JP2002078489A - New acid protease with serine residue relating to activity expression - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a gene encoding protease J-4 and kumamolysin, as new acid proteases each of which needs a serine residue for its activity. SOLUTION: This new acid protease contains, as the active region, an amino acid sequence IGGTSAVAPL shown in the 465th to 474th of the sequence No.2 or the 462nd to 471st of the sequence No.4 (See the specification).

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel protease. More specifically, it relates to a novel acidic protease that requires a serine residue for activity. As such acidic proteases, protease J-4 and kumamoricin are disclosed.

[0002]

2. Description of the Related Art Protease is a general term for enzymes that hydrolyze peptide bonds of proteins and peptides, and is important for various physiological actions such as digestion and degradation of proteins, hormone biosynthesis, blood coagulation, and inflammation. Enzyme group. 1960, B.C. S. Hartl
ey proposed to be classified into four groups, serine proteases, cysteine proteases, metal proteases and acid proteases, based on the nature of the residues involved in their activity (Hartley, B. et al.
S. (1960) Ann. Rev .. Biochem. 2
9, 45-72), and this classification is now commonly used. Of these, acidic proteases were
The catalytic residues were unknown because, for example, no effective inhibitors could be obtained, and they were grouped together only with the commonality of having an optimal pH in the acidic region. Against this background, Murao et al. (Murao, S. and S.
atoi, S .; (1979) Agric. Biol. C
hem. , 34, 1265-1267), believe that a specific inhibitor is effective in elucidating the catalytic mechanism of an enzyme, and searched for a substance that specifically inhibits an acidic protease.
Streptomyces naniwaensis in the year
Inhibitor S-PI (acetyl peps)
tatin). S-PI inhibited all acidic proteases known at that time, including pepsin. At the same time, the synthetic inhibitor DAN (diazo)
acetyl-DL-norleucine meth
ylester) and EPNP (1,2-epoxy-3)
-(P-nitrophenoxy) propane)
Was developed. Studies using these inhibitors have revealed that there are two aspartic acid-derived carboxyl groups modified by DAN and EPNP in the active center of acidic protease. At present, these acidic proteases are called aspartic proteases.

[0003] Aspartic proteases include enzymes derived from animals such as pepsin, renin, chymosin and cathepsin D, and enzymes derived from microorganisms such as penicillopepsin and mucorrennin, and are widely distributed in nature.
Also, the primary structure of these enzymes is about 4
Has 0% homology. In particular, it has been shown that the structure near the catalytic residue is conserved regardless of its origin, and that the tertiary structure also has a very similar structure. Against this background, Oda and Murao have noted that S-PI inhibits aspartic protease without exception and is a substrate analog. If a protease that is not inhibited by S-PI is found, it is considered to be a unique enzyme having a different substrate specificity from the conventional aspartic protease and a different active center structure. Based on such an original idea, a search for an acidic protease that is not inhibited by S-PI was performed on microorganisms.
fractionation of acidic proteases A, B, and C produced by Ytalidium lignicolum (Murao, S .;
Et al. (1972) Agric. Biol. Chem. 3
6, 1647-1650). These enzymes not only differed in the behavior with respect to the inhibitor, but also showed a marked difference in substrate specificity as compared with the conventional acidic protease. In particular, the primary structure of the B enzyme is not homologous to known aspartic proteases and has a common active center amino acid sequence (-Asp * -Thr-Gly-, A
(sp: catalytic residue) does not exist. Then, Asperg
genus illus, basidiomycetes, genus Pseudomonas (Pseudomonapepsin), Xantho
genus monas (Xanthomonapepsin),
Bacillus genus (Kumamolysin
sin), Protease J-
Related enzymes have been reported one after another from bacteria such as 4).
Furthermore, in 1997, from human brain, Pseudom
onappesin and Xanthomonapep
A CLN2 gene product (CLN2) having high homology to the primary structure of sin and having protease activity and tripeptidyl aminopeptidase activity was discovered. This has revealed that these pepstatin-insensitive carboxyl proteases (PI-CP) are widely distributed in nature from microorganisms to mammals.

[0004] In consideration of the use of PI-CP in the field of food industry, search for alcohol-resistant PI-CP was carried out.
Bacillus coagul by Ozaki et al. In 1990
Ans J-4 strain was isolated (Akira Ozaki et al., Published Patent Application (JP-A-5-212869)). Protease J-4 produced by this bacterium is 3% in the presence of 20% ethanol.
It was stable at 0 ° C. and pH 5.0 for at least 30 days, and exhibited unique properties such as being not inhibited by pepstatin, S-PI, DAN, EPNP and the like. This protease J-4 is a drug such as a digestive enzyme, or
The use of ethanol as a preservative for protein hydrolysis in foods can be expected.

For the purpose of expanding the use of PI-CP, heat-resistant P
A search for I-CP was conducted, and in 1988, Murao et al.
acillus novosp. The MN-30 strain was isolated (Murao, S. et al. (1988) Agric.
Biol. Chem. , 52 (6) 1629-163.
1). Kumamoricin produced by this bacterium is stable for 24 hours at optimal reaction conditions of pH 3.0, 70 ° C., or 50 ° C., pH 2 to 5, and contains pepstatin, SP-I, D
It showed a unique property not inhibited by AN and EPNP. This bear molysin can be expected to be used in food processing fields at high temperatures.

[0006]

SUMMARY OF THE INVENTION The present invention provides a novel acid protease gene. The present inventors have performed gene cloning of protease J-4, which is an ethanol-resistant PI-CP, and kumamoricin, which is a thermostable PI-CP, and have characteristics of these proteases, that is,
The present inventors have clarified the important property that serine residues are important for the catalytic function while being an aspartic protease, and have completed the present invention.

[0007]

According to the present invention, the active region is represented by positions 465 to 474 of SEQ ID NO: 2 or SEQ ID NO: 4
Amino acid sequence IGGT shown at positions 462 to 471 of
Novel acidic proteases, including SAVAPL, are provided.

[0008] Preferably, the protease is a novel acidic protease according to claim 1, which has the amino acid sequence shown in SEQ ID NO: 2 and has an alcohol-resistant protease activity.

Preferably, the protease is a novel acidic protease according to claim 1, which has the amino acid sequence shown in SEQ ID NO: 4 and has a thermostable protease activity.

[0010] Preferably, the protease is a novel acidic protease in which a serine residue is involved in the expression of activity.

[0011] Preferably, the protease is a novel acidic protease that is insensitive to pepstatin and thyrostatin.

Further, the present invention relates to a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 2, or a polynucleotide encoding an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence. And a polynucleotide comprising:

[0013] Preferably, the polynucleotide is a polynucleotide comprising the polynucleotide shown in SEQ ID NO: 1.

[0014] The present invention also relates to a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 4, or a deletion of one or several amino acids in the amino acid sequence.
Provided are polynucleotides, including polynucleotides encoding the substituted or added amino acid sequences.

[0015] Preferably, the polynucleotide is a polynucleotide comprising the polynucleotide shown in SEQ ID NO: 3.

[0016]

DETAILED DESCRIPTION OF THE INVENTION In the present invention, an ethanol-resistant PI
-Protease J-4 which is CP, and thermostable PI-
Perform the gene cloning of CP, Kumamoricin,
We clarified the primary structure and tried to construct a high expression system for industrial use.

According to the present invention, there is provided a novel protease useful in various industrial applications, particularly for use in pharmaceuticals such as digestive enzymes or protein hydrolysis in foods, and a gene encoding the protease. . The protease of the present invention comprises, as an active region, positions 465 to 474 of SEQ ID NO: 2 or positions 462 to 4 of SEQ ID NO: 4.
It is a novel acidic protease containing the amino acid sequence IGGTSAVAPL shown at position 71.

The present invention further relates to a variant of the nucleic acid molecule of the present invention, which encodes a novel acidic protease protein, analog or derivative thereof. Variants such as natural allelic variants can occur naturally. By "allelic variant" is intended one of several alternative forms of a gene occupying a given locus on the chromosome of an organism. Genes II, Lewin,
B. Hen, John Wiley & Sons, New Y
ork (1985). Non-naturally occurring variants can be generated using mutagenesis techniques known in the art.

Such variants include those produced by nucleotide substitutions, deletions or additions. The substitutions, deletions, or additions can include one or more nucleotides. Variants can be altered in the coding region, non-coding region, or both. Changes in the coding region can be conservative or non-conservative amino acid substitutions,
Deletions or additions can occur. Particularly preferred among these are silent substitutions, additions and deletions,
They do not alter the properties and activities of Protease J-4, or Kumamoricin protein, or portions thereof. Also particularly preferred in this regard are conservative substitutions.

