JP2002000277A - Method of detection for hiv-1 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a convenient method for detecting HIV-1 and an effective means for detecting HIV-1. SOLUTION: This method of detection for HIV-1 includes a process for confirming the presence or absence of HIV-1 by carrying out the amplification reaction of a nucleic acid which contains a part consisting of the part of HIV-1 env gene nucleotide sequence in which the nucleotide sequence is highly preserved between plural subtypes as a target sequence and by checking out whether the amplification of the nucleic acid is observed or not. The primer capable of being utilized in the detection of HIV-1 is a primer which contains a part consisting of the part of HIV-1 env gene nucleotide sequence in which the nucleotide sequence is highly preserved between plural subtypes as a target sequence. The kit for detecting HIV-1 includes a primer pair which contains a part consisting of the part of HIV-1 env gene nucleotide sequence in which the nucleotide sequence is highly preserved between plural subtypes as a target sequence.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting HIV-1, a primer which can be used for detecting HIV-1 and H
The present invention relates to a kit for detecting IV-1.

[0002]

2. Description of the Related Art Human immunodeficiency virus (hereinafter referred to as "HI")
V ". ) Is acquired immunodeficiency syndrome (hereinafter referred to as “A
IDS ". ) Causing the virus type 1 (HIV-
Types 1) and 2 (HIV-2) are known. this house,
There are many cases and various subtypes are found
HIV-1. Serum antibodies become positive within weeks after infection with HIV-1. HIV-1 antibodies are detected by an EIA (enzyme-immuno assay) method in which the antibodies react with the antigens of the virus to color. If the EIA method is positive or false positive,
Serum is added to the blot obtained by electrophoresing the antigens of the virus particles by the rn blot method, and if the antibody reacts with a specific virus antigen, the diagnosis is confirmed as positive. Since it takes several weeks from HIV-1 infection until antibodies can be detected in serum, it is necessary to wait several weeks or more after HIV-1 infection to check for the presence of HIV-1 infection by the above antibody method. What had to be was a problem.

[0003]

SUMMARY OF THE INVENTION Accordingly, the present invention provides H
HI even from a sample of subjects shortly after IV-1 infection
It is an object to provide a method capable of detecting V-1.
Another object of the present invention is to provide a kit for detecting HIV-1.

[0004]

Means for Solving the Problems The present inventors have developed HIV-
By designing a primer capable of amplifying any of the subtypes 1 and performing an amplification reaction of a nucleic acid in a sample using the primer, HIV-1 was successfully detected rapidly, and the present invention was completed. .

When HIV-1 enters an individual, it is adsorbed on CD4-positive cells such as helper T cells and macrophages, and viral genomic RNA is sent into the cells. Genomic RNA is converted to DNA in the cytoplasm by reverse transcriptase, translocates into the nucleus, and is integrated into chromosomal DNA. This DNA is called a provirus. Genomic RNA and mRNA are transcribed from the provirus, and viral proteins are translated using that as a template,
Virus particles are formed from RNA and viral proteins and budding outside the cells. HIV-1 multiplies by repeating such an infection cycle. The immune system of infected individuals recognizes viral proteins present in infected cells and virus particles as antigens, and produces specific antibodies and cytotoxic T cells to eliminate HIV-1. Thus, individuals who have HIV-1 infection will have antibodies specific for the viral proteins. A general diagnostic method for HIV-1 infection is performed based on the presence or absence of this virus antigen-specific antibody. But,
After the infection is established, it takes on average several weeks for the immune system to produce virus antigen-specific antibodies to detectable levels. This period is called a window period, and infection cannot be diagnosed by antibody testing. On the other hand, HIV-
Since one nucleic acid (DNA or RNA) increases before the immune system recognizes an antigen, a highly sensitive nucleic acid amplification reaction can diagnose HIV-1 infection earlier than an antibody test. That is, the window period can be shortened. However, HIV-1 has high genetic diversity and is divided into 10 subtypes from A to J, and amplification primers that can detect HIV-1 nucleic acids of any subtype have been established. Absent. That is, depending on the subtype, diagnosis of HIV-1 infection by nucleic acid amplification may be inaccurate. The present invention enables the detection of HIV-1 nucleic acid with high sensitivity at one copy per reaction regardless of subtype.

[0006] The present invention relates to a nucleic acid amplification reaction targeting a part of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among a plurality of subtypes. And a method for detecting the presence or absence of HIV-1 based on the presence or absence of nucleic acid amplification. Target sequence is 10
It may be from 0 to 2500 nucleotides in length, preferably from 150 to 500 nucleotides in length. In the above method, for example, the 3 ′ end of the target sequence is
v gene may be located in the C3 region, preferably in the C3 region.
It may be between 129 and 171 nucleotides from the 5 'end. Further, the 5 'end of the target sequence may be located in the C2 region of the HIV-1 env gene, and is preferably 3' of the C2 region.
It may be between 160 and 111 nucleotides from the end.

[0007] Here, "the nucleotide sequence is highly conserved among a plurality of subtypes" means that when the nucleotide sequences of all the HIV-1 strains already reported are analyzed, a plurality of the nucleotide sequences are conserved. Subtypes (i.e., all subtypes or A,
Subtypes B, C, and E) with 85% or more homology among HIV-1 strains with few exceptions. Since HIV-1 is a very diverse virus, the homology in the nucleotide sequence is the highest in every 20 subtypes of the strains belonging to each subtype, no matter how the primers are designed. Some are less than 85%. This is what the "small exceptions" mentioned above mean.

