JP2001521619A - Detection of molecular interactions by reporter subunit complementation - Google Patents

Abstract

  (57) [Summary] Methods and compositions are provided for detecting molecular interactions, particularly protein-protein interactions. The present invention allows for the detection of such interactions in living cells or in vitro. Detection of molecular interactions in living cells is not limited to nuclear compartments, but can be achieved in the cytoplasm, cell surface, organelles, or between these entities. In one embodiment, the method utilizes a novel composition comprising a fusion protein between a molecule of interest and two or more inactive, weakly complementary β-galactosidase variants. Association between the molecules of interest results in complementary β-galactosidase variants in close proximity, resulting in complementation and production of active β-galactosidase. Active β-galactosidase can be detected by methods well known in the art. Among the uses of the present invention are the study of protein-protein interactions, the screening of functional genomes, agonists and antagonists, and drug discovery.

Description

DETAILED DESCRIPTION OF THE INVENTION            Detection of molecular interactions by reporter subunit complementation                              Related application citations   This application is related to US Provisional Patent Application No. 60 / 042,576 filed April 2, 1997 and And US Patent Application No. 60 / 054,638 filed August 4, 1997; and 1998 Priority to U.S. Patent Application Attorney Docket Number 28600-20206.00 filed April 1 Claim the right.            STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH                               (Not applicable)                                 Technical field   The present invention is in the field of molecular biology, and more particularly, protein-protein In the field of reporter systems useful for the analysis of interactions.                                   background   β-galactosidase enzyme (β-gal) (protein product of E. coli lacZ gene) Is widely used in the study of gene expression and cell lineage in higher organisms. You. Several biochemical assays for β-gal activity (viable cell flow cytometry and And the chromogenic substrate 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal )), Including histochemical staining, quantitative reporter enzymes, selectable markers, or Create a very versatile lacZ gene product as a histological index. Bronstein et al. (1989) J. Am. Biolumin. Chemilumin. 4: 99-111; Nolan et al. (1988) Proc. Natl. Ac ad. Sci. USA 85: 2603-2607; and Lojda (1979) Enzyme Histochemistry: A Labo ratory Manual, Springer, Berlin. Well characterized in bacterial genetics research One characteristic of the lacZ system that has been used but not used in eukaryotes is cistron. It is a phenomenon of internal complementarity. E. Studies at coll are either N-terminal or C-terminal Deletion of β-gal, which removes part of it, shows that the enzyme produces an inactive enzyme Was. However, one of these deletion mutants is missing in the first mutant Co-expression with a second inactive deletion mutant containing the domain results in a plasmid called complementation. Can restore β-gal enzyme activity in the process. This complementary β-gal activity is Stable heterooctamer enzyme conjugate containing all of the essential domains of the homotetramer Produced by concentration-dependent assembly of the body. Ullman et al., (1965) J. Am. Mol. Biol. 12 : 918-923; Ullman et al., (1967) J. Am. Mol. Biol. 24: 339-343; and Ullman et al., ( 1968) J. Mol. Biol. 32: 1-13.   A system that utilizes β-gal complementation in an enzymatic assay has been described. Henderson U.S. Pat. No. 4,708,929. In this system, active β-gal is formed by complementation Inactive β-gal polypeptide fragment that can be combined with high affinity Is used. One of the fragments is conjugated to the analyte, Will compete with the analyte for binding to the analyte binding protein. Analyte binding The β-gal fragment cannot complement when bound to a synthetic protein. Accordingly To obtain β-gal activity in the presence of a sample in the presence of a known concentration of analyte. Of the sample (by an equal concentration of analyte binding protein) The amount of analyte therein can be determined. This method is based on the high affinity complement subunit of β-gal. Requires a knit, requires that the analyte binding protein be known, and Not applicable for single cell analysis.   Uses two fusion genes whose products reconstitute the function of the transcriptional activator Previous systems for studying protein-protein interactions have been described. You. Field et al., (1989) Nature 340: 245-247; Bai et al., (1996) Meth. Enzymol. Two 73: 331-347; Luo et al., (1997) BioTechniques 22 (2): 350-352. The sequence that encodes the first protein is the DNA-binding domain of a transcriptional regulatory protein. Conjugated to the sequence encoding the in. In the second fusion gene, the second tag The protein-encoding sequence encodes the transcriptional activation domain of a transcriptional regulatory protein. Conjugated to the sequence to be loaded. The two fusion genes are linked by the first fusion gene. Expression is controlled by DNA regulatory sequences linked by the loaded DNA binding domain The resulting reporter gene is also co-transfected into a cell that also contains the reporter gene. Report Expression of the target gene is determined by placing the transcriptional activation domain adjacent to the DNA regulatory sequence. And need. The binding of the first protein to the second protein results in a second fusion The transcription activation domain encoded by the gene is encoded by the first fusion gene. Close to the DNA binding domain to be reported, thereby stimulating reporter gene transcription. Intense. Thus, the level of expression of the reporter gene may differ between the first protein and the second. Reflects the degree of binding to the protein.   There are several disadvantages associated with the use of the above system. It is the reporter gene Because it relies on transcriptionally regulated expression, this system is an assay for interactions that occur in the nucleus. Is limited to In addition, this assay is based on reporter residues whose products are diffusible. Indirect, depending on transcriptional activation of the gene. Therefore, where they occur, A method that allows for direct and immediate testing of molecular interactions is desirable.   To detect protein-protein interactions that are not restricted to nuclear interactions System has been described. U.S. Patent Nos. 5,503,977 and 5,585,245. This system In one embodiment, a mutant subunit of a possible interacting polypeptide and protein ubiquitin A fusion with the knit is formed. Interactions between possible interacting polypeptides Juxtaposition of the two ubiquitin subunits results in ubiquitin-specific Creates substrates for proteases, and low molecular weight peptide reporter flags Is released. In this system, possible binding between interacting polypeptides Does not produce any type of enzymatic activity. Therefore, signal amplification does not occur. I can't. In addition, the ubiquitin system does not measure activity in intact cells. However, it relies on assays for protein lysis in cell-free extracts. Required Test the protein interactions in intact cells in the relevant cell compartment It is a highly sensitive method to test.   Fluorescence imaging has been used to study the intercellular biochemistry of living cells. You. Adenosine 3'5'-cyclic-phosphate (cAMP) signaling pathway Fluorescent indicators are described. Here, the sensor is cAMP kinase, The mediator and regulatory subunits are each a fluorescent subunit in the holoenzyme complex. Different fluorescent dyes (e.g., fluorescein, or Or rhodamine). The change in the shape of the fluorescence emission spectrum And thus activation of the kinase is achieved by microinjection using a labeled holoenzyme. Can be visualized in the injected cells. Adams et al., Nature, 349: 694-6. 97 (1991). This system is microinjected because it causes an energy transfer. Due to the fact that it requires a favorable distance between the Limited.   Substrates for β-lactamases have been described in the art. this is , A fluorescent donor moiety and a quencher, and make them permeable to cell membranes Ancillary groups, where the ancillary groups are hydrolyzed and removed after the substrate enters the cell. It is. The fluorescence energy transfer between the donor and the quencher is a β-lactamase Monitored as an indicator of activity. This system is also functionally linked to the promoter. Reporter genetics using cells containing the ligated β-lactamase reporter gene It can be used in child assays. PCT WO96 / 30540, published October 3, 1996, Are incorporated herein by reference.                                