JP2002017371A - Polypeptide of heparitinase t-iv and dna encoding the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To establish a method for providing inexpensively and on a large scale heparitinase T-IV in a pure form by elucidating the whole structure of the gene encoding heparitinase T-IV of Basillus circulans strain HpT298, followed by the genetic engineering technique. SOLUTION: This method comprises the steps of determining a partial amino acid sequence of purified heparitinase T-IV derived from Bacillus circulans strain HpT298, and screening a DNA library obtained from genomic DNA fragments obtained from the strain to obtain whole-length heparitinase T-IV gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a polypeptide of heparitinase, a DNA encoding the same, a recombinant DNA containing the DNA, a transformant transformed with the recombinant DNA,
And a method for producing a polypeptide of heparitinase T-IV using the transformant.

[0002]

BACKGROUND ART Heparitinase is an enzyme that cleaves the glucosaminide bond between heparan sulfate and heparin, and is useful as a reagent for elucidating the functions of heparan sulfate and heparin in a living body or for analyzing these substances in biological components. Also,
For the preparation of low molecular weight heparin which has potential therapeutic value as an antithrombin agent or an antitumor agent, as a low molecular weight agent or to reduce the side effects of heparin which is a problem during treatment with extracorporeal circulation device. Its usefulness is also attracting attention as a material (heparin-removing agent), and its various uses can be expected for diagnostic and therapeutic purposes.

As the heparitinase used in these applications, those having various substrate specificities recognizing differences in the sugar chain structure, such as the presence or absence of a sulfate group bound to the sugar chain and the binding position, are known. Morikawa et al. Searched for the enzyme-producing microorganisms and found that from the cultures of bacteria belonging to the genus Flavobacterium, three species (JP-A-2-57183) and the heat-resistant bacterium Bacillus circulans HpT298 were used.
Four types of thermostable enzymes having different substrate specificities (JP-A-4-278087) have been found from the strains. Horikoshi et al. Reported that certain microorganisms belonging to the genus Bacillus (Bacillus sp.
BH100 strain), a heat-stable heparin-degrading enzyme has been discovered (JP-A-2-142470).

Among these heparitinases, heparitinase T-IV, one of four enzymes produced by Bacillus circulans HpT298 strain, acts on heparan sulfate and heparin, and is an unsaturated disaccharide as a degradation product. Uronic acid-glucosamine-N-sulfuric acid, uronic acid-glucosamine-N, 6-disulfuric acid, uronic acid-2-sulfuric acid-glucosamine-
N-sulfuric acid, uronic acid-2-sulfuric acid-glucosamine-N-sulfuric acid, has a unique specificity of producing uronic acid-2-sulfuric acid-glucosamine-N, 6-disulfuric acid, It is useful as a reagent for elucidating the function of heparin in a living body or for analyzing these substances in a biological component.

[0005] Purified heparitinase T-IV is obtained by culturing enzyme-producing bacteria in a medium containing peptone, yeast extract, and sodium chloride to which heparin has been added as an inducing agent. It can be easily produced together with the other three enzymes by isolation and purification. However, 20
The purified heparitinase T-IV obtained from the culture of L is about 6 units, and the yield of the enzyme from the culture is as low as 0.73%. Therefore, there is a need for a method for obtaining an enzyme in an industrially usable amount as a low-molecular-weight agent at the time of preparing low-molecular-weight heparin or as a material for reducing side effects of heparin, which is a problem during treatment with an extracorporeal circulation device. And it was.

[0006]

The present inventors have attempted to obtain gene DNA for heparitinase T-IV from Bacillus circulans strain HpT298 (JP-A-10-234).
No. 370).

However, when the resulting DNA was expressed, heparitinase T-IV was partially expressed but had no enzymatic activity.

Accordingly, an object of the present invention is to clarify the structure of the entire gene encoding heparitinase T-IV of Bacillus circulans HpT298 strain, and to obtain heparitinase T-IV in a pure form at low cost by genetic engineering techniques. Establish a way to provide large quantities.

[0009]

Means for Solving the Problems The present inventors have made intensive studies to solve the above-mentioned problems, and as a result, the above-mentioned Bacillus.
Clarification that the coding region of heparitinase T-IV spreads further upstream of the region thought to be the gene encoding heparitinase T-IV of Circulance HpT298 strain, and obtained the entire sequence of heparitinase T-IV. By expressing this by genetic engineering techniques, heparitinase T-
The first successful preparation of IV by genetic recombination has completed the present invention.

That is, the gist of the present invention is as follows. (1) The following or the polypeptide of heparitinase T-IV. A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2. A polypeptide comprising an amino acid sequence having substitution, deletion, insertion or transposition of one or several amino acids in the amino acid sequence of the polypeptide described above, and having the heparitinase activity of the polypeptide.

(2) Heparitinase T-IV described below or
DNA encoding the polypeptide of A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2. A polypeptide comprising an amino acid sequence having substitution, deletion, insertion or transposition of one or several amino acids in the amino acid sequence of the polypeptide described above, and having the heparitinase activity of the polypeptide.

(3) DNA comprising any one of the following base sequences: The base sequence described in SEQ ID NO: 1. A base sequence consisting of base numbers 112 to 3264 described in SEQ ID NO: 1. Or a base sequence of a DNA which hybridizes to a DNA consisting of the base sequence under stringent conditions. A nucleotide sequence complementary to any one of the following:

(4) A recombinant vector containing the DNA according to (2) or (3).

(5) A transformant transformed with the DNA according to (2) or (3).

(6) A transformant transformed with the recombinant vector according to (4).

(7) The transformant according to (5) or (6) is cultured or grown, and a heparitinase T-IV polypeptide is collected from the culture or the grown body. A method for producing a polypeptide.

[0017]

BEST MODE FOR CARRYING OUT THE INVENTION
The present invention will be described in detail.

<1> The polypeptide of the present invention and the DNA of the present invention
T-IV polypeptide. A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2. A polypeptide comprising an amino acid sequence having substitution, deletion, insertion or transposition of one or several amino acids in the amino acid sequence of the polypeptide described above, and having the heparitinase activity of the polypeptide.

The DNA of the present invention is a DNA encoding the polypeptide of the present invention. Specific examples of the DNA of the present invention include a DNA having a nucleotide sequence encoding all of the amino acid sequence of SEQ ID NO: 2, which is a polypeptide of heparitinase T-IV derived from Bacillus circulans, and is preferable. Substitution of about 1 to 50 amino acids in the amino acid sequence,
The DNA of the present invention also includes a polypeptide having an amino acid sequence having a deletion, insertion or transposition, and having a nucleotide sequence encoding a polypeptide having the same heparitinase activity as the polypeptide having the amino acid sequence of SEQ ID NO: 2. You.

That is, there is no limitation as long as the polypeptide encoded by the DNA has heparitinase activity of heparitinase T-IV.

Specifically, DNA having the nucleotide sequence of SEQ ID NO: 1, DNA having the nucleotide sequence of nucleotides 112 to 3264 of SEQ ID NO: 1, and hybridizing to these DNAs under stringent conditions DNA. Examples of the other DNA of the present invention include DNA and RNA having a base sequence complementary to the DNA having the above-described base sequence. Further, the DNA may be single-stranded or double-stranded. It does not matter.

The above stringent conditions are defined as 50
% Formamide, 5 × SSPE (sodium chloride / sodium phosphate / EDTA (ethylenediaminetetraacetic acid) buffer), 5
× Denhardt solution (Denhardt solution: 0.02% BSA, 0.02%
Polyvinylpyrrolidone, 0.02% Ficall 400), 0.5% SD
S (sodium dodecyl sulfate), denatured salmon sperm DNA 200μ
In the presence of g / ml, the conditions at 42 ° C. and under substantially the same conditions are exemplified. That is, the stringent conditions are conditions used for normal gene hybridization, and include Northern blot, Southern blot,
The conditions used for screening using hybridization and the like are included in the “stringent conditions” herein.

The above-mentioned heparitinase activity can be measured, for example, by the same method as described in Examples below, and those skilled in the art can use the amino acid of SEQ ID NO: 2 as an indicator based on the presence or absence of the desired enzyme activity. It is possible to easily select a polypeptide having an amino acid sequence having a mutation such as substitution, deletion, insertion or transposition of one or more amino acids which does not substantially impair the heparitinase activity of the polypeptide having the sequence. it can. Substitution, deletion, of DNA base sequence causing such amino acid sequence mutation,
Mutations such as insertion or transposition are introduced into DNA by, for example, synthesizing a sequence having both ends of a restriction enzyme at both ends and including both sides of the mutation point, and replacing the corresponding portion of the base sequence of the unmutated DNA. can do. In addition, site-directed mutagenesis (Kremer, W. and Frits, HJ, Meth. In
Enzymol., 154, 350 (1987); Kunkel, TA et al., Me
th. In Enzymol., 154, 367 (1987)), and such a mutation can be introduced into DNA. In addition, it is predicted that differences in amino acid sequence that do not substantially impair heparitinase activity may exist between strains or individuals due to spontaneous mutation or artificial mutation. A polypeptide comprising the amino acid sequence having such a difference and a DNA encoding the same are also a polypeptide of the present invention and a DNA of the present invention.
Is included.

It is easily understood by those skilled in the art that DNAs having different base sequences due to the degeneracy of the genetic code are included in the DNA of the present invention as long as they encode the same amino acid sequence.

The DNA of the present invention preferably has a nucleotide sequence of the nucleotide sequence of SEQ ID NO: 1 which corresponds to the nucleotide sequence of nucleotides 112 to 3264.
9 calculated using etix-mac (manufactured by Software Development Company)
It has a base sequence having 0% or more homology. In addition, the polypeptide of the present invention is preferably a genetix-mac (manufactured by Software Development Co.) based on the amino acid sequence of SEQ ID NO: 2.
Has an amino acid sequence having a homology of 95% or more as calculated using

The DNA of the present invention is a purified heparitinase TI
Using the nucleotide sequence corresponding to the amino acid sequence of the degradation product of V as a primer, various restriction enzyme digested fragment DNAs of Bacillus circulans genomic DNA are amplified by PCR, and screening with the amplified product, nucleotide sequence analysis, and the obtained fragment Can be obtained by repeating further restriction enzyme digestion and analysis using the digested fragment. In addition, by artificially preparing primers based on the nucleotide sequence of the DNA of the present invention disclosed by the present invention and using the primers, those skilled in the art can use mammals such as humans and Bacillus such as microorganisms.
CDNA libraries derived from sources other than circulatory
It can be prepared from RNA or the like. The DNA of the present invention can be prepared by a preparation method comprising the following steps.