The polynucleotide encoding the novel acidic protease gene of the present invention has at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 2 or 4 as long as it can have the same activity as this enzyme. Is at least 85% sequence identity, more preferably at least 90% sequence identity, even more preferably at least 95% sequence identity, most preferably at least 99%
And polynucleotides having the sequence identity of The term "sequence identity" means that the two compared polynucleotide sequences are the same, and the percentage sequence identity between the two compared polynucleotide sequences is
After optimally aligning the two polynucleotide sequences to be compared, the same nucleobase (eg, A, T, C, G,
U, or I) occurs in both sequences to obtain the number of matched positions, giving the number of matched positions, dividing the number of matched positions by the total number of comparison polynucleotides, and multiplying the result by 100 You. Sequence identity can be calculated, for example, using the following tools for sequence analysis: Unix-based GC
G Wisconsin Package (Progr
am Manual for the Wiscons
in Package, Version 8, September 1994, Genetics ComputerGrou.
p, 575 Science Drive Madis
on, Wisconsin, USA 53711; Ric
e, P. (1996) ProgramManual f
or EGCG Package, Peter Ric
e, The Sanger Center, Hinxt
on Hall, Cambridge, CB10 1R
Q, England) and the ExPASy W
old Wide Web server for molecular biology (G
eneva University Hospital
and University of Genev
a, Geneva, Switzerland).

The names used herein below, and the laboratory procedures described below, use procedures that are well known and commonly used in the art. Standard techniques are used for recombinant methods, polynucleotide synthesis, and microbial culture and transformation (eg, electroporation). This technique and procedure are generally described in the art and in various general references provided throughout this specification (typically, Sambrook et al., Mo.
rectangular Cloning: A Labora
tory Manual, 2nd edition (1989) Col
d Spring Harbor Laborator
y Press, Cold Spring Harbo
r, N.R. Y. )checking. These are incorporated herein by reference.

The polynucleotide of the present invention is typically obtained according to the method described herein, but can also be obtained by chemical synthesis based on the sequence disclosed in the present invention. For example, a polynucleotide of the present invention may comprise Appli.
It can be synthesized using the ed Bio Systems polynucleotide synthesizer according to the specifications provided by the manufacturer.

Methods for PCR amplification are well known in the art (PCR Technology: Principl).
es and Applications for D
NAAmplification, HA Erlich
Hen, Freeman Press, New York, N
Y (1992); PCR Protocols: AG
uide to Methods and Appli
nations, Innis, Gelland, Sn
isky and White, Academic P
Res, San Diego, CA (1990); M
attila et al. (1991) Nucleic Acid.
s Res. 19: 4967; Eckert, K .; A.
And Kunkel, T .; A. (1991) PCR M
methods and Applications
1:17; PCR, McPherson, Quirke
s, and Taylor, IRL Press, Oxf
ord). These are incorporated herein by reference.

[0024]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below with reference to embodiments.
The following examples illustrate the present invention, and the present invention is not limited to the following examples.

Example 1 Cloning of Protease J-4 Gene Method of Oda et al. (Satoshi Ito, Bacill)
alcohol-protease produced by C. us coagulans J-4, a protease J-4 purified according to Kyoto Institute of Technology, Faculty of Textile Science, 1997 graduation thesis)
SDS-PAGE was performed. Zalto Blot II-S
(Sartorius) at room temperature, 90 mA, 9
Under the condition of 0 minutes, Polyvinylidene fl
The proteins were transferred from the gel to a uoride (PVDF) membrane. This PVDF membrane is used for Coomassiebri.
The membrane fraction containing the protease J-4 band was cut out by staining with lliant blue R-250 and used as a sample for amino acid sequence analysis.

Then, after carboxyl methylation of protease J-4, 0.1 M Tris-HC containing 3 M urea was used.
After dissolving in 1 buffer, pH 9.0, lysyl endopeptidase (1 μg) or trypsin (1 μg) was added, and reacted at 37 ° C. for 27 hours. The resulting degraded peptide was applied to an anhydrotrypsin agarose column, and the peptide contained in the non-adsorbed fraction was separated and purified by reverse phase (C18) HPLC. The separation conditions were a linear gradient of 1 to 40% acetonitrile (60 min) containing 0.1% trifluoroacetic acid at a flow rate of 0.5 ml / min. 22
While monitoring the peptide by absorption at 0 nm, each peak fraction was collected, lyophilized, and then subjected to a peptide sequencer (Perkin Elmer model 476A).
The amino acid sequence was analyzed using a protein sequencer.

Bacillus coagulans
The cells of the J-4 strain (equivalent to 30 ml of culture solution) were suspended in 11.5 ml of TE buffer, 60 μl of 10 mg / ml proteinase K and 0.5 ml of 10% SDS were added, and the mixture was incubated at 37 ° C. for 3 hours. . After extraction with an equal volume of a TE-saturated phenol / chloroform solution, 10 mg /
Add 1/500 volume of ml RNase A, and add 1
Warmed for hours. After centrifugation, transfer the aqueous layer to a new container,
Extracted again with TE-saturated phenol / chloroform. 1/10 volume of 3M sodium acetate and 0.6 volume of isopropanol were slowly added to the aqueous layer obtained by centrifugation, and the chromosomal DNA appearing at the interface was wound up with a glass rod. 70
After rinsing twice with% ethanol, it was dissolved in 5 ml of TE buffer to obtain a chromosomal DNA solution.

The following four primers were synthesized based on the amino acid sequence of the peptide fragment of protease J-4 obtained above.

Primer J4-P1 5'-CAG G
TG GCG TAC ACG CCG CCG CA
-3 '(SEQ ID NO: 5) Primer J4-P2 5'-C GCG CCGA
AC ACG GACGCC GGC TT-3 ′ (SEQ ID NO: 6) Primer J4-P2R 5′-A GCC GGC
GTC CGT GTT CGG CGC GA-3 '
(SEQ ID NO: 7) Primer J4-P3R 5′-T GCC CGC
GAT GTC GTT GTT GCC CT-3 '
(SEQ ID NO: 8) The synthesis was performed on a 40 nmol scale by Kikkotec Corporation.
Asked.

The PCR reaction was performed using J4-P1 and J4-P
2R, J4-P1 and J4-P3R, and J4-
Using a combination of P2 and J4-P3R primers, in a total volume of 100 μl, 0.4 μg of the above prepared J-4 chromosomal DNA solution, 40 pmole of each primer, 80 μM of dNTPs, 1 × PCR buffer, 1. 5m
The following PCR conditions with a reaction solution composition of M MgCl ₂ : 9
After preheating at 5 ° C. for 5 minutes, 10 U of Stoffel fragment is added, 30 cycles of 94 ° C. for 45 seconds, 58 ° C. for 60 seconds, 70 ° C. for 90 seconds, and a further 72 hours.
Heating was performed at 7 ° C. for 7 minutes to amplify the target DNA fragment.

The PCR fragment was used for Geneclean II
After purification with the kit, both blunt ends were phosphorylated using Klenow fragment and T4 polynucleotide kinase and inserted into the HincII site of pUC19. This plasmid is used for E. coli. coli JM109 strain was transformed.

The nucleotide sequence was analyzed by the dideoxy method using a plasmid as a template. Taq polymerase was used for the extension reaction, and the reaction product was analyzed using a DNA sequencer (Perkin Elmer model 373A).
DNA sequencer) was used. The amino acid sequence deduced from the base sequence of the PCR amplified fragment contained a partial sequence of protease J-4.

Example 2 Cloning of Full-length Protease J-4 Gene
After digestion with all, 1% agarose electrophoresis (1 × TB
(In E buffer). About 2 kb including J-4 gene
The EcoRI fragment and the SalI fragment of about 4 kb were cut out with a cutter knife and purified using a Geneclean II kit. At the same time, pUC19 was digested with EcoRI and SalI, respectively, and purified in the same manner. The insert DNA and pUC19 were mixed at a 2: 1 molar ratio, 0.5 volume of Ligation high was added, and the mixture was reacted at 16 ° C. for 1 hour. E. coli was prepared using this reaction solution.
coli JM109 strain was transformed to prepare a gene library.