Disclosure of the invention   The present invention relates to two or more low affinity reporter gene subunits (eg, different Between E. coli lacZ variants) in live cells and in vitro. Methods and compositions for detecting, assaying, and quantifying molecular interactions provide. In a preferred embodiment, protein-protein interactions in living cells Is detected and quantified using the methods and compositions of the present invention. Implementation of the present invention Are, for the first time, able to survive without relying on the transcriptional activation of the reporter gene construct. Study of protein-protein interactions and their regulation in mammalian cells Enable. Association of the protein of interest results directly in enzymatic activity, and Is independent of cell function. Therefore, the present invention provides a method for detecting a complex extracted from a nucleus. And the detection of complexes whose formation inhibits transcription, It offers advantages over other currently used systems. In addition, the present invention Detection and localization of specific binding interactions within Enables analysis of the induction or inhibition of binding interactions in the vesicle.   Interactions that occur in the nucleus of cells, in the cytoplasm, on the cell surface, in organelles Or between its surface or the cytoplasm and surface (cell or organelle) molecules All interactions that occur in the context of the present invention, as well as interactions that occur outside the cell, Can be detected. Thus, the present invention is directed to protein-protein interactions Overcomes limitations associated with previous assays. Earlier assays have grown in the nucleus. Always limited to precise interactions or precise localization of molecular interactions Interactions that either result in inhibition of transcription or translation Was not well suited for the detection of   Accordingly, in one embodiment, the present invention provides a reporter system comprising: To serve:   A first low affinity reporter subunit bound to the first putative binding moiety;   Here, the first low affinity reporter subunit comprises at least a second low affinity reporter subunit. Can associate with the sex reporter subunit to produce a detectable signal, Is mediated by the first putative binding moiety.   In another embodiment, the invention provides a method for combining a first putative binding moiety with a second putative binding moiety. There is provided a method of determining the occurrence of a bond between the two, comprising the following steps:   a) providing a reporter system;     The first low-affinity reporter subunit bound to the first putative binding moiety A first component comprising; and     The second low affinity reporter subunit bound to the second putative binding moiety A second component comprising;   Here, the first low affinity reporter subunit comprises at least a second low affinity reporter subunit. Can associate with the sex reporter subunit to produce a detectable signal, Is mediated by the binding of the first putative binding moiety to the second putative binding moiety;   b) combining the first and second components; and   c) detecting the presence or absence of the signal.   In a further embodiment, the present invention provides a method wherein the first binding moiety comprises a plurality of different second inferences. A method of screening for binding to a constant binding moiety member, the method comprising: Includes the following steps:   a) providing a plurality of reporter systems, each comprising:     Including a first low affinity reporter subunit attached to the first binding moiety A first component; and     One of the plurality of second components, each one of the plurality of second putative binding moieties. And a second low-affinity reporter subunit, wherein the second In each of the minutes, the second putative binding moiety is different;   Here, the first low affinity reporter subunit is the second low affinity reporter subunit. One of the second putative binding moieties associated with the subunit and distinct from the first binding moiety Can produce a detectable signal upon binding to   b) individually combining the first component with each of the plurality of second components to form a plurality of Generating a binding assay sample, each of which comprises a first component, And a different one of the second components; and   c) detecting the presence or absence of a signal in each of the binding assay samples Process.   The invention further includes a low affinity reporter subunit and a putative binding moiety Nucleic acids encoding fusion proteins, and fusions encoded by the nucleic acids Provide protein. The present invention provides nucleic acids encoding such fusion proteins. Further provided is a viral vector comprising: The present invention also relates to the nucleic acids and A cell transformed with the ils vector is provided.   All patents, patent applications, and publications mentioned herein are hereby , Incorporated by reference.                             BRIEF DESCRIPTION OF THE FIGURES   FIG. 1 shows the results of three deletion mutant lacZ constructs, designated Δα, Δω, and Δμ. It is a schematic diagram.   FIG. 2A shows the intracellular upstream of the hygromycin or neomycin resistance gene. FKBP-rapamycin associated protein (FRAP) or FK506-binding protein-12, an intracellular rapamycin binding protein (FKBP12), the fusion of a Δαβ-gal mutant or a Δωβ-gal mutant FIG. 2 is a schematic diagram of a viral construct encoding a synthetic protein.   FIG. 2B shows that, upstream of the hygromycin or neomycin resistance gene, FRAP or Or any of FKBP12, and another protein indicated as x and x '. Encodes a Δαβ-gal or Δωβ-gal mutant fusion protein FIG. 2 is a schematic diagram of a virus construct.   FIGS. 3A and 3B show immobilized cells expressing both FKBP12-Δω and FRAP-Δα. 2 shows the X-gal staining of the cells that had been lost. Cells shown in 3b were added to 10 ng / ml rapamycin for 12 hours. Exposure for a while. The cells shown in 3a were not exposed to rapamycin.   FIG. 4A shows C2 expressing both FKBP12-Δω and FRAP-Δα fusion proteins. Vs. time for treatment of C12 cells with and without rapamycin It is a graph of (beta) -gal activity.   FIG. 4B shows that C2 expressing both FKBP12-Δω and FRAP-Δα fusion proteins. FIG. 4 is a graph of the dose response of β-gal activity to rapamycin in C12 cells. .   FIG. 5 shows both FKBP12-Δω and FRAP-Δα measured by chemiluminescence. Rapamycin for β-gal activity in lysates from cells expressing the fusion protein Indicates a dependent increase.   FIG. 6A shows both FKBP12-Δω and FRAP-Δα after rapamycin treatment for 90 minutes. Analysis by fluorescence activated cell sorting (FACS) of C2C12 cells expressing You. The dark peak indicates the profile obtained from the untreated sample; Marks show profiles from samples treated with 10 ng / ml rapamycin.   FIG. 6B shows the FACS profile of untreated cells, selected based on low β-gal activity. The selected subpopulation is shown.   FIG. 6C shows the absence (dark peak) or presence (light peak) of rapamycin. FIG. 6B shows a FACS analysis of the selected population of cells in FIG. . 6A, 6B, and 6C, the vertical axis indicates cell number, and the horizontal axis indicates Shows the fluorescence intensity of β-gal expressed on a logarithmic scale.   FIG. 7 shows the dimerization of the EGF receptor monitored using β-gal complementation. Show.   FIG. 7A schematically describes the principle of the assay: two weak complementarities of β-gal. The mutant is linked to the extracellular and transmembrane domains of the EGF receptor. EGF Thus, dimerization of the stabilized receptor leads to β-gal complementation.   FIG. 7B shows the design of the retroviral construct used in the assay. The E. coli lacZ deletion mutants Δα and Δω were neomycin or hyg Cloned into the pWZL vector, expressing romycin resistance. Human EGF receptor The extracellular and transmembrane (tm) domains of the puter are Δα and Δω mutants. And cloned in-frame.   FIG. 7C shows a FACS analysis of the transduced and selected population of cells. EGF processing Increases β-gal activity (fluorescein fluorescence) in a substantial portion of cells You. The FACS profile of cells without EGF treatment is light gray shaded and white Outlined with. EGF-treated cell profiles are shaded in dark grey. You.   FIG. 7D shows a monoclonal antibody against the extracellular domain of the human EGF receptor. 2 shows a FACS analysis of chimeric receptor expression using Transduced and selected The FACS profile of the affected population is shaded in medium gray and outlined in white. Untransduced cells are shaded in light gray and outlined in white It is. FACS clones cells with low β-gal activity in the absence of EGF And increased β-gal activity in the presence of EGF. Group (dark gray One clone with a lower level of chimeric receptor compared to (shaded) Was used for further analysis.   FIG. 7E shows the clones selected in FIG. 7D treated with 100 ng / ml EGF for 2 hours. Shows induction of EGF receptor dimerization (β-gal activity) in all cells of . Untreated cells are shaded in light gray and outlined in white; EGF-treated cells are dark Can be shaded in gray.   FIG. 7F shows that dimerization can be detected after very brief treatment with EGF. Show. Cells are treated with 100 ng / ml EGF for 0, 1, 4, 8 and 15 minutes, after which Cells were rinsed and processed for FACS analysis. Average firefly in cell sample Light is plotted.   