JP2002065273A - Recombinant vector comprising alpha glucosidase gene, transformant and method for producing alpha glucosidase using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for efficiently producing an α-glucosidase that is derived from a plant and has hitherto been difficult to be industrially produced. SOLUTION: The 1st objective recombinant vector consists of α-glucosidase gene derived from Fagopyrum esculentum. The 2nd objective transformant contains the recombinant vector. The 3rd objective method for producing the α-glucosidase comprises the steps of culturing the transformant, and collecting the α-glucosidase from the culture.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a recombinant vector containing a buckwheat-derived α-glucosidase gene, and to expressing this recombinant vector in a heterologous host (eg, microorganism, yeast, mold, etc.), The present invention relates to a method for producing α-glucosidase.

[0002]

BACKGROUND OF THE INVENTION α-Glucosidase (EC 3.2.1.20) is an α-glucosidase at the non-reducing end of the substrate.
-A typical exo-type enzyme that hydrolyzes glucosidic bonds and releases α-glucose. In addition, glucose, maltose, and the like serve as an acceptor and catalyze a glycosyl transfer reaction that produces isomaltose, panose and the like. Buckwheat-derived α-glucosidase has a molecular weight of 88,000 and an optimal pH of 5.
0, pH stability 4.0-7.3, temperature stability 45 ° C or less, and has a substrate specificity of hydrolyzing not only low molecular substrates such as maltooligosaccharides, but also high molecular substrates such as starch. . In addition, as shown in FIG. 1, when this enzyme was allowed to act on 10% soluble starch as a substrate, α-
It produces a large amount of kojibiose and nigerose having 1,2- and α-1,3-glucoside bonds in the early stage of the reaction. When maltose is used as the receptor, nigerosyl glucose
(4-α-Nigerosyl-D-glucose) and Sentose (2,4-di
Oligosaccharides such as -α-D-Glucosyl-D-glucose) are produced. Therefore, from the viewpoint of industrializing these disaccharides and oligosaccharides, buckwheat-derived α-glucosidase is interesting. However, this enzyme has difficulties in industrialization, such as originating from plant seeds and having an expression period in the seeds, and has not been industrialized until now.

Hitherto, various expression systems using microorganisms have been developed using bacteria, yeast, and mold as hosts. Among them, as a eukaryotic cell expression system, for example, in yeast, using a methylotrophic yeast, Pichia pastoris, as a host, a gene of interest is inserted downstream of an expression vector containing an alcohol oxidase promoter. Is introduced into Pichia pastoris, the alcohol oxidase gene on the chromosome is replaced by homologous recombination, and the target gene is expressed by culturing in the presence of methanol, and the recombinant protein is expressed at a high level. An expressive system has been developed. Also, in mold,
Using Rhizopus niveus as a host, a host-vector system and the like described in JP-A-4-218382 have been developed. Unlike eukaryotic cell expression systems, these eukaryotic cell expression systems are capable of expressing large amounts of eukaryotic proteins and hormones, and regenerating proteins to obtain active proteins There are advantages such as no need.

[0004] However, it is difficult to express plant genes in heterologous expression systems such as eukaryotic cells, and there have been no successful cases.

Accordingly, an object of the present invention is to provide α-derived from buckwheat.
An object of the present invention is to provide a method for industrially producing the present enzyme by expressing a glucosidase gene using a heterologous expression system such as a eukaryotic cell.

[0006]

Technical Field The present invention relates to a recombinant vector containing a buckwheat-derived α-glucosidase gene and a transformant containing the recombinant vector. Furthermore, the present invention relates to a method for producing α-glucosidase, which comprises culturing the transformant of the present invention and collecting α-glucosidase from the culture.

[0007]

BEST MODE FOR CARRYING OUT THE INVENTION [Recombinant vector] The recombinant vector of the present invention contains a buckwheat-derived α-glucosidase gene. Examples of the buckwheat-derived α-glucosidase gene include the following (a) ) Or the gene encoding the protein of (b) or the following (c) or (d)
A gene consisting of DNA can be mentioned. (a) SEQ ID NO: 1 or SEQ ID NO: 2 described in the sequence listing
Or a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 1 to 87 shown in SEQ ID NO: 2
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a), and having a buckwheat-derived α-glucosidase activity; SEQ ID NO: 3 or SEQ ID NO: 4 described in
DNA consisting of the nucleotide sequence of SEQ ID NO: 89 to 2794 shown in SEQ ID NO: 3, or DNA consisting of the nucleotide sequence of SEQ ID NO: 39 to 2744 shown in SEQ ID NO: 4 (d) (c ) And a DNA encoding a protein having buckwheat-derived α-glucosidase activity that hybridizes under stringent conditions

The α-glucosidase gene contained in the recombinant vector of the present invention includes, for example, (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or 2 or SEQ ID NO: 1 or It can be an α-glucosidase gene encoding a protein consisting of the amino acid sequence of SEQ ID NOs: 1 to 870 shown in No. 2. Furthermore, the α-glucosidase gene contained in the recombinant vector of the present invention is, for example, (b)
It can be an α-glucosidase gene comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence (a), and encoding a buckwheat-derived protein having α-glucosidase activity. The number of amino acids to be deleted, substituted or added to the amino acid sequence is appropriately determined as long as the protein obtained by expressing this gene has buckwheat-derived α-glucosidase activity. α-Glucosidase activity can be measured by the method described in Examples described later.

The α-glucosidase gene contained in the recombinant vector of the present invention includes, for example, (c) a DNA comprising the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 in the sequence listing; SEQ ID NO: 8 shown in
It can be a gene consisting of a DNA consisting of the base sequence of 9 to 2794 or a DNA consisting of the base sequence of SEQ ID NO: 39 to 2744 shown in SEQ ID NO: 4. Furthermore, the α-glucosidase gene contained in the recombinant vector of the present invention, for example, (d) a protein that hybridizes with the DNA shown in (c) under stringent conditions and has buckwheat-derived α-glucosidase activity Can be a gene consisting of DNA encoding This gene can be DNA from buckwheat, but can also be DNA from a gene other than buckwheat.

The "stringent conditions" for hybridizing with the DNA shown in the above (c) are conditions under which a so-called specific hybrid is formed and a non-specific hybrid is not formed. Although it is difficult to quantify this condition clearly, for example, DNAs having high homology, for example, DNAs having homology of 80% or more, preferably 90% or more hybridize to each other, and The conditions are such that DNAs with low values do not hybridize with each other. More specifically, for example, general Southern hybridization processing conditions (the salt concentration of the hybrid solution is
5XSSC, 5XDenhardt's solution, 0.02%
SDS, 0.5% skim milk solution, 100 μg / ml
(Consisting of salmon-denatured sperm DNA), which means that the hybridization solution has a higher concentration of the constituents of the hybrid solution than this composition, the hybridization temperature is 55 ° C. or higher, or the membrane washing solution is 0.1%. % SDS,
This refers to a solution having a concentration lower than the composition of 0.5 × SSC or a film cleaning temperature of 50 ° C. or higher.

[0011] The recombinant vector of the present invention is not particularly limited, and examples thereof include a vector that functions in yeast and a vector that functions in mold. Vectors that function in yeast are, for example, Pichia
Genus), Saccharomyces (genus Saccharomyces) or Schizosaccharomyces. Further, specific examples of vectors that function in yeast include the following. As a vector that functions in the genus Pichia, for example, in the case of Pichia pastoris, pHIL-D2, pHIL-S1, pPIC3.
5, pPIC9, pPIC3.5K, pPIC9K, p
AO815, pPICZ, pPICZα, pGAPZ,
pGAPZα, Pichia methanolic
In the case of a), pMET and pMETα can be mentioned. Restriction maps of pMET, pMETα, and pPICZ are shown in FIG. 2 and show pHIL-D2, pHIL-S1,
FIG. 3 shows restriction enzyme sites of pPIC9 and pPIC3.5.

Examples of vectors that function in the genera Saccharomyces and Schizosaccharomyces include, for example, Saccharomyces cerevisiae and Schizosa.
ccharomyces pombe), pYES2, pYES2
/ CT, pYES2.1 / V5-His-TOPO, p
YES2 / NT, pYES6 / CT, pESC-HI
S, pESC-LEU, pESC-TRP, pESC-
URA, pYC2 / CT, pYC2 / NT, pYC6 /
CT, pESP-1, pESP-2, pESP-3 and the like. The restriction enzyme maps of pYES2.1 and pYES2 are shown in FIG. 4, and pESP-1, pESP-
Restriction enzyme maps of pESP-2 and pESP-3 are shown in FIG.