JM109 containing this gene library
Was cultured at 37 ° C. for 16 hours on a plate containing ampicillin (5 μg / ml), and colony hybridization was performed by a standard method. The PCR amplified fragment described above was used as a DIG label detection kit (DIG DNA Lab).
Using a kit labeled with a ling and Detection kit, Boehringer Mannheim, 1093657) as a probe, a target clone was screened using this kit. EcoR of about 2 kbp
Clones (pJ4E3 and pJ4S1) having the digested fragment of I and the SalI digested fragment of about 4 kbp were obtained. From the obtained restriction enzyme maps of both fragments, there is an EcoRI site immediately upstream of the mature enzyme, and the full-length protease J-
The four genes were found to be present over both of these fragments.

Each plasmid was digested with various restriction enzymes based on the restriction enzyme maps of pJ4E3 and pJ4S1.
Next, the obtained fragment was purified with a Geneclean II kit and subcloned into pUC18. Using each subcloned plasmid as a template, -21M13
primer and M13 Reverse Pri
Sequencing reactions were performed using primers in both directions of the mer. For analysis of the nucleotide sequence, use Perkin Elmer
Model 373A DNA Sequencer
Was used. The nucleotide sequence of the obtained full length J-4 is shown in SEQ ID NO: 1. The protease J-4 gene has a 1677 bp
And the presence of a 191 residue prepro region and a 368 residue mature enzyme region was inferred from the N-terminal amino acid sequence of the wild-type enzyme. The molecular weights of the prepro-form and the mature enzyme deduced from the nucleotide sequences were 57,801 and 37,05, respectively.
2 was calculated.

The amino acid sequence of the mature enzyme of protease J-4 has 69% homology with that of kumamoricin, Pse
It showed 35% homology with that of udomonappepsin. At the DNA level, the homology was 68% with kumamoricin and 31% with Peudomonappepsin. In addition, Pseudomonapep
Asp170 and Asp328 identified as catalytic sites of sin, and Xanthomonapes
Asp169 and A identified as catalytic sites in
Residues corresponding to sp348 (Asp165 and Asp165
319) was also conserved in protease J-4 (FIG. 2).

(Example 3 Construction of Expression System for Protease J-4 Gene in Escherichia coli) Based on the results of the entire J-4 nucleotide sequence analyzed above, an EcoRI site was placed on the N-terminal side and a EcoRI site was placed on the C-terminal side. Are primers having introduced a HindIII site (sense primer: 5′-CGC GAA TT
CATG GAT CAG CAG GTA TT-
3 '(SEQ ID NO: 9), antisense primer: 5'-
TTT AAG CTT CGC ATC CAAG
CG AGT GG-3 ′ (SEQ ID NO: 10) was synthesized. PCR was performed using chromosomal DNA (0.5 μg), sense primer (20.5 pmol), antisense primer (20.1 pmol), dNTP (0.16 m
M) In a total volume of 100 μl reaction solution containing 1 × KOD buffer, heat shock was applied at 96 ° C., and then 5 U KOD
Add DASH DNA polymerase and add the following PC
R conditions: 30 cycles of 96 ° C. for 1 minute, 62 ° C. for 30 seconds, 74 ° C. for 3 minutes, and further extension reaction at 74 ° C. for 5 minutes.

This PCR product was used for Geneclean II
Kit purification and HindIII digestion followed by further EcoRI digestion. From this reaction product, the desired
After purification of the bp DNA fragment, it was inserted into pUC18 and the resulting plasmid was named pUJ4. After preparing a gene fragment of protease J-4 from pUJ4, pKK223
-3 to obtain pKJ4.

One colony of the Escherichia coli JM109 strain carrying the pKJ4 strain was transferred to 2 m of LB liquid medium containing ampicillin.
1 and incubating overnight at 30 ° C. and 120 rpm with shaking. Diluted with sterile water so that A660 becomes about 1.0,
1 ml of Super rich containing ampicillin
The cells were inoculated into 100 ml of medium (ampicillin, 50 μg / ml). In a shaking culture at 30 ° C. and 120 rpm, A66
0 was cultured to about 0.5, and 0.1 ml of 1M IPTG was added.
(1 mM final concentration) was added to the culture. After shaking culture for 5 hours, a cell lysate was prepared by a conventional method. The obtained lysate was diluted with a 5-fold amount of 50 mM sodium acetate, pH 4.7, and activated at 25 ° C. for 4 hours. Also,
The protease activity was measured by the casein-forin method.

In order to examine the culture conditions, the recombinant bacterium precultured in an LB medium containing ampicillin was diluted with sterilized water so that the A660 became about 1.0.
100 ml of LB, 2 × YT, Super-ri
ch, M9- medium (ampicillin, 50 μg / m
l), inoculated at 25 ° C., 30 ° C., and 37 ° C., 12
Shaking culture was performed under the condition of 0 rpm. A660 is about 0.5
At which point, add 100 μl of 1M IPTG,
Induction of the enzyme was started. Five hours later, the cells were collected to prepare a cell suspension. The obtained lysate was activated under the same conditions as above. The culture condition of LB medium and 30 ° C. was the best.

The crushed cell suspension prepared under the above conditions was adjusted to pH
PH 3.7, pH 4.7, pH 5.7 and 4 ° C.
The optimum activation conditions were examined by combining the temperatures of 25 ° C. and 37 ° C. The activation time was 4 hours. The obtained enzyme solution was subjected to SDS-PAGE and Western blotting to analyze the yield of the target protein. Protease J-4 is biosynthesized as a 62 kDa precursor protein,
It had been processed to 5 kDa. Furthermore, the enzymatic activity of the sample subjected to the activation treatment was measured by the casein-Folin method to evaluate the activation conditions. Activation of the enzyme
It showed the highest enzyme activity under the conditions of pH 3.7 and 30 ° C. However, the optimal pH of protease J-4 (pH 3.
0), Western blotting and SDS-PA
The results of GE suggested that the self-decomposition was severe.
At pH 5.7, most of the enzyme remained in the prepro-form. This is probably because the mature enzyme was not processed due to the deviation from the optimum pH. pH 4.7
The enzyme activity was high at any temperature, and a high signal was obtained by Western blotting. At 4 ° C., a contaminant protein band appears on the polymer side,
This protein is not present at 25 ° C. From the above results, the present inventors have concluded that 25 ° C. and pH 4.7 are the optimal conditions.

Escherichia coli holding pKJ4 was cultured in 2 L of LB medium, and the resulting cells having a wet weight of about 11 g
After suspending in 50 ml of 50 mM phosphate buffer, pH 6.5, the suspension was sonicated. The cell debris was removed by centrifugation, and the supernatant was added to a 5-fold volume of 50 mM sodium acetate buffer, pH 4.0.
7 was added and activated at 37 ° C. for 4 hours. The enzyme solution after the activation treatment was subjected to DEAE Sepharo equilibrated with 50 mM sodium acetate buffer, pH 4.8.
It was adsorbed on a se CL-6B column (3.2 x 10 cm in diameter). After washing the column with the same buffer, protease J-
4 was eluted with a linear gradient from 0 M to 0.5 M NaCl concentration. The active fraction was centrifugally filtered (Amicon
After concentration with CF-25), gel filtration was performed on a Sephadex G-75 column equilibrated with a 50 mM sodium acetate buffer containing 0.15 M NaCl, pH 4.8, to obtain a purified preparation of protease J-4. The purified sample shows ethanol tolerance, and its molecular weight is determined by SDS-PAG.
E was calculated to be 45 kDa.

Example 4 Modification of Asp and Ser Residues Conserved in Kumamoricin and Protease J-4 Kumamoricin and protease J-4 include Pseudomonappepsin and Xant
The catalytic residues identified by homomonappinsin, two Asp residues, and the catalytic residue sequence -Gly-X-Ser- of a serine protease represented by subtilisin and the like are conserved. Ala variants of these residues were prepared by site-directed mutagenesis, and their respective enzyme activities were measured.

(Preparation of Modified Asp Residue and Ser Residue of Kumamoricin) (Modified Asp Residue) Cloning of the kumamoricin gene was carried out in the same manner as described in Examples 1 to 3 for protease J-4. The obtained gene was used in the following experiments.