(1) Preparation of Probe The probe used for obtaining the DNA of the present invention is, for example, purified heparitinase T-IV obtained by purifying from a culture such as a culture solution of Bacillus circulans or a cell extract. Of the fragment obtained by decomposing the amino acid sequence with a proteolytic enzyme or cyanogen bromide (for example, SEQ ID NO: 3 and SEQ ID NO: 4 (amino acid numbers 259 to 272 (peptide I) and 715 to 729 (peptide III of SEQ ID NO: 2) ) Can be created based on)). Usually, a region having less codon degeneracy is selected from the nucleotide sequence corresponding to the above amino acid sequence and used as a probe. The base sequence of the probe thus prepared includes, for example, the sequences described in SEQ ID NO: 5 and SEQ ID NO: 6 (FIG. 1).

Once the nucleotide sequence is determined, the probe can be easily prepared according to a conventional method. It is preferable that the prepared probe be labeled in some way so that it can be used for screening later. Labeling can be performed by a commonly used method. For example, a radioactive label, a fluorescent label and the like are preferable from the viewpoint of easy detection.

(2) Primary screening from genomic DNA Using the probe prepared above, a region containing the DNA of the present invention is selected from the genomic DNA. Usually, genomic DNA is digested with a restriction enzyme, and the obtained restriction enzyme fragment is fractionated by, for example, a method such as gel electrophoresis, and the probe is hybridized to have a base sequence complementary to the probe. The region of the genomic DNA is identified. Examples of the restriction enzyme include BamHI, EcoRI, HindIII, PstI, SalI and the like. As the hybridization conditions, the hybridization conditions used for ordinary gene screening can be used. For example, after pre-hybridization is performed for about 1 hour using a 6 × SSC, 1% SDS, and 5 × Denhardt solution, the above-described probe is added, and the mixture is shaken at 37 to 42 ° C. for 10 hours or more. Restriction enzyme fragments identified when using the probe having the nucleotide sequence of SEQ ID NO: 5 described above include, for example, 4.8 kb for BamHI, and 4.8 kb for EcoRI.
5.4kb, 6.2kb for HindIII, 9.9kb for PstI, Sa
In the case of lI, a 1.3 kb fragment is exemplified. It is preferable to use a restriction enzyme that generates a fragment that hybridizes even when a plurality of probes are used. When the probes of SEQ ID NO: 5 and SEQ ID NO: 6 are used, the 1.3 kb band obtained by SalI digestion can It is more preferable to use SalI in order to hybridize to the probe.

(3) Analysis of base sequence and preparation of secondary probe A recombinant plasmid is prepared according to a conventional method using a restriction enzyme fragment of genomic DNA to which the probe obtained by the above-mentioned method hybridizes. . That is, genomic DNA prepared from a strain expressing heparitinase T-IV prepared according to a conventional method is completely digested with the restriction enzyme used to prepare the restriction enzyme fragment selected above. After digestion, a DNA fragment having a target molecular weight is separated from the digested product according to a conventional method such as agarose gel electrophoresis, and a DNA fragment having a target molecular weight is recovered according to a conventional method.
This fragment is introduced into an appropriate plasmid vector according to a conventional method. If the plasmid vector is a plasmid vector having a cleavage site for the restriction enzyme used for preparing the DNA fragment, the plasmid fragment can be inserted by treating the plasmid vector with the restriction enzyme. It is preferable because it is possible. A plasmid vector into which the DNA fragment obtained by the method described above has been introduced,
The plasmid vector is introduced into a host bacterium, such as Escherichia coli, into which the plasmid vector can be introduced according to a conventional method, and the host strain is transformed.

The transformed host cells are subjected to colony hybridization using the probe used in the above-mentioned hybridization according to a conventional method, to identify colonies containing the target DNA fragment, and to constitute the identified colonies. The host bacteria are recovered and the introduced plasmid vector is isolated according to a conventional method. In addition, the probe prepared by the same procedure as that used in the above-mentioned hybridization is used. The DNA fragment incorporated in the recovered plasmid vector is cut out and isolated according to a conventional method,
Labeling can be performed using a known labeling method such as a fluorescent label or a radioactive label, and the resultant can be used as a probe for secondary screening in the next step (secondary probe).

For example, the restriction enzymes Sa to which the probes of SEQ ID NO: 5 and SEQ ID NO: 6 exemplified above hybridize.
When using a restriction enzyme fragment of about 1.3 kb generated by treatment with lI, for example, restriction enzyme SalI is added to 10 μg of chromosomal DNA of Bacillus circulans HpT298 strain prepared according to a conventional method.
30 units (U) are added, and the total volume is 200 μl, and the reaction is carried out for 1 hour or more, preferably 2-3 hours. After completion of the reaction, agarose gel electrophoresis is performed, and a DNA fragment of about 1 to 3 kb is recovered by cutting out the gel. A recombinant plasmid vector can be prepared by ligating the recovered fragment to a plasmid vector treated with SalI, for example, a pUC18 plasmid having its 5 ′ end dephosphorylated with alkaline phosphatase. The plasmid vector thus prepared is incorporated into a host cell suitable as a host for the plasmid vector to prepare a library. When pUC18 is used, for example, E. coli JM1
09 can be used as a host bacterium.

(4) Secondary Screening Using Secondary Probe Further secondary screening is performed using the secondary probe obtained in the above step. That is, a strain expressing heparitinase T-IV (preferably Bacillus circulans HpT2
98) is treated with a restriction enzyme different from the restriction enzyme used in preparing the secondary probe to prepare a restriction enzyme fragment. For example, when the restriction enzyme SalI is used for the preparation of the secondary probe, it is preferable to use other restriction enzymes, and examples of the restriction enzyme that can be used as such include HaeIII.
When a DNA fragment of a certain size (preferably 4 to 6 kb) is prepared, a sequence that hybridizes with the secondary probe is more likely to be generated. Therefore, when preparing a restriction enzyme fragment using HaeIII, Partial digestion is preferable to complete digestion. The degree of partial digestion varies depending on conditions such as the amount of enzyme and temperature. For example, 2 units of enzyme can be added to 2 μg of DNA for about 2 to 5 minutes.

The thus obtained restriction enzyme fragments are fractionated by molecular weight, for example, by a method such as electrophoresis, and a 4-6 kb fragment is recovered according to a conventional method. The collected restriction enzyme fragment is introduced into a phage vector according to a conventional method, and the phage is infected with a host bacterium to introduce the restriction enzyme fragment into the host bacterium and perform plaque hybridization. As the phage vector, a commonly used commercially available phage vector can be used. For example, Predigested Lamda manufactured by Stratagene, Inc.
Zap II / EcoRI / CIAP vectors are preferred for convenience.
This phage vector is packaged in a phage outer shell by a conventional method to infect a host bacterium. For packaging, for example, Gigapack III Gold packaging extract
(Manufactured by Stratagene) or the like can be used. When the above-described phage vector is used, E. coli (for example, C.
600hf1, XL-1 Blue, etc.).
L1-Blue is preferred because simple selection by color is possible.

From the plaque formed on the culture plate, DNA contained in the plaque is prepared in accordance with a conventional method, for example, on a nylon membrane, and the DNA can be subjected to hybridization with a secondary probe. Hybridization can be performed in the same manner as in the method described in (2).

(5) Recovering Restriction Enzyme Fragments and Analysis of Nucleotide Sequence Phage can be recovered from plaques that show positive hybridization results by a conventional method, and restriction enzyme fragments contained in the phage can be cut out. For example, Exassist hepler phag
Using e and E. coli XL1-Blue etc., the DNA containing the restriction enzyme fragment in the above host bacteria can be purified as a plasmid, and the nucleotide sequence of the restriction enzyme fragment incorporated therein can be analyzed. .

Based on the analyzed base sequence, a restriction enzyme fragment containing the most upstream region is recovered. Then, this restriction enzyme fragment is treated with a restriction enzyme corresponding to a restriction enzyme region present in the most upstream region of the restriction enzyme fragment, and the newly generated short fragment is used as a tertiary probe below.

When the above-mentioned secondary screening is performed using a restriction enzyme fragment generated by digestion of genomic DNA of a heparitinase T-IV producing bacterium with HaeIII,
The fragment containing the region near the end has a size of about 5 kb, and a fragment of about 0.5 kb can be obtained by treating this restriction enzyme fragment with EcoRI. This can be a tertiary probe.

(6) Tertiary Screening After the tertiary probe obtained above is labeled by a known labeling method, each restriction enzyme digested fragment of genomic DNA is screened again in the same manner as described in (2).

From the nucleotide sequences obtained in the secondary screening and the tertiary screening, the nucleotide sequence and restriction enzyme region of each restriction enzyme fragment are analyzed to determine which fragment contains the DNA of the present invention. be able to.

For example, Bacillus circulans HpT298
When DNA is used for screening, when a restriction enzyme fragment by HaeIII is screened in a secondary screening and a restriction enzyme fragment by SalI in a tertiary screening, a SalI fragment of 2.5 kb is obtained by the tertiary screening. When a restriction map is created from the results of base sequence analysis of the restriction fragments obtained in the secondary screening and the tertiary screening, a restriction map such as that shown in FIG. 6 is obtained.

(7) Construction of the DNA of the Present Invention The DNA of the present invention is prepared based on the above restriction enzyme map. That is, the DNA of the present invention can be obtained by joining short restriction enzyme fragments by a known method.

For example, according to the above restriction enzyme map, Ps
A 1.5 kb fragment having a tI region and an EcoRI region is prepared by a known method and introduced into an appropriate plasmid vector. Then, after treating this plasmid vector with EcoRI, a fragment of about 5 kb obtained in the secondary screening previously treated with EcoRI is ligated, thereby containing the DNA of the present invention containing about 5.
A 5 kb DNA fragment can be obtained.

By introducing the plasmid vector or a DNA fragment containing the DNA of the present invention cut out therefrom into an appropriate host, the DNA of the present invention can be expressed to produce the polypeptide of the present invention.

The polypeptide of the present invention can be more specifically obtained by the production method of the present invention described below.

The polypeptide of the present invention and its partial peptide can be used as an immunogen to produce an antibody against the polypeptide of the present invention.