The vector that functions in mold can be, for example, a vector that functions in Rhizopus niveus or Rhizopus delemar. Also, a vector that functions in mold includes a shuttle vector, and as a shuttle vector,
For example, a vector that can be expressed in Rhizopus niveus and Rhizopus delemar, specifically, pRNU76, pRNU
54, pRNU12 and the like. pRNU
76 indicates that the vector DNA is Escherichia coli pBR322,
The insert part is 9.0 kb. pRNU54 is
The vector DNA is pUC119, which is obtained by digesting pRNU76 with SphI and subcloning it into pUC119. The insert part is 5.4 kb. p
RNU12 has a vector DNA of pUC19, contains a pyr4 gene as a selection marker, and has an insert of 1.2 kb. FIG. 6 shows a restriction map of these vectors. Further, vectors such as pLeu4, pPPLeu4, and pJPLeu4 described in JP-A-4-218382 can also be mentioned as vectors that function in mold.

[Transformant] The transformant of the present invention contains the recombinant vector of the present invention. Examples of the host of the transformant include microorganisms (for example, Escherichia coli), yeasts (for example, genus Pichia, genus Saccharomyces or genus Schizosaccharomyces) and molds (for example,
Rhizopus niveus or Rhizopus delemar can be mentioned.

In the transformant of the present invention, when the host is yeast, the recombinant vector is a vector that functions in yeast, preferably the genus Pichia
Genus), Saccharomyces (genus Saccharomyces) or Schizosaccharomyces (genus). More specifically, expression systems using yeast include, as hosts, Pichia pastoris and Pichia melanolica
thanolica), Saccharomyces cerevisiae (Saccharom)
yces cerevisiae), Suzu Saccharomyces pombe (Schiz
osaccharomycespombe) and the like. In the transformant of the present invention, when the host is a mold, the recombinant vector is a vector that functions as a mold, preferably, Rhizopusniveus (Rh
izopus niveus or Rhizopus del Mar (Rhizopus)
Preferably, the vector is a vector or a shuttle vector that functions as a delemar).

[Method for Producing α-Glucosidase] The method for producing α-glucosidase of the present invention is characterized by culturing the transformant of the present invention and collecting α-glucosidase from the culture. Culture conditions for the transformant can be appropriately determined in consideration of the type of the host and the like. Further, α-glucosidase can be collected from the culture by a conventional method. More specifically, it can be performed as follows.

Using the cDNA of α-glucosidase cloned from ripened buckwheat seeds by RT-PCR,
For example, expression using yeast is performed. For example, as a host, Pichia pastoris GS115 strain or K
When the M71 strain is used, a vector having a buckwheat or rice-derived α-glucosidase gene downstream of the methanol oxidase promoter is constructed as an expression plasmid, and transformation is performed by electroporation. Histidine auxotrophy or zeocin resistance can be used for selection of transformants. Furthermore, the obtained transformant can confirm that homologous recombination has been performed to the yeast chromosome by amplifying the cDNA internal region of buckwheat-derived α-glucosidase by PCR.

The transformed yeast is inoculated into a BMGY medium and cultured at 30 ° C. with shaking. After the cells reach a target turbidity, the medium is changed to a BMMY medium and the culture is continued. Induction of α-glucosidase is performed. In addition, methanol can be added, for example, so as to have a final concentration of 0.1 to 4.0% every 24 hours. After lysing the cells of the obtained culture, the culture is purified by centrifugation or ultrafiltration to obtain buckwheat-derived α-glucosidase. As described in the Examples, α-glucosidase activity was determined by lysing the cells of the culture solution, and then, after lysing the cells from the buckwheat, 0.014 per 1 ml of the culture solution.
Unit confirmed.

When expression is performed using mold, for example, Rhizopus delem (Rhizopus delem) can be used as a host.
ar) When using FN47 strain, 3-phosphoglycerate kinase
A vector having a buckwheat-derived α-glucosidase gene downstream of the promoter is constructed as an expression plasmid,
Transformation is performed by the protoplast method. In addition, uracil auxotrophy can be used for selection of transformants.
Furthermore, the obtained transformant was homosporylated by forming spores three times, and homologous recombination to the mold chromosome was generated by Southern hybridization using a digoxigenin-labeled promoter fragment as a probe by the random prime method. You can confirm that. The transformed mold is inoculated into, for example, an SIV medium and cultured with shaking at 35 ° C. to induce α-glucosidase. In the induction, for example, glucose (for example, 2
%) Can be used. After crushing the cells of the obtained culture, centrifugation or ultrafiltration is performed, and the culture is purified to obtain buckwheat-derived α-glucosidase. In the examples, after crushing the cells of the culture solution, 0.015 per 1 ml of the culture solution
A unit of α-glucosidase activity was confirmed.

The α-glucosidase activity was measured using 200 μl of a 0.5% maltose solution as a substrate and 0.05%
50 mM acetate buffer pH 4.5 (for buckwheat origin) containing 100% Triton X-100 or 100 mM acetate buffer containing 0.05% Triton X-100
The measurement was performed by adding 100 μl of the enzyme solution to 200 μl of pH 4.0 (for rice origin) and quantifying the generated glucose.
The enzyme unit was defined as an enzyme activity that hydrolyzes 1 μmol of maltose per minute.

[0021]

The present invention will be described in more detail with reference to the following examples. Example 1 [Preparation of buckwheat-derived α-glucosidase by yeast] Construction of Expression Plasmid The construction of the expression plasmid was performed according to the procedure shown in FIG. CDNA fragment of buckwheat-derived α-glucosidase (SEQ ID NO: 3) 10
ng as a template and a sense primer EcoN2 (sequence: 5′-t
tgaattcgaatcggatgaggtcgtc-3 ′) (SEQ ID NO: 5) and antisense primer DesEcoRI (sequence: 5′-atcatcgaatc)
ccgaacaagc-3 ′) (SEQ ID NO: 6) at 400 pmol, 50 mM MgCl ₂
1 μl, 10 × PCR buffer 5 μl, 0.1 mM dNTP mix and 0.2
After making up to 50 μl with 5 units of KOD polymelase (manufactured by Toyobo) using sterilized water, fast PCR was performed. In addition, PCR
The conditions were as follows: 94 ° C., 30 seconds → 55 ° C., 30 seconds → 74 ° C., 30 seconds as one cycle, and 20 cycles were performed. At this time, primer DesEco
The RI was designed by mutating the EcoRI site at cDNA position 1765 so as not to change the primary structure of the translated protein. Then, the full-length cDNA of buckwheat-derived α-glucosidase
Using 10ng as a template, Megaprimer PCR (AK Datta,
Nucl. Acid. Res., 23, 4530-4531 (1995)), a fragment of about 1800 bp amplified by fast PCR was used as Megaprimer (about 40 pmol), and primer NotC (sequence: 5′-ttgcggccgct) was used.
agcaattggtgatttgaa-3 ') (SEQ ID NO: 7) 400 mM as a pair, 50 mM MgCl ₂ 1 μl, 10 × PCR buffer 5 μl, 0.1 mM
dNTP mix and 0.25 units of KOD polymelase (Toyobo)
After adjusting to 50 μl with sterile water using, a second PCR was performed. Note that the PCR conditions were initially defined as Megapri
94 ° C, 1 minute using only mer → 74 ° C, 3 minutes as one cycle
After 5 cycles, 400 pmol of the primer NotC was added, and 20 cycles were performed with 94 ° C, 30 seconds → 58 ° C, 30 seconds → 74 ° C, 2 minutes as one cycle. Further, PCR was performed using the fragment of about 2800 bp amplified by the second PCR as a template and EcoN2 and NotC as primers (FIG. 7 (a)). PEG / NaCl precipitation of the amplified fragment of about 2800 bp, followed by EcoRI and Not
It was treated with a restriction enzyme using I and inserted into a cloning site of pPICZαA (manufactured by Invitrogen). Transfer this plasmid to pPICZαA / BWG
(Above, FIG. 7 (b)).

2. Pichia pastori
Transformation of s) Plasmid pPICZαA / BWG (10 μl) was treated with NsiI to obtain a linearized product, which was concentrated to 10 μl by ethanol precipitation, and then 80 μl of Pichia pastoris (Pichia pastoris).
oris) GS115 strain and left on ice for 5 minutes. Change this to 0.
Place in a 2 cm cuvette and place the Bio-RAD GENE PULSAR II Electroporation system at 25 μF, 1.5 kV, 200 Ω.
(Bio-RAD) was used for electroporation. Thereafter, 1 ml of 1M sorbitol was added and immediately transferred to ice. This was used as an MD solid medium containing Zeocin (Bacto Yeas
t Nitrogen Base 1.34%, (NH ₄ ) ₂ SO ₄ 1%, biotin 4 × 10
^-5 %, glucose 2%, Ager 1.5%), and culture at 30 ° C for 2 days.
A patch was prepared by culturing the cells in an MD solid medium at 30 ° C. for 2 days. For confirmation of transformants, scrape a small amount of cells from the patch and 100 μl
Suspended in a TE buffer solution, treated at 100 ° C. for 5 minutes, treated with phenol / chloroform and precipitated with ethanol as a template, using a 5′AOX primer derived from a vector and cDN
A target transformant was selected by performing PCR using primers inside A and confirming the amplified fragment. Thus, a transformant PICZαA / BWG was obtained.