A sense primer (S3) into which an EcoRI site has been introduced, an antisense primer (A1) into which a HindIII site has been introduced, and a primer in both directions at sites containing Asp residues of interest (Asp164 and Asp316 of the mature enzyme). Was chemically synthesized, and a mutant gene was prepared by a PCR method using the kumamoricin gene as a template. The method for modifying the gene is shown in FIG. 3, and the sequence of each primer is shown below. (1) 5'-TTTTGAATTC ATG AGCGACA
TGGAGAA-3 ′ (Sense primer downstream from Met; S3 (SEQ ID NO: 11)) (2) 5′-TTT AAGCTT GTGGCGCTAC
TATAGCA-3 '(Antisense primer having a HindIII site introduced at the 3'end; A1 (SEQ ID NO: 12)) (3) 5'-GCGGCGGGGC GCC AGCGGGAT
C-3 ′ (Sense primer for mutating Asp164 to Ala: D164A-S (SEQ ID NO: 13)) (4) 5′-ATCCGCT GGC GCCCGCCGC
C-3 ′ (Antisense primer that mutates Asp164 to Ala; D164A-AS (SEQ ID NO: 14)) (5) 5′-GAGGTGTTTCAC GCG ATCA
CCGAG-3 ′ (sense primer that mutates Asp316 to Ala; D316A-S (SEQ ID NO: 15)) (6) 5′-TCGGTGAT CGC GTGAAACA
CCTCC-3 ′ (Antisense primer for mutating Asp316 into Ala; D316A-AS (SEQ ID NO: 16)) Each fragment amplified by the PCR method was used to obtain EcoRI and Hind.
After digestion with III, the plasmid was integrated into the expression vector pKK223-3, and Escherichia coli JM109 was transformed (KumaD).
164A, KumaD316A). The enzyme activity was measured by the casein-forin method, and the mutation was confirmed by analyzing the nucleotide sequence.

No protease activity was observed in KumaD164A, while KumaD316A was about 3% active per 1 g of wet weight of bacterial cells as compared to wild-type recombinant kumamoricin. From these results, Asp164
And Asp316 were suggested to be involved in the catalytic mechanism of kumamoricin. (Variant of Ser residue) Focusing on the SalI site about 300 bp upstream of Ser278, a sense primer including this site, an antisense primer having a HindIII site introduced at the 3 ′ end, and a Ser residue were identified. The primer in both directions is chemically synthesized at the site including
Mutant genes were prepared by the R method. The method of constructing the modified gene was performed according to FIG. The sequence of each primer is shown below. (1) 5'-CTGTACACC GTCGAC TTTC
C-3 '(sense primer containing SalI site; S
al-S (SEQ ID NO: 17)) (2) 5′-TTT AAGCTT GTGGCGCTAC
TATAGCA-3 '(Antisense primer having a HindIII site introduced at the 3'end; A1 (SEQ ID NO: 18)) (3) 5'-ATCGGCGGGACG GCC GCCG
T-3 ′ (sense primer that mutates Ser278 to Ala; S278A-S (SEQ ID NO: 19)) (4) 5′-GGC GGC CGTCCCGCCGATG
A-3 ′ (Antisense primer that mutates Ser278 to Ala; S278A-AS (SEQ ID NO: 20)) The fragment amplified by the PCR method is SalI and HindII.
After digestion with E.I, the plasmid was integrated into the expression vector pKK223-3 and E. coli JM109 strain was transformed (KumaS2
78A). The enzyme activity was measured by the casein-forin method, and the mutation was confirmed by analyzing the nucleotide sequence.

No protease activity was observed in KumaS278A, which revealed that Kumamoricin Ser278 is involved in the catalytic mechanism.

(Asp residue of protease J-4 and S
Preparation of modified er residue) (Modified Asp residue and Ser residue) Sense primer (J4-F) introduced with EcoRI site, Hind
An antisense primer (J4-
R) and desired Asp and Ser residues (Asp165, Asp319, Ser279 of mature enzyme)
The primers in both directions were chemically synthesized at the site containing, and a mutant gene was prepared by the PCR method using the protease J-4 gene as a template. The method of constructing the modified gene was performed according to FIG. The sequence of each primer is shown below. (1) 5'-CGCGAATTC ATG GATCAGC
AGGTTATT-3 '(Sense primer downstream from Met; J4-F (SEQ ID NO: 21)) (2) 5'-TTT AAGCTT CGCATCCAAG
CGAGTGG-3 ′ (Antisense primer having a HindIII site introduced at the 3 ′ end; A1 (SEQ ID NO: 22)) (3) 5′-CGGG GCC AGCGGATCCACA
GAT-3 '(sense primer for mutating Asp165 to Ala: D165-S (SEQ ID NO: 23)) (4) 5'-CTGTTGGATCCGCT GGC CCC
GGC-3 ′ (Antisense primer that mutates Asp165 to Ala; D165-ASS (SEQ ID NO: 2
4)) (5) 5'-GCATTTCGC GCC ATTACAC
AGGGCA-3 ′ (sense primer that mutates Asp319 into Ala; D319-S (SEQ ID NO: 25)) (6) 5′-CCTGTGTAAT GGC GCGAAA
TGCCTG-3 ′ (Antisense primer that mutates Asp319 into Ala; D319-ASS (SEQ ID NO: 26)) (7) 5′-CAATTGGTGGGGACG GCT GC
CGTG-3 '(sense primer that mutates Ser279 to Ala; S279-S (SEQ ID NO: 27)) (8) 5'-CGGC AGC CGTCCCACCAAT
TGCC-3 ′ (Antisense primer that mutates Ser279 to Ala; S279-AAS (SEQ ID NO: 2
8)) Each fragment amplified by the PCR method was subjected to EcoRI and Hind.
After partial digestion with III (there was one EcoRI site in the J-4 gene), it was incorporated into the expression vector pKK223-3 and transformed into Escherichia coli JM109 (J-4D).
319A, J-4 S279A). The enzyme activity was measured by the casein-forin method, and the mutation was confirmed by analyzing the nucleotide sequence. Asp165Ala variants could not be constructed.

J-4 D319A and J-4 S279A
Has no protease activity, and Asp319 and S
er279 was suggested to be involved in the catalytic mechanism of protease J-4.

Table 1 summarizes the results of the activity measurements of the mutant enzymes. AspI indicates a conserved aspartic acid residue on the N-terminal side, and AspII indicates a conserved aspartic acid residue on the C-terminal side. In Kumamoricin and Protease J-4,
The mutant enzyme in which the conserved serine residue was mutated to alanine had no activity, suggesting that this serine residue is essential for activity. These mutants did not show the processing observed with the wild-type enzyme due to the lack of enzymatic activity, even after the activation treatment with acid (FIG. 5). On the other hand, Pseudo which is another PI-CP
omonappepsin and Xanthomonapep
For sin, the activity was not affected even if the corresponding serine residue was mutated.

[0051]

[Table 1] The above examples illustrate various aspects of the present invention and illustrate how certain oligonucleotides of the present invention can be made and utilized. It does not limit the scope of the invention.

[0052]

One advantage of the present invention is the industrial use of the novel protease of the present invention. As industrial protease, liquid products are generally distributed, but all conventional products are inactivated by heat or autolysis during storage,
There was a problem with the storage stability as an enzyme product. On the other hand, it has been confirmed that protease J-4 and kumamoricin in the present invention have high storage stability in a liquid state, and this problem is solved. Also, in addition to that, alcohol tolerance,
From the viewpoint of heat resistance, specifically, for example, application to a steak sauce addition and a sake fining agent (slagging agent) is expected. Conventionally, papain has been used as a protease for adding steak sauce, but it has been a problem that the effective period of the enzyme is as short as several months. The effective activity retention period of protease J-4 or kumamoricin in the steak sauce is 8 months to 1 year, which can significantly improve the conventional problems. In addition, persimmon astringent and acid proteases, which are currently the mainstream sizing agents, are inactivated when added before burning, so they must be added by opening the tank once during storage after burning, which may lead to the risk of bacterial contamination. Accompanied. But,
Protease J-4 and Kumamoricin can be added with an enzyme before burning due to their alcohol resistance or heat resistance, and are expected to have an effect of aseptically removing scum.

Another effect of the present invention is to use the protease of the present study to elucidate the mechanism that the protease plays in vivo. Proteases are not only known in the body, such as the production of hormones from hormone precursors in cells, the limited cleavage of active peptides and inactivation of proteases, as well as the known biological control and regulatory mechanisms of proteases, Communication, division,
In recent years, it has been clarified that it is involved in proliferation, cell cycle, fertilization, apoptosis and the like. with this,
In recent years, new proteases have been discovered one after another by the introduction of molecular biological techniques. Aspartic proteases are no exception, and the discovery of a new group of aspartic proteases having a serine residue in the active center according to the present invention will greatly affect the progress of future research. Specifically, for example, Batten's disease (Ba), which is a genetic disease that causes cerebral neuronal degenerative disease in children,
(ten's Disease) is known to be caused by a mutation or deletion of the CLN2 gene. In the future, protease J-4 including CLN2 gene
By analyzing the three-dimensional structure of
It is expected to be applied to the development of new drugs and gene therapy.