The subtypes of HIV-1 are A,
B, C, D, E, F, G, H, I and J are known. The step of confirming the presence or absence of HIV-1 comprises:
Using the first primer pair, a nucleic acid targeting a portion of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among a plurality of subtypes. After performing the amplification reaction, a second amplification reaction using the nucleotide sequence inside the target sequence as the target sequence is performed using the second primer pair, and the presence or absence of HIV-1 is determined depending on the presence or absence of nucleic acid amplification. It may consist of confirming its presence. In this step, a mixture of a plurality of upstream primers having different nucleotide sequences and a plurality of downstream primers having different nucleotide sequences may be used as primers.

[0009] Here, the "upstream primer" means an oligonucleotide having a nucleotide sequence complementary to a nucleotide sequence located near the 5 'end of the target sequence of the amplification reaction, and the "downstream primer" is an amplification primer. An oligonucleotide having a nucleotide sequence complementary to a nucleotide sequence located near the 3 'end of the reaction target sequence is meant. For example, as the first primer pair, GCAATAGAAA
Primer 12A containing the nucleotide sequence of AATTCTCCTC (SEQ ID NO: 5), Primer 12B containing the nucleotide sequence of ACAGTAGAAAAATTCCCCTC (SEQ ID NO: 6), CACAGTACAATGC
Primer 9AE containing the nucleotide sequence of ACACATG (SEQ ID NO: 8) and CACAGTACAATGTACACATG (SEQ ID NO: 9)
Using a mixture of primers 9B containing the nucleotide sequence of AATTTCTGGGTCCCCTCCTG as the second primer pair
A primer comprising the nucleotide sequence of (SEQ ID NO: 18)
11LB, primer 11LAE containing the nucleotide sequence of AATTTCTAGATCCCCTCCTG (SEQ ID NO: 25), AATTTCTAGGTCCCCTC
Primer 11LC containing the nucleotide sequence of CTG (SEQ ID NO: 26) and CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 20)
A mixture of 10 U of primers containing the nucleotide sequence of

[0010] The present invention also relates to a primer which targets a part of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among a plurality of subtypes. Accordingly, the present invention provides primers that can be used for detecting HIV-1. Further, the present invention includes a primer pair that targets a portion of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among a plurality of subtypes. A kit for detecting HIV-1 is provided.

[0011]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Embodiments of the present invention will be described below in detail. HIV-infected persons, HIV-
1) Samples of blood, lymph, cerebrospinal fluid, semen, lymph nodes, etc. are collected from a subject such as an infected person or a patient who has been confirmed to have an infection, or a patient receiving anti-HIV-1 treatment. From the collected sample, Pharmacol Ficol
After separating monocytes using l-Paque density gradient centrifugation,
Alternatively, directly use QIAGEN's QIAamp Blood Kit
Is extracted. Alternatively, after removing the cell components from the collected sample by centrifugation, use QIAGEN's QIAamp Vir
Extract RNA using al RNA Kit. The concentration of the DNA or RNA is then determined from the absorbance at 260 nm.

Next, this nucleic acid is subjected to PCR, preferably n
Perform ested PCR. Here, a case where nested PCR is used will be described. Nested PCR is a method in which a second primer pair is designed inside a target sequence to be amplified by one set of primer pairs (first primer pair), the first PCR is performed, and then The second PCR is carried out using the part as a new template and another pair of primers (second primer pair). In the first PCR, an undesired sequence may be amplified in addition to the target sequence. However, the probability that there is a sequence in which the primers of the second primer pair anneal is present in the undesired fragment amplified in the first PCR. Therefore, by performing such two PCRs, only the target sequence is selectively amplified.

The method for detecting HIV-1 according to the present invention comprises the steps of:
-1 of the nucleotide sequence of the env gene,
Includes a step of conducting an amplification reaction of a nucleic acid targeting a part of the nucleotide sequence whose nucleotide sequence is highly conserved among a plurality of subtypes as a target sequence, and confirming the presence or absence of HIV-1 based on the presence or absence of nucleic acid amplification . The step of confirming the presence or absence of HIV-1 is performed using the first primer pair.
After performing an amplification reaction on a nucleic acid targeting a part of the nucleotide sequence of the HIV-1 env gene, the nucleotide sequence of which is highly conserved among a plurality of subtypes, A second amplification reaction using the nucleotide pair inside the target sequence as a target sequence by using the primer pair described above, and confirming the presence or absence of HIV-1 based on the presence or absence of nucleic acid amplification.

As a first primer pair, a first PCR (first PC) using a mixture of primers capable of giving amplification products for several subtypes
R) may be performed. Primers for this purpose can include mixtures of primer 9AE, primer 9B, primer 12A and primer 12B.

9AE / 9B / 12A / 12B Primer 9AE: CACAGTACAATGCACACATG (SEQ ID NO: 8) Primer 9B: CACAGTACAATGTACACATG (SEQ ID NO: 9) Primer 12A: GCAATAGAAAAATTCTCCTC (SEQ ID NO: 5) Primer 12B: ACAGTAGAAAAATTCCCCTC (SEQ ID NO: 6)

Primer 9AE is a sequence complementary to the sequence of position 6943-6962, counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and has subtypes A and E. , F and H specific primers. Primer 9B is HI
It is a sequence complementary to the sequence at position 6943-6962, counted from the 5 'end (left end) of the entire nucleotide sequence of V-1 (NL4-3 strain), and has subtypes B, C, D, E, F, Primers specific to G, H and J. Primer 12A was HIV-1 (NL4-3 strain)
7369-7350, counting from the 5 'end (left end) of the entire nucleotide sequence of
A sequence complementary to the th sequence and having subtypes A, C,
Primers specific to E, G, H, I and J.
Primer 12B is a sequence complementary to the 7369-7350th sequence counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and has subtypes B, D, E, Primers specific to F and I.

