4434 tgccatctgt gtgcaggagc cctgccagcc tggctgtggc tgccctggag ggcagctgct 4494 gcacaatggc acgtgtgtgc ctcccactgc ctgcccctgc acccagcatt ctctgccctg 4554 gggcctcacc ctgaccctgg aagagcaggc ccaggagctg cccccaggga ctgtgctcac 4614 ccggaactgc acccgctgtg tctgccacgg tggagccttc agctgctccc tcgttgactg 4674 tcaggagtgc cccctgggga aacgtggcag caggtggccc cgggggagct ggggctctgc 4734 gagcagacgt gcctggagat gaacgccaca aagacccaga gtaactgcag ttcagctcga 4794 gcctcg ggct gcgtgtgcca gcccgggcac ttccgcagcc aggcaggccc ctgcgtcccc 4854 gaagaccact gcgagtgctg gcaccttggg cgtccccacc tgcctggatc tgaatggcag 4914 gaggcctgtg agagctgcct ctgcctcagt gggaggcctg tctgcaccca gcactgctcc 4974 ccactcacct gtgctcaggg cgaggagatg gtgctggagc cagggagctg ctgtccctct 5034 tgccgcaggg aggctccgga ggagcagtcg ccctcctgcc agctcctcac ggagcttcga 5094 aacttcacca aagggacctg ttacctggac caggtagaag tgagctactg cagtgggtac 5154 tgcccatcca gcacccatgt catgccagag gagccatacc tgcagagcca gtgtgactgc 5214 tgcagctacc gtctagaccc ggagagccct gtgcggatcc tgaacctgcg ctgtctgggt 5274 ggccacacag agcccgtggt gctgccggtc atccacagct gccagtgcag ctcctgccag 5334 ggaggtgact tctcaaagcg gtg cct ctg ctg ctg ctg ctg ctg ctg ctg ctg ctg ctg gtg <210> 3 <211> 966 <212> PRT <213> Homo sapiens <400> 3 Met Ser Trp Thr Gln Ala Arg His Phe Val Gln Ala Val Ala Thr Ala 1 5 10 15 Arg Val His Thr Gly Ser Cys Leu Ala Pro Trp Thr Thr Ala Ser Arg 20 25 30 Pro Met Val Val Ser Val Pro Gly Ala Arg Gly Ala Arg Ala Pro Ala 35 40 45 Pro Val Glu Gly Trp Ala Pro Val Pro Ala Ala Ala Ser Val Cys Ser 50 55 60 Pro Cys Pro Pro Ser Val Val Arg Ala Ala Val Gly Pro Ala Arg Thr 65 70 75 80 Ser Ser Asn Cys Pro Ser Pro Asp Cys Pro Gly Ala Glu Gly Ser Thr 85 90 95 Val Glu Pro Val Thr Gly Leu Pro Gly Gly Trp Gly Pro Trp Ser Ser 100 105 110 Trp Ser Pro Cys Ser Arg Ser Cys Thr Asp Pro Ala Arg Pro Ala Trp 115 120 125 Arg Ser Arg Thr Arg Leu Cys Leu Ala Asn Cys Thr Met Gly Asp Pro 130 135 140 Leu Gln Glu Arg Pro Cys Asn Leu Pro Ser Cys Thr Glu Leu Pro Val 145 150 155 160 Cys Pro Gly Pro Gly Cys Gly Ala Gly Asn Cys Ser Trp Thr Ser Trp 165 170 175 Ala Pro Trp Glu Pro Cys Ser Arg Ser Cys Gly Val Gly Gln Gln Arg 180 185 190 Arg Leu Arg Ala Tyr Arg Pro Pro Gly Pro Gly Gly His Trp Cys Pro 195 200 205 Asn Ile Leu Th r Ala Tyr Gln Glu Arg Arg Phe Cys Asn Leu Arg Ala 210 215 220 Cys Pro Val Pro Gly Gly Trp Ser Arg Trp Ser Pro Trp Ser Trp Cys 225 230 235 240 Asp Arg Ser Cys Gly Gly Gly Gln Ser Leu Arg Ser Arg Ser Cys Ser 245 250 255 Ser Pro Pro Ser Lys Asn Gly Gly Ala Pro Cys Ala Gly Glu Arg His 260 265 270 Gln Ala Arg Leu Cys Asn Pro Met Pro Cys Glu Ala Gly Cys Pro Ala 275 280 285 Gly Met Glu Val Val Thr Cys Ala Asn Arg Cys Pro Arg Arg Cys Ser 290 295 300 Asp Leu Gln Glu Gly Ile Val Cys Gln Asp Asp Gln Val Cys Gln Lys 305 310 315 320 Gly Cys Arg Cys Pro Lys Gly Ser Leu Glu Gln Asp Gly Gly Cys Val 325 330 335 Pro Ile Gly His Cys Asp Cys Thr Asp Ala Gln Gly His Ser Trp Ala 340 345 350 Pro Gly Ser Gln His Gln Asp Ala Cys Asn Asn Cys Ser Cys Gln Ala 355 360 365 Gly Gln Leu Ser Cys Thr Ala Gln Pro Cys Pro Pro Pro Thr His Cys 370 375 380 Ala Trp Ser His Trp Ser Ala Trp Ser Pro Cys Ser His Ser Cys Gly 385 390 395 400 Pro Arg Gly Gln Gln Ser Arg Phe Arg Ser Cys Thr Pro Glu Gly Val 405 410 415 Ile Cys Glu A sp Thr Glu Cys Ala Val Pro Glu Ala Trp Thr Leu Trp 420 425 430 Ser Ser Trp Ser Asp Cys Pro Val Ser Cys Gly Gly Gly Asn Gln Val 435 440 445 Arg Thr Arg Ala Cys Arg Ala Ala Ala Pro His His Arg Ser Pro