FIG. 8 shows the dimerization of EGF receptor after EGF treatment and the receptor on the cell surface. The time course of the expression of the puter is shown. Cells expressing the chimeric receptor are 100 ng / m l Treated with EGF for 0-24 hours. Dimerization as measured by β-gal activity Was monitored by FACS and the average β-gal activity of the cells (fluorescein Fluorescence) was plotted (left axis;-■-). Cell surface chimeric receptor level Are monoclonal antibodies to the extracellular domain of the human EGF receptor and Measured by FACS using a phycoerythrin labeled secondary antibody. Average Coerythrin fluorescence values are shown on the right axis (-▲-). Triple for each time point Samples were analyzed, and 5000 cells were analyzed for each sample Was. Error bars indicate the standard deviation of duplicate samples.   FIG. 9 shows that the dimerization of the EGF receptor was detected by tyrphostin AG1478. Shows that it is enhanced by   FIG. 9A shows, in the left panel, EGF, tyrphostin, or both. FIG. 2 shows an illustration of a different regime for the treatment of cells. After various treatments, the cells are And the average fluorescence is shown in the right panel. Each process is It was performed in triplicate.   FIG. 9B shows β-gas in EGF-treated cells compared to EGF + tyrphostin-treated cells. 4 shows the measurement of lactosidase activity. 100 ng / cell expressing the chimeric receptor ml EGF (-■-) or EGF and 100 nM tyrphostin AG1478 for 0 to 24 hours (... ▲ …). Three samples are analyzed for each time point, Error bars indicate the standard deviation of duplicate samples.                         BEST MODE FOR CARRYING OUT THE INVENTION Definition   As used herein, the following terms have the following definitions:   As used herein, “reporter subunits” are low binding parents to each other. Can associate with each other to produce a detectable signal, or with each other and one or more With additional substances to produce a detectable signal, and individually detectable A member of a complex of two or more subunits that does not produce a possible signal .   As used herein, “low affinity” reporter subunits each refer to When covalently binding to two different binding moieties, the binding interaction between the two binding moieties Unless it occurs, the binding parents are low enough to prevent them from substantially associating. Refers to molecular species having compatibility. Therefore, "low affinity" generally means at least A binding affinity that is lower than the binding affinity of the combined binding moieties.   As used herein, "binding moieties" are stable complexes that interact with each other. At least two components, such as proteins or fragments thereof, that form the body Refers to offspring.   As used herein, "detectable signal" refers to a reporter subunit. During the assembly of a subunit or through the interaction of an associated subunit with another substance Refers to any detectable signal that results. A detectable signal is, for example, Detectable production of an enzymatic reaction catalyzed by an associated reporter subunit Chromogenic, fluorescent, phosphorescent, or chemiluminescent signals, such as obtain.   The terms "protein", "polypeptide" and "peptide" refer to any length It is used interchangeably herein to refer to a polymer of amino acids. The polymer can be linear or branched, can include modified amino acids, and Can be interrupted by non-amino acids. It is also modified naturally or by intervention For example, disulfide bond formation, glycosylation, myristylation, acetyl Phosphorylation, alkylation, phosphorylation, or dephosphorylation. This definition also includes 1 Analogs of one or more amino acids (including, for example, unnatural amino acids) and the art And polypeptides containing other modifications known in US Pat.   Unless otherwise indicated, practice of the present invention is within the skill of the art in molecular biology. , Biochemistry, microbiology, recombinant DNA, nucleic acid hybridization, genetics, immunity Uses conventional techniques in oncology, embryology, and oncology. Such techniques are well documented Described. For example, Maniatis, Fritsch and Sambrook, MOLECULAR CLONI NG: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press (1982); Sambro ok Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition , Cold Spring Harbor Laboratory Press (1989); Ausubel et al., CURRENT PROTOCOLS  IN MOLECULAR BIOLOGY, John Wiley & Sons (1987, 1988, 1989, 1990, 1991, 1992, 1993, 1994, 1995, 1996).Reporter subunit   As used herein, "reporter subunits" refers to low binding to each other. Can associate with an affinity to produce a detectable signal, or Can be associated with additional substances above to produce a detectable signal, and individually detected A member of a complex of two or more subunits that does not produce a possible signal .   Thus, a detectable signal gives an indication that the subunits are associated. I can. Generally, a first species and at least a second species ("the putative binding moiety" 1) one reporter bound to the first species in the binding affinity assay of A first component comprising a subunit is provided and attached to a second molecular species. A second component comprising the same or a different reporter subunit is provided. So The molecule whose binding affinity to the molecule is to be assayed is complexed between the two components Unless and until they have sufficient binding affinity to mediate the reporter -Subunits preferably do not substantially associate with each other in solution As such, they have sufficiently low binding affinity for each other. Generally hydrogen bonded or hydrophobic Binding and generation of binding moieties by non-covalent interactions, such as sexual interactions When the reporter subunits meet, for example, Are oriented sufficiently close together that they are associated with low affinity and are detectable Can produce a useful signal. In this system, individual reporter subunits are No signal can be generated. Therefore, the reporter subunit is If placed in contact, they undergo forced complementation.   Reporter subunits are used for specific applications, and for binding assays Can be designed to have a favorable low affinity for different conditions. The binding of molecules is Depending on factors in the solution such as pH, ionic strength, concentration of assay components, and temperature Exist. In binding assays using the reporter systems described herein, Binding affinity of the protein subunits is low enough to allow forced complementation. Should be. Reporters in assay solutions, such as buffer systems or inside cells -Non-limiting examples of subunit dissociation constants depend on the characteristics of the particular assay system. For example, about 10^-8Greater than M, 10^-6Greater than M, or about 10 as needed^-2 ~Ten^-FiveIt is an order between M.   Molecule with sufficiently low binding affinity and bound to a reporter subunit Reporter that can still associate and produce a detectable signal upon species binding -Subunits can be designed as disclosed herein. Les that can be used The porter subunit can be any low binding that can associate to produce a detectable signal Contains affinity subunits. In one preferred embodiment, the reporter sub Units are associable and, when associated, directly or indirectly detectable It is a protein that can catalyze a reaction that produces a unique product.   Direct or direct, for example, used in cell-based screening assays Proteins that can catalyze the conversion of a substrate to a reaction product that is either indirectly detectable Enzymes can be used as reporter subunits. Enzyme is a reporter sabyu Knits and have the ability to undergo low binding affinity and forced complementation Can be modified to have These include, for example, site-directed mutagenesis or run Can be modified by dam mutagenesis, or deletion mutations, and associate with low binding affinity Provide low affinity subunits that can catalyze enzymatic reactions Complementation can occur. For example, reporter subunits that can complement with low binding affinity Are β-galactosidase, β-glucuronidase (GUS), β-lactamase, Alkaline phosphatase, peroxidase, chloramphenicol acetylate Can be derived from enzymes such as transferase (CAT), and luciferase . Any range of enzymes capable of producing a detectable product, either directly or indirectly Can be so modified or naturally occurring. In addition, Reporter Sabyu The knit may be from a non-enzymatic molecule. For example, the association of two proteins Recognized by antibodies or other ligands on one or both interacting proteins It can result in a unique conformation that can be perceived.   E. β-galactosidase encoded by the E. coli lacZ gene is known in the art. Is an enzyme that has been developed as a reporter enzyme. β-galactosider Live cell flow cytometry and the chromogenic substrate 5-bromo-4-clo B) Histochemical staining using 3-indoyl β-D-galactopyranoside (X-gal) It can be measured by various methods, including: Nolan et al., Proc. Natl. Acad. Sci., U SA, 85: 2603-2607 (1988); and Lojda, Z., Enzyme Histochemistry: A Labor. atory Manual, Springer, Berlin, (1979), the disclosures of which are incorporated herein. It is.   