The primers used for the first PCR may be designed as follows. Collect the nucleotide sequences of all previously reported HIV-1 strains, classify them into subtypes, and arrange the nucleotide sequences in the C2 or C3 region for the highest homology, Of HIV-1 strains belonging to about 20 nucleotides with 85% or more homology, with few exceptions. For example, the nucleotide sequence of CACAGTACAATGTACACATG (SEQ ID NO: 9) comprises subtypes B, C,
All HIV-1 strains belonging to D, E, F, G, H and J have 85% or more homology with the nucleotide sequence between 160 and 141 nucleotides from the 3 'end of the C2 region (FIG. 1) ). The oligonucleotide consisting of this nucleotide sequence was named primer 9B. Also, CACAGT
The nucleotide sequence of ACAATGCACACATG (SEQ ID NO: 8) is
All the HIV-1 strains belonging to subtypes A, E, F and H have 85% or more homology with the nucleotide sequence between 160 and 141 nucleotides from the 3 'end of the C2 region (FIG. 1). The oligonucleotide consisting of this nucleotide sequence was named primer 9AE. In general, the length of the primer should be 18-30 base pairs,
Preferably it is 20 to 25 base pairs.

Using a 1/1000 to 1/5 volume (for example, 1/50 volume) of this PCR product, and using another pair of primers (second primer pair), a second PCR (second P
CR). At this time, a primer pair for the second PCR is designed inside the target sequence to be amplified by the first PCR. For example, in order to be able to amplify any subtype, a second PCR (second PCR) using a mixture of primers capable of giving amplification products for several subtypes as a second primer pair ) Is good. Primers for this purpose can include mixtures of primer 10U, primer 11LB, primer 11LAE and primer 11LC.

• 10U / 11LB / 11LAE / 11LC Primer 10U: CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 20) Primer 11LB: AATTTCTGGGTCCCCTCCTG (SEQ ID NO: 18) Primer 11LAE: AATTTCTAGATCCCCTCCTG (SEQ ID NO: 25) Primer 11LC: AATTTCTAGGTCCCCTCCTG (SEQ ID NO: 26)

Primer 10U is a sequence complementary to the sequence at position 6992-7011, counting from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (strain NL4-3), and has subtypes A and B. , D, E and J are primers that are particularly specific, but also for all other subtypes, with the exception of a few HIV-1 strains.
There is high homology. Primer 11LB is HIV-1 (NL4-3 strain)
7327-7308, counting from the 5 'end (left side) of the entire nucleotide sequence of
The subtype B, D, F, G
And I specific primers. Primer 11LA
E is complementary to the sequence at positions 7327-7308, counted from the 5 'end (left side) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and has subtypes A, E, F, G, and I. And J-specific primers. Primer 11LC is complementary to the sequence of position 7327-7308, counted from the 5 ′ end (left side) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and has subtypes C, F, G, H, Primers specific to I and J.

The primers used for the second PCR may be designed as follows. The nucleotide sequences of all HIV-1 strains that have already been reported are collected and classified into subtypes, and then the nucleotide sequences of the C2 region or C3 region are arranged so as to have the highest homology. And
Inside the primer pair used for the first PCR, that is, in the region 3 'of the upstream primer and 5' of the downstream primer, among HIV-1 strains belonging to a plurality of subtypes,
With few exceptions, about 85% or more homology
Search for a sequence consisting of 20 nucleotides. For example, CTGT
The nucleotide sequence of TAAATGGCAGTCTAGC (SEQ ID NO: 20) has only a small portion between the nucleotide sequence 111 and 92 nucleotides from the 3 ′ end of the C2 region.
Except for the HIV-1 strain, HIV-1 strains belonging to subtypes A, B, D, E and J and HIV belonging to other subtypes of 90% or more
-1 strain has a homology of 85% or more (FIG. 1). An oligonucleotide consisting of this nucleotide sequence is used as a primer
Named 10U.

Alternatively, a common primer pair capable of amplifying any subtype, or a mixture of primer pairs capable of detecting each subtype (eg, subtype A, subtype B, subtype E) is used. And a second PCR (second PCR) may be performed.

As the primer pair capable of detecting each subtype, for example, at least one of the primers constituting the second PCR primer pair may be HIV
A primer (primer 1) containing a sequence complementary to a subtype-specific nucleotide sequence of a part of the C2 region of the -1 env gene may be used. HIV-1 env gene
Since the nucleotide sequence of the C2 region differs depending on the subtype as shown in FIG. 1, it is preferable to select a nucleotide sequence from this region and design a primer. The other primer may be a primer (primer 2) containing a sequence complementary to a partial nucleotide sequence of the C3 region of the HIV-1 env gene. FIG. 2 shows the nucleotide sequence of the 3 ′ flanking region (C3 region) of the V3 region of the env gene of various HIV-1 subtypes. It is advisable to design primers. In designing the above primers, it is advisable to use a phylogenetic tree analysis method and select a primer in which the nucleotide sequence of a certain subtype has the largest genetic distance from the corresponding nucleotide sequence of another subtype. Specifically, a primer pair containing the following nucleotide sequence can be used.

Second PCR for detection of subtype A
Primer pair and its nucleotide sequence ・ 10 / 11QA Primer 10: AAATGGCAGTCTAGCAGAAG (SEQ ID NO: 4) Primer 11QA: CTCCTGAGGGGTTAGCAAAG (SEQ ID NO: 1) Primer 10 is the 5 ′ end of the entire nucleotide sequence of HIV-1 (NL4-3 strain) It is a sequence complementary to the sequence at positions 6997-7016 counted from (left end) and a primer specific to subtypes A, B, D and E. Primer 11QA was used for HIV-1 (NL4-3
7313-7, counted from the 5 'end (left end) of the entire nucleotide sequence of
It is a sequence complementary to the sequence at position 294, and is a primer specific only to subtype A.