Pro 450 455 460 Cys Leu Gly Pro Asp Thr Gln Thr Arg Gln Gln Pro Cys Pro Gly Leu 465 470 475 480 Leu Glu Ala Cys Ser Trp Gly Pro Trp Gly Pro Cys Ser Arg Ser Cys 485 490 495 Gly Pro Gly Leu Ala Ser Arg Ser Gly Ser Cys Pro Cys Leu Met Ala 500 505 510 Lys Ala Asp Pro Thr Cys Asn Ser Thr Phe Leu His Leu Asp Thr Gln 515 520 525 Gly Cys Tyr Ser Gly Pro Cys Pro Glu Glu Cys Val Trp Ser Ser Trp 530 535 540 Ser Ser Trp Thr Arg Cys Ser Cys Arg Val Leu Val Gln Gln Arg Tyr 545 550 555 560 Arg His Gln Gly Pro Ala Ser Arg Gly Ala Arg Ala Gly Ala Pro Cys 565 570 575 Thr Arg Leu Asp Gly His Phe Arg Pro Cys Leu Ile Ser Asn Cys Ser 580 585 590 Glu Asp Ser Cys Thr Pro Pro Phe Glu Phe His Ala Cys Gly Ser Pro 595 600 605 Cys Ala Gly Leu Cys Ala Thr His Leu Ser His Gln Leu Cys Gln Asp 610 615 620 Leu Pro Pro Cys G ln Pro Gly Cys Tyr Cys Pro Lys Gly Leu Leu Glu 625 630 635 640 Gln Ala Gly Gly Cys Ile Pro Pro Glu Glu Cys Asn Cys Trp His Thr 645 650 655 Ser Ala Ala Gly Ala Gly Met Thr Leu Ala Pro Gly Asp Arg Leu Gln 660 665 670 Leu Gly Cys Lys Glu Cys Glu Cys Arg Arg Gly Glu Leu His Cys Thr 675 680 685 Ser Gln Gly Cys Gln Gly Leu Leu Pro Leu Ser Glu Trp Ser Glu Trp 690 695 700 Ser Pro Cys Gly Pro Cys Leu Pro Pro Ser Ala Leu Ala Pro Ala Ser 705 710 715 720 720 Arg Thr Ala Leu Glu Glu His Trp Leu Arg Asp Pro Thr Gly Leu Ser 725 730 735 Pro Thr Leu Ala Pro Leu Leu Ala Ser Glu Gln His Arg His Arg Leu 740 745 750 Cys Leu Asp Pro Ala Thr Gly Arg Pro Trp Thr Gly Ala Pro His Leu 755 760 765 Cys Thr Ala Pro Leu Ser Gln Gln Arg Leu Cys Pro Asp Pro Gly Ala 770 775 780 780 Cys Pro Asp Ser Cys Gln Trp Ser Leu Trp Gly Pro Trp Ser Pro Cys 785 790 795 800 Gln Val Pro Cys Ser Gly Gly Phe Arg Leu Arg Trp Arg Glu Ala Glu 805 810 815 Ala Leu Cys Gly Gly Gly Cys Arg Glu Pro Trp Ala Gln Asp Arg Lys 820 825 830 830 Leu Gln Arg ArgAla Leu Pro Arg Leu Glu Leu Arg Gly Pro Arg His 835 840 845 Cys Ile His Pro Gly Leu Cys Gln Pro Val Pro Thr Gln Leu Cys Arg 850 855 860 Pro Leu Gly Pro Arg Ser Val Ser Ala Gly Thr Leu Pro Pro Arg Leu 865 870 875 880 Pro Leu Ser Pro Trp Pro Ala Gly Pro Gly Trp Ala Leu Cys Ala Asp 885 890 895 Leu Leu Leu Pro Leu Trp Pro Pro Gln Cys Gln Cys Leu Leu Gly Ala 900 905 910 Gly Pro Gly Pro Gly Gly Ala Ala Gly Leu Pro Lys Leu His Leu Cys 915 920 925 Gln Arg Val Pro Gly Val Pro Thr Pro Gly Val Ser Ser Pro Trp Ala 930 935 940 Leu Val Ser Leu Glu Gln Leu Leu Gly Pro Leu Trp Trp Grp His Tyr 945 950 955 960 Gly Ala Thr Ser Asp Leu 965 <210> 4 <211> 5939 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1297) .. (4197) <400> 4 gccaggtact gagttccaac ggggccatct gcgtgcagcc gggtcactgc agctgcctgg 60 acctgctgac cgggcagcgg caccatccgg gtgctcggct ggcaaggcct gacggctgca 120 accactgcac ctgcctggag gggaggctga actgcacaga cctgccctgc ccagtgcccg 180 gaggctggtg cccgtggtcg gagtggacaa tgtgctccca gccctgcagg ggccagacca 240 ggagccgctc cagggcctgt gcctgcccca ctcctcagca cggtggtgcc ccgtgcactg 300 gagaggctgg ggaggcaggg gcccagcatc agagggaggc ctgccccagc tacgccacgt 360 gcccagtgga cggagcctgg ggcccatggg ggccatggtc tccctgcgac atgtgcttgg 420 ggcagtccca ccggagccgg gcgtgcagcc ggccccccac ccctgaggga gggaggccct 480 gccctgggag ccacacgcag agtcgccctt gccaggaaaa ttccacccag tgcacagact 540 gcgggggtgg ccagagtctg catccctgtg ggcagccctg cccccgctcc tgccaggacc 600 tgtcccctgg gagtgtgtgc cagccaggct ctgtgggctg ccagcccact tgtgggtgcc 660 ccctgggcca gctctcccag gacgggctgt gcgtgccccc agcccactgc cgctgccagt 720 accagcctgg agccatgggg