Enzyme variants that can be complemented in cistrons are particularly useful as reporter subunits. Is appropriate. E. In E. coli, deletion of either N-terminal or C-terminal of β-gal Is inactive, but contains a second domain containing a domain that is missing in the first variant. Co-expression with the activity-deficient mutant produces an enzyme that can still be complemented. Complementarity The N-terminal and C-terminal domains involved in It is known. Ullmann, J .; Mol. Biol. 12: 918-923 (1965); Ullman et al. Mol. B iol. 24: 339-343 (1967); and Ullman et al. Mol. Biol. 32: 1-13 (1968), this The disclosures of these are incorporated herein. The β-gal complementation system in mammalian cells is Mohler and Blau, Proc. Natl. Acad. Sci. USA, 93: 12423-12427 (1996) And this disclosure is incorporated herein by reference. As described there, Vectors expressing β-gal complementary mutants can be constructed. In this specification, it is called Δα The naturally occurring lacZ mutant ΔM15 (Beckwith, J. Mol. Biol, 8: 427-430 (196 4); and Prentki, Gene, 122: 231-232 (1992) and Nature, 369: 761-766 ( 1994), the disclosures of which are incorporated herein). This specification Another deletion mutant, referred to as Δω, was made as disclosed herein, The structure is schematically shown in FIG. peptide region between α and ω regions Regions were first described by Mohler and Blau, Proc. Natl. Acad. Sci. USA 93: 12423-12427 (1996), referred to herein as the μ region. Δα mutation And Δω variants demonstrated herein to have optimal forced complementarity properties Is done. These deletion mutants contain α-acceptor / ω-donor (Δα) and α-donor Expresses a polypeptide that exhibits body / ω-receptor (Δω).   β-gal complementation is based on the ability of the mutant enzyme molecule to associate and reassemble the active enzyme. Good. Thus, each lacking one or more structural domains that are important for the activity of the holoenzyme The two β-gal molecules associate into a single machine that contains all of the required structural determinants. Form functional units. This phenomenon occurs between the domains of a single peptide of wild-type β-gal. A naturally occurring interaction may also exist between domains that are present in two separate peptides. , Leading to the formation of stable dimers. This dimer is wild-type β -g functionally behave as a single peptide, and ultimately show the active form of the enzyme Involved in the formation of tetramers. Therefore, the β-gal mutation that recreates the active form of the enzyme The ability of body pairs is strongly dependent on the ability to form stable dimers, and therefore Is expected to depend on their affinity for each other.   Surprisingly, two different low-affinity βgal variants have relatively low affinities with each other. Forced association of the two different low-affinity βgal mutants despite having Combination or complementation results in efficient formation of active enzyme molecules in mammalian cells Was found. Forced complementation is when two mutant subunits When associated due to the binding affinity of the binding moiety bound to the subunit, I will. The domain or protein of interest is Δαβgal mutant and Δωβgal mutant Intact eukaryotes by manipulating constructs that drive dimerization during Complementary effects obtained by co-expression of these fusion proteins in biological cells Monitoring and quantifying such interactions by assessing the rate Is possible.   In addition to the two-component complementation between the Δαβgal and Δωβgal mutants, the present invention also provides Also, a ternary phase between variants, each containing only a single functional α, μ, or ω region Supplement is also intended. Among other applications, this is the case for three different reports based on a single reporter. Detection of interactions between different proteins. Similarly, four or more reports Higher dimensional systems that include a tar component are also within the scope of the invention.   Using fusion protein systems, protein-protein interactions and their Regulation is studied in mammalian cells without resorting to transcriptional activation of the reporter construct. obtain. The association of the protein of interest results directly in enzymatic activity, and other cellular machinery Independent of Noh. Thus, this system is either eliminated from the nucleus or inhibits transcription Allows the detection of complexes containing the partner to be performed. Furthermore, specific binding within cells Localization of interactions, as well as detection and determination of the temporal distribution of such binding interactions Amount, and allow for decisions. Binding interactions at different stages of development or differentiation Cells, as well as normal versus diseased and infected versus uninfected cells Can be compared. Thus, the binding interaction is a property and property between different cell types. It can be evaluated against the background of endogenous competitor components that can vary in concentration.   Other enzymes capable of forced complementation in the reporter systems described herein The element can be identified or constructed. For example, the cistronic internal phase of enzyme activity The complement phenomenon has been described for tryptophan synthase. Jackson et al., J. Bio l. Chem., 244: 4539-4546 (1969). Mutant subunit of thymidylate synthase The complement between the sets is described. Pookanjanatavip et al., Biochemistry 31: 10303-. 10309 (1992). This disclosure is incorporated herein by reference. Therefore, in the field Reporter subunits derived from any of the known complementary enzyme systems can be used in the practice of the present invention. Can be used. Mutants are reporters of protein-protein interactions Or its activity can be modulated as described above. , Other enzymes or proteins. This system is a protein-protein For the detection of the interaction, the complementing ability of the low binding affinity enzyme variant is used.   For example, a complementary low affinity reporter subunit derived from β-lactamase Can build. The activity of the complementary β-lactamase includes the fluorescence donor moiety and the quencher. Substrates for β-lactamases developed in the art (which cross cell membranes) A binding group that renders the substrate permeable to the cell Later hydrolyzed). Then the donor and quenching PCT WO 96/3054, published October 3, 1996, describes the fluorescent energy transfer to and from the body. As described in 0, it can be monitored as an indicator of β-lactamase activity.   In addition to enzymes that catalyze the reaction and produce a detectable product, Proteins, protein domains, or protein fragments that are Can be used. Exemplary proteins include green fluorescent protein. The green fluorescent protein has a characteristic detectable emission spectrum, and As described in PCT WO 96/23810, the disclosure of which is incorporated herein by reference. Modifications have been made to alter their emission spectra. In addition to green fluorescent protein And fusion proteins expressed in cells DNA sequences are described in PCT WO 95/07463, the disclosure of which is incorporated herein by reference. I will use it here.   Other exemplary subunits include photochemical signals such as fluorescent or luminescent signals. Includes subunits that can be combined to produce nulls, including chemiluminescence and Or a light emission signal. The reporter subunit can also be No. 0601889A2 and PCT WO 96/41166 (the disclosures of which are incorporated herein by reference). If they are closely associated, as disclosed in US Pat. It may include a fluorophore capable of energy transfer.   Other complementary enzymes are known in the art. For example, pancreatic ribonuclease and And Staphylococcus nuclease. Mutants of the complementing subunits of these enzymes Are constructed using methods well known to those skilled in the art, such as site-directed Sex complementary subunits can be generated. For these types of complementary proteins, 1 One potential use is as a tumor treatment. Here, the tumor-specific protein Quality acts as a bridge bringing the two proteins together. These proteins Each of the qualities is fused to a low affinity complementary fragment of the nuclease. Get Nuclease activity can, in some cases, destroy mRNA, genomic DNA, etc. Can kill cells.   Coupling part   The binding moieties that can be assayed for their binding affinity to each other are binding interactions And any molecule capable of The binding interaction between two or more binding moieties is directly or Or one or more additional binding species (eg, a charged ion or molecule, a ligand , Or macromolecules).   The binding moieties attached to the reporter subunit Carbohydrates, lipids, proteins, and nucleic acids, as well as Any of a variety of molecules, including these moieties, polymers, and analogs Can get. Exemplary proteins are the signaling cascade proteins, Apototo Cis-regulatory proteins, proteins that regulate cell cycle progression or tumor development , Transcription regulatory proteins, translation regulatory proteins, tans that affect cell interactions Protein, cell adhesion molecule (CAM), ligand receptor pair, other proteins Proteins involved in folding and the Golgi apparatus, endoplasmic reticulum, ribosome, Targeting specific subcellular compartments such as loplasts and mitochondria Includes members of the protein involved.   Other exemplary proteins include protein hormones and cytokines. Cytokines such as interferons, chemokines, and hematopoietic growth factors Proteins involved in various signal transductions. Other exemplary proteins include Terleukin, lymphotoxin, transforming growth factors α and β, etc. Macrobiage colony stimulating factor and granulocyte colony stimulating factor including. Other proteins include protein kinases, phosphatases and synthases. Contains intracellular enzymes such as lyse.   