10U / 11QA1 Primer 10U: CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 2)
0) Primer 11QA1: CTCCTGAGGAGTTAGCAAAG (SEQ ID NO: 2
7) Primer 11QA1 is 5 'of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7313 to 7294 counted from the end (left end), and is a primer specific to only subtype A.

Second PCR for detection of subtype B
Primer pair and its nucleotide sequence ・ 10 / 11BB Primer 10: AAATGGCAGTCTAGCAGAAG (SEQ ID NO: 4) Primer 11BB: CTGTGCATTACAATTTCTGG (SEQ ID NO: 2) Primer 11BB is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7338 to 7319, counted from the end (left end), and is a primer specific only to subtype B.

10U / 11VB primer 10U: CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 2)
0) Primer 11VB: CACAATTAAAACTGTGCATTAC (SEQ ID NO: 2)
8) Primer 11VB is 5 'of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7349 to 7328, counted from the end (left end), and is a primer specific only to subtype B.

Second PCR for detection of subtype E
Primer pair and its nucleotide sequence 10 / 11QE Primer 10: AAATGGCAGTCTAGCAGAAG (SEQ ID NO: 4) Primer 11QE: CTCCTGAGGGTGGTTGAAAG (SEQ ID NO: 3) Primer 11QE is 5 'of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7313-7294, counted from the end (left end), and is a primer specific only to subtype E.

10U / 11WE primer 10U: CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 2)
0) Primer 11WE: CTCTACAATTAAAATGATGCATTG (SEQ ID NO: 30) Primer 11WE is 5 'of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7352-7329 counted from the end (left end), and is a primer specific only to subtype E.

Second PCR for detection of subtype C
Primer pair and its nucleotide sequence ・ 10U / 11YE Primer 10U: CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 20) Primer 11YE: TTCCCCTCTACAATTAAAATGA (SEQ ID NO: 3)
5) Primer 11YE is a primer for the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7357-7336, counted from the 5 'end (left end), and is a primer specific to only subtype E.

10U / 11YE2 Primer 10U: CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 20) Primer 11YE2: GAAAAATTCCCCTCTACAATTAAAATGA (SEQ ID NO: 36) Primer 11YE2 is a full-length nucleotide sequence of HIV-1 (strain NL4-3).
It is a sequence complementary to the sequence at positions 7363-7336, counted from the 5 'end (left end), and is a primer specific only to subtype E.

10C / 11RC Primer 10C: AAATGGTAGCCTAGCAGAAG (SEQ ID NO: 1)
0) Primer 11RC: CTCCTGAGGATGGTGCAAATTT (SEQ ID NO: 1
3) Primer 10C is a sequence complementary to the sequence of position 6997-7016, counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (strain NL4-3). Specific primer. Primer 11RC is a sequence complementary to the sequence at position 7313-7292, counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and is specific only to subtype C. It is a primer.

10UC / 11XC Primer 10UC: CTGTTAAATGGTAGTCTAGC (SEQ ID NO: 2)
4) Primer 11XC: TTGTTTTATTAGGGAAGTGTTC (SEQ ID NO: 2
9) Primer 10UC is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain)
It is a sequence complementary to the sequence at position 6992-7011, counted from the end (left end), and is a primer specific to subtypes C and E. Primer 11XC is a sequence complementary to the 7289-7268th sequence counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and a primer specific to subtype C. It is.

Second PCR for detection of subtype D
Primer pair and its nucleotide sequence ・ 10 / 11RD Primer 10: AAATGGCAGTCTAGCAGAAG (SEQ ID NO: 4) Primer 11RD: CTCCTGAGGATGGTTTAAAAAT (SEQ ID NO: 1)
4) Primer 11RD is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain)
It is a sequence complementary to the sequence at positions 7313-7292, counted from the end (left end), and is a primer specific only to subtype D.

Second PCR for detection of subtype F
Primer pair and its nucleotide sequence ・ 10C / 11RF primer 10C: AAATGGTAGCCTAGCAGAAG (SEQ ID NO: 1
0) Primer 11RF: CTCCTGAGGATGAGTTAAATTT (SEQ ID NO: 1
5) Primer 11RF is 5 'of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7313-7292, counted from the end (left end), and is a primer specific only to subtype F.

Second PCR for detection of subtype G
Primer pair and its nucleotide sequence ・ 10G / 11SG Primer 10G: GAATGGCAGTTTAGCAGAAG (SEQ ID NO: 1
1) Primer 11SG: TCCTGCAGATGAGTTAAAGG (SEQ ID NO: 1
6) Primer 10G is a sequence complementary to the sequence of position 6997-7016, counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and is specific only to subtype G Primer. Primer 11SG is a sequence complementary to the 7312-7293th sequence counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and is specific only to subtype G. It is a primer.

Second PCR for detection of subtype H
Primer pair and its nucleotide sequence ・ 10H / 11SH Primer 10H: GTCAAATGGCAGTTTAGCAG (SEQ ID NO: 1
2) Primer 11SH: TCCTGAGGATGGTTTAAAGG (SEQ ID NO: 1
7) Primer 10H is a sequence complementary to sequence 6994-7013, counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and is specific only to subtype H Primer. Primer 11SH is a sequence complementary to the 7312-7293th sequence counted from the 5 'end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain), and is specific only to subtype H. It is a primer.