[0054]

[Sequence List] SEQUENCE LISTING <110> Daiwa Kasei Kabushiki Kaisha <120> Novel genes encoding Carboxyl Protease which requires Ser residue for activity <130> <140> JP <141> 2000-09-04 <160> 28 <170> PatentIn Ver. 2.1 <210> 1 <211> 2013 <212> DNA <213> Bacillus coagulans <220> <221> CDS <222> (124) .. (1803) <220> <223> Description of Artificial Sequence: synthesized <400> 1 cgggaagatg gagaaaaagc ggatttttcg cccgatccag gggacaacca aatgtatcca 60 tgctatactg accgtgaacc cgtcgcactc tctacactct cgctcgaatt ggagatgatg 120 tgt atg gat cag cag gta ttg gca n Gag Asca G g Asca G g Asg Gca Gg Asca 1 5 10 15 agc cac ttt gtc ccg tta cct ggg cat gtc cgg ccg ctc gcg gct ggc 216 Ser His Phe Val Pro Leu Pro Gly His Val Arg Pro Leu Ala Ala Gly 20 25 30 gcg acg gat gtc ggg cca gcg gat ccc gac gag cgc gta tcc gtc aca 264 Ala Thr Asp Val Gly Pro Ala Asp Pro Asp Glu Arg Val Ser Val Thr 35 40 45 ctc gta ttg cgg cgg cgt tcg cct gag caa ctg gaa gcg acg att gag 3 12 Leu Val Leu Arg Arg Arg Ser Pro Glu Gln Leu Glu Ala Thr Ile Glu 50 55 60 tca tta caa tcg ttg ccg ccc agc caa cgc agg cat ctc aca cac gac 360 Ser Leu Gln Ser Leu Pro Pro Ser Gln Arg Arg His Leu Thr His Asp 65 70 75 gag ttt gct gtt cgc cac ggc gcc gat tcg cag gat atc gag aag gta 408 Glu Phe Ala Val Arg His Gly Ala Asp Ser Gln Asp Ile Glu Lys Val 80 85 90 95 cgg gca ttc gcc gat gcg cac ggg ctg gtg ctg gag aag gtg cac gtc 456 Arg Ala Phe Ala Asp Ala His Gly Leu Val Leu Glu Lys Val His Val 100 105 110 gca gct ggc acg gca ttg ctt acg ggc cgt gta gcc gat gtg aat cag 504 Ala Ala Gla Ala Leu Leu Thr Gly Arg Val Ala Asp Val Asn Gln 115 120 125 gcg ttt cgg atc gat ctt cgc acg tat caa cat cct gag ttc tcg tat 552 Ala Phe Arg Ile Asp Leu Arg Thr Tyr Gln His Pro Glu Phe Ser Tyr 130 135 140 cgg gga cac agc ggc gat gtg cat gtg ccg atg gac atc gct gac gtg 600 Arg Gly His Ser Gly Asp Val His Val Pro Met Asp Ile Ala Asp Val 145 150 155 gtg acg gcg gta ctt ggt ctc gat aca cgg ccg cag act cca cac 648 Val Thr Ala Val Leu Gly Leu Asp Thr Arg Pro Gln Ala Thr Pro His 160 165 170 175 ttt cga att cgg cga caa cct gcg ggg gcg gcg atg cgc gcc aca gca 696 Phe Arg Ile Arg Arg Gln Pro Ala Gly Ala Ala Met Arg Ala Thr Ala 180 185 190 act gaa cag gtt gcc tac acg ccg cca cag gtt gca gcg gcc tat gcc 744 Thr Glu Gln Val Ala Tyr Thr Pro Pro Gln Val Ala Ala Ala Tyr Ala 195 200 205 ttt ccg gaa aac gtc gat tgt acg ggg cag tgt atc ggc atc att gag 792 Phe Pro Glu Asn Val Asp Cys Thr Gly Gln Cys Ile Gly Ile Ile Glu 210 215 220 ctt ggc ggt ggg tat tca gat caa aat atc ggc gag tat ttc gcg tca 840 Gly Gly Tyr Ser Asp Gln Asn Ile Gly Glu Tyr Phe Ala Ser 225 230 235 ctt ggt atg gcg ccg cca cct ctt gtt gcg gta ggg gta gat gga gca 888 Leu Gly Met Ala Pro Pro Pro Leu Val Ala Val Gly Val Asp Gly Ala 240 245 250 255 gtc aac caa ccg acc ggc gat ccg aat ggc ccg gac ggc gag ttc gag 936 Val Asn Gln Pro Thr Gly Asp Pro Asn Gly Pro Asp Gly Glu Phe Glu 260 265 270 270 ctc gat atc gag gtt gcc ggc gcc gtc gct gca aag ctc gct 984 Leu Asp Ile Glu Val Ala Gly Ala Val Ala Pro Gly Ala Lys Leu Ala 275 280 285 gtt tat ttt gcg cca aat acg gac gct ggg ttt ttg aac gcg atc acg 1032 Val Tyr Phe Ala Pro Asn Thr Asp Ala Gly Phe Leu Asn Ala Ile Thr 290 295 300 acg gct att cac gat acg acg aac aaa cct atg gtg att tct atc agt 1080 Thr Ala Ile His Asp Thr Thr Asn Lys Pro Met Val Ile Ser Ile Ser 305 310 315 tgg ggc ggt cct gag aac ggt tgg gcg ccg gcc tct atc cag gcg atg 1128 Trp Gly Gly Pro Glu Asn Gly Trp Ala Pro Ala Ser Ile Gln Ala Met 320 325 330 335 aat cgg gct ttg cag gac gcg gct gcg ctt ggt gtg acc gtg tgt Asn Arg Ala Leu Gln Asp Ala Ala Ala Leu Gly Val Thr Val Cys Val 340 345 350 gcg gcc ggg gac agc gga tcc aca gat ggc gag aac gac ggt ttg tac 1224 Ala Ala Gly Asp Ser Gly Ser Thr Asp Gly Glu Asn Asp Gly Leu Tyr 355 360 365 cat gtt gat ttt ccc gca tcg tca ccc tat gcc ttg gct tgc ggg gga 1272 His Val Asp Phe Pro Ala Ser Ser Pro Tyr Ala Leu Ala Cys Gly Gly 370 375 380 acg cgt ttg gta gtg gaa aat ggt cag att gcg agt gag acc gtc tgg 1320 Thr Arg Leu Val Val Glu Asn Gly Gln Ile Ala Ser Glu Thr Val Trp 385 390 395 aac gac ggc gca caa ggt ggc agc acc ggg ggc ggc gtg agt agc gta 1368 Asla Asp Gln Gly Gly Ser Thr Gly Gly Gly Val Ser Ser Val 400 405 410 415 ttt gcg ctt ccc agc tgg cag caa aac gca cag gtg cca ccg tct tca 1416 Phe Ala Leu Pro Ser Trp Gln Gln Asn Ala Gln Val Pro Pro Ser Ser 420 425 430 aac ccc ggc ggc acg gtt gga cgc ggt gtg ccg gac gtc gcg gga gat 1464 Asn Pro Gly Gly Thr Val Gly Arg Gly Val Pro Asp Val Ala Gly Asp 435 440 445 445 gct gac cct gcg aca ggc tac gag gta ggc gaa act gcg 1512 Ala Asp Pro Ala Thr Gly Tyr Glu Val Leu Val Asp Gly Glu Thr Ala 450 455 460 gca att ggt ggg acg agt gcc gtg gca ccc ttg tgg gcg ggg ctg gtc 1560 Ala Ile Gly Gly Thr Ser Ala Val Pro Leu Trp Ala Gly Leu Val 465 470 475 acc att gca aac aag acc atc ggt cag cct gtg ggt tat ctc aac cca 1608 Thr Ile Ala Asn Lys Thr Ile Gly Gln Pro Val Gly Tyr Leu Asn Pro 480 485 490 490 495 gta c ta tat agc ttg cca aaa gcg gcg cag gca ttt cgc gac att aca 1656 Val Leu Tyr Ser Leu Pro Lys Ala Ala Gln Ala Phe Arg Asp Ile Thr 500 505 510 cag ggc aac aac gat atc gcc ggc aca ggg gat gtc tat ggg 1704 Gln Gly Asn Asn Asp Ile Ala Gly Thr Gly Asp Val Tyr Ala Ala Gly 515 520 525 ccc ggt tgg gac ccg tgc acg ggc ctt ggt agt ccg att gcc aat cga 1752 Pro Gly Trp Asp Pro Cys Thr Gly Leu Gly Pro Ile Ala Asn Arg 530 535 540 ctc att gca gca ctg cag cag ttg cag cag caa gat cga ggt cag gcg 1800 Leu Ile Ala Ala Leu Gln Gln Leu Gln Gln Gln Asp Arg Gly Gln Ala 545 550 555 tga ttgcgag taggctagctaggctaggctaggc 560 atatagtagc cccacaactt gatatgctcg cttggtttca ctacgacggt gaatgaaaag 1913 ggaatccggt gcgaatccgg aacggtcccg ccgcggtgag gaacgacgct gttgacgttt 1973 gcggcttatc ggccgcgagc cactcgcttg gatgcgggga 2013 <210> 2 <211> 559 <212> PRT <213> Bacillus coagulans <400> 2 Met Asp Gln Gln Val Phe Val Ser Asn Thr Gly Thr Gln Ala Gly Ser 1 5 10 15 His Phe Val Pro Leu Pro Gly H is Val Arg Pro Leu Ala Ala Gly Ala 20 25 30 Thr Asp Val Gly Pro Ala Asp Pro Asp Glu Arg Val Ser Val Thr Leu 35 40 45 Val Leu Arg Arg Arg Ser Pro Glu Gln Leu Glu Ala Thr Ile Glu Ser 50 55 60 Leu Gln Ser Leu Pro Pro Ser Gln Arg Arg His Leu Thr His Asp Glu 65 70 75 80 Phe Ala Val Arg His Gly Ala Asp Ser Gln Asp Ile Glu Lys Val Arg 85 90 95 Ala Phe Ala Asp Ala His Gly Leu Val Leu Glu Lys Val His Val Ala 100 105 110 Ala Gly Thr Ala Leu Leu Thr Gly Arg Val Ala Asp Val Asn Gln Ala 115 120 125 Phe Arg Ile Asp Leu Arg Thr Tyr Gln His Pro Glu Phe Ser Tyr Arg 130 135 140 Gly His Ser Gly Asp Val His Val Pro Met Asp Ile Ala Asp Val