atccctgaga accagagccg ctcagcaggg tctaggttta 780 gctcctggga gagcctggaa cccggagagg tggtcactgg gccatgtgac aactgcacct 840 gtgtggcagg ca ttctgcaa tgccaggagg tgcctgactg cccggaccct ggggtgtgga 900 gctcttgggg cccttgggaa gactgcagtg tttcgtgtgg gggcggggag cagctgcgct 960 cccggcgctg tgctcgtcct ccctgcccag ggcctgcccg ccagagccgc acatgcagca 1020 cacaggtctg cagagaccct gtcatccctg ggcaggcccc taagcagcac acaggctggt 1080 gaggccagcc gaggcctctg ctgacagcgt cgggggcagg cagagttaga cgcagcctcc 1140 cggggtccct ggttccccgg gatggggaac acctgccacc tctggacttg cctgtcctct 1200 gttcctgact ggagtgccct tgtgtgctga cagcctggct gctgcaggag ctgggagcca 1260 ccataggtga ccctggtcag cccctcgggc ctggag atg agc tgg act cag gcc 1314 Met Ser Trp Thr Gln Ala 15 aga cac ttc gta caa gct gtg gca act gct cgt gtg cac acg gga agc 1362 Arg His Phe Val Gln Ala Val Ala Thr Ala Arg Val His Thr Gly 10 15 20 tgt ctt gct ccc tgg acg act gct tcg agg ccg atg gtg gtt tcg gtc 1410 Cys Leu Ala Pro Trp Thr Thr Ala Ser Arg Pro Met Val Val Ser Val 25 30 35 cct gga gcc cgt ggg gcc cgt gct ccc gct cct gtg gag ggc tgg gca 1458 Pro Gly Ala Arg Gly Ala Arg Ala Pro Ala Pro Val Glu Gly Trp Ala 40 45 50 ccc gta ccc gca gcc gcc agt gtg tgc tca cca tgc cca ccc tca gtg 1506 Pro Val Pro Ala Ala Ala Ser Val Cys Ser Pro Cys Pro Pro Ser Val 55 60 65 70 gtc agg gct gcc gtg ggc ccc gcc agg acc tcg agt aac tgc ccc agc 1554 Val Arg Ala Ala Val Gly Pro Ala Arg Thr Ser Ser Asn Cys Pro Ser 75 80 85 cca gac tgc cct ggg gct gaa ggg tcc acg gtg gag cca gta aca ggc 1602 Pro Asp Cys Pro Gly Ala Glu Gly Ser Thr Val Glu Pro Val Thr Gly 90 95 100 ctt cca ggt ggc tgg ggc cca tgg tcc tcc tgg tcc ccc tgc tcc aga 1650 Leu Pro Gly Gly Trp Gly Pro Trp Ser Ser Trp Ser Pro Cys Ser Arg 105 110 115 agc tgc acg gac ccc gct cgc cct gca tgg cgc agc cgc acc cgc ctc 1698 Ser Cys Thr Asp Pro Ala Arg Pro Ala Trp Arg Ser Arg Thr Arg Leu 120 125 130 tgc ctg gct aac tgc acc atg ggg gac cca tta cag gag cgc cccg Cys Leu Ala Asn Cys Thr Met Gly Asp Pro Leu Gln Glu Arg Pro Cys 135 140 145 150 aac ctg ccc tca tgc aca gag ctg ccc gtg tgc cct ggc cct ggc tgt 1794 Asn Leu Pro Ser Cys Thr Glu Leu Pro Val Cys Pro Gly Pro Gly Cys 155 160 165 ggg gct ggg aac tgt tcc tgg acc tcc tgg gcc ccg tgg gaa cct tgc 1842 Gly Ala Gly Asn Cys Ser Trp Thr Ser Trp Ala Pro Trp Glu Pro Cys 170 175 180 tcc cgc agc tgc gga gtg gg cag cgc cgc ctg cgg gca tac cgt 1890 Ser Arg Ser Cys Gly Val Gly Gln Gln Arg Arg Leu Arg Ala Tyr Arg 185 190 195 ccc cct ggg ccc ggc ggg cac tgg tgc ccc aac atc ctt act gcc tac 1938 Pro Pro Gly Pro Gly His Trp Cys Pro Asn Ile Leu Thr Ala Tyr 200 205 210 caa gag cgc cgc ttc tgc aac ctg cga gcc tgc cca gtg ccc ggg ggc 1986 Gln Glu Arg Arg Phe Cys Asn Leu Arg Ala Cys Pro Val Pro Gly Gly 215 220 225 230 tgg tca cgc tgg agt ccc tgg tcc tgg tgt gac cgc agc tgt ggg gga 2034 Trp Ser Arg Trp Ser Pro Trp Ser Trp Cys Asp Arg Ser Cys Gly Gly 235 240 245 ggc caa tcc ctg aga agc cgc agc tgc ccac ccc aag aac 2082 Gly Gln Ser Leu Arg Ser Arg Ser Cys Ser Ser Pro Pro Ser Lys Asn 250 255 260 ggg gga gcc ccc tgt gct ggg gag cgg cac cag gcc cgc ctc tgc aat 2130 Gly Gly Aly Pro Cys Ala Gly Glu Arg His Gln Ala Arg Leu Cys Asn 265 270 275 ccc atg cct tgt gag gcc ggc tgc cca gca ggc atg gag gtg gtc acc 2178 Pro Met Pro Cys Glu Ala Gly Cys Pro Ala Gly Met Glu Val Val Thr 280 285 285 290 tgt gcc aacc tgc ccc cgc cgc tgc tca gac ctc cag gag gga att 2226 Cys Ala Asn Arg Cys Pro Arg Arg Cys Ser Asp Leu