In addition, the following primers can be used. Primer 10KC: CTCAACTACTGTTAAATGGTAG (SEQ ID NO: 2
1) Primer 10KC is 5 'of the entire nucleotide sequence of HIV-1 (NL4-3 strain)
It is a sequence that is complementary to the sequence at positions 6984-7005, counted from the end (left end), and is a primer specific only to subtype C.

Primer 10UF: CTGTTAAATGGCAGCCTAGC
(SEQ ID NO: 22) Primer 10UF is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at position 6992-7011, counted from the end (left end), and is a primer specific to subtypes A, E, F, H and I.

Primer 10UG: CTGTTAAATGGCAGTTTAGC
(SEQ ID NO: 23) Primer 10UG is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the 6992-7011 sequence counted from the end (left end), and is a primer specific to subtypes A, E, G, I and J.

Primer 11LE: AATTTCTAGATCTCCTCCTG
(SEQ ID NO: 19) Primer 11LE is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
These primers are complementary to the sequence at positions 7327 to 7308, counted from the end (left side), and are specific to subtypes E, F, G, H, and J.

Primer 11TC: TTCTCCTCTACAATTAAAGC
(SEQ ID NO: 31) Primer 11TC is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7357-7338, counted from the end (left end), and is a primer specific to only subtype C.

Primer 11RC1: TTATTGTTTTATTAGGGAAGT
G (SEQ ID NO: 32) Primer 11RC1 is a 5 ′ part of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7292 to 7271 counted from the end (left end), and is a primer specific only to subtype C.

Primer 11SE: TGCATTGTAATTTCTAGATCTC
(SEQ ID NO: 33) Primer 11SE is 5 ′ of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the 7333-7314 sequence counted from the end (left end), and is a primer specific only to subtype E.

Primer 11BE: TGATGCATTGTAATTTCTAG
(SEQ ID NO: 34) Primer 11BE is a 5 ′ part of the entire nucleotide sequence of HIV-1 (NL4-3 strain).
It is a sequence complementary to the sequence at positions 7338-7319, counted from the end (left end), and is a primer specific only to subtype E.

Primer 12E: GCAATAGAAAAATTCCCCTC (SEQ ID NO: 7) Primer 12E is complementary to the 7369-7350th sequence counted from the 5 ′ end (left end) of the entire nucleotide sequence of HIV-1 (NL4-3 strain). Array, subtypes B, C, D, E, H and J
Is a primer specific to

The PCR procedure and reaction conditions are described in Bruisten
S. et al., AIDS Res Hum Retroviruses 1993, 9: 259-
265, but it is desirable to use the hot start method. The hot start method refers to a PCR method in which a PCR reaction solution is placed on a hot plate and starts working only when the temperature becomes high (usually 90 ° C. or higher). By the way, HIV-1 may not be detected when HIV-1 is detected by the above-described method for a subject for which HIV-1 infection has been confirmed by an antibody test. This may be because the HIV-1 DNA concentration was below the detection limit or there were many mutations in the primer binding portion.

For the former possibility, generally, HIV
Since the concentration of -1 is higher in plasma than in cells, RNA is extracted from plasma, converted to cDNA using reverse transcriptase, and then subjected to the above method. For the latter possibility, the annealing temperature in the nucleic acid amplification reaction was set to 4 ° C. more than the temperature in the examples described below in order to suppress the influence of mismatch between the primer and the HIV-1 nucleotide sequence.
Alternatively, lower the temperature by 8 ° C and perform the above method. The reaction products of the PCR are separated by agarose gel electrophoresis and detected by ethidium bromide staining. HIV-1 in the sample DNA
A clear band is observed when DNA or RNA is present, but no band is observed when DNA or RNA is not present. Thus, the presence or absence of HIV-1 is determined.

The present invention relates to a primer targeting a part of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among a plurality of subtypes. , HIV-1. The primer of the present invention,
A primer containing a sequence complementary to a partial nucleotide sequence of the C2 region of the HIV-1 env gene or HIV-
It is preferable that the primer be a primer containing a sequence complementary to a partial nucleotide sequence of the C3 region of the env gene of No. 1, specifically, a primer having any one of the nucleotide sequences of SEQ ID NOs: 1 to 36 can be mentioned. .

The present invention includes primer pairs that target a portion of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among multiple subtypes. And a kit for detecting HIV-1. As the primer pair, the primer pair for the second PCR (inner prim
ers) or primer pairs for the first PCR (outer
primers) and a second PCR primer pair. The kit of the present invention also includes a dNTP mixture, a reaction buffer, a DNA polymerase, a pair of common subtype primers for the first PCR (eg, 9B / 12B), and a pair of common subtype primers for the second PCR. (For example, 10U / 11VB). Further, in order to reduce the influence of mismatch between the primer and the base pair of the sample HIV-1 DNA, it is desirable to increase the concentration of magnesium ion in the reaction buffer from normal 1.5 mM to about 4 mM. In this diagnostic kit, the components that make up the kit may be contained individually or in combination or collectively in containers such as vials, tubes, etc. It may be stored in a structured supporting means.