Exemplary proteins involved in apoptosis are tumor necrosis factor (TNF), F as ligand, interleukin 1β converting enzyme (ICE) protease, and Includes TNF-related apoptosis-inducing ligand (TRAIL). Involved in the cell cycle Proteins include deoxyribonucleic acid (DNA) polymerase, proliferating cell nuclear antigen , Telomerase, cyclin, cyclin-dependent kinase, tumor suppressor, And phosphatases. The proteins involved in transcription and translation are Acid (RNA) polymerase, transcription factor, enhancer binding protein and ribo Including somal proteins. Involved in cell interactions (eg, cell-to-cell signaling) Proteins that are reporter proteins, and peptide hormones or Such potentiating or inhibitory mimetics.   The binding of molecules can be controlled by pH, ionic strength, concentration of assay components and temperature. Depends on factors in solution. Using the reporter system described herein In a binding assay, the binding affinity of the binding moiety is between the reporter subunits. Should be high enough to allow forced complementation. Assay solution (eg, buffer Non-limiting examples of dissociation constants of binding moieties in a system or inside a cell) About 10 depending on the characteristics of the system^-8Less than M, for example, about 10^-9Orders less than M, or About 10 if necessary^-9M and about 10^-12This is an order between M.   Linkage between reporter subunit and binding moiety   The reporter subunit and one or more binding moieties are generally The linkers are linked either via a linker or generally by a covalent bond. An example For example, if the reporter subunit and the binding moiety are proteins, Can be linked by methods known in the art for linking peptides.   In one preferred embodiment, the reporter subunit and the binding moiety are A reporter subunit that is the complement of a low binding affinity enzyme and is assayed A fusion protein comprising a binding moiety. Thus, the fusion protein is It can be expressed intracellularly from acids. This system is advantageous. Because it is a cell Detection and determination of protein-protein interactions in (eg, mammalian cells) Because it allows for the amount to be based on enzyme complementation of the low affinity reporter subunit. is there.   For example, one of two complementary low affinity βgal variants and a “test” In embodiments where the chimeric fusion protein comprising the protein is produced intracellularly, Βgal activity detected due to the interaction between the two chimeric proteins of interest is , Is proportional to the strength of the interaction of the non-βgal protein components. Thus, the interaction is Driven by the test protein of interest, not the complementing variant. Enzyme activity Acts as an indicator of the interaction. Another advantage of this system is the low level of testing Only protein expression is required for binding detection.   The fusion gene construct is preferably constructed and results in low level expression Transformed into cells. This system is then used as an endogenous competitor protein partner Allows the monitoring of interactions in a given cell in the presence of Where The combined protein functions as a "tracer" for the binding / association reaction. This Systems such as can eliminate artifacts resulting from induced protein overexpression. There is no tendency to bring. Decreased expression of the fusion gene product is determined by appropriate promoter, It can be achieved by the selection of a bosome binding site, and other regulatory elements. An example For example, fusion gene constructs may be Upstream of the flame virus internal ribosome entry sequence (IRES) And a splice donor / a upstream of the ATG sequence responsible for initiating translation of the fusion gene. It can be introduced into a vector containing a mutation in the receptor sequence. This type of construct Reduces the translation efficiency of the first coding sequence in bicistronic messages. Translation of the second (antibiotic resistance) sequence, which depends only on the IRES Has no effect. As a result of these reduced levels of expression, The frequency of natural interactions of resident reporter subunits is significantly reduced.   Expression of fusion protein   The present invention provides a fusion protein between a putative binding moiety and a low affinity reporter subunit. Provides park quality. The putative binding moiety is tested for its ability to bind to a second molecule; It can include any protein or other molecule. Low affinity reporter subunit Means that the monomer subunit is inactive but two or more identical or different Mer association can be any molecule that restores activity. Activity is detectable Must be able to generate nulls. In a preferred embodiment, the low affinity repo Protein subunits include mutants of β-galactosidase that can complement each other.   Fusion proteins combine the full-length or partial sequences of two or more different proteins. Includes a single continuous linear polymer of amino acids. Construction of fusion proteins It is well known in the art. The two or more amino acid sequences may be, for example, And can be chemically bonded. In a preferred embodiment, the fusion protein is a fusion protein. It is produced by expressing the gene construct in a cell. The fusion gene construct , A single continuous linear polymer of nucleotides. This nucleotide is 2 Identical uninterrupted readiness of complete or partial sequences of two or more different proteins Code in the switching frame. Fusion gene constructs are also generally used in eukaryotes. And / or an active origin of replication in prokaryotic cells, and one or more, eg, For example, it includes a selectable marker encoding drug resistance. They are also virus packs. Caging signals and transcriptional and / or translational regulatory sequences and RNA probes May include a processing signal.   The fusion gene construct of the present invention provides a putative gene encoded by the fusion gene construct. The cells are introduced into cells to assay for binding between the mating parts. Fusion gene The product also associates with the promoter and, usually, the gene encoding the putative binding moiety. It may contain other transcriptional and / or translational regulatory sequences that match. The fusion gene construct Any method of nucleic acid transfer known in the art (eg, viral vectors, transformation , Coprecipitation, electroporation, neutral liposomes and cationic liposomes Including, but not limited to, vector transfer, microinjection, or gene gun Sa Not) into the cell. The viral vector is a retrovirus , Poxvirus, herpes virus, adenovirus, and adeno-associated virus Including irs. Particularly preferred in the present invention are those which are stably integrated into the genome of the host cell. It is a retroviral vector that can be inserted. For example, embedded signals and A packaging signal, a drug resistance marker, and one or more fusion genes of interest Retroviral constructs encoding offspring are useful in the practice of the present invention.   Different fusion gene constructs encoding unique fusion proteins can Offspring or the same nucleic acid molecule. Identical nucleic acid content of different fusion gene constructs Inclusion in the offspring indicates that uptake of only a single species of nucleic acid by the cell may result in both putative binding -Is advantageous in that it is sufficient to introduce the toner-encoding sequence into cells. is there. In contrast, when different fusion constructs are present on different nucleic acid molecules, The nucleic acid molecule is taken up by certain cells in order to be functional for the assay. Must be rare. Therefore, the problem of cell mosaicism is that both fusion genes It is avoided if the constructs are included in the same nucleic acid molecule.   The fusion gene construct or fusion protein of the present invention can be used in cultured cells, in vivo. For studying animal cells, ex vivo animal cells, or protein interactions Into any other cell type.Assay   Using the reporter systems disclosed herein, a detectable signal can be generated. Low-affinity reporter subunit via complementation between the resulting low-affinity reporters The binding interaction of the putative binding moiety bound to the protein can be assayed. Between putative joints In addition to testing for direct binding interactions of one or more additional molecules or Ion dependent interactions can be evaluated. Furthermore, perhaps in living animal cells Interactions, and various drugs, peptides and medicaments for these interactions The effects of the drug can be evaluated.   In one embodiment, the binding affinity of one or more putative binding moieties is low affinity One component having one of the molecules binding to the reporter subunit, and a second One other putative binding moiety bound to the low affinity reporter subunit of Measured by providing a reporter system containing at least one other component. Can be The binding moieties can be different or the same. In this system, Porter subunits are proximate by binding one or more putative binding moieties. Can only bind and produce a detectable signal. Sig Nulls can be detected and quantified directly or indirectly.   