Gln Glu Gly Ile 295 300 305 310 gtg tgt cag gac gac cag gtc tgc cag aag ggc tgc cgcgcggcggcgcggcgcagc Val Cys Gln Asp Asp Gln Val Cys Gln Lys Gly Cys Arg Cys Pro Lys 315 320 325 ggg tcc ctg gag cag gat ggt ggc tgc gtg cca att ggg cac tgt gac 2322 Gly Ser Leu Glu Gln Asp Gly Gly Cys Val Pro Ile Gly His Cys Asp 330 335 340 tgc acc gat gcc cag ggc cac agc tgg gcc ccg ggg agc cag cac cag 2370 Cys Thr Asp Ala Gln Gly His Ser Trp Ala Pro Gly Ser Gln His Gln 345 350 355 gat gcc tgc aac aac tgc tca tc ca gct ggg cag ctc tcc tgc acg 2418 Asp Ala Cys Asn Asn Cys Ser Cys Gln Ala Gly Gln Leu Ser Cys Thr 360 365 370 gct cag ccc tgc ccg cct ccc acc cac tgt gcc tgg agc cac tgg tcg 2466 Ala Gln Pro Cys P ro Pro Pro Thr His Cys Ala Trp Ser His Trp Ser 375 380 385 390 gcc tgg agt ccc tgc agc cac tca tgc ggg ccc aga ggg cag cag agc 2514 Ala Trp Ser Pro Cys Ser His Ser Cys Gly Pro Arg Gly Gln Gln Ser 395 400 405 cgc ttc cgc tcc tgc acc ccg gag ggt gtg atc tgc gaa gat acg gag 2562 Arg Phe Arg Ser Cys Thr Pro Glu Gly Val Ile Cys Glu Asp Thr Glu 410 415 420 tgt gca gtg cct gag gct tgg tcc acg ctg tgg tgg tcc gac tgc 2610 Cys Ala Val Pro Glu Ala Trp Thr Leu Trp Ser Ser Trp Ser Asp Cys 425 430 435 cct gtc tcc tgt gga ggt gga aac cag gtc cga acc cgg gcc tgc agg 2658 Pro Val Ser Cys Gly Gly Gly Gly Asn Gln Val Arg Thr Arg Ala Cys Arg 440 445 450 gcc gca gcc cct cac cac agg agc cca ccc tgc ctg ggc cct gac acc 2706 Ala Ala Ala Pro His His Arg Ser Pro Pro Cys Leu Gly Pro Asp Thr 455 460 465 465 470 cag acc agg cag cag cct tgc cca ggg ctg ctg gag gcc tgc tcc tgg 2754 Gln Thr Arg Gln Gln Pro Cys Pro Gly Leu Leu Glu Ala Cys Ser Trp 475 480 485 ggc ccg tgg ggg ccc tgt tcc cgc agc tgc ggc ccg 2802 Gly Pro Trp Gly Pro Cys Ser Arg Ser Cys Gly Pro Gly Leu Ala Ser 490 495 500 cgc tct ggg tcc tgc ccc tgc ctg atg gcc aag gcc gac ccc acc tgc 2850 Arg Ser Gly Ser Cys Pro Cys Leu Met Ala Lys Ala Asp Pro Thr Cys 505 510 515 aac agc acc ttc ctc cac ctg gac acc cag ggc tgc tac tca ggg ccc 2898 Asn Ser Thr Phe Leu His Leu Asp Thr Gln Gly Cys Tyr Ser Gly Pro 520 525 530 tgc cca gag gag tgt gtg tgg ag agc tgg agc agc tgg acg cgc tgc 2946 Cys Pro Glu Glu Cys Val Trp Ser Ser Trp Ser Ser Trp Thr Arg Cys 535 540 545 550 tct tgc cgg gtg ctg gtg cag cag cgc tac cga cac cag ggc ccg Arg2c Leu Val Gln Gln Arg Tyr Arg His Gln Gly Pro Ala 555 560 565 tcc cga ggg gcc agg gca ggc gcc ccc tgc acg cgg ctg gat ggc cac 3042 Ser Arg Gly Ala Arg Ala Gly Ala Pro Cys Thr Arg Leu Asp Gly His 570 575 580 ttc cgg cct tgc ctt atc agc aac tgc tct gag gac agc tgc acg cct 3090 Phe Arg Pro Cys Leu Ile Ser Asn Cys Ser Glu Asp Ser Cys Thr Pro 585 590 595 ccc ttt gag ttc cat gcc tgc ggc tcc ccc tgt gct ggg ctc tgt gcc 3138 Pro Phe Glu Phe His Ala Cys Gly Ser Pro Cys Ala Gly Leu Cys Ala 600 605 610 aca cac ctg agc cat cag ctc tgc cag gac ctg cca ccc tgc cag ccg 3186 Thr His Leu Ser His Gln Leu Cy Gln Asp Leu Pro Pro Cys Gln Pro 615 620 625 630 ggc tgc tac tgc ccc aag ggg ctg ctg gag cag gct ggg ggc tgc att 3234 Gly Cys Tyr Cys Pro Lys Gly Leu Leu Glu Gln Ala Gly Gly Cys Ile c 635 640 gag gag tgt aac tgc tgg cat acc tca gca gca gga gcc ggg 3282 Pro Pro Glu Glu Cys Asn Cys Trp His Thr Ser Ala Ala Gly Ala Gly 650 655 660 atg acc ctg gcc cct ggg gac cgc ctg cag ctg ggc tgt gag ggt 3330 Met Thr Leu Ala Pro Gly Asp Arg Leu Gln Leu Gly Cys Lys Glu Cys 665 670 675 gaa tgc cgg cgt ggg gag ctg cac tgc acc agc cag ggc tgt caa