[0051]

EXAMPLES The present invention will be described below in more detail with reference to examples, but the scope of the present invention is not limited to these examples. [Example 1] Subjects and methods 1) Standard specimens by subtype for testing subtype determination methods Subtypes A, B, C and E were determined by sequencing the env gene V3 region and analyzing the phylogenetic tree. HIV
-1, 3 persons, 3 persons, 2 persons and 3 persons, respectively, total 11
DNA was extracted from the blood of each name and used as a standard sample. 2) Subjects whose subtypes were determined 32 HIs who went to or were hospitalized in a hospital in Tokyo
HIV-1 subtypes were determined for V-infected individuals. 3) Preparation of DNA from HIV Patient Blood 10 ml of peripheral blood was collected from the above HIV-infected person.
Sodium citrate was used as an anticoagulant. After separating mononuclear cells from peripheral blood by Ficoll-Paque (Amersham Pharmacia) density gradient centrifugation, the QIAamp Blood Kit (QIAG
DNA was prepared using EN. DNA is dissolved in pure water or a buffer containing 1 mM EDTA, and
Stored at ° C. PCR was performed using 0.5 μg of this DNA. 4) Detection of subtypes A, B, C and E by PCR The nucleotide sequences of primers used for PCR are shown in FIG.

As a primer for the first PCR, 9A
A mixture of E, 9B, 12A and 12B was used. The second PC
As primers for R, 10U and 11QA1 are used for specific detection of subtype A, 10U and 11VB are used for specific detection of subtype B, and specific detection of subtype C is used. Nested PCR was performed using 10UC and 11XC, and 10U and 11YE2 for specific detection of subtype E. To amplify HIV-1 DNA regardless of subtype, nested PCR was performed using a mixture of 10U, 11LB, 11LAE and 11LC (FIG. 3).

The PCR was performed using DN prepared from an HIV-infected person.
Using 0.5 μg of A as a sample, 100 μL of a reaction solution (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 4 mM MgCl 2,
0.2 mM dNTP, 1.0 μM primer, 2.5 units of Taq polymer
ase) for 30 cycles of 94 ° C for 15 seconds, 56 ° C for 30 seconds, and 72 ° C for 1 minute.
I went there. The second PCR was performed under the same conditions for 25 cycles using 2 μL of a solution obtained by diluting the reaction solution of the first PCR 5 times with a buffer as a sample. However, 60 ° C. for 30 seconds was used instead of 56 ° C. for 30 seconds.

The detection of PCR products (322 bp for subtype A, 358 bp for subtype B, 298 bp for subtype C, and 372 bp for subtype E) was performed by separation on ethidium after electrophoresis on a 2% agarose gel. This was performed by performing bromide staining. Results 1) Examination of subtypes by PCR of standard specimens for each subtype The following results were obtained for specimens whose subtypes were determined by virus genome sequencing. PCR using primers for detecting subtype A
Is positive only for subtype A specimens, while subtypes B and C
And E samples were all negative. In the PCR using the primers for detecting subtype B, only the sample of subtype B was positive, and the samples of subtypes A, C and E were all negative. In the PCR using the primers for detecting subtype C, only the sample of subtype C was positive, and the samples of subtypes A, B and E were all negative. In addition, in the PCR using the primer for detecting subtype E, only the specimen of subtype E was positive, and the specimens of subtypes A, B and C were all negative (FIG. 4). In addition, regardless of subtype, DNA of HIV-1
All samples were positive by PCR using primers for amplifying (FIG. 4). 2) Subtype determination of HIV infected persons by PCR. 32 HIs visiting or hospitalized in a hospital in Tokyo
HIV-1 subtypes were determined for V-infected individuals. The breakdown is that, when the standard specimens by subtype of 11 cases are combined, subtype A is 3 cases, subtype B is 30 cases, subtype C is 2 cases, and subtype E is 8 cases.

In order to confirm that the above diagnostic results were correct, 21 out of a total of 43 HIV-infected persons, whose subtypes were determined by PCR,
FIG. 5 shows the results of sequencing the NA and analyzing the phylogenetic tree. As a result, for these HIV-1,
The subtypes determined by CR and phylogenetic analysis were completely consistent with each other.

Example 2 Subjects and Methods 1) Western Blot Negative, PA Method Positive Serum A blood test at a hospital in Tokyo revealed that the Western blot method was HIV-1 negative, but the PA method was HIV. -
Fifteen serum samples that were 1 positive were used. 2) Preparation of DNA from RNA from Plasma RNA was prepared from 200 µL of the serum sample using an RNAeasy Kit (QIAGEN). RNA was dissolved in pure water and stored at −20 ° C. until immediately before use. 3) Detection of HIV-1 by PCR RNA corresponding to 20 μL of serum was used as a sample, and primers were
Using a mixture of 12A and 12B, 20 μL of the reaction solution (10 mM Tris-
HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 1 mM dNTP, 5
The mixture was reacted at 42 ° C. for 30 minutes with μM primer and 100 units of reverse transcriptase to synthesize cDNA. Using this cDNA as a sample,
Able to amplify HIV-1 DNA regardless of subtype
Sted PCR was performed. As a primer for the first PCR, a mixture of 9AE, 9B, 12A and 12B was used. As a primer for the second PCR, a mixture of 10U, 11LB, 11LAE and 11LC was used.

In the first PCR, 100 μL of the reaction solution (10 m
M Tris-HCl, pH 8.3, 50 mM KCl, 4 mM MgCl2, 0.2 mM d
NTP, 1.0 μM primer, 2.5 units of Taq polymerase)
A cycle of 94 ° C. for 15 seconds, 56 ° C. for 30 seconds and 72 ° C. for 1 minute was performed 30 times. The second PCR is the reaction solution 2 of the first PCR.
Using the μL as a sample, 25 cycles were performed under the same conditions.
However, 60 ° C. for 30 seconds was used instead of 56 ° C. for 30 seconds.