In one embodiment of the invention, the protein-protein interaction is detected And can be quantified. Signa generated by complementation reporter subunit Is a putative moiety that binds, either directly or indirectly, through a third substrate. It can serve as an indicator of binding between. The signals that can be detected are light emission and absorption including. Exemplary signals include chromogenic, fluorescent and luminescent signals. I can do it. These signals can be visualized, or spectrophotometer, fluorimeter Use of a microscope, scintillation counter or other device known in the art Can be detected and quantified.   Binding of the components of the reporter system disclosed herein may be due to factors in solution (eg, , PH, ionic strength, concentration of assay components, and temperature). Assay Solutions can be designed and developed for a particular system. Repo disclosed herein The promoter system is used in solution (eg, buffered cell-free solution, cell interior). , Cell solution, cell extract solution, and cell fraction (eg, nuclear fraction, cytoplasmic fraction) , The mitochondrial fraction and the membrane fraction). Can be used. Assay solutions (eg, enzyme assay solutions, cell extracts, and Methods known in the art for preparing cell suspensions) can be used. For example, Physiologically compatible buffers such as phosphate buffered saline can be used. . See, for example, a series of Methods in Enzymology, Academic Press, New York. When.   In one embodiment, the low affinity reporter subunits can be complementary to each other. Can catalyze the conversion of a substrate to a detectable product, either directly or indirectly Form an enzymatically active complex. In one embodiment, the reporter The system may include two or more components, each of which is a fusion protein, wherein Putative fusion proteins were each fused to a low-affinity reporter subunit A binding protein. Thus, a nucleic acid encoding the fusion protein is constructed Gain, fine Can be introduced into cells and expressed intracellularly. Alternatively, the combined report Unit or bound binding moiety is labeled with a particular binding moiety (eg, , Antibody to the bound complex).   In one embodiment, the low affinity reporter subunit is a subunit of β-gal The units can be complementary. This system may contain more than two reporter subunits. Are all required to associate to generate a detectable signal . A method for detecting a reaction product of active β-gal that has been developed in the art has been developed. Can be used. For example, β-galactosidase activity is measured in the flow cytos of viable cells. 5-bromo-4-chloro-3-indolyl β-D-Ga Measured by a range of methods including histochemical staining using lactopyranoside (X-Gal) Can be done. Nolan et al., Proc. Natl. Acad. Sci. USA, 85: 2603-2607 (1988); and Lojda , Z. Enzyme Histochemistry: A Laboratory Manual, Springer, Berlin, (1979) The disclosures of which are incorporated herein). Histochemical staining for β-gal This can be achieved by immobilization of the cells, followed by exposure to X-gal.   Mohler and Blau, Proc. Natl. Acad. Sci., 93: 12423-12427 (1996) (the disclosure of , Incorporated herein by reference) for β-gal activity. Essays can be used. In one embodiment, the intracellular assay comprises fixing the cells. And can be performed by staining with the indigo-producing substrate, X-gal. Solid Defined cells also use azo dyes for X-gal or 5-bromo-6-chloro-3-indolyl. Fluorescence used in combination with any of β-D-galactopyranoside (5-6-X-Gal) It can be analyzed by an assay for β-gal activity by histochemistry. Preferred pair The combination was azo dye red-purple LB (Sigma Chemical, St. Lous, MO) and 5-6-X-g al (referred to as fluorescent X-gal). For this combination, the fluorescence micrograph is Can be obtained in a fluorescence microscope using the Rhodamine / Texas Red filter set You. The use of these substrates initially results in a β-gal-dependent fluorescence, Visualize simultaneously with light signal.   The essential substrate for β-gal, which can be used in living cells, is also Covered by the invention. For example, the essential fluorogenic substrate resorufin β- Described galactoside bis-aminopropyl polyethylene glycol 1900 (RGPEG) Have been. Minden (1996) BioTechniques 20 (1): 122-129. This compound is Cloinjection, electroporation, or various bulk loading -loading) technique. Once inside the cell, the substrate It cannot deviate through the plasma membrane or by gap junctions. Book Another essential substrate that can be used in the practice of the invention is fluorescein di-β-D- Galactopyranoside (FPG), which is a fluorescent activated cell sorting (FACS) ) And flow cytometry. Nolan et al. (1988 Proc. Natl. Acad. Sci. USA 85: 2603-2607 and Rotman et al., (1963) Proc. Natl. Acad. .Sci.USA 50: 1-6.   β-gal can also be detected using a chemiluminescent assay. For example, β-gal fusion Cells containing the compound were purified from Galactolight Plus assay kit (Tropix, Bedford MA). Dissolve in a mixture of buffer containing lacton and substrate. Bronsteln et al., J. Biolumi n. Chemilumin, 4: 99-111 (1989) (the disclosure of which is incorporated herein). Light Emi After addition of the ssion Accelerator solution, the luminescence is measured using a luminometer or scintillation Measure with a counter.   A reporter system different from β-gal can also be used in the practice of the present invention. An example For example, the enzyme β-glucuronidase (GUS) can be used as a reporter, And chromogenic and fluorogenic GUS substrates have been developed. GUS substrate 5- Bromo-4-chloro-3-indolyl β-D-glucuronic acid (X-gluc) In both industrial and fluorogenic applications, it can be used as follows. Pigment forming dye In one method of color, fixed cells are washed with PBS and 2 mM X-gluc (Mol ecular Probes, Eugene OR), 10 mM EDTA, 0.5 mM K_ThreeFe (CN)₆, 0.5 mM K_FourFe (CN)₆, 0 .1% TritonX-100, 0.1M NaPO_FourStain using Fluorogen protostaining was performed using 5-bromo- 6-chloro-3-indolyl β-D-glucuronic acid (5,6X-gluc, Molecular Probes, Eugen e, OR) and Fast Red violet LB (Sigma Chemical, St. Lous, MO) Can be achieved by using Rinse the fixed cells with PBS and add 50 μg / ml 5,6X-gluc and 100 μg / ml Fast Red violet LB, then PBS Rinse with Fluorescence is detected with a fluorescence microscope calibrated for detection of rhodamine fluorescence. Put out.   In one embodiment of the invention, the reporter subunit comprises an enzyme and an enzyme , Including inhibitors. Preferably, the inhibitor may have low affinity for the enzyme . In this case, the binding between the putative binding moieties is apparent by inhibition of the enzyme activity It is. Exemplary enzymes include β-gal, GUS, β-lactamase, and the like. .   The dimer reporter subunit complex is discussed herein as an example On the other hand, a reporter that is only active in the presence of one or more additional molecules or atoms Multimeric reporter subunits, which may be subunits, are also used. Can be One example of a trimeric reporter subunit system is a β-galω donor (eg, Δα-Δμ double mutant) and β-galμ donor (eg, Δα-Δω double mutant) And a β-galα donor (eg, a Δμ-Δω double mutant). Wherein each individual variant and any two-pair combination of the two variants are Inert enzymatically. Activity indicates that all three subunits can bind to each other Only achieved if. Enzymatic reaction products can be obtained by methods available in the art (eg, Biochemical assays, microscopy, flow cytometry, light emission or absorption detection, And immunological methods).   The methods disclosed herein are useful in conjugating cells in cell lysates and intact cells. Enables detection and quantification of joint events. Thus, a fully folded protein The interaction between is detectable and co-translational expression of the binding component is detected Not required for binding.   In the practice of the present invention, the reaction products may be obtained, for example, by immunological techniques (eg, immunological techniques). Fluorescent labels).   Protein-protein interaction is a report involving one or more fusion proteins. Can be measured in a thermometer system. Each fusion protein is a low-affinity reporter -Contains putative binding proteins associated with subunits. Intracellular fusion protein For expression, one or more fusion genes comprising a sequence encoding the fusion protein A construct is prepared. Fusion gene constructs can be prepared using methods available in the art (such as virus Vector, transformation, co-precipitation, electroporation, neutral or cationic Liposome-mediated transfer, microinjection or gene gun But not limited to these).   Various cell-based assays have been performed using cells containing the fusion gene construct. Can be done. Binding of the putative binding moiety of the fusion protein expressed in cells is forced The signal generated by a reporter subunit that undergoes strong complementarity Can be ascertained. Thus, for example, if the reporter subunit has complementary β If it is a -gal subunit, cells showing β-gal activity are putative within these cells. Shows the bond between the linking moieties.   Fusion gene constructs also include a promoter that is normally associated with the gene encoding the putative binding moiety. And other transcriptional and / or translational regulatory sequences. this is, Putative binding proteins in vivo, as opposed to systems in which the test protein is overexpressed Enables the study of physiologically relevant levels of quality. In addition, this Enables the study of naturally occurring changes in avidity levels, and The effect of an endogenous or exogenous substance on it may be revealed.   