Specifically, a polypeptide having, for example, all or a part of the amino acid sequence of SEQ ID NO: 2 and having at least the amino acid sequence characteristic of the polypeptide of the present invention is administered to an animal other than human as an immunogen. Then, a polyclonal antibody or a monoclonal antibody can be prepared according to a conventional method. The animal immunized with the immunogen is not limited to animals, and is not limited as long as it is an animal other than human and can produce antibodies by sensitization with the above-mentioned immunogen, for example, rat, mouse, guinea pig, hamster, rabbit, goat , Sheep, cows, horses, pigs, chickens, ducks, etc., with rabbits, mice, rats and goats being particularly preferred.

When administering the immunogen to an animal, a mixture (suspension) of the above-mentioned immunogen and an adjuvant (complete Freund's adjuvant, incomplete Freund's adjuvant, aluminum adjuvant, pertussis adjuvant, etc.) is preferably prepared by a conventional method. It is administered subcutaneously, intradermally, intravenously or intraperitoneally to the animals.

After the initial administration, if booster immunization is carried out once every 1 to 5 weeks, about 1 to 5 times, antibodies to the above immunogen are produced in the body of the immunized animal. The antibody produced in this way is collected as a polyclonal antibody or a monoclonal antibody by a conventional method.

The antibody may have amino acids 1 to 20 of SEQ ID NO: 2.
It is preferable to recognize an area corresponding to 0. Such an antibody may be selected, for example, as one that recognizes a polypeptide having the full length of the amino acid sequence of SEQ ID NO: 2, but does not recognize a polypeptide consisting of amino acid residues 201 to 1051 of the same amino acid sequence. Can be.

The antibody thus prepared can be used, for example, by binding it to an affinity carrier during affinity purification of the polypeptide of the present invention.

(2) The recombinant vector of the present invention, the transformant of the present invention, and the production method of the present invention The enzyme production method of the present invention comprises a method for producing a heparitinase T-IV polypeptide or the enzyme using the DNA of the present invention. It is.

The cells of microorganisms, animals and plants transformed with the DNA of the present invention are cultured or grown, and the polypeptide of the present invention is produced and accumulated in or in the medium, and the culture (medium and / or cells) Alternatively, the polypeptide of the present invention can be produced by collecting the polypeptide of the present invention from a living body (cell).

[0054] A recombinant plasmid is constructed by inserting the DNA of the present invention into a known expression vector, and transformation is performed using the recombinant plasmid, whereby cells (transformants) transformed with the DNA of the present invention are transformed. Obtainable. still,
The present invention is a recombinant plasmid or recombinant vector containing the DNA of the present invention, and the DNA of the present invention has been introduced,
The present invention also provides a transformant (for example, a transformant transformed with the above-mentioned recombinant vector) that can express the DNA of the present invention and can be used for production of the polypeptide of the present invention.

Examples of the cells include mammals, insects, yeasts, Bacillus subtilis, and Escherichia coli cells.

In the method of the present invention, a host-vector system generally used for protein production can be used. Particularly, a combination of a prokaryotic host cell such as Escherichia coli with a phage vector or a plasmid vector which can be introduced into the host cell is used. Is preferred since the polypeptide of the present invention can be prepared in large amounts from the DNA of the present invention, but is not particularly limited. Specifically, E. coli and p
UC vectors, pET vectors and the like. The medium and culture conditions are appropriately selected according to the host used, that is, the cells.

The DNA of the present invention can be used to express the polypeptide of the present invention and a fusion peptide of the polypeptide of the present invention and another polypeptide.

Specific examples of the method for constructing a recombinant plasmid expressing the above fusion polypeptide include the following methods. That is, the DN of the present invention contains a protein such as protein A in the same readout region as the DNA of the present invention, and has multiple protein genes in the same readout region.
A into which an expression plasmid vector (for example, pGIR201pr
otA: J. Biol. Chem. 269, 1394-1401, 1994, pcDNAI-
A: J. Biol. Chem. 274, 3215-3221, 1999) can be constructed, and a fusion polypeptide can be produced by introducing this expression plasmid vector into a host cell. It is also possible to cut out a DNA fragment encoding the fusion protein from the above-described expression plasmid vector with a restriction enzyme, ligate it to another expression plasmid vector by the same operation as described above, and introduce it into host cells.

The polypeptide of the present invention can be collected from the culture by a known polypeptide purification method. Specific examples include affinity chromatography using a Sepharose column to which heparitinase T-IV substrate or the like is bound. When expressed as a fusion polypeptide, in addition to the affinity column, the host cell may be subjected to purification treatment such as affinity chromatography to which a substance (eg, an antibody) having a high affinity for the polypeptide fused with the polypeptide of the present invention is bound. Can be purified by attaching the culture.
Furthermore, by previously incorporating a linker having an amino acid sequence that is recognized and cleaved by a specific proteolytic enzyme, for example, between the polypeptide of the present invention in the fusion polypeptide and a polypeptide of another protein, The fusion polypeptide can be cleaved to obtain the polypeptide of the present invention. Examples of the combination of the above protease and a specific sequence recognized by the protease include, for example, a combination of a signal peptidase that works during synthesis of proinsulin and a signal peptide of insulin. The above culture includes a medium and cultured cells.

[0060]

EXAMPLES The present invention will be described more specifically with reference to the following examples.

[0061]

Example 1 Preparation of DNA of the Present Invention <1> Genomic DNA of Bacillus circulans HpT298 strain
Preparation of Saito-Miura (Saito, H and Miura, K., Biochim.
ys. Acta, 72, 618 (1963)).
Genomic DNA of Circulance HpT298 strain was prepared.
Growth medium for Bacillus circulans HpT298 strain (0.75%
Polypeptone, 0.5% yeast _{extract, 0.1% K 2 HPO 4,} 0.02% MgS
_{O 4 · 7H 2 O, 0.1} % NaCl, and incubated overnight in 37 ° C. thermostatic shaking incubator at pH 7.0), to obtain the cells. The obtained cells (wet cell weight about
5 g) in 6 ml of lysozyme solution (2 mg / ml in 0.15 M NaCl-0.1
M EDTA, pH 8.0) and kept at 37 ° C. for about 30 minutes. After confirming lysis, 50 ml of 100 mM Tris-HCl (pH 9.0) -1% SDS-
A 0.1 M NaCl solution was added, and the cells were completely lysed in a 60 ° C warm bath. Subsequently, about 60 ml of saturated phenol (saturated with the above buffer solution immediately before use) was added, stirred for 20 minutes, and then centrifuged to collect an aqueous layer. 1/10 amount of cooled ethanol (−80 ° C.) was added to the aqueous layer, and DNA appearing in a thread form was collected with a glass rod. The recovered DNA was sequentially immersed in 70, 80, and 90% ethanol, and then about 30 ml of 0.1 × SSC (SSC: 0.15 M NaCl-
0.015M sodium citrate). After confirming that the DNA was completely dissolved, 10 × SSC was added to adjust the concentration to 1 × SSC. Heat treatment (to deactivate DNase)
After adding Nase to a final concentration of 50 μg / ml,
Incubated for 30 minutes. This solution was again subjected to ethanol precipitation under the above conditions, and the obtained DNA was dissolved in 5 ml of 1 × SSC.

<2> Preparation of Synthetic DNA Probe A solution of purified heparitinase T-IV derived from Bacillus circulans HpT298 (1.6 μg / ml (20 mM Tris-AcOH)) 120
Add 466.6 μl of 5% cyanogen bromide (90% formic acid) to the final concentration
A solution containing 72% formic acid was prepared and reacted at 4 ° C. in a dark place for 24 hours. The reaction was stopped by adding 10 volumes of water to the reaction solution. Centrifuge the sample solution with Centricon-3 (manufactured by Amicon) (6500r
pm), the obtained peptide was separated by SDS-polyacrylamide electrophoresis (PAGE), and transferred to a PVDF membrane. Peptides I, II and III of the resulting fragment (molecular weight 15 kDa, 2
(0 kDa, 10 kDa) and the N-terminal amino acid sequence of the untreated enzyme were analyzed using a protein sequencer (Applied Biosystems, Model 476A). As a result, the peptide
The N-terminal amino acid sequences of I and III have been determined (SEQ ID NOs: 3 and 4).

[0063] N-terminal amino acid sequence analysis of peptide II and the untreated enzyme was not possible, indicating that the N-terminal may have been modified in some way. Based on the N-terminal amino acid sequences of peptides I and III, DNA probes I and II having the nucleotide sequences shown in SEQ ID NOS: 5 and 6, respectively, were designed (FIG. 1),
It was synthesized with a DNA synthesizer (manufactured by Japan Gene Research Institute).

The synthesized probe was end-labeled with [γ- ³² P] adenosine-5′-triphosphate (about 259 TBq / mmol; manufactured by ICN) in accordance with a conventional method. That is, for the transphosphorylation reaction, polynucleotide kinase (manufactured by Nippon Gene) was used, and the reaction was performed according to the attached instructions. The radiolabeled probe was purified using a MENSORB ^™ 20 nucleic acid purification cartridge (manufactured by DuPont) according to a conventional method. That is, the cartridge was washed with 2 ml of methanol and equilibrated with 2 ml of reagent A (0.1 M Tris-HCl, 10 mM trimethylamine, 1 mM EDTA, pH 7.7). After 400 μl of reagent A was added to the entire amount of the probe solution, the solution was injected into a cartridge, and the DNA was adsorbed to the resin of the cartridge. After adsorption
After washing by adding 3 ml of reagent A and 3 ml of sterile distilled water once each, the column was eluted with 5% butanol, and the eluate was fractionated by 200 μl. Each radioactivity was measured with a liquid scintillation counter, and the one with the highest radioactivity was used.

<3> Southern Hybridization The genomic DNA obtained in <1> was ligated with restriction enzymes (BamHI, EcoRI,
After digestion completely with HindIII, PstI, SalI or MboI), agarose gel electrophoresis (using a 0.7% agarose S gel) was performed. After the electrophoresis, the DNA fragment was transferred to a membrane. That is, the gel after electrophoresis was immersed in an alkaline solution (1.5 M NaCl, 0.5 M NaOH) for 40 minutes, and the DNA fragment was alkali-denatured while shaking. After washing the gel twice with sterile distilled water, neutralize solution (0.5M Tris-HCl, 3.0M NaCl, pH
7.4), and neutralized while shaking. For blotting, four filter papers (Whatman 3MM filter papers) soaked in 20 x SSC buffer (3 M NaCl, 0.3 M sodium citrate, pH 7.0) of the same size as the gel were placed on paper towels stacked at a height of 5 cm. Pile the nylon membrane (Amersham Hybond N ⁺ pre-soaked in 20 × SSC), the gel with the blotting surface down, and 4 pieces of 3MM filter paper on top of it. The 3MM filter paper cut into pieces was overlaid, and one end thereof was immersed in 20 × SSC buffer. A glass plate and a weight of about 100 g were placed thereon, and the plate was left standing for about 2 hours to blot a DNA fragment on the membrane.
After blotting, peel off the gel and membrane, confirm that no DNA fragments remain in the gel under a UV transilluminator, wash the membrane with 2 × SSC buffer, remove the attached gel, and remove the gel at 80 ° C. For 2 hours to fix the DNA to the membrane.