The PCR product (336 b regardless of subtype)
The detection of p) was performed by performing ethidium bromide staining after separation by electrophoresis on a 2% agarose gel. Results Although HIV-1 was negative on Western blot,
In Method A, HIV-1 was not detected by PCR from any of the 15 serum samples that were HIV-1 positive (FIG. 6). The PCRs used in this study were all subtypes of H
It was designed so that IV-1 could be detected, and it was demonstrated that at least HIV-1 of subtypes A, B, C and E could be detected (FIG. 4). Therefore, it is highly likely that the discrepancy between the results of the Western blotting and the PA method of the serum samples tested this time was not a subtype problem but a false positive result by the PA method. Thus, HIV-
It is considered that PCR that can detect 1 is effective as a definitive diagnosis of HIV-1 infection.

[0059]

According to the present invention, there has been provided a method for detecting HIV-1 from a sample of a subject immediately after HIV-1 infection. According to the method of the present invention, HIV-1 can be easily detected. Also, an effective means for detecting HIV-1 was provided.

[0060]

[Sequence List] SEQUENCE LISTING <110> KEIO UNIVERSITY <120> A METHOD FOR HIV-1 SUBTYPING <130> P99-0609 <140> <141> <160> 36 <170> PatentIn Ver. 2.0 <210> 1 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 1 ctcctgaggg gttagcaaag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220 > <223> Description of Artificial Sequence: synthetic DNA <400> 2 ctgtgcatta caatttctgg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400 > 3 ctcctgaggg tggttgaaag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 4 aaatggcagt ctagcagaag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 5 gcaatagaaa aattctcctc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: synthetic DNA < 400> 6 acagtagaaa aattcccctc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 7 gcaatagaaa aattcccctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 8 cacagtacaa tgcacacatg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 9 cacagtacaa tgtacacatg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 10 aaatggtagc ctagcagaag 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 11 gaatggcagt ttagcagaag 20 <210> 12 <211> 20 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 12 gtcaaatggc agtttagcag 20 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223 > Description of Artificial Sequence: synthetic DNA <400> 13 ctcctgagga tggtgcaaat tt 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 14 ctcctgagga tggtttaaaa at 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 15 ctcctgagga tgagttaaat tt 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 16 tcctgcagat gagttaaagg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 17 tcctgaggat ggtttaaagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 18 aatttctggg tcccctcctg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 19 aatttctaga tctcctcctg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 20 ctgttaaatg gcagtctagc 20 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 21 ctcaactact gttaaatggt ag 22 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 22 ctgttaaatg gcagcctagc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 23 ctgttaaatg gcagtttagc 20 <210> 24 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 24 ctgttaaatg gtagtctagc 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 25 aatttctaga tcccctcctg 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 26 aatttc tagg tcccctcctg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 27 ctcctgagga gttagcaaag 20 <210> 28 <211> 22 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 28 cacaattaaa actgtgcatt ac 22 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223 > Description of Artificial Sequence: synthetic DNA <400> 29 ttgttttatt agggaagtgt tc 22 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 30 ctctacaatt aaaatgatgc attg 24 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 31 ttctcctcta caattaaagc 20 <210> 32 <211> 22 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 32 ttattgtttt attagggaag tg 22 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> < 223> Descrip tion of Artificial Sequence: synthetic DNA <400> 33 tgcattgtaa tttctagatc tc 22 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 34 tgatgcattg taatttctag 20 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 35 ttcccctcta caattaaaat ga 22 <210> 36 <211> 28 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 36 gaaaaattcc cctctacaat taaaatga 28

[0061]

[Sequence list free text] SEQ ID NO: 1 is primer 11
1 shows the nucleotide sequence of QA.

SEQ ID NO: 2 shows the nucleotide sequence of primer 11BB.

SEQ ID NO: 3 shows the nucleotide sequence of primer 11QE.

SEQ ID NO: 4 shows the nucleotide sequence of primer 10.

[0065] SEQ ID NO: 5 shows the nucleotide sequence of primer 12A.

SEQ ID NO: 6 shows the nucleotide sequence of primer 12B.

SEQ ID NO: 7 shows the nucleotide sequence of primer 12E.

SEQ ID NO: 8 shows the nucleotide sequence of primer 9AE.

[0069] SEQ ID NO: 9 shows the nucleotide sequence of primer 9B.

SEQ ID NO: 10 shows the nucleotide sequence of primer 10C.

SEQ ID NO: 11 shows the nucleotide sequence of primer 10G.

SEQ ID NO: 12 shows the nucleotide sequence of primer 10H.

SEQ ID NO: 13 shows the nucleotide sequence of primer 11RC.

SEQ ID NO: 14 shows the nucleotide sequence of primer 11RD.

SEQ ID NO: 15 shows the nucleotide sequence of primer 11RF.

SEQ ID NO: 16 shows the nucleotide sequence of primer 11SG.

SEQ ID NO: 17 shows the nucleotide sequence of primer 11SH.

SEQ ID NO: 18 shows the nucleotide sequence of primer 11LB.

[0079] SEQ ID NO: 19 shows the nucleotide sequence of primer 11LE.

SEQ ID NO: 20 shows the nucleotide sequence of primer 10U.

SEQ ID NO: 21 shows the nucleotide sequence of primer 10KC.

SEQ ID NO: 22 shows the nucleotide sequence of primer 10UF.

SEQ ID NO: 23 shows the nucleotide sequence of primer 10UG.

SEQ ID NO: 24 shows the nucleotide sequence of primer 10UC.

SEQ ID NO: 25 shows the nucleotide sequence of primer 11LAE.

SEQ ID NO: 26 shows the nucleotide sequence of primer 11LC.

[0087] SEQ ID NO: 27 shows the nucleotide sequence of primer 11QA1.

SEQ ID NO: 28 shows the nucleotide sequence of primer 11VB.

SEQ ID NO: 29 shows the nucleotide sequence of primer 11XC.