ggt 3378 Glu Cys Arg Arg Gly Glu Leu His Cys Thr Gln Cys Gln Gly 680 685 690 ctt ctg cct ctg agt gag tgg tcc gag tgg tcg ccc tgt ggg ccc tgc 3426 Leu Leu Pro Leu Ser Glu Trp Ser Glu Trp Ser Pro Cys Gly Pro Cys 695 700 705 710 ctg ccg ccc agc gcc tg gcc cct gcc tcc agg act gcc cta gag gag 3474 Leu Pro Pro Ser Ala Leu Ala Pro Ala Ser Arg Thr Ala Leu Glu Glu 715 720 725 cac tgg ctc cga gac cca act ggc ctc tcc ccc acc ttg gcc ccg ctg 3522 His Trp Leu Arg Asp Pro Thr Gly Leu Ser Pro Thr Leu Ala Pro Leu 730 735 740 ctg gct tca gag cag cac cgc cac cgg ctc tgt ctg gat cct gcg aca 3570 Leu Ala Ser Glu Gln His Arg His Arg Leu Cys Leu Asp Pro Ala Thr 745 750 755 ggg agg ccc tgg act gga gcc cct cac ctc tgc acc gca ccc ctc agc 3618 Gly Arg Pro Trp Thr Gly Ala Pro His Leu Cys Thr Ala Pro Leu Ser 760 765 770 cag cag cgc ctc tgc cct gac cct gga gcc cct gac tca tgc cag 3666 Gln Gln Arg Leu Cys Pro Asp Pro Gly Ala Cys Pro Asp Ser Cys Gln 775 780 785 790 tgg agt ctg tgg ggg cca tgg agc ccc tgc cag gtg ccc tgc agt ggg 3714 Trp Ser Leu Trp Gly Ser Pro Cys Gln Val Pro Cys Ser Gly 795 800 805 ggg ttc agg cta cgc tgg aga gag gca gag gcc ctc tgt gga gga ggc 3762 Gly Phe Arg Leu Arg Trp Arg Glu Ala Glu Ala Leu Cys Gly Gly Gly 810 815 820 t gc cgg gag cca tgg gct caa gac aga aag ctg caa cgg agg gcc ctg 3810 Cys Arg Glu Pro Trp Ala Gln Asp Arg Lys Leu Gln Arg Arg Ala Leu 825 830 835 ccc agg tta gag ctg cga ggc cca aga cacgt at gga ctg 3858 Pro Arg Leu Glu Leu Arg Gly Pro Arg His Cys Ile His Pro Gly Leu 840 845 850 tgc caa cca gtg ccc aca cag ctg tgc cga cct ctg gga ccg cgt tca 3906 Cys Gln Pro Val Pro Thr Gln Leu Cys Arg Pro Leu Gly Pro Arg Ser 855 860 865 870 gtg tct gca ggg acc ctg ccg ccc agg ctg ccg ctg tcc ccc tgg cca 3954 Val Ser Ala Gly Thr Leu Pro Pro Arg Leu Pro Leu Ser Pro Trp Pro 875 880 885 gct ggt cca gga tgg gcg ctg tgt gcc gat ctc ctc ttg ccg ctg tgg 4002 Ala Gly Pro Gly Trp Ala Leu Cys Ala Asp Leu Leu Leu Pro Leu Trp 890 895 900 cct ccc cag tgc caa tgc ctc ttg gga gct ggc ccc Prog Gln Cys Gln Cys Leu Leu Gly Ala Gly Pro Gly Pro Gly Gly 905 910 915 gca gct gga ctg cca aaa ctg cac ctg tgt caa cga gtc cct ggt gtg 4098 Ala Ala Gly Leu Pro Lys Leu His Leu Cys Gln Arg Val Pro Gl y Val 920 925 930 ccc aca cca gga gtg tcc agt cct tgg gcc ttg gtc agc ctg gag cag 4146 Pro Thr Pro Gly Val Ser Ser Pro Trp Ala Leu Val Ser Leu Glu Gln 935 940 945 950 ttg ctc ggc ccc ctg tgg tgg cac tat gga gcg aca tcg gac ttg 4194 Leu Leu Gly Pro Leu Trp Trp Gly His Tyr Gly Ala Thr Ser Asp Leu 955 960 965 tga ggggggtcct ggggtggcac catgccaggc ccaggacaca gagcaacggc 4247 aggagtgtaa cctgcagccc tgccctgagt gcccccctgg ccaggtgctt agtgcctgtg 4307 ccacctcatg cccgtgcctc tgctggcatc tgcagcctgg tgccatctgt gtgcaggagc 4367 cctgccagcc tggctgtggc tgccctggag ggcagctgct gcacaatggc acgtgtgtgc 4427 ctcccactgc ctgcccctgc acccagcatt ctctgccctg gggcctcacc ctgaccctgg 4487 aagagcaggc ccaggagctg cccccaggga ctgtgctcac ccggaactgc acccgctgtg 4547 tctgccacgg tggagccttc agctgctccc tcgttgactg tcaggagtgc cccctgggga 4607 aacgtggcag caggtggccc cgggggagct ggggctctgc gagcagacgt gcctggagat 4667 gaacgccaca aagacccaga gtaactgcag ttcagctcga gcctcgggct gcgtgtgcca 4727 gcccgggcac ttccgcagcc aggcaggccc ctgcgtcccc gaagaccact gcgagtgctg 4787 gcaccttggg cgtccccacc tgcctggatc tgaatggcag gaggcctgtg agagctgcct 4847 ctgcctcagt gggaggcctg tctgcaccca gcactgctcc ccactcacct gtgctcaggg 4907 cgaggagatg gtgctggagc cagggagctg ctgtccctct