After immersing the above-mentioned membrane in 2 × SSC buffer for 10 minutes, a hybridization solution (6 × SSC buffer,
1% SDS, 5x Denhardt's solution) and shake 1
Time prehybridization was performed. After the prehybridization, the probe prepared in the above <2> was added to the hybridization solution at a concentration of 2 to 5 × 10 ⁶ cpm / ml, and hybridization was carried out at 37 ° C. for 16 hours or more. After hybridization, 0.
Washing was performed three times with SSC buffer containing 1% SDS at room temperature for 10 minutes.

After washing, the membrane was air-dried and subjected to autoradiography according to a conventional method.

When DNA probe I was used, a restriction enzyme
One band was detected in genomic DNA digested with restriction enzymes other than MboI, and the length of each band was
4.8 kb, 5.4 kb for EcoRI, 6.2 kb for HindIII, 9.9 kb for PstI,
It was 1.3 kb with SalI (FIG. 2).

When DNA probe II was used, S
A band of about 1.3 kb was detected in the genomic DNA digested with alI, as in the case of the DNA probe I, but no band was detected in the genomic DNA treated with other restriction enzymes (FIG. 3). ).

<4> Preparation of secondary probe Bacillus circulans prepared in the same manner as in <1>
To 10 μg of the genomic DNA of the HpT298 strain, 30 U of restriction enzyme SalI was added, and the mixture was reacted for 3 hours in a total reaction volume of 200 μl for complete digestion. After completion of the reaction, agarose gel electrophoresis was performed to recover a DNA fragment of 1 to 3 kb. This recovered fragment was mixed with a plasmid pUC18 that had been cut with SalI in advance and the 5 ′ end of the cut surface was dephosphorylated with alkaline phosphatase (Bacterial Alkaline Phosohatase: manufactured by Nippon Gene), and T4 DNA ligase (manufactured by Promega) ) To prepare a recombinant plasmid (FIG. 4). Using this, E. coli JM109 was transformed by the calcium chloride method to obtain a transformed strain.

The above transformant was transformed with an appropriate amount of ampicillin, X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside), IPTG (isopropyl-β-D-thio). (Galactopyranoside) was patched on two LB plates, and cultured at 37 ° C. for about 10 hours to form colonies. One of the plates was stored at 4 ° C. as a master plate, and a nylon membrane (Hybond N ⁺ manufactured by Amersham) was placed on the other plate and allowed to stand for about 1 minute to create a replica.

This membrane was treated with an alkali denaturing solution (1.5 M
(NaCl, 0.5N NaOH) was allowed to stand on 0.7 ml for 10 minutes, and air-dried on a paper towel. After repeating this operation twice, a neutralization solution (1.5 M NaCl,
The same operation was performed twice using 0.5 M Tris-HCl (pH 7.0), and the mixture was heated at 80 ° C. for 2 hours. After immersing the membrane in 2 × SSC buffer for 5 minutes, the pre-washing solution (5 × SS
C, 0.5% SDS, 1 mM EDTA, pH 8.0) at 42 ° C. for 30 minutes. Wipe off the bacterial cell residue attached to the membrane,
Hybridization was performed using the DNA probe I prepared in <2>.

That is, the above membrane was placed in 2 × SSC buffer solution.
After immersion in the hybridization solution (6 × S
SC buffer, 1% SDS, 5x Denhardt's solution) and shake
Prehybridization for 1 hour
After rehybridization, hybridization
The DNA probe I prepared in the above <2> was added to the solution at 2 to 5 × 10 ⁶c
pm / ml and shake at 37 ° C for at least 16 hours.
Hybridization. Hybridization
3 minutes at room temperature with SSC buffer containing 0.1% SDS for 3 minutes.
Washing was performed twice.

After washing, the membrane was air-dried and subjected to autoradiography to detect three positive colonies.

[0075] The detected positive colonies were collected, and the plasmid introduced therein was extracted from each colony according to a conventional method. After confirming the presence and length of the inserted DNA fragment, all the nucleotide sequences of the inserted fragments were the same. Was confirmed. As a result, it was revealed that a base sequence corresponding to DNA probe I was present. SalI obtained in this way
The fragment (1.3 kb) was used as a secondary probe.

<5> Label of Secondary Probe The above 1.3 kb SalI fragment was obtained by
Labeling was performed using abeling and detection systems (Amersham). That is, the SalI fragment 30 μl (10 n
g / μl) was boiled for 5 minutes and cooled on ice for 5 minutes. Next, an equal amount of a labeling reagent as that of the DNA solution was added thereto, and mixed completely.
A glutaraldehyde solution in an amount equal to that of the labeling reagent was added thereto, mixed thoroughly, and incubated at 37 ° C. for 10 minutes.

<6> Preparation of recombinant phage • 6-1 Preparation of recombinant phage vector In order to prepare a DNA fragment to be inserted into a phage, <1>
Was partially digested with a restriction enzyme. That is, about 2 μg of genomic DNA is 1 unit (U) of restriction enzyme HaeIII
For 3 minutes, and after electrophoresis, DNA around 4 to 6 kb was recovered. 1 μg of the obtained DNA fragment was treated with 10 U of EcoRI methylase (Nippon Gene) under the conditions described in the instruction manual. The reaction solution was extracted with phenol / chloroform, precipitated with ethanol, and then washed with Tris-EDTA (TE) buffer (10 mM Tr
is-HCl (pH 8.0), 1 mM EDTA) and used for linker ligation. That is, methylase treatment was performed.
EcoRI linker (manufactured by Nippon Gene) for 1 μg of DNA fragment
Ligation was performed using 30 pmol. A DNA fragment was purified from the reaction solution, and after ethanol precipitation, the obtained DNA fragment was dissolved in a TE buffer and digested with EcoRI. The reaction solution was subjected to agarose gel electrophoresis, and the DNA fragment was recovered again to obtain DNA to be inserted into phage. Phage vector is Predige
Using a sted Lamda ZAP II / EcoRI / CIAP vector (Stratagene), 0.1-0.2
μg of the above DNA fragment was added, 10 U of T4 DNA ligase diluted so that the glycerol concentration did not exceed 5% was added, and the mixture was reacted at 4 ° C. overnight. After adding ethanol to the reaction solution to precipitate a DNA fragment, the DNA fragment was dissolved in a TE buffer.

6-2 Packaging into phage particles Gigapack III Gold packaging extra as phage particles
ct (Stratagene) was used. This solution was thawed, and the recombinant phage vector solution (1 to 4 μl in 0.1 to 1.0
μg), and the mixture was stirred and incubated at 22 ° C. for 2 hours. Then, 500 μl of SM buffer (0.1 M NaCl, 8 mM MgSO ₄
・ 7H ₂ O, 0.05M Tris-HCl pH7.5 2% gelatin) and 20 μl of chloroform were added and stirred, followed by centrifugation, and the upper layer containing phage particles was separated and stored at 4 ° C.

6-3 Infection of Phage Particles into Host Bacteria E. coli XL1-Bl
ue was used. For culture of E. coli XL1-Blue, use LB medium supplemented with tetracycline at a concentration of 12.5 μg / ml for storage, and use 0.2% maltose in LB medium for phage infection. , 10 mM MgSO ₄ was used. Host bacteria were inoculated into LB medium 8 ml, OD ₆₀₀ of the culture was grown to 0.5-1.0, after centrifugation,
10 mM MgSO ₄ to precipitated bacterial cells an OD ₆₀₀ of 0.5-0.7
Suspended in water. A phage particle solution (10 to 100 μl) appropriately diluted with SM buffer was added to 200 μl of the suspension, and the mixture was stirred.
The phage particles were infected by incubation at 37 ° C. for 15 minutes.

Culturing a host cell infected with the phage particles;
To form plaques, NZY medium (NaCl 90 mM, MgSO
_{4 · 7H 2 O 8mM, 0.5} % yeast extract, NZ amine 1%, pH 7.5)
It was used. When preparing a plate using this medium, 1.5% agar was added, and when used as a top agar, 0.7% agar was added. Dissolve 3 ml of top agar and add 4
Add the host bacterium infected with phage particles (200 µl) to the one kept at 8 ° C, mix thoroughly, and mix it with NZY
The plates were overlaid to prevent air bubbles. After allowing the top agar to set, it was cultured overnight at 37 ° C. to form plaques.

6-4 Amplification and plaque lift In order to amplify the phage in the plaque, amplification was performed by the plate lysate method. That is, 5 ml of the SM buffer and 4 to 5 drops of chloroform were added to the plate on which the plaque had been formed, and the phage was eluted in the SM buffer by leaving overnight at 4 ° C. This SM buffer was isolated as a phage solution, stored at 4 ° C., and used as needed.

A plaque lift was performed to isolate the plaque formed on the plate. A Pasteur pipette was inserted into the plaque to be isolated, the agar medium was collected, and the mixture was stirred in 500 μl of SM buffer supplemented with 20 μl of chloroform. Then leave at room temperature for 1 hour
The phage was eluted in M buffer and used as an isolated phage solution.

6-5 Excision of DNA Fragment from Phage Vector DNA fragment contained in phage obtained by plaque lift using E. coli SOLR, Exassist helper phage (Stratagene) and E. coli Xl1-Blue Was recovered as a plasmid. For the culture of E. coli SOLR, use kanamycin at a concentration of 50 μg / ml added to LB medium during storage, and use L-type medium to cut out DNA fragments.
B medium supplemented with 0.2% maltose and 10 mM MgSO ₄ was used.