3. Culture of transformant and production of α-glucosidase From the patch, transformant PICZαA / BWG was added to 50 ml of BMGY medium (1%
yeast extract, 2% polypeptone, 100mM potassium ph
osphate buffer pH6.0, 1.34% Yeast Nitrogenbase, 4
× 10 ⁻⁵ % biotin, 1% glycerol), and cultured at 30 ° C. with shaking until the absorbance at 600 nm exceeded 2. 25 cells
Collect by centrifugation at 3,000 ° C for 5 minutes at 5 ° C.
0 ml of BMMY medium (1% yeast extract, 2% polypeptone, 10
0mM potassium phosphate buffer pH6.0, 1.34% Yeast
The suspension was suspended in Nitrogen base (4 × 10 ⁻⁵ % biotin, 0.5% methanol), and cultured at 30 ° C. with shaking at an absorbance of 600 nm of about 2 for 50 hours. The absorbance at 600 nm after culturing was 15. Zymolyase (manufactured by Kirin Brewery Co., Ltd.) was added to this culture solution to lyse the cells. At this time, 0.014 units were confirmed per 1 ml of the culture solution. Subsequently, centrifugation and ultrafiltration were performed, and the culture solution was purified to obtain buckwheat-derived α-glucosidase.

4. Method for measuring enzyme activity of α-glucosidase 200 μl of 0.05% Triton X-100 in an ice-cooled test tube
Was added thereto and a 50 mM acetate buffer pH 4.5 and an enzyme solution were added, and the mixture was kept at 37 ° C. for 3 minutes. The reaction was started by adding 200 μl of a 0.5% maltose solution as a substrate. After a certain time, 1 ml of 2M Tris-HCl buffer pH 7.0 was added to stop the reaction. To this, 200 μl of Glucostat reagent (glucose AR-II, manufactured by Wako Pure Chemical Industries) was added, and after stirring, a color reaction was performed at 37 ° C. for 1 hour. The absorbance at a wavelength of 505 nm was measured, and the amount of glucose was quantified from a calibration curve. The enzyme unit was defined as an enzyme activity that hydrolyzes 1 μmol of maltose per minute.

Example 2 [Preparation of buckwheat-derived α-glucosidase by mold] Construction of Expression Plasmid Using 10 ng of a cDNA fragment of buckwheat-derived α-glucosidase as a template, a sense primer BWG / Kpn1 (sequence: 5′-ttggtacc
atcatgggcaaacacactcac-3 ′) (SEQ ID NO: 8) and antisense primer BWG / Sse1 (sequence: 5′-ttcctgcaggta
gcaattggtgatttgaa-3 ′) (SEQ ID NO: 9) at 50 pmol, 25 mM
MgCl _{2 4} μl, 10 × PCR buffer 4 μl, 2.5 mM dNTP mix 4
μl and 0.25 units of polymerase (trade name: TaKaRa Ex T
aq Takara Shuzo) to make up to 50 μl with sterile water, followed by PCR. The PCR conditions were 94 ° C, 30 seconds → 55 ° C, 30 seconds → 7
The cycle was performed at 4 ° C for 30 seconds for 25 cycles. After the amplified fragment of about 2800 bp was PEG / NaCl precipitated, Kpn I and Sse
After treatment with restriction enzyme with 8387 I, pRNU54 (H. Horiuchi et.al.,
Curr. Genet., 27, 472-478 (1995)).
8387I was inserted into the cloning site. This plasmid
It was named pRNU / BWG (about 11.4 kbp). Then, 3-phosphoglycerate k of Rhizopus niveus
0.7 kbp promoter of the inase2 gene (pgk2) (H. Horiuch
i et.al., Curr.Genet., 27, 472-478 (1995))
After performing blunt-end treatment with polymerase, this promoter gene, pRNU / BWG was subjected to restriction enzyme treatment with Sac I, and similarly subjected to blunt-end treatment and dephosphorylation treatment with Alkaline Phospatase (from calf small intestine). Cloned. This plasmid was designated as pRD / BWG (about 12.1 kbp).

2. Rhizopus delem
ar) Protoplasts Rhizopus delemar FN47 strain (H. Hor
iuchi et.al., Curr.Genet., 27, 472-478 (1995)).
Potate-Dextrose medium containing 05 mg / ml uridine (Difico
) And cultured at 30 ° C for 3 days to form spores. Cultured Rhizopus delemar
Both mycelia and spores of the FN47 strain were scraped and suspended in 30 ml of sterile water with a platinum loop. The spores were liberated from the mycelium by vortexing and vigorously repeatedly stirring the mixture up and down. A part of this spore suspension is collected and 3 × 1 on a hemocytometer.
0 vigorously stirred to ⁶ spores / ml. Next, the spore suspension was filtered through a G-1 glass filter (manufactured by Whatman) to remove mycelia, and then filtered using a G-3 glass filter (manufactured by Whatman) to remove only spores released from spore pus. collected. The filtrate was centrifuged at 2500 rpm for 10 minutes to obtain 5 × 10 ⁷ spores. The obtained spores were converted to YP containing 10 mM proline.
G medium (1% glucose, 2% Polypeptone, 2% yeast extrac
t) was inoculated to 10 ⁷ cells and cultured at 26 ° C. for 9 hours to form a germinating tube. This is collected, the supernatant is discarded, and a protoplast buffer (0.3 × McIlvain buffer pH 5.4, 0.3M
(Mannitol). To obtain protoplasts from these germ tubes, 2 mg / ml Yatalase
(Manufactured by Takara Shuzo), 0.5 mg / ml chitinase RS (manufactured by Seikagaku Corporation) and 1.5 mg / ml chitosanase (manufactured by Wako Pure Chemical Industries) suspended in a protoplast buffer, and gently stirred at 30 ° C. for 3 hours. did. The obtained protoplasts were filtered through a G-2 glass filter, and MMC buffer (0.3 M mannitol, 50 M
mM CaCl ₂ , 10 mM MOPS (pH 6.3)
Protoplast suspension was obtained by suspending in MMC buffer.

3. Rhizopus delem
ar) Transformation About 25 μg of plasmid pRD / BWG was dissolved in MMC buffer containing 50 mg / ml of heparin, and allowed to stand on ice for 20 minutes. This D
NA solution and Rhizopus delemar FN47
100 μl of the protoplast suspension of the strain was mixed and allowed to stand on ice for 30 minutes. Then, 100 μl of PEG solution (40 (w / v)% PEG40
After mixing with 00 and 10 mM MOPS (pH 6.3) and 50 mM CaCl ₂ ), the mixture was allowed to stand still on ice for 30 minutes, and then allowed to stand at room temperature for 30 minutes. The protoplasts were washed with 1 ml of YPG medium containing 0.275 M mannitol, resuspended in 1 ml of the same medium, and kept at 30 ° C. for 30 minutes. After holding, SIV medium pH2.7 containing 0.3M mannitol and 0.8% agar (2% glucose, 2 mg / ml _{L-asparagine, 5mg / ml KH 2 PO 4} , 0.5mg / ml MgSO 4 · H 2 O, 0.28g / m
l CaCl _2, 20μg / ml citric _{acid, 15μg / ml Fe (NO 3} ) 3 · 9H
_{2 O, 10μg / ml ZnSO 4} · 7H 2 O, 3μg / ml MnSO 4 · 7H 2 O, 0.5μ
g / ml CuSO ₄・ 5H ₂ O, 0.5 μg / ml NaMoO ₄・ 2H ₂ O)
The cells were suspended in the same medium and overlaid on a pH 2.7 SIV medium containing 0.3 M mannitol and 1.5% agar. This was cultured at 30 ° C. for 2 days to obtain a transformant RD / BWG. The obtained transformant RD / B
The WG was sporulated three times in a Potate-Dextrose medium, homogenized to obtain a transformant RD / BWG1. The target transformant was confirmed by Hybound-N ⁺ (Amersham
Manufactured by Southern Hybridization. The probe used was a promoter fragment labeled with digoxigenin by the random prime method.

4. Culture of Transformant and Production of α-Glucosidase Transformant RD / BWG1 was inoculated into 50 ml of SIV medium and cultured with shaking at 35 ° C. for 50 hours. The culture was disrupted by ultrasonic waves. At this time, 0.015 units were confirmed per 1 ml of the culture solution. After crushing the cells, centrifugation and ultrafiltration were performed, and the culture solution was purified to obtain buckwheat-derived α-glucosidase.