The methods and compositions of the present invention also affect the interaction of two putative binding partners. It can be used to study other molecules that affect it. Proteins, peptides, nucleic acids, Carbohydrates, lipids, ions, small molecules, synthetic compounds, or other substances Whether endogenous or exogenously added) It can act as either an agonist or antagonist. For example, test Β-gal produced by cells containing two or more fusions representing a particular pair of proteins By measuring the effect of such molecules on their activity, the agonism of such molecules Or the activity of the antagonist can be determined. Use of the methods and compositions of the present invention Test for agonists or antagonists of specific binding interactions High-throughput assays performed for Such high sloop Assay affects medically relevant protein-protein interactions Of particular value in screening for drugs.   A putative binding partner or moiety as used in the present invention comprises: It may include molecules that do not normally interact with each other, but do interact with a third molecule. As a result, in the presence of the third molecule, the putative binding partners come together. Therefore, the estimate Substances that affect interactions between binding partners are weaker phases between putative binding partners. Stimulators of interactions, as well as interactions between molecules that do not normally interact with each other One or more molecules that mediate Furthermore, interactions between putative binding partners That directly affect upstream events that result in association between putative binding partners Or include substances that affect indirectly. For example, one of the putative binding partners, phosphorus Oxidation confers on one of the putative binding partners the ability to associate with another putative binding partner If possible, substances that affect the interaction of the putative binding partner may directly affect kinase activity. Includes substances that affect directly or indirectly.   Assays may be developed as disclosed herein to provide for drug (eg, antipyretic and And anti-inflammatory, analgesic, anti-arthritic, antispasmodic, antidepressant, antipsychotic, tranquila Iser, anxiolytic, narcotic antagonist, antiparkinsonian, cholinergic Tagonists, chemotherapeutics, immunosuppressants, antivirals, parasiticides, appetite suppressants , Antiemetic, antihistamine, antimigraine, coronary vasodilator, cerebral vasodilator, powder Peripheral vasodilators, hormones, contraceptives, antithrombotics, diuretics, antihypertensives, cardiovascular Of intermolecular interactions of various compositions including pills, opioids, and vitamins) Can be tested.   Protein-protein interactions mediated by a third molecule can be detected and And can be quantified. The kinetics of binding can also be studied. One example of such a system is: Described in Examples 1 and 2 below, where the β-gal fusion protein is To monitor rapamycin-mediated interaction of FKBP12 and FRAP proteins Used for Belshaw, P.J. et al., Proc. Natl. Acad. Sci. USA, 93: 4604-4607 (1996) Brown et al., Nature 369: 756-758 (1994); Chen et al., Proc. Natl. Acad. Sci. USA, 92:49. 47-4951 (1995); and Choi, J et al., Science, 273: 239-242 (1996). For example, join Kinetics to two complementary low-affinity β-gal mutants (eg, Δα and Δω) After addition of rapamycin to cultures of cells expressing a fusion of FKBP12 and FRAP Can be determined by measuring β-gal activity at different times. Capacity A response curve can also be obtained, where the extent of binding as measured by the activity of β-gal Degree is determined as a function of rapamycin concentration.   This assay highlights the potential effects of protein components on their fusion partners About the protein in a quantitative manner. Enables the study of protein-protein interactions. One such control system Containing the reporter subunit, binding protein, and protein of interest A three-part fusion construct is provided. As described in Example 3 below In one embodiment, the fusion protein comprises 1) a β-gal mutant portion, 2) FKBP12 or FRAP part, and 3) test protein part. Most N-terminal components The minute is the test protein followed by FKBP12-Δω or FRAP-Δα. These structures The presence of FKBP12 and FRAP in the architectural structure of the fusion protein rapamycin-mediated dimer Can be implemented. Fusions containing the test protein of interest and different potential phases Absence of β-gal activity obtained by simple co-expression of fusions containing interaction partners A pair value is determined. In parallel samples, β-gal activity was reduced to a fixed amount of rapamycin. It is measured by induction of complementation with syn. In the absence or presence of rapamycin The resulting ratio of β-gal activity is relative to the different protein pairs that interact with each other. Ability.   A further advantage of the three-part fusion system is that the presence of FKBP12 and FRAP compounds to provide a flexible hinge domain between the -gal variant and the test protein. You. This reduces the potential for interference between the β-gal component and the test protein. In addition, direct testing of the functional integrity of the β-gal component in fusions is more efficient This is possible without the need for recloning into a viral promoter. For example , The tetracycline repressor tetR is highly efficient in mammalian cells Form an immer. Hinrichs et al. (1994) Science 264: 418-420. tetR-FKBP12- Co-expression of Δω and tetR-FRAP-Δα fusion results in β-gal positive cells, As shown in Example 3, it is possible to construct a functional three-part fusion. Where the dimerization of the N-terminal peptide component is attributed to the C-terminal mutant β-gal FKBP12 and FR serve as both an internal standard for the repeptide and a flexible hinge Efficiently drives complementation in the AP component.   This system further comprises a fusion between each β-gal variant of MEF2c and the complete coding sequence. Can be tested and compared. MEF2c is homozygous in vivo It is known that they form a β-gal mutation, which is fused to MEF2c. Co-expression of the variant should result in readily detectable enzymatic activity. Dima MEF2c mutants that impair transformation capacity are available and have become one of the β-gal mutants Negative control to further confirm this system Can be provided as a file. Molkentin et al., Mol. Cell. Biol., 16: 2627-2636 (1996).   The reporter system also allows quantification of expression levels of β-gal fusion proteins Can be designed using controls. This means that two (or more than two) 2.) Allows control of the potential differential expression of the fusion protein. For example, fully featured Peptide tags that can be used for monoclonal antibodies Can be fused to the C-terminus of each β-gal mutant. different tags like flag and myc can be used for Δα and Δω, and when co-expressed in the same cell Even so, it allows differential detection of the two variants. The lysate of these cells In parallel with the measurement of β-gal activity in The exact amount of gal fusion protein can be measured. First, polyclonal anti-β-gal Antisera can be used for immobilization of the antigen. Then point to the appropriate tag Monoclonal antibody, followed by enzyme-conjugated anti-mouse secondary antibody It can be used for quantification of the amount of β-gal fusion protein. Well-characterized skills Such an approach using surgery involves measuring the expression level of each fusion protein. Should be possible. This modification is based on the fact that the binding tag is This is useful if the complementarity of the protein subunit is not impaired.   Application of the invention   As will be apparent to those skilled in the art, the present invention provides for multiple Extensive studies of the interaction of proteins and other types of multiple molecules have been It is possible to do qualitatively for the first time. In the following, the different applications of the invention Non-limiting examples are provided.   Being able to distinguish β-gal activity levels in the presence or absence of forced complementation (Biochemical observation (FIG. 5) and FACS observation (Example 10 and FIG. 6) )), The method of the present invention is a novel binding part for a given target protein. Suggest that it can be used to screen for donors. This embodiment Target proteins fused to weakly complementary β-gal mutants are well characterized Stably expressed in attached cell lines. Fusion with weakly complementary β-gal mutant An expression library containing the obtained cDNA is, for example, a retroviral vector (for example, Kitamura et al., Proc. Natl. Acad. Sci. USA 92: 9146-9150 (1995)) The cells are introduced into these cells using any other known means of gene transfer. Mark Vectors that express gene products that interact with the target protein Isolated by identifying the protein. The advantage of this system is that endogenous (and potentially In any cell type, regardless of the cellular environment of the protein) Screening can be performed. A further possibility of this type of system is that For the purpose of identifying proteins involved in interactions restricted to specific positions In the above, the target protein can be localized to a specific cell compartment.   