First, E. coli XL1-Blue and E. coli SOLR
Was inoculated into 8 ml of LB medium and cultured, and suspended in 10 mM MgSO ₄ so that OD ₆₀₀ became 1.0. 200 μl E. coli XL1-
Blue suspension, 250 μl of isolated phage solution (1 × 10 ⁵
pfu or more) and 1 μl of Exassist helper phage (1 × 1
0 ⁶ pfu or more) for 15 minutes at mixing 37 ° C. was by plasmid pBluescript SK from phage vector (-)
Was cut out. Add this solution to 3 ml of LB medium and add
After culturing with shaking at 7 ° C. for 3 hours and further incubating at 65 ° C. for 20 minutes to eliminate the infectivity of the phage vector, the supernatant containing pBluescript SK (−) was collected by centrifugation. 200
Add the collected solution to 10-100 μl of E. coli SOLR suspension.
After incubating at 37 ° C for 15 minutes, culture on an LB plate containing ampicillin, pBluescript SK
E. coli SOLR retaining (-) was obtained.

<7> Plaque Hybridization A phage particle containing the target gene was prepared according to the method described above, and a library was prepared so that about 5,000 plaques were formed per plate. The plate on which the plaque was formed was allowed to stand at 4 ° C. for 2 hours or more, then placed on a nylon membrane and allowed to stand for about 2 minutes to form a replica.

This membrane was treated with an alkali denaturing solution (0.7 ml).
Placed on top for 5 minutes, then air dried. Perform this operation 2
After repeating the above operation twice, the same operation was performed twice using the neutralized solution.
After the membrane was air-dried, it was kept at 80 ° C. for 2 hours. After washing the membrane with 2 × SSC, screening was performed using a secondary probe in the same manner as in <3>.

The plaques that showed positive were recovered by plaque lift, and screening and plaque lift were repeated until phage containing the target gene was completely isolated. Finally, 10 positive plaques were collected, and pBluescript SK (-) was excised from the isolated phage according to the method described above.

<8> Determination of base sequence The base sequence was determined using a DNA sequencer (SQ-5500: manufactured by Hitachi, Ltd.). The DNA fragment whose nucleotide sequence was to be determined was inserted into any of pUC18, pUC19, or pBluescript SK (-) plasmid DNA, and subcloned.
Plasmid DNA containing the target DNA fragment is extracted by the alkaline method, and RNase A (10 mg / ml, 10 mM Tris-HC
l, 15mM NaCl, pH7.5) and react at 37 ° C for 1 hour.
RNA mixed in the DNA solution was degraded. Next, phenol / chloroform extraction and ethanol precipitation were performed,
Was purified. Prepare sequence samples by Sanger
According to these methods, PCR samples were purchased from Hitachi Thermo
Sequenase Pre-mixed cycle Sequrncing kit and Texas re
d Created using M13 Forward / Reverse Primer. The PCR used a program balance control system PC800. The PCR reaction conditions are as follows.

[0089]

[Table 1] Composition of PCR reaction solution Each dNTP (dATP, dCTP, dGTP, dTTP) 2 μl each DNA primer mixture (mixture of the following reagents) 6 μl Texas red labeled primer (1 pmol / μl) 2 μl template DNA 0.2 pmol Sterilization Distilled water 25 μl total volume PCR cycle Step 1: 94 ° C for 4 minutes Step 2: 94 ° C for 30 seconds → 60 ° C for 30 seconds (25 cycles) Step 3: Store at 4 ° C

The sequence gel was prepared on a 37 cm electrophoresis plate. Preparation and electrophoresis of the gel were performed according to a conventional method. The determined base sequence was analyzed using Genetix-mac (manufactured by Software Development). As a result, SalI
It was also found that a 1.3 kb fragment was also included, and it was also revealed that the fragment contained the base sequences corresponding to DNA probe I and DNA probe II. Among them, a fragment of about 5 kb considered to contain the most upstream region was hereinafter referred to as “pE5”. However, from the comparison of the molecular weight calculated from the number of amino acids encoded by this sequence with the molecular weight of heparitinase T-IV, the presence or absence of a signal sequence, and the like, it was revealed that N-terminal was not included.

Therefore, this pE5 is digested with EcoRI, and it is located further upstream than the above-mentioned 1.3 kb obtained by SalI digestion.
A 0.5 kb EcoRI digestion fragment was obtained and used as a tertiary probe. This probe is labeled according to <5>, and B of the genomic DNA obtained in <1> is labeled using the labeled tertiary probe.
Hybridization was performed on the completely digested fragments of amHI, EcoRI, HindIII and SalI according to the method of <3> (FIG. 5).

Based on this result and the results shown in FIGS. 2 and 3, a restriction enzyme map around the heparitinase T-IV gene was prepared (FIG. 6). Based on this restriction map, heparitinase T-
A library was prepared by inserting a DNA fragment containing a 2.5 kb DNA fragment of SalI predicted to contain the N-terminal part of the IV gene into plasmid pUC19 according to a conventional method (FIG. 7).
Colony hybridization was performed in the same manner as above using a 0.5 kb DNA fragment by EcoRI as a probe. As a result, the obtained 2.5 kb SalI fragment (hereinafter referred to as “pS2.5”) was obtained. When the base sequence of this SalI fragment was analyzed in the same manner as above, heparitinase
It is clear that it encodes the N-terminal part of T-IV,
This DNA fragment was subcloned and the nucleotide sequence was confirmed again. Heparitinase, including the determined base sequence
SEQ ID NO: 1 shows the full-length nucleotide sequence encoding T-IV and the amino acid sequence deduced from this nucleotide sequence. Only this amino acid sequence is shown in SEQ ID NO: 2.

As a result, heparitinase T-IV has a base number of
3150 bp, the number of amino acids was 1050, and the estimated molecular weight from the amino acid sequence was 116.5 kDa. Furthermore, in the open reading frame, an SD sequence, a signal sequence, a heparin binding region (base numbers 2797 to 2811 and 2854 to 2865 in the base sequence of SEQ ID NO: 1), and a site considered to be a calcium binding region (SEQ ID NO: 1) Nucleotide number 12 in the nucleotide sequence of
67-1302).

[0094]

Example 2 Expression of DNA of the Present Invention <1> Construction of Expression Plasmid ・ 1-1 Construction of Expression Plasmid Using pUC19 In order to express heparitinase T-IV in E. coli, PstI containing its N-terminal region was used. -1.5 kb of EcoRI digested fragment
A plasmid (pPE1.5) containing a DNA fragment was prepared. Next, this plasmid was digested with EcoRI to remove the 5'-phosphate group, and pE5 treated with EcoRI was ligated thereto. The plasmid into which pE5 treated with EcoRI was inserted in the correct direction was used as an expression plasmid, and this plasmid was used as pPE5.5 (FIG. 8). E. coli JM109 strain was transformed with pPE5.5 according to a conventional method.

1-2 Construction of Expression Plasmid Using pET An expression plasmid was constructed using the pET11-c vector (Stratagene). The pET11-c vector has a restriction enzyme recognition region NdeI site on the N-terminal side and a restriction enzyme recognition region BamHI site on the C-terminal side. To allow the ligation of the heparitinase T-IV gene to the pET11-c vector, p
A point mutation was introduced by a conventional method using PCR using PE1.5 as a template to prepare a PCR fragment of about 450 bp in the upstream region of the heparitinase T-IV gene. This PCR fragment
This is the portion where the initiation codon is expected and the portion excluding the signal sequence, and the portion where the restriction enzyme recognition region BamHI site, which is located about 450 bp downstream from the site, exists. The N-terminal primer was subjected to point mutation by changing the primer base sequence without changing the amino acid so that the site of the initiation codon could be cut with NdeI. The following primers were used for the PCR method.

[0096]

[Table 2] Pr NDP: 5 'GAAACATATGCAGCCGGCCGCA 3' (SEQ ID NO: 7) Pr NDS: 5 'TGAGCATATGCGTAAAACAACG 3' (SEQ ID NO: 8) Pr BS: 5 'GCTCGGATCCGAGGCGAAAGGT 3' (SEQ ID NO: 9)

The region downstream from the BamHI site is 4.8 kb.
The plasmid pUC18 (hereinafter referred to as [pB4.8]) containing the BamHI fragment is digested with BamHI, the resulting 4.8 kb DNA fragment is subjected to agarose gel electrophoresis, and the DNA fragment of the desired molecular weight is recovered from the gel and used. did. Next, the PCR fragment amplified using the PCR primers prepared above was cut with NdeI and BamHI to obtain a DNA fragment for insertion. NdeI and Bam
It was cut with HI and ligated with pET11-c from which the 5′-phosphate group had been removed. After confirming that the PCR fragment was ligated, the plasmid was cut with BamHI to remove the 5'-phosphate group to obtain a vector. The 4.8 kb DNA fragment obtained previously by BamHI digestion was ligated to the vector.

The direction of the inserted BamHI 4.8 kb fragment was confirmed, and the one inserted in the correct direction was used as an expression plasmid (FIG. 9). This plasmid was designated as p11, p11 with the signal sequence remaining was designated as p11 +, and the removed p11 was designated as p11-. E. coli BL21 (DE3) strain was transformed with these plasmids.

<2> Culture of host cells and preparation of enzymes • 2-1 Culture of host cells E. coli BL2 carrying p11 +, p11- or pET11-c (control)
A single colony of strain 1 (DE3) and E. coli JM109 strain holding pPE5.5 was inoculated into 5 ml of LB liquid medium containing ampicillin, and cultured with shaking at 37 ° C overnight. 1 ml of the obtained culture solution
In 500 ml of LB broth containing 100 ml of ampicillin
1 ml was inoculated into a ml Sakaguchi flask and cultured at 30 ° C. at 130 reciprocations / minute. In some cultures, the OD ₆₆₀
After shaking and culturing for about 3 to 5 hours until the pH becomes 0.5, 1M IPTG was added to a final concentration of 0.1 mM, and further at 12 ° C for 30 hours at 30 ° C.
Shaking culture was performed at 30 round trips / minute.

.2-2 Preparation of Crude Cell Extract The cultured cell solution was cooled in an ice bath for 10 minutes, transferred to an ice-cooled 500 ml centrifuge tube, and collected by centrifugation.
The collected cells were suspended in ice-cooled 50 ml Tris-AcOH (pH 7.5) and centrifuged. This operation of centrifugation was repeated twice to wash the medium remaining in the cells. Next, the obtained washed cells were suspended in 4 ml of ice-cold 50 ml of Tris-AcOH (pH 7.5) and sonicated at 190 W for 5 minutes. After confirming that the cells were crushed, the lysate was transferred to an ice-cooled 50 ml centrifuge tube and centrifuged. The resulting 4 ml supernatant was used as a crude cell extract.

.2-3 SDS-PAGE Analysis of Cell Extract The results of SDS-PAGE analysis of the cell extract are shown in FIG. In FIG. 10, the strains and culture conditions in lanes 1 to 7 are as shown in the following table.