5. Method for measuring enzyme activity of α-glucosidase 200 μl of 0.05% Triton X-100 in an ice-cooled test tube
Was added thereto and a 50 mM acetate buffer pH 4.5 and an enzyme solution were added, and the mixture was kept at 37 ° C. for 3 minutes. The reaction was started by adding 200 μl of a 0.5% maltose solution as a substrate. After a certain time, 1 ml of 2M Tris-HCl buffer pH 7.0 was added to stop the reaction. To this, 200 μl of Glucostat reagent (glucose AR-II, manufactured by Wako Pure Chemical Industries) was added, and after stirring, a color reaction was performed at 37 ° C. for 1 hour. The absorbance at a wavelength of 505 nm was measured, and the amount of glucose was quantified from a calibration curve. The enzyme unit was defined as an enzyme activity that hydrolyzes 1 μmol of maltose per minute.

[Sequence List] Sequence Listing <110> Nihon Shokuhin Kako Co., Ltd., <120> Transformed vector comprising Buckwheat α glucosidase gene, trans formant and preparation method for α glucosidase using the same <130> A05119H <160> 9 <210> 1 <211> 901 <212> Amino acid <213> Fagopyrum esculentum Moeench <400> 1 Met Phe Lys His Thr His His Ala Asn Pro Ala Lys Leu Leu Leu Leu 16 Ala Ala Thr Leu Leu Phe Cys Ser Leu Phe Val Val Ser Glu Ser Gly 1 Glu Val Val Gly Tyr Gly Tyr Arg Val Val Arg Ala Lys Val Asp Ser 17 Ser Ser Asn Thr Leu Thr Ala Phe Leu Lys Leu Ile Asn Ala Ser Ser 33 Leu Tyr Gly Gln Asp Ile Pro Asn Leu Thr Phe Thr Ala Thr Phe Glu 49 Lys Asp Tyr Arg Leu Arg Ile Arg Ile Thr Asp Ala Glu Lys Pro Arg 65 Trp Glu Ile Pro Asn Glu Val Leu His Arg Asp Gly Ser Ser His Gly 81 His Gln Pro Leu Asp Ser Arg Pro Thr Thr Pro Pro Ser Ala Ala Val 97 Leu Thr His Pro Asn Ser Asp Leu Ile Phe Arg Leu His Asp Thr Asn 113 Pro Phe Gly Phe Ser Val Thr Arg Arg Ser Thr Asn Asp Val Leu Phe 129 Asp Thr Arg Ser Ala As p Pro Glu Thr Asp Pro Val Gly Leu Val Phe 145 Lys Asp Gln Tyr Ile Gln Leu Ser Ser Ser Leu Pro Gly Arg Arg Ala 161 His Leu Tyr Gly Ile Gly Glu His Thr Lys Pro Thr Phe Arg Leu Ala 177 His Asn Gln Thr Leu Thr Leu Trp Asn Ala Asp Ile Ala Ser Tyr Asn 193 Val Asp Leu Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Asp Val Arg 209 Ala Pro Leu Gly Thr Ser Asn Gly Val Leu Leu Leu Asn Ser Asn Gly 225 Met Asp Val Glu Tyr Thr Gly Asp Arg Ile Thr Tyr Lys Val Ile Gly 241 Gly Ile Ile Asp Leu Tyr Val Phe Ala Gly Pro Thr Pro Asp Glu Val 257 Val Gln Gln Tyr Thr Glu Leu Ile Gly Arg Pro Ala Pro Met Pro Tyr 273 Trp Ser Phe Gly Phe His Gln Cys Arg Tyr Gly Tyr Arg Asn Val Ser 289 Val Val Glu Asn Val Val Lys Ala Tyr Ala Thr Met Arg Ile Pro Leu 305 Glu Ala Ile Trp Thr Asp Ile Asp Tyr Met Glu Ala Asn Lys Asp Phe 321 Thr Val Asp Pro Val Asn Phe Pro Leu Asp Lys Met Gln Arg Phe Val 337 Asn Lys Leu His Lys Asn Gly Gln Lys Tyr Val Ala Ile Leu Asp Pro 353 Gly Ile Asn Ile Asn Thr Thr Thr Tyr Gly Thr Phe Gln Arg Ala Met 369 Ly s Ala Asp Ile Phe Ile Lys Arg Gln Gly Glu Pro Tyr Gln Gly Glu 385 Val Trp Pro Gly Pro Val Tyr Phe Pro Asp Phe Leu Asn Pro Lys Thr 401 Thr Ile Phe Trp Ile Ser Glu Ile Gln Thr Phe Phe Asn Ala Leu Pro 417 Val Asp Gly Leu Trp Ile Asp Met Asn Glu Val Ser Asn Phe Ile Ser 433 Ser Pro Pro Ile Pro Asp Ser Pro Leu Asp Asn Pro Pro Tyr Val Ile 449 Asn Asn Ser Gly Gly Arg Arg Pro Ile Asn Glu Lys Thr Ile Pro Val 465 Ser Ser Val His Tyr Gly Asn Val Ser Asp Tyr Asn Val His Asn Leu 481 Tyr Gly Tyr Leu Glu Ala Ile Ala Thr Asn Val Ala Leu Lys Lys Val 497 Thr Lys Gln Arg Pro Phe Val Leu Ser Arg Ser Thr Phe Ile Gly Ser 513 Gly Lys Tyr Thr Ala His Trp Thr Gly Asp Asn Ala Ala Thr Trp Thr 529 Asn Met Ala Ala Ser Ile Pro Thr Ile Leu Asp Phe Gly Leu Phe Gly 545 Ile Pro Met Ile Gly Ala Asp Ile Cys Gly Phe Ala Tyr Thr Thr Thr 561 Glu Glu Leu Cys Arg Arg Trp Ile Gln Leu Gly Ala Phe Tyr Pro Phe 577 Ser Arg Asp His Ser Asp Asn Leu Thr Glu Pro Gln Glu Leu Thr Gln 593 Trp Gly Ser Val Thr Glu Thr Ala Arg Lys Val Leu Gl y Leu Arg Tyr 609 Arg Leu Leu Pro Tyr Tyr Tyr Thr Leu Met Tyr Glu Ala His Lys Lys 625 Gly Thr Pro Ile Ala Arg Pro Leu Phe Phe Ser Phe Pro Asn Asp Pro 641 Asn Thr Tyr Gly Ile Asp Ala Gln Phe Leu Val Gly Lys Gly Val Met 657 Val Ser Pro Val Leu Thr Gln Gly Ala Thr Ser Val Thr Ala Tyr Phe 673 Pro Ser Gly Asn Trp Phe Asn Leu Phe Asp Tyr Thr Lys Thr Val Ser 689 Ser Pro Thr Asn Gly Ser Phe Val Thr Leu Asp Ala Pro Leu Glu Glu 705 Ile Asn Val His Val Arg Glu Gly Ser Ile Leu Ala Leu Gln Gly Glu 721 Ala Met Thr Thr Arg Glu Ala Arg Asn Thr Pro Phe Glu Leu Val Val 737 Val Ile Ser Asp Ser Gly Asn Gly Ser Ser Ile Gly Ser Val Phe Leu 753 Asp Asn Gly Val Asp Ile Glu Met Gly Asp Asp Gly Gly Arg Trp Ser 769 Leu Val Thr Phe Ser Ala Gly Leu Ile Gly Asn Asn Lys Val Thr Ile 785 Thr Ser Ser Val Val Asn Gly Arg Phe Ala Leu Ser Gln Gly Trp Lys 801 Ile Ser Lys Val Thr Ile Leu Gly Leu Ser Arg Gly Ser Gln Val Lys 817 Gly Tyr Thr Met Leu Ser Ile Gly Arg Val Val Thr Thr Ser Val Lys 833 Gly Ala Arg Lys Cys Ser Arg Gl y Thr Gly Lys Phe Asp Val Val Glu 849 Ile Pro Asn Leu Ser Leu Leu Val Gly Arg Asn Phe Lys Leu Asp Ile 865 Gln Ile Thr Asn Cys 870 <210> 2 <211> 901 <212> Amino acid <213> Fagopyrum esculentum Moeench <400> 2 Met Phe Lys His Thr His His Ala Asn Pro Ala Lys Leu Leu Leu Leu 16 Ala Ala Thr Leu Leu Phe Cys Ser Leu Phe Val Val Ser Glu Ser Asp 1 Glu Val Val Gly Tyr Gly Tyr Arg Val Val Arg Ala Lys Val Asp Ser 17 Ser Ser Asn Thr Leu Thr Ala Phe Leu Lys Leu Ile Asn Ala Ser Ser 33 Leu Tyr Gly Gln Asp Ile Pro Asn Leu Thr Phe Thr Ala Thr Phe Glu 49 Lys Asp Tyr Arg Leu Arg Ile Arg Ile Thr Asp Ala Glu Lys Pro Arg 65 Trp Glu Ile Pro Asn Glu Val Leu His Arg Asp Gly Ser Ser His Gly 81 His Gln Pro Leu Asp Ser Arg Pro Thr Thr Pro Pro Ser Ala Ala Val 97 Leu Thr His Pro Asn Ser Asp Leu Ile Phe Arg Leu His Asp Thr Asn 113 Pro Phe Gly Phe Ser Val Thr Arg Arg Ser Thr Asn Asp Val Leu Phe 129 Asp Thr Arg Ser Ala Asp Pro Glu Thr Asp Pro Val Gly Leu Val Phe 145 Lys Asp Gln Tyr Ile Gln Leu Ser Ser Ser Leu Pro Ala A sp Arg Ser 161 Asn Leu Tyr Gly Ile Gly Glu His Thr Lys Pro Thr Phe Arg Leu Ala 177 Arg Asn Gln Thr Leu Thr Leu Trp Asn Ala Asp Ile Ala Ser Tyr Asn 193 Val Asp Leu Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Asp Val Arg 209 Ala Pro Leu Gly Thr Ser Asn Gly Val Leu Leu Leu Asn Ser Asn Gly 225 Met Asp Val Glu Tyr Thr Gly