tgccgcaggg aggctccgga 4967 ggagcagtcg ccctcctgcc agctcctcac ggagcttcga aacttcacca aagggacctg 5027 ttacctggac caggtagaag tgagctactg cagtgggtac tgcccatcca gcacccatgt 5087 catgccagag aggtcttctg tggccccaca ccattcccag agtgtgcccg ctgtgccctt 5147 caaggcaatg agccaggagc ccagcaaaga aaggcatgga ggagctaagc tagcctctga 5207 catcagaacc catcacacgg tgcatgagag catgagagct ctgccggaat gcactttcta 5267 cagagaggat caccgcacac atttcctgca agctgtccga gccaggctgg ctctgagtct 5327 tgggcaggtg gctccgctct gcgtttgccc tctgtggacc cagaagcccc tgatccttct 5387 taggatcttc caaggggctc tgtgcccacc ctgactcccc tcagcctgat gagctgtaac 5447 ctgagctgcc tcctgccagg gtcctctctc cagcttcact cacactactc ctgcctgccc 5507 ctaggcccac ctcccagcac tctgcggcca tcccttctgc ttcagcctac ctggtttacc 5567 tcatcctgga agacaaggat actttcctac ctggtcccca aagacacagc ccctca accc 5627 tcggccgctc tacggctccc ccaggcgcgc cctggacctc ctggaaatac tttcccaaat 5687 cactttcgga attttttttc acacttttag aatttttaaa acatagagtg agaaaagaga 5747 gaaagtaatt aagagatgct tttttttttt tcctgaggaa agaaattgat agtgggatac 5807 aaattggagg gaaatttttt cgctgaaaaa cctcttgcag tttttgaacc tggcattgta 5867 tgaatgtact acccatttaa aagtaaaatt ataaatagaa ttatacataa aattaaatga 5927 tatgcttata gg 5939

[Brief description of the drawings]

BRIEF DESCRIPTION OF DRAWINGS FIG. 1 is a view showing an analysis of a tissue expressing the FG06969 gene.

FIG. 2 is a view showing the structure of pcDNA3.1 (−) / FG06969 / MycHis prepared.

FIG. 3 is a view showing the structure of pcDNA3.1 (−) / FG01896 / MycHis prepared.

FIG. 4 shows the structure of plasmid pENTR1A / FG06969 / MycHis.

FIG. 5: Transfer plasmid pDEST8 / FG06969 / M
It is a figure showing the structure of ycHis.

[FIG. 6] SDS / FG06969 / MycHis protein
FIG. 7 shows the results of PAGE (FIG. 6 (a)) and the results of Western analysis using an anti-His-Tag antibody (FIG. 6 (b)). The arrow in the figure indicates the FG06969 protein.

FIG. 7a: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7b: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7c: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7d: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7e: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7f: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7g: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7h: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7i: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7j cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7k: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 71. cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7m: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7n: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7o: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7p: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7q: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7r: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7s: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7t: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7u: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 7v: cDN of FG6969 and FG01896
The A sequence can be obtained from Genom of known AC004877 (GenBank ID).
FIG. 3 is a view showing the results of comparative analysis with an ic DNA sequence.

FIG. 8A is an alignment diagram of FG06969 and FG01896. In the figure, “*” indicates that the amino acids match each other, and “:” indicates that the amino acids do not match. “#” Indicates the range of the assigned domain.