2-4. Measurement of Heparitinase Activity of Cell Extract The measurement of heparitinase activity of the cell extract is described in "Quantitative Determination of Reducing Sugars" (Sakuzo Fukui, University of Tokyo Press), pp. 19-20. Was carried out according to the method described above. That is, 10 mM phosphate buffer (pH 7.0) containing 10 mg / ml of heparan sulfate or heparin as a substrate solution, and a bacterial cell extract as an enzyme solution diluted with 10 mM phosphate buffer (pH 7.0), and 50 μl of the substrate solution Plus 45 ° C
For 10 minutes, 300 μl of 3,5-dinitrosalicylic acid (hereinafter referred to as DNS) was added, and the mixture was boiled at 100 ° C. for 5 minutes. Then, after immersing in cold water for 5 minutes, 2100 μl of distilled water was added, and the absorbance at 535 nm (OD535) was measured. A heat-inactivated enzyme solution was used as a blank. The difference between the OD535 of the enzyme solution and the blank was defined as ΔOD535.

The enzyme titer is determined by the amount of enzyme (U / m) that releases reducing sugar corresponding to 1 μmol of N-acetylglucosamine per minute.
l), and the calculation was performed by the following equation. Reference material (St
N-acetylglucosamine was used as d). The specific activity obtained is shown in the table below.

[0104]

[Equation 1] U / ml = ΔOD535 / Std OD535 × Std Wt / Std MW ×
1/10 (min) × 1 / 0.05 (ml) × dd Std OD535: OD535 of Std Std Wt: amount of Std (160 μg) Std MW: molecular weight of Std (221.21) dd Dilution rate

[0105]

Table 3 Lane strain IPTG induction Specific activity (mU / mg) 1 E.coli BL21 (p11-) + 03 E.coli BL21 (p11-) + 03 E.coli BL21 (p11 +)-0.4E. E. coli BL21 (p11 +) + 14.15 E. coli JM109 (pPE5.5)-34. 26 E. coli JM109 (pPE5.5) + 34.27 E. coli BL21 (pET11-c) + 0

[0106]

According to the present invention, heparitinase T-IV can be provided in a pure form at low cost and in a large amount by a genetic engineering technique.

[0107]