Asp Lys Ile Thr Tyr Lys Val Ile Gly 241 Gly Ile Val Asp Leu Tyr Val Phe Glu Gly Pro Thr Pro Asp Glu Val 257 Val Gln Gln Tyr Thr Glu Leu Ile Gly Arg Pro Ala Pro Met Pro Tyr 273 Trp Ser Phe Gly Phe His Gln Cys Arg Tyr Glu Tyr Arg Asn Ile Ser 289 Val Val Glu Asn Val Val Lys Ala Tyr Ser Thr Met Arg Ile Pro Leu 305 Glu Ala Met Trp Thr Asp Ile Asp Tyr Met Glu Ala Asn Lys Asp Phe 321 Thr Val Asp Pro Val Asn Phe Pro Leu Asp Lys Met Gln Arg Phe Val 337 Asn Lys Leu His Lys Asn Gly Gln Lys Tyr Val Ala Ile Leu Asp Pro 353 Gly Ile Asn Ile Asn Thr Thr Thr Tyr Gly Thr Phe Gln Arg Ala Met 369 Lys Ala Asp Ile Phe Ile Lys Arg Gln Gly Glu Pro Tyr Gln Gly Glu 385 Val Trp Pro Gly Pro Val Tyr Phe P ro Asp Phe Leu Asn Pro Lys Thr 401 Thr Ile Phe Trp Ile Ser Glu Ile Gln Thr Phe Phe Asn Ala Leu Pro 417 Val Asp Gly Leu Trp Ile Asp Met Asn Glu Val Ser Asn Phe Ile Ser 433 Ser Pro Pro Ile Pro Asp Ser Pro Leu Asp Asn Pro Pro Tyr Val Ile 449 Asn Asn Ser Gly Gly Arg Arg Pro Ile Asn Glu Lys Thr Ile Pro Val 465 Ser Ser Val His Tyr Gly Asn Val Ser Asp Tyr Asn Val His Asn Leu 481 Tyr Gly Tyr Leu Glu Ala Thr Ala Thr Asn Val Ala Leu Lys Lys Val 497 Thr Lys Gln Arg Pro Phe Val Leu Ser Arg Ser Thr Phe Ile Gly Ser 513 Gly Lys Tyr Thr Ala His Trp Thr Gly Asp Asn Ala Ala Thr Trp Thr 529 Asn Met Ala Ala Ser Ile Pro Thr Ile Leu Asp Phe Gly Leu Phe Gly 545 Ile Pro Met Ile Gly Ala Asp Ile Cys Gly Phe Ala Tyr Thr Thr Thr 561 Glu Glu Leu Cys Arg Arg Trp Ile Gln Leu Gly Ala Phe Tyr Pro Phe 577 Ser Arg Asp His Ser Asp Asn Leu Ser Glu Pro Gln Glu Leu Thr Gln 593 Trp Gly Ser Val Thr Glu Ser Ala Arg Lys Val Leu Gly Leu Arg Tyr 609 Arg Leu Leu Pro Tyr Tyr Tyr Thr Leu Met Tyr Glu Ala His Lys Lys 625 Gly Thr Pro I le Ala Arg Pro Leu Phe Phe Ser Phe Pro Asn Asp Pro 641 Asn Thr Tyr Gly Ile Asp Ala Gln Phe Leu Ile Gly Lys Gly Val Met 657 Val Ser Pro Val Leu Thr Gln Gly Ala Thr Ser Val Thr Ala Tyr Phe 673 Pro Ser Gly Asn Trp Phe Asn Leu Phe Asn Tyr Thr Lys Thr Val Ser 689 Ser Pro Ala Asn Gly Ser Phe Val Thr Leu Asp Ala Pro Leu Lys Glu 705 Ile Asn Val His Val Arg Glu Gly Ser Ile Leu Ala Leu Gln Gly Glu 721 Ala Met Thr Thr Arg Glu Ala Arg Asn Thr Pro Phe Glu Leu Val Val 737 Val Ile Ser Asp Ser Gly Asn Gly Ser Ser Ile Gly Ser Val Phe Leu 753 Asp Asn Gly Val Asp Ile Glu Met Gly Asp Asp Gly Gly Arg Trp Ser 769 Leu Val Thr Phe Ser Ala Gly Leu Val Gly Asn Asn Lys Val Thr Ile 785 Thr Ser Ser Val Val Asn Gly Arg Phe Ala Leu Ser Gln Gly Trp Lys 801 Ile Ser Lys Val Thr Ile Leu Gly Leu Ser Arg Gly Ser Gln Val Lys 817 Gly Tyr Thr Met Leu Ser Ile Gly Arg Val Val Thr Thr Ser Ala Lys 833 Gly Ala Arg Lys Cys Ser Lys Gly Thr Gly Lys Phe Asp Val Val Glu 849 Ile Pro Asn Leu Ser Leu Leu Val Gly Arg Asn Phe Lys Leu Asp I le 865 Gln Ile Thr Asn Cys 870 <210> 3 <211> 2932 <212> DNA <213> Fagopyrum esculentum Moeench <400> 3 tttttttttt tttttttttt tttttttttt tttttttt tttttttttt gaacatcaaa 60 ccaagaatcc aacgcccctcct cct cct cct cct cct att ctt gtt Phe Lys His Thr His His Ala aac ccg gca aag ctg ctg ctt ctc gcg gcc aca ctt ctc ttc tgc tcc 160 Asn Pro Ala Lys Leu Leu Leu Leu Ala Ala Thr Leu Leu Phe Cys Ser ctc ttt gtt gtt gc tg gt gc g gtc ggc tat ggc tat cgg 208 Leu Phe Val Val Ser Glu Ser Gly Glu Val Val Gly Tyr Gly Tyr Arg gtc gtc cgg gcc aag gtc gac tcc tct tct aat aca ctc acc gct ttt 256 Val Val Arg Ala Lys Val Asp Ser Ser Ser Asn Thr Leu Thr Ala Phe ctt aag ctc att aac gct tcc tcg cta tat ggc caa gac att ccc aat 304 Leu Lys Leu Ile Asn Ala Ser Ser Leu Tyr Gly Gln Asp Ile Pro Asn ctc acc ttc act gca acg ttt gaa aaa gat t cgt ttg agg att cgg 352 Leu Thr Phe Thr Ala Thr Phe Glu Lys Asp Tyr Arg Leu Arg Ile Arg ata acc gat gcc gaa aag cct agg tgg gag atc cca aac gaa gtc tta 400 I le Thr Asp Ala Glu Lys Pro Arg Trp Glu Ile Pro Asn Glu Val Leu cac cgt gac ggc tct tca cat gga cac caa cca cta gat tca cgg cca 448 His Arg Asp Gly Ser Ser His Gly His Gln Pro Leu Asp Ser Arg Pro aca act cct cct tca gcg gcg gtg ctc acc cac ccc aac tca gac ctc 496 Thr Thr Pro Pro Ser Ala Ala Val Leu Thr His Pro Asn Ser Asp Leu atc ttc agg ctc cat gac acc aac ccc ttc ggg ttc tcc gtc aca cgc 544 Ile Phe Arg Leu His Asp Thr Asn Pro Phe Gly Phe Ser Val Thr Arg cgc tcc aca aac gac gtc ctc ttc gac acc cgc tcc gct gat ccc gag 592 Arg Ser Thr Asn Asp Val Leu Phe Asp Thr Arg Ser Ala Asp Pro Glu aca gac ccg gtc ggg ctt gtc ttc aag gac caa tac atc caa ctc tcc 640 Thr Asp Pro Val Gly Leu Val Phe Lys Asp Gln Tyr Ile Gln Leu Ser tcc tcc ctt ccc ggc cga cgg gcc cac cta tac ggc atc ggt gag cac 688 Leu Pro Gly Arg Arg Ala His Leu Tyr Gly Ile Gly Glu His acc aag ccc acg ttt agg ttg gct cat aat caa acc ctc act cta tgg 736 Thr Lys Pro Thr Phe Arg Leu Ala His Asn Gln Thr Leu Thr Leu Trp aat gcc gac a tt gct agc tac aat gtg gac ttg aac ctc tac ggc tct 784 Asn Ala Asp Ile Ala Ser Tyr Asn Val Asp Leu Asn Leu Tyr Gly Ser cac cca ttc tac ctc gat gtg cgt gca cca ctc gga acc tcc aac gg Tyr Leu Asp Val Arg Ala Pro Leu Gly Thr Ser Asn Gly gtc ttg tta ctt aat agc aac ggg atg gac gtg gag tat acc ggt gat 880 Val Leu Leu Leu Asn Ser Asn Gly Met Asp Val Glu Tyr Thr Gly Asp agg atc aca tac aag gtg atc ggc ggt att att gat ttg tac gtg ttc 928 Arg Ile Thr Tyr Lys Val Ile Gly Gly Ile Ile Asp Leu Tyr Val Phe gcg ggt ccg act ccc gat gaa gtc gtg caa cag tat acc gag Actc atc76 Pro Asp Glu Val Val Gln Gln Tyr Thr Glu Leu Ile gga aga ccg gcc cct atg cct tac tgg tca ttc ggc ttc cat caa tgc 1024 Gly Arg Pro Ala Pro Met Pro Tyr Trp Ser Phe Gly Phe His Gln Cys cga tac ggg tac cgc aac gtt agt gta gtc gag aac gta gtt aaa gca 1072 Arg Tyr Gly Tyr Arg Asn Val Ser Val Val Glu Asn Val Val Lys Ala tac gcg act atg aga atc cct ctc gaa gca ata tgg aca gac atc gat 1120 Tyr Ala Thr Met Ar g Ile Pro Leu Glu Ala Ile Trp Thr Asp Ile Asp tac atg gaa gca aac aag gac ttt acc gtt gat ccc gtc aat ttc ccg 1168 Tyr Met Glu Ala Asn Lys Asp Phe Thr Val Asp Pro Val Asn Phe Pro ctg gat aag atg caa aga ttc gtc aat aag ctt cat aaa aac ggc caa 1216 Leu Asp Lys Met Gln Arg Phe Val Asn Lys Leu His Lys Asn Gly Gln aag tac gtt gcc ata ttg gat ccc ggg att aac ata aac acc act acc 1264 Lys Tyr Val Ala Ile Leu Asp Pro Gly Ile Asn Ile Asn Thr Thr Thr tat ggt aca ttt caa aga gct atg aaa gcg gat atc ttc atc aag aga 1312 Tyr Gly Thr Phe Gln Arg Ala Met Lys Ala