FIG. 8B is an alignment diagram of FG06969 and FG01896. In the figure, “*” indicates that the amino acids match each other, and “:” indicates that the amino acids do not match. “#” Indicates the range of the assigned domain.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 45/00 A61P 9/00 4C085 48/00 9/08 4C086 A61P 9/00 9/10 4H045 9/08 17/00 9/10 19/02 17/00 27/02 19/02 29/00 101 27/02 35/00 29/00 101 43/00 105 35/00 C07K 14/52 43/00 105 16/24 C07K 14/52 C12N 1/15 16/24 1/19 C12N 1/15 1/21 1/19 C12P 21/02 K 1/21 G01N 33/15 Z 5/10 33/50 T C12P 21/02 Z G01N 33/15 33/53 D 33/50 C12P 21/08 C12N 15/00 ZNAD 33/53 A61K 37/02 // C12P 21/08 C12N 5/00 A (72) Inventor Takahiro Nagase 1532 Yana, Kisarazu-shi, Chiba Prefecture No. 3 Inside the Kazusa DeNA Institute (72) Inventor Nobuo Nomura 1532-3 Yana, Kisarazu-shi, Chiba Pref.Kazusa DeNA Research Institute (72) Inventor Kazuhiro Yano 2-5-1, Odani Otani, Hirakata-shi, Osaka Welfido Co., Ltd. Person Koji Murakami 2-5-1, Otani Otani, Hirakata City, Osaka Prefecture Inside the Pharmaceutical Research Laboratories of Wellfide Co., Ltd. (72) Inventor Akiko Kashima 2- 25-1, Ohtani, Hirakata City, Osaka Prefecture Inside the Drug Discovery Laboratory, Wellfide Co., Ltd. (72) Inventor Koji Kazaki 2- 25-1, Invitation Otani, Hirakata City, Osaka Prefecture (72) Inventor Yoshihisa Inoue 2- 25-1, Invitation Otani, Hirakata City, Osaka Prefecture Welphide Co., Ltd. (72) Inventor Masahide Nakajima 2- 25-1, Invitation Otani, Hirakata City, Osaka Prefecture No. Welfay (72) Kenichi Katayama, Inventor Kenichi Katayama 2-5-1, Otani, Hirakata-shi, Osaka Prefecture F-term in Wellphid Co., Ltd. Drug Discovery Laboratory (Reference) AA01 AA11 BA21 BA44 CA04 DA02 DA06 EA02 EA04 GA05 GA11 HA14 HA15 4B064 AG02 AG26 AG27 CA02 CA10 CA19 CA20 CC24 DA01 DA13 4B065 AA26X AA92X AA93Y AB01 AB05 BA02 4C084 AA02 AA07 AA13 AA12 ZA12A22 ZA22A ZB262 ZC752 4C085 AA13 AA14 CC21 DD33 DD86 FF24 GG01 4C086 AA01 AA03 EA16 MA01 MA04 NA14 ZA33 ZA36 ZA39 ZA40 ZA89 ZA96 ZB15 ZB21 ZB26 ZC75 4H045 AA10 AA11 AA20 AE30 FA10

Claims (17)

[Claims] 1. A TSP1 domain-containing polypeptide selected from the following group or a protein having the polypeptide: a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or 3 in the sequence listing; a polypeptide containing the polypeptide A peptide, a polypeptide having at least about 50% amino acid sequence homology with the polypeptide and having at least eight repeats of the TSP1 domain, and a deletion of one to several amino acids in the amino acid sequence of Polypeptide having a mutation such as substitution, addition or insertion, and having eight or more repeats of the TSP1 domain. 2. A partial peptide having a part of the amino acid sequence shown in SEQ ID NO: 1 or 3 in the sequence listing, wherein the peptide has at least about 8 consecutive amino acid sequences. 3. A polynucleotide encoding the polypeptide or peptide according to claim 1 or a complementary strand thereof. 4. A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 or 4 in the sequence listing, or a complementary strand thereof. 5. A polynucleotide that hybridizes under stringent conditions to the polynucleotide according to claim 3 or its complementary strand. 