Val 145 150 155 160 Thr Ala Val Leu Gly Leu Asp Thr Arg Pro Gln Ala Thr Pro His Phe 165 170 175 Arg Ile Arg Arg Gln Pro Ala Gly Ala Ala Met Arg Ala Thr Ala Thr 180 185 190 Glu Gln Val Ala Tyr Thr Pro Pro Gln Val Ala Ala Ala Tyr Ala Phe 195 200 205 Pro Glu Asn Val Asp Cys Thr Gly Gln Cys Ile Gly Ile Ile Glu Leu 210 215 220 Gly Gly Gly Tyr Ser Asp Gln Asn Ile Gly Glu Tyr P he Ala Ser Leu 225 230 235 240 Gly Met Ala Pro Pro Pro Leu Val Ala Val Gly Val Asp Gly Ala Val 245 250 255 Asn Gln Pro Thr Gly Asp Pro Asn Gly Pro Asp Gly Glu Phe Glu Leu 260 265 270 Asp Ile Glu Val Ala Gly Ala Val Ala Pro Gly Ala Lys Leu Ala Val 275 280 285 Tyr Phe Ala Pro Asn Thr Asp Ala Gly Phe Leu Asn Ala Ile Thr Thr 290 295 300 Ala Ile His Asp Thr Thr Asn Lys Pro Met Val Ile Ser Ile Ser Trp 305 310 315 320 Gly Gly Pro Glu Asn Gly Trp Ala Pro Ala Ser Ile Gln Ala Met Asn 325 330 335 Arg Ala Leu Gln Asp Ala Ala Ala Leu Gly Val Thr Val Cys Val Ala 340 345 350 Ala Gly Asp Ser Gly Ser Thr Asp Gly Glu Asn Asp Gly Leu Tyr His 355 360 365 Val Asp Phe Pro Ala Ser Ser Pro Tyr Ala Leu Ala Cys Gly Gly Thr 370 375 380 Arg Leu Val Val Glu Asn Gly Gln Ile Ala Ser Glu Thr Val Trp Asn 385 390 395 400 Asp Gly Ala Gln Gly Gly Ser Thr Gly Gly Gly Val Ser Ser Val Phe 405 410 415 Ala Leu Pro Ser Trp Gln Gln Asn Ala Gln Val Pro Pro Ser Ser Asn 420 425 430 Pro Gly Gly Thr Val Val Gly Arg Gly Val Pro Asp ValAla Gly Asp Ala 435 440 445 Asp Pro Ala Thr Gly Tyr Glu Val Leu Val Asp Gly Glu Thr Ala Ala 450 455 460 Ile Gly Gly Thr Ser Ala Val Ala Pro Leu Trp Ala Gly Leu Val Thr 465 470 475 475 480 Ile Ala Asn Lys Thr Ile Gly Gln Pro Val Gly Tyr Leu Asn Pro Val 485 490 495 Leu Tyr Ser Leu Pro Lys Ala Ala Gln Ala Phe Arg Asp Ile Thr Gln 500 505 510 Gly Asn Asn Asp Ile Ala Gly Thr Gly Asp Val Tyr Ala Ala Gly Pro 515 520 525 Gly Trp Asp Pro Cys Thr Gly Leu Gly Ser Pro Ile Ala Asn Arg Leu 530 535 540 Ile Ala Ala Leu Gln Gln Leu Gln Gln Gln Asp Arg Gly Gln Ala 545 550 555 <210> 3 <211> 2415 <212 > DNA <213> Bacillus novosp <220> <221> CDS <222> (376) .. (2094) <400> 3 ttcgcccggg cgggagattc ctgctgctcg aatgggacaa gcgtcccatg gagatggggc 60 caccggtcga ggagcgtttg tcgatccacg cgtgtgagga ggcgcttcgc acggccggtt 120 ttgagatcct ttatcgcatt tttccgaacg acgtccaata cggaattgtg gccgagcgcc 180 caggccgccc gtccacgccg tgagcacccg gctgcatgta gcacagcagg ggagtcgcag 240 gctccgcgca gccgaccgca gatgcctaaa tcttgcgtaa aatccacaac ttttcctcc a 300 gccgtgttat actgaggaga gcgaagcctg aagccctgca tgcccatccc gactaggaga 360 atggagtgga aggcg atg agc gac atg gag aag cct tgg aag gaa gag gag 411 Met Ser Asp Met Glu Lys Pro Trp Lys Glu gc gc gc gc gc gc gc gc gc cg gc cg cag gcg ccg cag gct 459 Lys Arg Glu Val Leu Ala Gly His Ala Arg Arg Gln Ala Pro Gln Ala 15 20 25 gtc gat aag gga ccg gtg acc ggg gac cag cgg att tcc gtt acg gtc 507 Val Asp Lys Gly Pro Val Thr Gly Asp Gln Arg Ile Ser Val Thr Val 30 35 40 gtg ctg cgc cgc caa cga ggc gat gaa ctc gag gcg cat gtg gaa cgc 555 Val Leu Arg Arg Gln Arg Gly Asp Glu Leu Glu Ala His Val Glu Arg 45 50 55 60 cag gcc gcg ctc gca cct cac gcg cga gtg cat ctg gag cga gaa gcg 603 Gln Ala Ala Leu Ala Pro His Ala Arg Val His Leu Glu Arg Glu Ala 65 70 75 ttt gcc gct tcg cac ggc gct tcg ctc gac gac ttt gc 651 Phe Ala Ala Ser His Gly Ala Ser Leu Asp Asp Phe Ala Glu Ile Arg 80 85 90 aag ttc gcg gaa gcg cac ggg ctc acg ctc gat cgc gcc cac gtg gct 699 Lys Phe Ala Glu Ala His Gly Leu Thr Leu Asp Arg Ala His Val Ala 95 100 105 gcg ggc acc gcg gtg ctg agc ggc ccg gtg gac gcc gtt aac caa gcg 747 Ala Gly Thr Ala Val Leu Ser Gly Pro Val Asp Ala Val Asn Gln Ala 110 115 120 ttt ggg gtc gag ttg cgc cat ttc gat cat cca gac gga tcc tat cga 795 Phe Gly Val Glu Leu Arg His Phe Asp His Pro Asp Gly Ser Tyr Arg 125 130 135 140 agc tac gtc ggc gac gtg cgt gtg ccg gct tcc atc gg ctg att 843 Ser Tyr Val Gly Asp Val Arg Val Pro Ala Ser Ile Ala Pro Leu Ile 145 150 155 gaa gcg gtg ttt ggc ctg gac acg cgc ccg gtg gcg cgg ccc cac ttt 891 Glu Ala Val Phe Gly Leu Asp Thr Arg Pro Ala Arg Pro His Phe 160 165 170 cgg ctg cgg agg cgc gcc gag ggc gag ttt gag gcg aga tcg cag tcc 939 Arg Leu Arg Arg Arg Ala Glu Gly Glu Phe Glu Ala Arg Ser Gln Ser 175 180 185 gcg gcg tcc g act acg ccg ctc gac gtc gcg cag gcg tac caa 987 Ala Ala Pro Thr Ala Tyr Thr Pro Leu Asp Val Ala Gln Ala Tyr Gln 190 195 200 ttt ccc gag ggg ctc gac gga cag gga cag tgc atc gcc atc atc gaa Phe 1035 PheGly Leu Asp Gly Gln Gly Gln Cys Ile Ala Ile Ile Glu 205 210 215 220 ttg ggc ggc ggc tac gac gag aca tct ctc gcg cag tat ttc gca tcg 1083 Leu Gly Gly Gly Tyr Asp Glu Thr Ser Leu Ala Gln Tyr 225 230 235 ctt ggc gtg tcc gcg ccg cag gtg gtg agc gtc tcg gtg gac ggc gcc 1131 Leu Gly Val Ser Ala Pro Gln Val Val Ser Val Ser Val Asp Gly Ala 240 245 250 acc aat cag ccc acg ggc gat ccg aat gg gac ggc gag gtc gag 1179 Thr Asn Gln Pro Thr Gly Asp Pro Asn Gly Pro Asp Gly Glu Val Glu 255 260 265 ctc gat atc gaa gtg gcg gga gcg ctc gcc ccg ggc gcc aag att gcc 1227 Leu Asp Ile Gla Val Leu Ala Pro Gly Ala Lys Ile Ala 270 275 280 gtg tat ttc gcg ccg aac acg gac gcc ggc ttc ctg aac gcc atc acg 1275 Val Tyr Phe Ala Pro Asn Thrh Asp Ala Gly Phe Leu Asn Ala Ile Thr 285 290 290 acc gtt cac gat ccc acc cac aag ccg tcc atc gtg tcc atc agc 1323 Thr Ala Val His Asp Pro Thr His Lys Pro Ser Ile Val Ser Ile Ser 305 310 315 tgg ggt ggc cct gag gac agt tgg gcg ccg gct tcc atc gcg g cg atg 1371 Trp Gly Gly Pro Glu Asp Ser Trp Ala Pro Ala Ser Ile Ala Ala Met 320 325 330 aac cgc gcg ttt ctg gac gcg gcg gcg ctg ggg gtg acg gtc ctc gcg 1419 Asn Arg Ala Phe Leu Asla Ala Gla Val Thr Val Leu Ala 335 340 345 gcg gcg ggc gac agc gga tcc acg gac ggc gag cag gac ggc ctg tac 1467 Ala Ala Gly Asp Ser Gly Ser Thr Asp Gly Glu Gln Asp Gly Leu Tyr 350 355 360 cac gtc gc gc tcc gcg tcg ccg tac gtg ctg gcc tgc ggc ggt 1515 His Val Asp Phe Pro Ala Ala Ser Pro Tyr Val Leu Ala Cys Gly Gly 365 370 375 380 acg cgg ctt gtg gcg agc gcg ggc cgc atc gag cgaggag Acct Thrgt Leu Val Ala Ser Ala Gly Arg Ile Glu Arg Glu Thr Val Trp 385 390 395 aac gac ggc ccg gat gga gga tcg acg ggc ggc ggc gtg agc cgc atc 1611 Asn Asp Gly Pro Asp Gly Gly Ser Thr Gly Gly Gly Val Ser Ar 400 405 410 ttt ccg ctg ccc tcg tgg cag gag cgc gcg aac gtg cct cct tcg gcg 1659 Phe Pro Leu Pro Ser Trp Gln Glu Arg Ala Asn Val Pro Pro Ser Ala 415 420 425 aat ccg ggc gct ggc agc ggcgg g ccg gat gtg gct ggc aat 1707 Asn Pro Gly Ala Gly Ser Gly Arg Gly Val Pro Asp Val Ala Gly Asn 430 435 440 gcc gat ccg gcc acg ggg tac gag gtc gtg atc gac ggc gag act acg 1755 Ala Asp Pro Ala Thry Tyr Glu Val Val Ile Asp Gly Glu Thr Thr 445 450 455 