Asp Ile Phe Ile Lys Arg caa gga gag ccg tat ca ggc gag gtt tgg cct ggt cca gtc tat ttc 1360 Gln Gly Glu Pro Tyr Gln Gly Glu Val Trp Pro Gly Pro Val Tyr Phe ccg gat ttt ctt aac ccg aaa aca act atc ttc tgg ata tcc gaa att 1408 Pro Asp Phe Leun Lys Thr Thr Ile Phe Trp Ile Ser Glu Ile caa aca ttc ttc aat gct ctt cca gtc gac ggt ctt tgg att gac atg 1456 Gln Thr Phe Phe Asn Ala Leu Pro Val Asp Gly Leu Trp Ile Asp Met aac gag gtt tcg aatttc atc agc tcc cca ccc atc ccg gat tct ccg 1504 Asn Glu Val Ser Asn Phe Ile Ser Ser Pro Pro Ile Pro Asp Ser Pro cta gac aat ccg ccc tat gtc atc aac aac tcc ggt ggt cgg aga cca 1552 Leu Asp Asn Pro Pro Tyr Val Ile Asn Asn Ser Gly Gly Arg Arg Pro atc aac gag aaa acc att ccg gta tca tcc gtg cat tac gga aat gta 1600 Ile Asn Glu Lys Thr Ile Pro Val Ser Ser Val His Tyr Gly Asn Val tcc gat tat aat gta cac aat ctt tat ggc tac ttg gag gcc ata gca 1648 Ser Asp Tyr Asn Val His Asn Leu Tyr Gly Tyr Leu Glu Ala Ile Ala acc aat gtt gcc ctc aag aag gtg act aaa caa aga ccg ttc gtt ctc 1696 Thr Asn Val Ala Les Lys Val Thr Lys Gln Arg Pro Phe Val Leu tcg agg tct aca ttc atc gga tcc gga aag tat acg gca cat tgg acc 1744 Ser Arg Ser Thr Phe Ile Gly Ser Gly Lys Tyr Thr Ala His Trp Thr gga gac aat gct gca aca tgg aca aat atg gca gct tcc att cct acg 1792 Gly Asp Asn Ala Ala Thr Trp Thr Asn Met Ala Ala Ser Ile Pro Thr att ctc gac ttc ggc ttg ttc gga att ccg atg ata gga gcc gat atc 1840 Ile Leu Asp Phe Gly Leu Phe Gly Ile Pro Met Ile Gly Ala Asp Ile tgc ggc ttt gct tac acc aca acc gaa gag ctt tgt cga cgt tgg ata 1888 Cys Gly Phe Ala Tyr Thr Thr Thr Thr Glu Glu Leu Cys Arg Arg Trp Ile caa ctc gga cct tac ttc tct aga gat cat tca gac aac ttg 1936 Gln Leu Gly Ala Phe Tyr Pro Phe Ser Arg Asp His Ser Asp Asn Leu act gag cct caa gaa ctc act caa tgg gga tca gtg act gaa acc gca 1984 Thr Glu Pro Gln Glu Leu Thr Gln Trp Gly Ser Val Thr Glu Thr Ala aga aaa gta ctc ggc ctt cga tat cgg cta ctc cca tac tac tac aca 2032 Arg Lys Val Leu Gly Leu Arg Tyr Arg Leu Leu Pro Tyr Tyr Tyr Thr ctt atg tac gag gca cat aag aaa gga act cct att gca cgc ccg ctc 2080 Leu Met Tyr Glu Ala His Lys Lys Gly Thr Pro Ile Ala Arg Pro Leu ttc ttc tca ttc ccc aac gac ccg aac acg tac ggt atc gac gct caa 2128 Phe Phe Ser Phe Pro Asn As Asn Thr Tyr Gly Ile Asp Ala Gln ttt ctc gtc gga aag ggt gtg atg gtc tct ccg gtc tta acc caa ggt 2176 Phe Leu Val Gly Lys Gly Val Met Val Ser Pro Val Leu Thr Gln Gly gct acc agc gtc acc gcg tac ttc cca tcc gga aac tgg ttt aat ctc 2224 Ala Thr Ser Val Thr Ala Tyr Phe Pro Ser Gly Asn Trp Phe Asn Leu ttc gat tac acg aag acg gtt agt tct ccg aca aac ggg tct ttt gtt 2272 Phe Asp Tyr Thr Lys Thr Val Ser Ser Pro Thr Asn Gly Ser Phe Val acg ctt gat gca cca ctc gag gag ata aat gtt cat gtt cga gag gga 2320 Thr Leu Asp Ala Pro Leu Glu Glu Ile Asn Val His Val Arg Glu Gly agt att ttg gct tta caa gga gaa gca atg aca aca aga gaa gcg agg 2368 Ser Ile Leu Ala Leu Gln Gly Glu Ala Met Thr Thr Arg Glu Ala Arg aac acg ccg ttt gag ttg gtg gta gtg atc agc gat tcg ggt aat ggt 2416 Asn Thr Pro Phe Glu Val Ile Ser Asp Ser Gly Asn Gly agt agc att gga tcg gtt ttc tta gac aat gga gtc gat atc gag atg 2464 Ser Ser Ile Gly Ser Val Phe Leu Asp Asn Gly Val Asp Ile Glu Met gga gat gat gga gga aga tgg agc tt gtt acg ttt tct gca gga ttg 2512 Gly Asp Asp Gly Gly Arg Trp Ser Leu Val Thr Phe Ser Ala Gly Leu att ggt aat aat aag gtg acg att acg tcg agt gtt gta aat ggt cga 2560 Ile Gly Asn Asn Lys Val Thr Ile Thr Ser Ser Val Val Asn Gly Arg ttt gct ctc tca caa gga tgg aag att agt aag gtg acc att ttg ggg 2608 Phe Ala Leu Ser Gln Gly Trp Lys Ile Ser Lys Val Thr Ile Leu Gly ttg agt aga ggg agc caa gtg aaa ggc tac aca atg cta agt att gga 2656 Leu Ser Arg Gly Ser Gln Val Lys Gly Tyr Thr Met Leu Ser Ile Gly cga gtt gtg acg aca agt gtg aaa ggt gcg agg aag tgt tct agg ggt 2704 Arg Val Val Thr Thr Ser Val Lys Gly Ala Arg Lys Cys Ser Arg Gly acg ggg aag ttt gat gtg gtg gag ata ccc aat cta agc tta ctt gtt 2752 Thr Gly Lys Phe Asp Val Val Glu Ile Pro Asn Leu Ser Leu Leu Val gga agg aac ttc aag cta gat att ca atc acc aat tgc tag ggtaatgtt 2803 Gly Arg Asn Phe Lys Leu Asp Ile Gln Ile Thr Asn Cys * gtatcttagc tagatagaga ctatcatttt gtgaaacaag tgagctcaca aaaaatgcatt 2863 tgaaagtaaa taaagagatatagtagattagtattcattagcattagtattcattactattc2 > DNA <213> Fagopyrum esculentum Moeench <400> 4 gaacatcaaa ccaagaatcc aacgccctct cctctatc a tg ttc aaa cac act cac 56 Met Phe Lys His Thr His cat gcc aac ccg gca aag ctg ctg ctt ctc gcg gcc aca ctt ctc ttc 104 His Ala Asn Pro Ala Lys Leu Leu Leu Leu Ala Ala Thr Leu Leu Phe tgc tcc ct gtt gtt tcc gaa tcg gat gag gtc gtc ggc tat ggc 152 Cys Ser Leu Phe Val Val Ser Glu Ser Asp Glu Val Val Gly Tyr Gly tat cgg gtc gtc cgg gcc aag gtc gac tcc tct tct aat aca ctc acc 200 Tyr Arg Val Arg Ala Lys Val Asp Ser Ser Ser Asn Thr Leu Thr gct ttt ctt aag ctc att aac gct tcc tcg cta tat ggc caa gac att 248 Ala Phe Leu Lys Leu Ile Asn Ala Ser Ser Leu Tyr Gly Gln Asp Ile ccc aat ctc acc ttc act gca acg ttt gaa aaa gat tac cgt ttg agg 296 Pro Asn Leu Thr Phe Thr Ala Thr Phe Glu Lys Asp Tyr Arg Leu Arg att cgg ata acc gat gcc gaa aag cct agg tgg gag atc cca aac gaa 344 Ile Arg Ile Thr Asp Ala Glu Lys Pro Arg Trp Glu Ile Pro Asn Glu gtc tta cac cgt gac ggc tct tca cat gga cac caa cca cta gat tca 392 Val Leu His Arg Asp Gly Ser Ser His Gly His Gln Pro Leu Asp Ser cgg cca aca act cct cct tc a gcg gcg gtg ctc acc cac ccc aac tca 440 Arg Pro Thr Thr Pro Pro Ser Ala Ala Val Leu Thr His Pro Asn Ser gac ctc atc ttc agg ctc cat gac acc aac ccc ttc ggg ttc tcc gtc 488 Asp Leu Ile Phe Arg Leu His Asp Thr Asn Pro Phe Gly Phe Ser Val aca cgc cgc tcc aca aac gac gtc ctc ttc gac acc cgc tcc gct gat 536 Thr Arg Arg Ser Thr Asn Asp Val Leu Phe Asp Thr Arg Ser Ala Asp ccc gag aca gac ccg gtc ggg cta gtc ttc aag gac caa tac atc caa 584 Pro Glu Thr Asp Pro Val Gly Leu Val Phe Lys Asp Gln Tyr Ile Gln ctc tcc tcc tcc ctc ccg gcc gac cgg tcc aac cta tat ggg atc ggt 632 Leu Ser Ser Ser Leu Pro Ala Asp Arg Ser Asn Leu Tyr Gly Ile Gly gag cac acc aag ccc acc ttt agg ttg gct cgt aat caa acc ctc act 680 Glu His Thr Lys Pro Thr Phe Arg Leu Ala Arg Asn Gln Thr Leu Thr cta tgg aat gcc gac att gct agc tac aat gtg gac tta aac ctc tac 728 Leu Trp Asn Ala