[Sequence Table] <110> Separagina T-IV polypeptide and DNA encoding it <130> P-7754 <160> 9 <210> 1 <211> 3267 <212> DNA <213> Bacillus circulans <220> <221> CDS <222> (112) .. (3264) <400> 1 atagcgggta acatcctgca aggataactt tagacaaaat tggaatttta ccaggcaaaa 60 agatgtgcga agccggatcc aagcgacaat cctttgggag atgct gag atg aaa aca acg atc gtg cga tgg acc gcg gcg gtt ttg ttc gtc gcg gtt 165 Lys Thr Thr Ile Val Arg Trp Thr Ala Ala Ala Val Leu Phe Val Ala Val 5 10 15 ccg gcg gtg gcc ggc gtc tcc gtt caa ttg gcg cag ccg 213 Pro Ala Val Ala Gly Val Ser Val Gln Leu Ala Lys Arg Thr Gln Pro 20 25 30 gcc gca acg cat gcg acg gcg gca gcg gag aag ctg ccg gga cca ccg 261 Ala Ala Thr His Ala Thr Ala Ala Ala Glu Lys Leu Pro Gly Pro Pro 35 40 45 50 gtt gcc gcc aca cag gcg gtt gcc att cgc gac gac ggc tcc ttt aaa 309 Val Ala Ala Thr Gln Ala Val Ala Ile Arg Asp Asp Gly Ser Phe Lys 55 60 65 aag tcg gaa tcg ttc gaa ggc gga caa att ccc gcg gcg tgg cag acg 357 Lys Ser Glu Ser Phe Glu Gly Gly Gln Ile Pro Ala Ala Trp Gln Thr 70 75 80 gat ggg gga ggg cag cta tcc tta tcg gg tac aag cac ggc 405 Asp Gly Gly Gly Gln Leu Ser Leu Ser Ala Ala His Tyr Lys His Gly 85 90 95 cgc caa tcc ttg caa tgg aat tgg gct cag ggc tcc agg ctg ctg gtc 453 Arg Gln Ser Leu Gln Trp Asn Trp Gln Gly Ser Arg Leu Leu Val 100 105 110 ata aag ccg ccg aac ctt gag cag gcg ggc gcg agc aag cgg gga ggg 501 Ile Lys Pro Pro Asn Leu Glu Gln Ala Gly Ala Ser Lys Arg Gly Gly 115 120 125 130 atc aag ctg tgg ctg tac aac gag aag gct gtc gac ggc aag gcg acc 549 Ile Lys Leu Trp Leu Tyr Asn Glu Lys Ala Val Asp Gly Lys Ala Thr 135 140 145 ttt cgc ctc gga tcc gag cag gaa atc aac tcg aac aatcc 597 Phe Arg Leu Gly Ser Glu Gln Glu Ile Asn Ser Asn Asn Pro Arg Tyr 150 155 160 gtt ttc gaa atc ggc atc aac ttc acc ggc tgg cgg ggc atg tgg att 645 Val Phe Glu Ile Gly Ile Asn Phe Thr Gly Trp Arg Gly Trp Ile 165 170 175 cag ttc agg gaa gac ggc gct tac gac ggc tac aag ggg gac ggg aag 693 Gln Phe Arg Glu Asp Gly Ala Tyr Asp Gly Tyr Lys Gly Asp Gly Lys 180 185 190 gca ccc ctg gag gtc atg gac atc gac gct gcg gcg cct caa 741 Ala Pro Leu Glu Val Met Glu Ile Ile Pro Pro Ala Ala Ala Pro Gln 195 200 205 210 ggc agc ttg ttt ttc gat gtg gtg gaa ttc gag ggc acg att ccc gcg 789 Gly Ser Leu Phe Val Glu Phe Glu Gly Thr Ile Pro Ala 215 220 225 acg cgc tcg acc gac tac cag gtg ccg tac gac cgc aag cgc tcc aac 837 Thr Arg Ser Thr Asp Tyr Gln Val Pro Tyr Asp Arg Lys Arg Ser Asn 230 235 240 gac ggg atg ggc gga acg tgg gac cgg agc tac tac tgg agc caa atg 885 Asp Gly Met Gly Gly Thr Trp Asp Arg Ser Tyr Tyr Trp Ser Gln Met 245 250 255 aag ccg gac ctt ccg ctt gcg gac cgg atc acg ccg ggg cag 933 Lys Pro Asp Leu Pro Leu Ala Asp Arg Ile Thr Pro Glu Gln Ser Arg 260 265 270 gcg ttc gaa acg ata gcc aaa cgg tac gaa ggc tgg att tac ggc gag 981 Ala Phe Glu Thr Ile Ala Lys Arg Tyr Glu Gly TrpTyr Gly Glu 275 280 285 290 cat ccg gat ctg acc cgg gag ccg ctc cgc att cgc aac agc gcg ctg 1029 His Pro Asp Leu Thr Arg Glu Pro Leu Arg Ile Arg Asn Ser Ala Leu 295 300 305 caa tcg ttg atg ctg caa aaa tac gcg cag ctc ggc ttg 1077 Gln Ser Phe Ile Ala Lys Gly Leu Gln Lys Tyr Ala Gln Leu Gly Leu 310 315 320 aat agg gac ggc aac gga tac att acc ggt cct ccg ctg ttt tcc agc 1 AsGn Asn Gly Tyr Ile Thr Gly Pro Pro Leu Phe Ser Ser 325 330 335 cgt tcg acg cac ggg ccg gag ttc ggc gag gat gtg gcc aag acg atc 1173 Arg Ser Thr His Gly Pro Glu Phe Gly Glu Asp Val Ala Lys Thr Ile 340 345 350 ttt ctg ccg ctc gtg ttc gat tac aag atc aac ggc cgt cag gaa agc 1221 Phe Leu Pro Leu Val Phe Asp Tyr Lys Ile Asn Gly Arg Gln Glu Ser 355 360 365 370 aaa aac aag gtg ctc tc gac tc ttc ttc ttc ttc ttc ttctt gac cag ggc tgg 1269 Lys Asn Lys Val Leu Asp Leu Phe Asp Tyr Phe His Asp Gln Gly Trp 375 380 385 gcg gac ggc agc ggt ctg gaa acg ctc gat cac gag acg aac cgg acg 1317 Ala Asp Gly Ser Gly Lely hr Leu Asp His Glu Thr Asn Arg Thr 390 395 400 aac ggg tat ttt cac gcc gtc tac ttg atg cgt aaa gag ctt caa gaa 1365 Asn Gly Tyr Pyr His Ala Val Tyr Leu Met Arg Lys Glu Leu Gln Glu 405 410 415 tcc ggc cgg ctt gac cgc gag ctg ccg acc gtc cgc tgg ttt acg aat 1413 Ser Gly Arg Leu Asp Arg Glu Leu Pro Thr Val Arg Trp Phe Thr Asn 420 425 430 ttc gga aaa acg tac atc gcc gat ccc ggg gag acg acg gcc gat gat 1461 Phe Gly Lys Thr Tyr Ile Ala Asp Pro Gly Glu Thr Thr Ala Asp Glu 435 440 445 450 atc cgc acc aaa ttc atg tat gag ctg ctg tac gtg ctg gcg ctc gac 1509 Ile Arg Thr Lys Phe Met Tyr Glu Leu Leu Leu Leu Leu Ala Leu Asp 455 460 465 gac ggt ccc gca aaa gtg cgc gag atg cag agc ttg ctg cgc tgg atg 1557 Asp Gly Pro Ala Lys Val Arg Glu Met Gln Ser Leu Leu Arg Trp Met 470 475 480 aat cat gcg gc acc ggc ttt gcc gga acg atc aag gac 1605 Asn His Ala Leu Ala Val Ala Thr Gly Phe Ala Gly Thr Ile Lys Asp 485 490 495 gac ttc atg gga ttt cat cac agg ggc gtt tac atg agc gcg tat gcg 1653 Asp Phe t Gly Phe His His Arg Gly Val Tyr Met Ser Ala Tyr Ala 500 505 510 cgg caa gcg ttt cat atg gct gcc ttg atc gct tat ttg ctg cac gat 1701 Arg Gln Ala Phe His Met Ala Ala Leu Ile Ala Tyr Leu Leu His Asp 515 520 525 530 acg ccg ttt gct ctt tcc aag caa tcg acg gat aac atg ccg aaa cgc 1749 Thr Pro Phe Ala Leu Ser Lys Gln Ser Thr Asp Asn Met Pro Lys Arg 535 540 545 gct gct gac ttt tcg gac ggt ggc ga ata cga cgt gcc ggt ggc 1797 Ala Ala Asp Phe Ser Asp Gly Gly Glu Gln Ile Arg Arg Ala Gly Gly 550 555 560 ctc agc ggc cgc ttt ccg gcc aag gac ggc gtg gcg aac gaa atc gtg Ala Pg LeAg Lec Lys Asp Gly Val Ala Asn Glu Ile Val 565 570 575 ccg gct tac gcc tat atg gcg ctg gcg agc gag ccc gtc gac cgg gag 1893 Pro Ala Tyr Ala Tyr Met Ala Leu Ala Ser Glu Pro Val Asp Arg Glu 580 585 590 g ggg gcg ttc atg cgg ctg tgg gac ccg agt tcg ccc tac ttg 1941 Met Ala Gly Ala Phe Met Arg Leu Trp Asp Pro Ser Ser Pro Tyr Leu 595 600 605 610 aag cag ggg ctg ttc ccc aaa gcc gat agc gtc gc tat ctg 1989 Lys Gln Gly Leu Phe Pro Lys Ala Asp Ser Gly Asp Val Ser Tyr Leu 615 620 625 gac aca ata ggc gga ctt cag ctc gcg ctg aag ctg gcg gat caa gga 2037 Asp Thr Ile Gly Gly Leu Gu Leu Ala Leu Ala Asp Gln Gly 630 635 640 ttc gcg ccg gaa aaa agc ccg cag ttc tgg atg aag ccg tcc gcc gcc 2085 Phe Ala Pro Glu Lys Ser Pro Gln Phe Trp Met Lys Pro Ser Ala Ala 645 650 650 ttcgcgcgg gac gat tgg gcg gtg tcg gtg aag ggc tgg 2133 Phe Ala Val Met Arg Arg Asp Asp Trp Ala Val Ser Val Lys Gly Trp 660 665 670 agc cag tac gta ttc gac ttc gaa tcg cag gcg ccg talggg Serg Val Phe Asp Phe Glu Ser Gln Ala Pro Lys Ala Ala Asp 675 680 685 690 tcc gcg cag aag gcg ctg gcc gga caa aac gtg ttc ggc cgg tac gcg 2229 Ser Ala Gln Lys Ala Leu Ala Gly Gln Asn Val Phe Gly Ar 695 700 705 agc tac ggc gcc atg cag gtg atg gcc gcc ggc gat ccg atc aac aaa 2277 Ser Tyr Gly Ala Met Gln Val Met Ala Ala Gly Asp Pro Ile Asn Lys 710 715 720 gcg aat aac gga tac ggc gc gat ag gc tgg gac tgg aac cgc tgg 2325 Ala Asn Asn Gly Tyr Gly Leu Asp Asn Gly Trp Asp Trp Asn Arg Trp 725 730 735 ccc ggc gcg acg acg atc cgg ttg ccc tgg gag cgg ctc ggc gta tcg A Thr Gly A373 Pro G Arg Leu Pro Trp Glu Arg Leu Gly Val Ser 740 745 750 aag gat cgc ccg caa acc cgt tcg ttt acg gac caa acg ttc gtg ggc 2421 Lys Asp Arg Pro Gln Thr Arg Ser Phe Thr Asp Gln Thr Phe Val Gly 755 760 765 770 770 gga gtc gaa agc gaa ggg aaa gac ggc att ttc gcg atg aag ctg cac 2469 Gly Val Glu Ser Glu Gly Lys Asp Gly Ile Phe Ala Met Lys Leu His 775 780 785 gat acg gtg tac gac aag tcg ttt cg ttt ttt 2517 Asp Thr Val Tyr Asp Lys Ser Phe Arg Ala Glu Lys Ser Val Phe Phe 790 795 800 ctc gat aac gag gtc att gcg ctc ggc tcc ggc att cat aac gac gac 2565 Leu Asp Asn Glu Val Ile Ala Leu Gly Ser Gly Ile His Asn Asp Asp 805 810 815 ggc gcc cac tcg acg gaa acg acg ctg ttt caa tcg tac atg aaa gat 2613 Gly Ala His Ser Thr Glu Thr Thr Leu Phe Gln Ser Tyr Met Lys Asp 820 825 830 acg ggc atg ccg at t cgg acg ggt tcg gcc ggt tcc gcc gaa acg atc 2661 Thr Gly Met Pro Ile Arg Thr Gly Ser Ala Gly Ser Ala Glu Thr Ile 835 840 845 850 gcg gag ttt cct tac cgt cgg gac ttc aag ccc aaa gaa aac gta tgg 2 Ala Glu Phe Pro Tyr Arg Arg Asp Phe Lys Pro Lys Glu Asn Val Trp 855 860 865 ctc atg gac ccg tac ggc aac gat ata tcg tac cga tgc gga ggg tgc 2757 Leu Met Asp Pro Tyr Gly Asn Asp Ile Ser Tyr Arg Gly Cys 870 875 880 gcc ttg aac gaa gca agc agt cgt cgc ccg att aga gcg gta aaa aaa 2805 Ala Leu Asn Glu Ala Ser Ser Arg Arg Pro Ile Arg Ala Val Lys Lys 885 890 895 895 cga cga ccg gca gca gca gca gca gga tcg atc acg gca cga agc 2853 Arg Arg Pro Ala Ala Thr Ala Pro Pro Gly Ser Ile Thr Ala Arg Ser 900 905 910 cga agg gtg cgg gct acg aat atg cga tgc tcg tgc agg ctt ctc ccg 2901 Arg Arg Val Arg Ala Thrg Asn Met Arg Cys Ser Cys Arg Leu Leu Pro 915 920 925 930 agc agg tgc gga aat acg cgg agt cgc cgg gct atg agg tgc ttc gaa 2949 Ser Arg Cys Gly Asn Thr Arg Ser Arg Arg Ala Met Arg Cys Phe Glu 935 945 aag aca gcc agg ctc ata tcg tca gac atg cga aga agc gcg cgc tcg 2997 Lys Thr Ala Arg Leu Ile Ser Ser Asp Met Arg Arg Ser Ala Arg Ser 950 955 960 gat acg tca ttt tcg atg cgg cgg agg gg tg gca tcg tcc 3045 Asp Thr Ser Phe Ser Met Arg Arg Arg Lys Cys Arg Ala Ala Ser Ser 965 970 975 gga aag cag gcc ggc cgg cga tca tta tgg aaa aac aaa agg aga acg 3093 Gly Lys Gln Ala Gly Arg Arg Ser Leu Trp Lys Asn Lys Arg Arg Thr 980 985 990 gaa tcg ttc tca gcg tcg ccg atc cgg atc tgc gcc tgc cca agc ttc 3141 Glu Ser Phe Ser Ala Ser Pro Ile Arg Ile Cys Ala Cys Pro Ser Phe 995 1000 1005 1010 ccg tgg acg acg gcg tcg gct gac gcc tgg aac ggc gga 3189 Pro Thr Lys Glu Trp Thr Thr Ala Ser Ala Asp Ala Trp Asn Gly Gly 1015 1020 1025 gac ggt gcg ggt cga gct gaa agg aag ctg gca gcc ggg aca gcc gct 3 Gly Ala Gly Arg Ala Glu Arg Lys Leu Ala Ala Gly Thr Ala Ala 1030 1035 1040 tcc ggc cgg cat ccg tct gac ggg taa cgg 3267 Ser Gly Arg His Pro Ser Asp Gly 1045 1050 <210> 2 <211> 1050 <212>PRT <213> Bacillus circulans <400> 2 Met Arg Lys Thr Thr Ile Val Arg Trp Thr Ala Ala Val Leu Phe Val 1 5 10 15 Ala Val Pro Ala Val Ala Gly Val Ser Val Gln Leu Ala Lys Arg Thr 20 25 30 Gln Pro Ala Ala Thr His Ala Thr Ala Ala Ala Glu Lys Leu Pro Gly 35 40 45 Pro Pro Val Ala Ala Thr Gln Ala Val Ala Ile Arg Asp Asp Gly Ser 50 55 60 Phe Lys Lys Ser Glu Ser Phe Glu Gly Gly Gln Ile Pro Ala Ala Trp 65 70 75 80 Gln Thr Asp Gly Gly Gly Gln Leu Ser Leu Ser Ala Ala His Tyr Lys 85 90 95 His Gly Arg Gln Ser Leu Gln Trp Asn Trp Ala Gln Gly Ser Arg Leu 100 105 110 Leu Val Ile Lys Pro Pro Asn Leu Glu Gln Ala Gly Ala Ser Lys Arg 115 120 125 Gly Gly Ile Lys Leu Trp Leu Tyr Asn Glu Lys Ala Val Asp Gly Lys 130 135 140 Ala Thr Phe Arg Leu Gly Ser Glu Gln Glu Ile Asn Ser Asn Asn Pro 145 150 155 160 Arg Tyr Val Phe Glu Ile Gly Ile Asn Phe Thr Gly Trp Arg Gly Met 165 170 175 Trp Ile Gln Phe Arg Glu Asp Gly Ala Tyr Asp Gly Tyr Lys Gly Asp 180 185 190 Gly Lys Ala Pro Leu Glu Val Met Glu Ile Ile Pro Pro Ala Ala A la 195 200 205 Pro Gln Gly Ser Leu Phe Phe Asp Val Val Glu Phe Glu Gly Thr Ile 210 215 220 Pro Ala Thr Arg Ser Thr Asp Tyr Gln Val Pro Tyr Asp Arg Lys Arg 225 230 235 240 Ser Asn Asp Gly Met Gly Gly Thr Trp Asp Arg Ser Tyr Tyr Trp Ser 245 250 255 Gln Met Lys Pro Asp Leu Pro Leu Ala Asp Arg Ile Thr Pro Glu Gln 260 265 270 Ser Arg Ala Phe Glu Thr Ile Ala Lys Arg Tyr Glu Gly Trp Ile Tyr 275 280 285 Gly Glu His Pro Asp Leu Thr Arg Glu Pro Leu Arg Ile Arg Asn Ser 290 295 300 Ala Leu Gln Ser Phe Ile Ala Lys Gly Leu Gln Lys Tyr Ala Gln Leu 305 310 315 320 Gly Leu Asn Arg Asp Gly Asn Gly Tyr Ile Thr Gly Pro Pro Leu Phe 325 330 335 Ser Ser Arg Ser Thr His Gly Pro Glu Phe Gly Glu Asp Val Ala Lys 340 345 350 Thr Ile Phe Leu Pro Leu Val Phe Asp Tyr Lys Ile Asn Gly Arg Gln 355 360 365 Glu Ser Lys Asn Lys Val Leu Asp Leu Phe Asp Tyr Phe His Asp Gln 370 375 380 Gly Trp Ala Asp Gly Ser Gly Leu Glu Thr Leu Asp His Glu Thr Asn 385 390 395 400 Arg Thr Asn Gly Tyr Phe His Ala Val Tyr Leu Met Arg Lys Glu L eu 405 410 415 Gln Glu Ser Gly Arg Leu Asp Arg Glu Leu Pro Thr Val Arg Trp Phe 420 425 430 Thr Asn Phe Gly Lys Thr Tyr Ile Ala Asp Pro Gly Glu Glu Thr Thr Ala 435 440 445 Asp Glu Ile Arg Thr Lys Phe Met Tyr Glu Leu Leu Tyr Val Leu Ala 450 455 460 Leu Asp Asp Gly Pro Ala Lys Val Arg Glu Met Gln Ser Leu Leu Arg 465 470 475 480 Trp Met Asn His Ala Leu Ala Val Ala Thr Gly Phe Ala Gly Thr Ile 485 490 490 495 Lys Asp Asp Phe Met Gly Phe His His Arg Gly Val Tyr Met Ser Ala 500 505 510 Tyr Ala Arg Gln Ala Phe His Met Ala Ala Leu Ile Ala Tyr Leu Leu 515 520 525 His Asp Thr Pro Phe Ala Leu Ser Lys Gln Ser Thr Asp Asn Met Pro 530 535 540 Lys Arg Ala Ala Asp Phe Ser Asp Gly Gly Glu Gln Ile Arg Arg Ala 545 550 555 560 Gly Gly Leu Ser Gly Arg Phe Pro Ala Lys Asp Gly Val Ala Asn Glu 565 570 575 575 Ile Val Pro Ala Tyr Ala Tyr Met Ala Leu Ala Ser Glu Pro Val Asp 580 585 590 Arg Glu Met Ala Gly Ala Phe Met Arg Leu Trp Asp Pro Ser Ser Pro 595 600 605 Tyr Leu Lys Gln Gly Leu Phe Pro Lys Ala Asp Ser Gly Asp Val Ser 6 10 615 620 Tyr Leu Asp Thr Ile Gly Gly Leu Gln Leu Ala Leu Lys Leu Ala Asp 625 630 635 640 Gln Gly Phe Ala Pro Glu Lys Ser Pro Gln Phe Trp Met Lys Pro Ser 645 650 655 655 Ala Ala Phe Ala Val Met Arg Arg Asp Asp Trp Ala Val Ser Val Lys 660 665 670 670 Gly Trp Ser Gln Tyr Val Phe Asp Phe Glu Ser Gln Ala Pro Lys Ala 675 680 685 Ala Asp Ser Ala Gln Lys Ala Leu Ala Gly Gln Asn Val Phe Gly Arg 690 695 700 Tyr Ala Ser Tyr Gly Ala Met Gln Val Met Ala Ala Gly Asp Pro Ile 705 710 715 715 720 Asn Lys Ala Asn Asn Gly Tyr Gly Leu Asp Asn Gly Trp Asp Trp Asn 725 730 735 735 Arg Trp Pro Gly Ala Thr Thr Ile Arg Leu Pro Trp Glu Arg Leu Gly 740 745 750 Val Ser Lys Asp Arg Pro Gln Thr Arg Ser Phe Thr Asp Gln Thr Phe 755 760 765 Val Gly Gly Val Glu Ser Glu Gly Lys Asp Gly Ile Phe Ala Met Lys 770 775 780 780 Leu His Asp Thr Val Tyr Asp Lys Ser Phe Arg Ala Glu Lys Ser Val 785 790 795 800 Phe Phe Leu Asp Asn Glu Val Ile Ala Leu Gly Ser Gly Ile His Asn 805 810 815 Asp Asp Gly Ala His Ser Thr Glu Thr Thr Leu Phe Gln Ser Tyr Met 8 20 825 830 Lys Asp Thr Gly Met Pro Ile Arg Thr Gly Ser Ala Gly Ser Ala Glu 835 840 845 Thr Ile Ala Glu Phe Pro Tyr Arg Arg Asp Phe Lys Pro Lys Glu Asn 850 855 860 Val Trp Leu Met Asp Pro Tyr Gly Asn Asp Ile Ser Tyr Arg Cys Gly 865 870 875 880 Gly Cys Ala Leu Asn Glu Ala Ser Ser Arg Arg Pro Ile Arg Ala Val 885 890 895 895 Lys Lys Arg Arg Pro Ala Ala Thr Ala Pro Pro Gly Ser Ile Thr Ala 900 905 910 Arg Ser Arg Arg Val Arg Ala Thr Asn Met Arg Cys Ser Cys Arg Leu 915 920 925 Leu Pro Ser Arg Cys Gly Asn Thr Arg Ser Arg Arg Ala Met Arg Cys 930 935 940 Phe Glu Lys Thr Ala Arg Leu Ile Ser Ser Asp Met Arg Arg Ser Ala 945 950 955 960 Arg Ser Asp Thr Ser Phe Ser Met Arg Arg Arg Lys Cys Arg Ala Ala 965 970 975 Ser Ser Gly Lys Gln Ala Gly Arg Arg Ser Leu Trp Lys Asn Lys Arg 980 985 990 Arg Thr Glu Ser Phe Ser Ala Ser Pro Ile Arg Ile Cys Ala Cys Pro 995 1000 1005 Ser Phe Pro Thr Lys Glu Trp Thr Thr Ala Ser Ala Asp Ala Trp Asn 1010 1015 1020 Gly Gly Asp Gly Ala Gly Arg Ala Glu Arg Lys Leu Ala Ala Gly Thr 1025 1030 1035 1040 Ala Ala Ser Gly Arg His Pro Ser Asp Gly 1045 1050 <210> 3 <211> 14 <212> PRT <213> Bacillus circulans <400> 3 Lys Pro Asp Leu Pro Leu Ala Asp Arg Ile Thr Pro Glu Gln 1 5 10 <210> 4 <211> 15 <212> PRT <213> Bacillus circulans <400> 4 Ala Ala Gly Asp Pro Ile Asn Lys Ala Asn Asn Gly Tyr Gly Leu 1 5 10 15 <210> 5 <211 > 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: probe for heparitinase T-IV segment I <220> <221> misc_feature <222> 9, 15, 18, 21, 24 , 30, 36, 39 <223> n = i <400> 5 atgaarccng ayytnccnyt ngcngaymgn athacnccng arca 44 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: probe for heparitinase T-IV segment III <220> <221> misc_feature <222> 3, 6, 9, 15 <223> n = i <400> 6 gcngcnggng ayccnathaa yaa 23 <210> 7 <211> 22 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer NDP <400> 7 gaaacatatg cagccggccg ca 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer NDS <400> 8 tgagcatatg cgtaaaacaa cg 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer BS <400> 9 gctcggatcc gaggcgaaag gt 22