460 gtc atc ggc ggg acg agc gcc gtg gcg ccg ctt ttc gcc gcg ctg gtg 1803 Val Ile Gly Gly Thr Ser Ala Val Ala Pro Leu Phe Ala Ala Leu Val 465 470 gcc cgc atc aac cag aag ctc ggc aag cca gtc ggc tat ttg aac ccg 1851 Ala Arg Ile Asn Gln Lys Leu Gly Lys Pro Val Gly Tyr Leu Asn Pro 480 485 490 aca ctc tac cag ttg cct ccg cag gaggt gag ggc 1899 Thr Leu Tyr Gln Leu Pro Pro Glu Val Phe His Asp Ile Thr Glu Gly 495 500 505 aac aac gac atc gcg aac cgg gcg agg atc tat cag gcg ggg ccg gga 1947 Asn Asn Asp Ile Ala Asn Arg Ala Arg Ileyr Gln Ala Gly Pro Gly 510 515 520 tgg gat ccg tgc acg ggg ctc ggg agc ccc att ggg atc cga ttc gct 1995 Trp Asp Pro Cys Thr Gly Leu Gly Ser Pro Ile Gly Ile Arg Phe Ala 525 530 535 535 540 tca ggc gct gcc gag cgc ttc aca ggc cca gcc gta acg cgc gac 2043 Ser Gly Ala Ala Ala Glu Arg Phe Thr Gly Pro Ala Val Thr Arg Asp 545 550 555 ctc gct tca ggc aag gaa tac aat tgc gaa agt ttg cag g91 Ala Ser Gly Lys Glu Tyr Asn Cys Glu Ser Leu Gln Ala Met Leu 560 565 570 tag tagcgccacg tagagatggc gtcggcacat ggcgacgccc ggacgaacat 2144 ccgggcgccg cttgtgtgta tcagggcctg ttgcccatcg cggcgccagc cttgattctg 2204 cgaaggagga gagcacaact tggccttcac cgcctcaatc ggatttcccc gcatggggcc 2264 tcgccgcgag ctcaagcgga tggtggaaca gttttggcag ggcaaaattg gggaggacga 2324 gctcacgtcc cgtgccgcgg aactgcgaaa actgcgctgg caggtgcaaa aggaccgcgg 2384 cgtcaagtgg atcgtcgcga acgacttttc c 2415 <210> 4 <211> 572 <212> PRT <213> Bacillus novosp <400> 4 Met Ser Asp Met Glu Lys Pro Trp Lys Glu Glu Glu Lys Arg Glu Val 1 15 Ala Gly His Ala Arg Arg Gln Ala Pro Gln Ala Val Asp Lys Gly 20 25 30 Pro Val Thr Gly Asp Gln Arg Ile Ser Val Thr Val Val Leu Arg Arg 35 40 45 Gln Arg Gly Asp Glu Leu Glu Ala His Val Glu Arg Gln Ala Ala Leu 50 55 60 Ala Pro His Ala Arg Val His Leu Glu Arg Glu Ala Phe Ala Ala Ser 65 70 75 80 His Gly Ala Ser Leu Asp Asp Phe Ala Glu Ile Arg Lys Phe Ala Glu 85 90 95 Ala His Gly Leu Thr Leu Asp Arg Ala His Val Ala Ala Gly Thr Ala 100 105 110 Val Leu Ser Gly Pro Val Asp Ala Val Asn Gln Ala Phe Gly Val Glu 115 120 125 Leu Arg His Phe Asp His Pro Asp Gly Ser Tyr Arg Ser Tyr Val Gly 130 135 140 Asp Val Arg Val Pro Ala Ser Ile Ala Pro Leu Ile Glu Ala Val Phe 145 150 155 160 Gly Leu Asp Thr Arg Pro Val Ala Arg Pro His Phe Arg Leu Arg Arg 165 170 175 Arg Ala Glu Gly Glu Phe Glu Ala Arg Ser Gln Ser Ala Ala Pro Thr 180 185 190 Ala Tyr Thr Pro Leu Asp Val Ala Gln Ala Tyr Gln Phe Pro Glu Gly 195 200 205 Leu Asp Gly Gln Gly Gln Cys Ile Ala Ile Ile Glu Leu Gly Gly Gly 210 215 220 Tyr Asp Glu Thr Ser Leu Ala Gln Tyr Phe Ala Ser Leu Gly Val Ser 225 230 235 240 Ala Pro Gln Val Val Ser Val Ser Val Asp Gly Ala Thr Asn Gln Pro 245 250 255 Thr Gly Asp Pro Asn Gly Pro Asp Gly Glu Val Glu Leu Asp Ile Glu 2 60 265 270 Val Ala Gly Ala Leu Ala Pro Gly Ala Lys Ile Ala Val Tyr Phe Ala 275 280 285 Pro Asn Thr Asp Ala Gly Phe Leu Asn Ala Ile Thr Thr Ala Val His 290 295 300 Asp Pro Thr His Lys Pro Ser Ile Val Ser Ile Ser Trp Gly Gly Pro 305 310 315 320 Glu Asp Ser Trp Ala Pro Ala Ser Ile Ala Ala Met Asn Arg Ala Phe 325 330 335 Leu Asp Ala Ala Ala Leu Gly Val Thr Val Leu Ala Ala Ala Gly Asp 340 345 350 Ser Gly Ser Thr Asp Gly Glu Gln Asp Gly Leu Tyr His Val Asp Phe 355 360 365 Pro Ala Ala Ser Pro Tyr Val Leu Ala Cys Gly Gly Thr Arg Leu Val 370 375 380 Ala Ser Ala Gly Arg Ile Glu Arg Glu Thr Val Trp Asn Asp Gly Pro 385 390 395 400 400 Asp Gly Gly Ser Thr Gly Gly Gly Val Ser Arg Ile Phe Pro Leu Pro 405 410 415 Ser Trp Gln Glu Arg Ala Asn Val Pro Pro Ser Ala Asn Pro Gly Ala 420 425 430 Gly Ser Gly Arg Gly Val Pro Asp Val Ala Gly Asn Ala Asp Pro Ala 435 440 445 Thr Gly Tyr Glu Val Val Ile Asp Gly Glu Thr Thr Val Ile Gly Gly 450 455 460 Thr Ser Ala Val Ala Pro Leu Phe Ala Ala Leu Val Ala Arg Ile Asn 465 Four 70 475 480 Gln Lys Leu Gly Lys Pro Val Gly Tyr Leu Asn Pro Thr Leu Tyr Gln 485 490 495 Leu Pro Pro Glu Val Phe His Asp Ile Thr Glu Gly Asn Asn Asp Ile 500 505 510 Ala Asn Arg Ala Arg Ile Tyr Gln Ala Gly Pro Gly Trp Asp Pro Cys 515 520 525 Thr Gly Leu Gly Ser Pro Ile Gly Ile Arg Phe Ala Ser Gly Ala Ala 530 535 540 Ala Glu Arg Phe Thr Gly Pro Ala Val Thr Arg Asp Leu Ala Ser Gly 545 550 555 555 560 Lys Glu Tyr Asn Cys Glu Ser Leu Gln Ala Met Leu 565 570 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 5 caggtggcgt acacgccgcc gca 23 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 6 cgcgccgaac acggacgccg gctt 24 <210> 7 <211> 24 <212> DNA < 213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 7 agccggcgtc cgtgttcggc gcga 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequ ence: synthesized <400> 8 tgcccgcgat gtcgttgttg ccct 24 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 9 cgcgaattca tggatcagca ggtatt 26 <210 > 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 10 tttaagcttc gcatccaagc gagtgg 26 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 11 tttgaattca tgagcgacat ggagaa 26 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 12 tttaagcttg tggcgctact atagca 26 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 13 gcggcgggcg ccagcggatc 20 <210> 14 < 211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 14 atccgctggc gcccgccgcc 20 <210> 15 <211> 24 <212> DNA <21 3> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 15 gaggtgtttc acgcgatcac cgag 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 16 tcggtgatcg cgtgaaacac ctcc 24 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 17 ctgtaccacg tcgactttcc 20 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 18 tttaagcttg tggcgctact atagca 26 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 19 atcggcggga cggccgccgt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized < 400> 20 ggcggccgtc ccgccgatga 20 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 21 cgc gaattca tggatcagca ggtatt 26 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 22 tttaagcttc gcatccaagc gagtgg 26 <210> 23 <211> 22 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 23 cggggccagc ggatccacag at 22 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223 > Description of Artificial Sequence: synthesized <400> 24 ctgtggatcc gctggccccg gc 22 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 25 gcatttcgcg ccattacaca gggca 25 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 26 cctgtgtaat ggcgcgaaat gcctg 25 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesized <400> 27 caattggtgg gacggctgcc gtg 23 <210> 28 <211> 23 <212> DNA <213> Artificial Sequenc e <220> <223> Description of Artificial Sequence: synthesized <400> 28 cggcagccgt cccaccaatt gcc 22