Asp Ile Ala Ser Tyr Asn Val Asp Leu Asn Leu Tyr ggc tct cac ccg ttc tac ctc gac gtc cgt gca cca ctc gga acc tcc 776 Gly Le His As Phe Tyr Va l Arg Ala Pro Leu Gly Thr Ser aac ggc gtc ttg tta ctt aat agc aac ggg atg gac gtg gag tat acc 824 Asn Gly Val Leu Leu Leu Asn Ser Asn Gly Met Asp Val Glu Tyr Thr ggt gat aag atc aca tac aag gtg atc ggc ggt att gtc gat ttg tac 872 Gly Asp Lys Ile Thr Tyr Lys Val Ile Gly Gly Ile Val Asp Leu Tyr gtg ttc gag ggt ccg act ccc gat gaa gtc gtg caa cag tat acc gag 920 Val Phe Glu Glu Pro Thr As Pro Thr Val Val Gln Gln Tyr Thr Glu ctc atc gga aga ccg gcc cct atg cct tat tgg tca ttc ggc ttc cat 968 Leu Ile Gly Arg Pro Ala Pro Met Pro Tyr Trp Ser Phe Gly Phe His caa tgc cga tac gag tac cgc aac attgt gtt gtc gag aac gta gtt 1016 Gln Cys Arg Tyr Glu Tyr Arg Asn Ile Ser Val Val Glu Asn Val Val aaa gca tac tcg act atg aga atc cct ctc gaa gca atg tgg acg gac 1064 Lys Ala Tyr Ser Thr Met Arg Ile Pro Leu Glu Ala Met Trp Thr Asp atc gat tac atg gaa gca aac aag gac ttt acc gtt gat cct gtc aat 1112 Ile Asp Tyr Met Glu Ala Asn Lys Asp Phe Thror Val Asp Pro Val Asn ttc ccg ctg gat aag atg gt ag ttc gtc aag ctt cat aaa aac 1160 Phe Pro Leu Asp Lys Met Gln Arg Phe Val Asn Lys Leu His Lys Asn ggc caa aag tac gtt gcc ata ttg gat ccc ggg att aac ata aac acc 1208 Gly Gln Lys Tyr Val Ala Ile Leu Asp Pro Gly Ile Asn Ile Asn Thr act acc tat ggt aca ttt caa aga gct atg aaa gcg gat atc ttc atc 1256 Thr Thr Tyr Gly Thr Phe Gln Arg Ala Met Lys Ala Asp Ile Phe Ile aag aga caa gga gag ccg tat caa ggc gag gtt tgg cct ggt cca gtc 1304 Lys Arg Gln Gly Glu Pro Tyr Gln Gly Glu Val Trp Pro Gly Pro Val tat ttc ccg gat ttt ctt aac ccg aaa aca act atc ttc tgg ata tcc 1352 Tyr Phe Pro Asp Phe Leu Asn Pro Lys Thr Thr Ile Phe Trp Ile Ser gaa att caa aca ttc ttc aat gct ctt cca gtc gac ggt ctt tgg att 1400 Glu Ile Gln Thr Phe Phe Phe Asn Ala Leu Pro Val Asp Gly Leu Trp Ile gac atg aac gag gtt tcg aat ttc atc ccc atc ccg gat 1448 Asp Met Asn Glu Val Ser Asn Phe Ile Ser Ser Pro Pro Ile Pro Asp tct ccg cta gac aat ccg ccc tat gtc atc aac aac tcc ggt ggt cgg 1496 Ser Pro Leu Asp Asn Pro Pro Tyr Val Ile Asn Asn Ser Gly Gly Arg aga cct atc aac gag aaa acc att ccg gta tca tcc gtg cat tac gga 1544 Arg Pro Ile Asn Glu Lys Thr Ile Pro Val Ser Ser Val His Tyr Gly aat gta tcc gat tat aat gta cac aat ctt tat ggc tac ttg gag gcc 1592 Asn Val Ser Asp Tyr Asn Val His Asn Leu Tyr Gly Tyr Leu Glu Ala aca gca acc aat gtt gcc ctc aag aag gtg act aaa caa aga ccg ttc 1640 Thr Ala Thr Asn Val Ala Leu Lys Lys Val Thr Lys Gln Arg Pro Phe gtt ctc tcg agg tct aca ttc atc gga tcc gga aag tat acg gca cat 1688 Val Leu Ser Arg Ser Thr Phe Ile Gly Ser Gly Lys Tyr Thr Ala His tgg acc gga gac aat gct gca aca tgg aca aat atg gca gct tcc att 1736 Trp Thr Gly Asp Asn Ala Ala Thr Trp Thr Asn Met Ala Ala Ser Ile cct acg att ctc gac ttc ggc ttg ttc gga att ccg atg ata gga gcc 1784 Pro Thr Ile Leu Asp Phe Gly Leu Phe Gly Ile Pro Ile Gly Ala gat atc tgc ggc ttt gct tac acc aca acc gaa gag ctt tgt cga cgt 1832 Asp Ile Cys Gly Phe Ala Tyr Thr Thr Thr Glu Glu Leu Cys Arg Arg tgg ata caa ctc gga gct ttc tac cct ttc tct aga gat cat tca gac 1880 Trp Ile Gln Leu Gly Ala Phe Tyr Pro Phe Ser Arg Asp His Ser Asp aac ttg agt gag cct caa gaa ctc act caa tgg gga tca gtg act gaa 1928 Asn Leu Ser Glu Pro Gln Glu Leu Thr Gln Trp Gly Ser Val Thr Glu tcc gca agg aaa gta ctc ggc ctt cga tat cga cta ctc ccc tac tac 1976 Ser Ala Arg Lys Val Leu Gly Leu Arg Tyr Arg Leu Leu Pro Tyr Tyr tac aca cta atg tac gag gca cat aag aaa gga act cct att gca cgc 2024 Tyr Thr Leu Met Tyr Glu Ala His Lys Lys Gly Thr Pro Ile Ala Arg ccg ctc ttc ttc tca ttc ccc aac gac ccg aac acg tac ggt atc gac 2072 Pro Leu Phe Phe Ser Phe Pro Asn Asp Pro Asn Thr Gly Ile Asp gct caa ttt ctc atc gga aag ggt gtg atg gtc tct ccg gtg tta acc 2120 Ala Gln Phe Leu Ile Gly Lys Gly Val Met Val Ser Pro Val Leu Thr caa ggt gct acc agc gtc acc gcg tac ttc cca tcc tgg ttt 2168 Gln Gly Ala Thr Ser Val Thr Ala Tyr Phe Pro Ser Gly Asn Trp Phe aat ctc ttc aat tac acg aag acg gtt agt tcc ccg gcc aac ggg tct 2216 Asn Leu Phe Asn Tyr Thr Lys Thr Val Ser Ser Pro Ala Asn Gly Ser ttt gtt acg ctt gat gca cca ctc aag gag ata aat gtt cat gtt cga 2264 Phe Val Thr Leu Asp Ala Pro Leu Lys Glu Ile Asn Val His Val Arg gag gga agt att ttg gct tta caa ggg gaa gca atg acg aca aga gaa 2312 Glu Gly Ser Ile Leu Ala Leu Gln Gly Glu Ala Met Thr Thr Arg Glu gcg agg aac acg cca ttt gag ttg gtg gta gtg atc agc gat tcg ggt 2360 Ala Arg Asn Thr Pro Phe Glu Leu Val Val Ile Asp Ser Gly aat ggt agt agc att gga tcg gtt ttc tta gac aat gga gtc gat atc 2408 Asn Gly Ser Ser Ile Gly Ser Val Phe Leu Asp Asn Gly Val Asp Ile gag atg gga gat gat gga gga aga tgg agc ttg gtt ac tct gca 2456 Glu Met Gly Asp Asp Gly Gly Arg Trp Ser Leu Val Thr Phe Ser Ala gga ttg gta ggt aat aat aag gtg acg att acg tcg agt gtt gta aat 2504 Gly Leu Val Gly Asn Asn Lys Val Thr Ile Thr Ser Ser Val Val Asn ggt cga ttt gct ctc tca caa gga tgg aag att agt aaa gtg acc att 2552 Gly Arg Phe Ala Leu Ser Gln Gly Trp Lys Ile Ser Lys Val Thr Ile ttg ggg ttg agt aga ggg agc caa gtg aaa ggt tac aca tg cta agt 2600 Leu Gly Leu Ser Arg Gly Ser Gln Val Lys Gly Tyr Thr Met Leu Ser att gga cga gtt gtg acg aca agt gcg aaa ggt gcg agg aag tgt tct 2648 Ile Gly Arg Val Val Thr Thr Ser Ala Lys Gly Ala Arg Lys Cys Ser aag ggt acg ggg aag ttt gat gtg gtg gag ata ccc aat cta agc tta 2696 Lys Gly Thr Gly Lys Phe Asp Val Val Glu Ile Pro Asn Leu Ser Leu ctt gtt gga agg aac ttc aag cta gat att caa atc accat tgc tag 2744 Leu Val Gly Arg Asn Phe Lys Leu Asp Ile Gln Ile Thr Asn Cys * ggtaatgttg tatcttagag gctatcattt tgtgaaacaa gtgagctcac aaaaaatgcg 2804 gtgaaagtaa ataaagagat gagtgaaaaaa2aaa <aaa> aaa aaaaaaaaaaaaaaa2aaaaaaaagtaaaaa2 <400> 5 ttg aat tcg aat cgg atg agg tcg tc 26 <210> 6 <211> 21 <212> DNA <213> Artificial sequence <400> 6 atc atc gaa tcc cga aca agc 21 <210> 7 <211> 29 <212> DNA <213> Artificial sequence <400> 7 ttg cgg ccg cta gca att ggt gat ttg aa 29 <210> 8 <211> 29 <212> DNA <213> Artificial sequence <400> 8 ttg gta cca tca tgg gca aac aca ctc ac 29 <210> 9 <211> 29 <212> DNA <213> Artificial sequence <400> 9 ttc ctg cag gta gca att ggt gat ttg aa 29