6. A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 or 4 in the sequence listing or a polynucleotide comprising at least about 15 consecutive nucleotide sequences of its complementary nucleotide sequence. 7. A recombinant vector comprising any one of the polynucleotides according to claim 3 or a complementary strand thereof. 8. A transformant transformed with the recombinant vector according to claim 7. 9. The method for producing a polypeptide, protein or peptide according to claim 1, comprising a step of culturing the transformant according to claim 8. An antibody that immunologically recognizes the polypeptide, protein or peptide according to claim 1 or 2. 11. The antibody according to claim 10, which recognizes at least a TSP1 domain-containing polypeptide. 12. A compound which interacts with the polypeptide or protein according to claim 1 and has an action of inhibiting or promoting the activity thereof, and / or interacting with the polynucleotide or the polynucleotide according to claim 3 to 5. A method for screening a compound having an action of inhibiting or promoting its expression, comprising the polypeptide of claim 1 or 2,
A protein or peptide, the polynucleotide according to claims 3 to 6, the vector according to claim 7, or the vector according to claim 7.
A screening method, characterized by using at least one of the transformant according to claim 1 and the antibody according to claim 10 or 11. 13. A compound that interacts with the polypeptide or protein according to claim 1 to inhibit or activate its activity, or interacts with the polynucleotide according to claim 3 to inhibit expression thereof. Or a method for screening a compound to promote, wherein the polypeptide or protein is brought into contact with the compound to be screened under conditions allowing the interaction between the compound and the polypeptide or protein, and the interaction of the compound is evaluated. (Such interaction is associated with a second component that can provide a detectable signal in response to the interaction of the polypeptide or protein with the compound), and then the interaction of the compound with the polypeptide or protein. By detecting the presence or absence of a signal resulting from the action, the compound Or interacting with the protein to determine whether to activate or inhibit its activity. 14. A compound to be screened by the method according to claim 12 or 13, which interacts with the TSP1 domain-containing protein or polypeptide according to claim 1 or 2 to inhibit or promote its activity. A compound or a salt thereof. 15. A compound to be screened by the method according to claim 12 or 13, wherein the compound is screened.
A compound or a salt thereof, which interacts with the polynucleotide of 1 to inhibit or promote its expression. 16. The polypeptide, protein or peptide according to claim 1 or 2, the polynucleotide according to claim 3 to 6, the vector according to claim 7, the transformant according to claim 8, A pharmaceutical composition comprising at least one of the antibody according to claim 10 or 11, or the compound according to claim 14 or 15. 17. A method for diagnosing a disease associated with the expression or activity of the polypeptide or protein of claim 1 in an individual, comprising: (a) a nucleic acid sequence encoding said polypeptide or protein; b) A method comprising analyzing the polypeptide or protein in a sample derived from an individual as a marker.