SEQ ID NO: 30 shows the nucleotide sequence of primer 11WE.

SEQ ID NO: 31 shows the nucleotide sequence of primer 11TC.

[0092] SEQ ID NO: 32 shows the nucleotide sequence of primer 11RC1.

SEQ ID NO: 33 shows the nucleotide sequence of primer 11SE.

SEQ ID NO: 34 shows the nucleotide sequence of primer 11BE.

SEQ ID NO: 35 shows the nucleotide sequence of primer 11YE.

[0096] SEQ ID NO: 36 shows the nucleotide sequence of primer 11YE2.

[Brief description of the drawings]

FIG. 1 shows the env of various subtypes of HIV-1.
Figure 3 shows the nucleotide sequence of the 5 'flanking region (C2 region) of the V3 region of the gene. The last three nucleotides are bordered by the V3 region, and the 3 'end of the C2 region refers to the fourth to last nucleotide. Uppercase letters indicate that nucleotides are completely common within the same subtype, and lowercase letters indicate that there are variants with different nucleotides within the same subtype. ?
Indicates that there are too many mutations to determine the consensus nucleotide. -Indicates the same nucleotide as subtype A. . Indicates that no nucleotide is present at the corresponding site.

FIG. 2 shows env of various subtypes of HIV-1.
Figure 3 shows the nucleotide sequence of the 3 'flanking region (C3 region) of the V3 region of the gene. The first three nucleotides are bordered by the V3 region, and the 5 'end of the C3 region refers to the fourth nucleotide from the beginning. Uppercase letters indicate that nucleotides are completely common within the same subtype, and lowercase letters indicate that there are variants with different nucleotides within the same subtype. ?
Indicates that there are too many mutations to determine the consensus nucleotide. -Indicates the same nucleotide as subtype A. . Indicates that no nucleotide is present at the corresponding site.

FIG. 3 shows the positions, combinations, and nucleotide sequences of primers used in nested PCR (primers for the first PCR are common and primers for the second PCR are different) for determining the subtype of HIV-1. Is shown. 9M indicates a mixture of primers 9AE and 9B, 11M indicates a mixture of primers 11LAE, 11B and 11LC, and 12M indicates a mixture of primers 12A and 12B.

FIG. 4 shows nests using the primers shown in FIG.
The results of subtype detection by ed PCR are shown.

FIG. 5 shows en obtained by sequencing.
The results of phylogenetic tree analysis of HIV-1 mutants based on the nucleotide sequence of the v3 region of the v gene and determination of the subtype are shown.

FIG. 6 shows HIV-1 irrespective of subtype of serum samples from subjects diagnosed as positive (PA ⁺ ) by the particle adsorption method and negative (WB ⁻ ) by the Western blot method. RT-PCR using primer pairs that can be amplified
The result of performing is shown. N1 and N2 indicate a negative control, and P1 and P2 indicate a positive control.

Claims (9)

[Claims] An amplification reaction of a nucleic acid targeting a part of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among a plurality of subtypes, is performed. HIV depending on the presence or absence of nucleic acid amplification
HIV, comprising the step of confirming the presence or absence of -1
-1 detection method. 2. The method of claim 1, wherein the target sequence is between 100 and 2500 nucleotides in length. 3. The method according to claim 1, wherein the 3 ′ end of the target sequence is in the C3 region of the HIV-1 env gene. 4. The method according to claim 1, wherein the 5 ′ end of the target sequence is in the C2 region of the HIV-1 env gene. 5. The step of confirming the presence or absence of HIV-1 comprises the step of:
After performing a nucleic acid amplification reaction that is a part of the nucleotide sequence of the env gene and a target sequence is a part of which nucleotide sequence is highly conserved among a plurality of subtypes,
Using a second primer pair, performing a second amplification reaction using the nucleotide sequence inside the target sequence as a target sequence, and confirming the presence or absence of HIV-1 by the presence or absence of nucleic acid amplification. A method according to any of claims 1 to 4. 6. The method according to claim 5, wherein a mixture of a plurality of upstream primers having different nucleotide sequences and a plurality of downstream primers having different nucleotide sequences is used as a primer. 7. The method according to claim 7, wherein the first primer pair is GCAATAGAAA.
Primer 12A containing the nucleotide sequence of AATTCTCCTC (SEQ ID NO: 5), Primer 12B containing the nucleotide sequence of ACAGTAGAAAAATTCCCCTC (SEQ ID NO: 6), CACAGTACAATGC
Primer 9AE containing the nucleotide sequence of ACACATG (SEQ ID NO: 8) and CACAGTACAATGTACACATG (SEQ ID NO: 9)
Using a mixture of primers 9B containing the nucleotide sequence of AATTTCTGGGTCCCCTCCTG as the second primer pair
A primer comprising the nucleotide sequence of (SEQ ID NO: 18)
11LB, primer 11LAE containing the nucleotide sequence of AATTTCTAGATCCCCTCCTG (SEQ ID NO: 25), AATTTCTAGGTCCCCTC
Primer 11LC containing the nucleotide sequence of CTG (SEQ ID NO: 26) and CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 20)
The method according to claim 6, wherein a mixture of 10 U of primers containing the nucleotide sequence of 8. A primer targeting a part of the nucleotide sequence of the HIV-1 env gene, wherein the nucleotide sequence is highly conserved among a plurality of subtypes, wherein the primer is HIV. A primer that can be used for the detection of -1. 9. An HIV comprising a primer pair that targets a portion of the nucleotide sequence of the HIV-1 env gene, the nucleotide sequence being highly conserved among a plurality of subtypes. Kit for detecting -1.