[Brief description of the drawings]

FIG. 1 shows the substrate specificity of buckwheat-derived α-glucosidase.

FIG. 2 shows a restriction map of a vector that functions in the genus Pichia.

FIG. 3 shows a restriction map of a vector that functions in the genus Pichia.

FIG. 4: Saccharomyces (Saccharomyces)
2 shows restriction maps of (cerevisiae) and (Schizosaccharomyces pombe) vectors.

FIG. 5: Saccharomyces
2 shows restriction maps of (cerevisiae) and (Schizosaccharomyces pombe) vectors.

FIG. 6 shows a restriction map of a shuttle vector used for mold transformation.

FIG. 7 shows a procedure for constructing an expression plasmid in Example 1.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (Reference) C12N 9/24 C12N 5/00 A (72) Inventor Ken Yamamoto 2954 Imaizumi 2954 Imaizumi, Fuji City, Shizuoka Prefecture Takehiro Unno 703-25 Nakamaru Nakamaru, Fuji City, Shizuoka Prefecture (72) Inventor Mikio Yamamoto 110-23 Miyashita, Fuji City, Shizuoka Prefecture F term (reference) 4B024 AA05 BA12 CA04 CA12 DA11 DA12 GA14 GA21 HA03 4B050 CC01 DD13 FF05E LL02 4B065 AA69X AA7789 AA79A AB01 AC14 BA03 BA10 CA31 CA41

Claims (11)

[Claims] 1. A recombinant vector containing a buckwheat-derived α-glucosidase gene. 2. The buckwheat-derived α-glucosidase gene comprises:
The recombinant vector according to claim 1, which is a gene encoding the following protein (a) or (b) or a gene consisting of the following DNA (c) or (d): (a) SEQ ID NO: 1 or SEQ ID NO: 2 described in the sequence listing
Or a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 1 to 87 shown in SEQ ID NO: 2
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a), and having a buckwheat-derived α-glucosidase activity; SEQ ID NO: 3 or SEQ ID NO: 4 described in
DNA consisting of the nucleotide sequence of SEQ ID NO: 89 to 2794 shown in SEQ ID NO: 3, or DNA consisting of the nucleotide sequence of SEQ ID NO: 39 to 2744 shown in SEQ ID NO: 4 (d) (c ) And a DNA encoding a protein having buckwheat-derived α-glucosidase activity that hybridizes under stringent conditions 3. The recombinant vector according to claim 1, wherein the vector is a vector that functions in yeast. 4. The vector that functions in yeast is a genus Pichia.
The recombinant vector according to claim 3, which is a vector that functions in the genus Sia), Saccharomyces (genus Saccharomyces) or Schizosaccharomyces (genus Schizosaccharomyces). 5. The recombinant vector according to claim 1, wherein the vector is a vector that functions in fungi. 6. The vector that functions in fungi is Rhizopus niveus or Rhizopus delmer (R).
hizopus delemar).
3. The recombinant vector according to item 1. A transformant comprising the recombinant vector according to any one of claims 1 to 6. 8. The transformant according to claim 7, wherein the host is a microorganism, yeast or mold. 9. The transformant according to claim 7, wherein the host is yeast and the recombinant vector is the recombinant vector according to claim 3 or 4. 10. The transformant according to claim 7, wherein the host is a mold and the recombinant vector is the recombinant vector according to claim 5 or 6. 11. A method for producing α-glucosidase, comprising culturing the transformant according to claim 7 and collecting α-glucosidase from the culture.