[Brief description of the drawings]

FIG. 1 shows the results of Western blot analysis of the precursor protein of protease J-4 processed under various activating conditions. The numbers shown below the figure indicate the protease activity of the fraction obtained under each condition.

FIG. 2 shows the sequence alignment of the mature enzyme of bacterial pepstatin-insensitive carboxyl protease (PI-CP). KUM is Kumamoricin, J-4 is Protease J-4, PCP is Pseudomonape.
Psin, XCP is Xanthomonapepsi
n and CLN indicate CLN2 gene products, respectively. Open triangles indicate Asp residues essential for activity, and closed triangles indicate serine residues that are essential for activity in Kumamoricin, protease J-4, and CLN2, but are not essential for other PI-CPs.

FIG. 3 shows the effect of ethanol on the obtained recombinant protease J-4 activity. The enzyme was pre-incubated in the presence of 20% ethanol at pH 5.0 and 30 ° C., and after 1 to 3 days, the residual activity was measured using Casein-f
It was measured by the olin method. Black circles are natural protease J-
4. Closed triangles indicate recombinant protease J-4 and closed squares indicate pepsin.

FIG. 4 shows the procedure for constructing a Kumamoricin mutant plasmid or a protease J-4 mutant plasmid by PCR.

FIG. 5 shows the results obtained when wild-type and mutant (D319A and S279A) proteases J-4 were not treated with acid (-) and activated with acid (+). Figure 4 shows the results of Western blot analysis of processed precursor proteins.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 38/46 (C12N 9/52 C12G 3/02 119 C12R 1:19) (C12N 9/52 C12N 15 / 00ZNAA C12R 1:19) A61K 37/54 (72) Inventor Masafumi Minoda 1251-68 Fukuta, Ryuo-cho, Gamo-gun, Shiga F-term (reference) 4B024 AA01 AA05 BA14 CA05 DA06 EA04 GA11 HA01 HA12 4B036 LC05 LF03 LH49 4B050 CC04 DD02 LL01 LL02 4C084 AA07 BA01 BA08 BA22 BA23 BA24 DC02 MA01 NA05 ZA692 ZB072 ZB212

Claims (9)

[Claims] 1. A novel acidic protease comprising, as an active region, an amino acid sequence IGGTSAVAPL shown at positions 465 to 474 of SEQ ID NO: 2 or positions 462 to 471 of SEQ ID NO: 4. 2. The novel acidic protease according to claim 1, which has an amino acid sequence represented by SEQ ID NO: 2 and has an alcohol-resistant protease activity. 3. The novel acidic protease according to claim 1, which has an amino acid sequence represented by SEQ ID NO: 4 and has a thermostable protease activity. 4. The novel acidic protease according to claim 1, wherein a serine residue is involved in activity expression. 5. The novel acidic protease according to claim 1, which is insensitive to pepstatin and thyrostatin. 6. A polynucleotide comprising a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 2, or a polynucleotide encoding an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence. nucleotide. 7. The polynucleotide according to claim 6, comprising the polynucleotide shown in SEQ ID NO: 1. 8. A polynucleotide comprising a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 4, or a polynucleotide encoding an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence. nucleotide. 9. The polynucleotide according to claim 8, comprising the polynucleotide set forth in SEQ ID NO: 3.