[Brief description of the drawings]

FIG. 1 shows a probe used for Southern hybridization screening of a genomic DNA library derived from Bacillus circulans HpT298 strain.

FIG. 2 shows the results (electrophoresis photograph) of Southern hybridization using Probe I. 1. BamHI, 2. Eco
RI, 3. HindIII, 4. PstI, 5. SalI, 6. MboI.

FIG. 3 shows a result (electrophoresis photograph) of Southern hybridization using Probe II. 1. BamHI, 2. Eco
RI, 3. HindIII, 4. PstI, 5. SalI, 6. MboI.

FIG. 4 shows the construction of a recombinant plasmid containing a 1.3 kb DNA fragment.

FIG. 5 shows a result (electrophoresis photograph) of Southern hybridization using a tertiary probe. 1. BamHI, 2. E
coRI, 3. HindIII, 4. PstI, 5. SalI.

FIG. 6 shows a restriction map around the heparitinase T-IV gene.

FIG. 7 shows the construction of a recombinant plasmid containing a 2.5 kb DNA fragment.

FIG. 8 shows the construction of an expression plasmid.

FIG. 9 shows the construction of an expression plasmid.

FIG. 10 shows the results of SDS-PAGE analysis (electrophoresis photograph) of the expression of heparitinase T-IV.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 9/88 (C12N 9/88 C12Q 1/68 C12R 1:19) // (C12N 9/88 C12N 15 / 00 ZNAA C12R 1:19) 5/00 A F term (reference) 4B024 AA03 AA11 AA20 BA07 CA03 CA09 DA06 EA03 EA04 GA11 HA01 HA12 4B050 CC03 CC04 DD02 LL03 LL10 4B063 QA01 QA13 QQ06 QQ13 QQ42 QR14 QR32 QR33 QR80 QS34 QX07 4B065 AA15Y AA26X AB01 AC14 AC16 BA02 CA27 CA46 CA60

Claims (7)

[Claims] 1. A polypeptide of the following or of heparitinase T-IV. A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2. A polypeptide comprising an amino acid sequence having substitution, deletion, insertion or transposition of one or several amino acids in the amino acid sequence of the polypeptide described above, and having the heparitinase activity of the polypeptide. 2. A DNA encoding the following or the polypeptide of heparitinase T-IV. A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2. A polypeptide comprising an amino acid sequence having substitution, deletion, insertion or transposition of one or several amino acids in the amino acid sequence of the polypeptide described above, and having the heparitinase activity of the polypeptide. 3. A DNA comprising any one of the following base sequences: The base sequence described in SEQ ID NO: 1. A base sequence consisting of base numbers 112 to 3264 described in SEQ ID NO: 1. Or a base sequence of a DNA which hybridizes to a DNA consisting of the base sequence under stringent conditions. A nucleotide sequence complementary to any one of the following: A recombinant vector comprising the DNA according to claim 2 or 3. A transformant transformed with the DNA according to claim 2 or 3. 6. A transformant transformed with the recombinant vector according to claim 4. 7. The transformant according to claim 5 or 6, wherein the transformant is cultured or grown, and heparitinase is obtained from the culture or the grown body.
A method for producing a heparitinase T-IV polypeptide, comprising collecting a T-IV polypeptide.