The use of fluorescence activated cell separation technology is particularly well suited for this embodiment of the invention . For example, β-g containing cDNA that expresses a gene product that interacts with the target protein al-positive cells allow such cells to be purified by cell separation techniques. Signal. Such cDNAs are, for example, highly complex cDNA libraries. Using a retroviral vector that allows for the introduction of Can be reached.   The assays and methods of the present invention also provide for extracellular signaling molecules, growth factors or Are differentiation factors, peptides, drugs or synthetic analogs (the presence or efficacy of The result is the interaction of two or more given proteins in a particular cell type. (Potentially changing potential).   Detection of molecular interactions using the methods and compositions of the present invention occurs in the nucleus It is not limited to interactions, nor is it limited to intracellular interactions. For example, surface Interactions involving putters can be detected by practicing the present invention. One embodiment In another aspect, the present invention relates to a ligand-induced dimer of a surface receptor in living cells. To provide a new technology for the detection of contamination. Dimerization of cell surface receptors Alternatively, a higher degree of oligomerization may lead to receptor activation and subsequent Often essential for this signaling. For example, epidermal growth factor (EGF ) Binding to its receptor stabilizes receptor dimerization and This results in activation of scepter tyrosine kinase activity. Schlessinger et al. (1992) Neuro on 9: 383-391; Ullrich et al. (1990) Cell 61: 203-212; and Weiss et al. (1997) Curr. Opin. Genet. Dev. 7: 80-86. Example 11 below describes the membrane receptor in living cells. Disclosed is the use of β-gal complementation to monitor the dimerization of the protein. this For purposes, weakly complementary β-gal Δα and Δω deletion mutants are Fused with the extracellular and transmembrane domains of the sceptor, the chimeric receptor molecule (Fig. 7). Deletion of the cytoplasmic domain of the receptor is Receptor internalization and degradation commonly observed following F stimulation (Livneh et al. (1986 ) J. Biol. Chem. 261: 12490-12497), which means that in changing conditions Allows for the analysis of receptor dimerization over time. The results shown in Example 11 are Embodiments of the Invention Have Not Been Recognized Prior to Modulation of EGF Receptor Signaling (EGF receptor tyrosine kinase activity leads to receptor dimerization) Act as a limiting feedback inhibitor) Demonstrate what you get.   The practice of the present invention is not limited to detecting the interaction between two different molecules. molecule Can also be detected using the methods and compositions of the present invention. This In this regard, Example 11 provides for the recognition of receptor dimerization throughout the practice of the present invention. Disclose detection.   The methods and compositions of the present invention can be used to convert retroviral high titer, high complexity cDNA lines. State-of-the-art methods for building libraries (see, for example, Pear et al. (1993) Proc. Natl. Acad. . Sci. USA 90: 8392-8396) in mammalian cells. Identification of the interaction partner for a particular test protein (ie, protein level Performing functional genomics at the same level) is possible. For this application, retro CDNA library in a viral vector (where the cDNA coding sequence is Fused to a sequence encoding a compatible reporter subunit). It is. The sequence encoding the binding protein of interest is the first retroviral vector And a low affinity reporter subunit. Retrovirus vector In a second series of proteins, a second complementary low affinity reporter subunit comprises: A variety of different proteins to be tested for their ability to bind to the protein of interest , Fused. The test comprises a first retroviral vector and a second retrovirus. This is accomplished by co-infecting cells with one of a series of vector vectors. Eye A test protein that can bind to a target protein Detection of the reporter signal in cells. This application is also Screen for agonists and antagonists of biologically significant protein interactions Useful for training.   In one embodiment of the present invention, encoded by one of the second vector series. Protein interacts with the target binding protein encoded by the first vector Cells that can be used include flow cytometry or fluorescence-activated cell sorting (FA CS). Flow cytometry and FACS methods Are well known in the art; see, for example, Nolan et al. (1988) Proc. Natl. Acad. Sci. US A 85: 2603-2607; Webster et al., Exp. Cell Research, 174: 252-265 (1988); and Pa rks et al. (1986) The Handbook of Experimental Immunology, (Weir, D.M., Herzenber g, L.A., Blackwell, C.C. and Herzenberg, L.A.), Blackwell, Edinburgh, Ed. Fourth edition, pages 29.1 to 29.21. In this way, clones of cells in which binding occurs are further It can be isolated and propagated for further study. This aspect is the mechanism of occurrence Is particularly suitable for the study of Cell population, and study the further development of that cell population. At the same time, to study further development of non-interacting cells for comparison Is possible. In a similar manner, the practice of the present invention is directed to proteins (eg, Transcription control protein, translation control protein, DNA replication protein, mRNA splicing Proteins, proteins involved in signal transduction, intercellular and cell-substrate Proteins involved in adhesion (eg, cell migration, axon guidance, angiogenesis), cancer Gene products, tumor suppressors, proteins involved in cell cycle control, and Virus proteins (eg, viral replication, virus-host interactions and virus Proteins involved in the regulation of lus assembly)), as well as subunits Involve proteins, crosslinkers, modifiers, or molecular motors in the cytoskeleton of cells Isolation of cells exhibiting interaction and / or further development of the cells. Make it work.   Certain target proteins to which the gene can be fused with the low affinity complementarity reporter subunit For proteins, known or previously unknown using the compositions and methods of the present invention. The protein or other endogenous or exogenous material with which the protein interacts The substance can be identified. Similarly, from the nucleic acid sequence database Sequences (or cDNA libraries) that encode proteins of unknown function The practice of the present invention provides that the encoded protein Allows identification of interacting molecules. The identity of interacting molecules is unknown It appears to provide information on protein structure and / or function. Therefore The practice of the present invention encodes newly discovered proteins and proteins It appears to help identify and characterize the nucleic acid sequence.   In another aspect of the invention, to identify protein-protein interactions Shotgun approach is a fusion of the first low-affinity complementarity subunit to 1 A first set of constructs expressing the products encoded by the two cDNA libraries, And second (or identical) cDNA fused to a second low affinity complementarity subunit Generating a second set of constructs expressing the product encoded by the library Is adopted. The cells where co-expression and complementation of the two sets of constructs occur Vessel selection is based on the isolation of clones and the cDNA encoding the interacting partner. Enable identification. One or both of the interacting partners can be known Alternatively, both interacting partners may identify previously unidentified proteins. Can represent. If both partners are known, the binding specificity of the partners New information can be obtained. Unknown binding part if one partner is known Can provide information on the function of the donor. If both are unknown, a view of their interaction Insight may assist in the eventual identification of one or both of the interacting pairs.   The present invention relates to homodimerization or heterodimerization Study of mechanisms that regulate thymerization (synthesis or Including high efficiency screening to identify naturally occurring compounds) .   The invention relates to specific complexes in intact cells or intact animals. Can be used for studies on the localization of The types of cells that can be used are Primary or established cell lines and other types of embryonic cells, neonatal cells, or Are adult cells or transformed cells (eg, spontaneous transformation or viral Sex transformation). These cells include fibroblasts, macrophages, muscle Bud Cells, osteoclasts, hematopoietic cells, neurons, glial cells, primary B cells, primary T cells , B cell lines, T cell lines, chondrocytes, keratinocytes, adipocytes and hepatocytes. But not limited thereto.   Through the practice of the present invention, regulation of enzyme activity by regulation of the association of complementing variants It is also possible to devise a system for this. This aspect of the invention relates to a prodrug Potential of human therapy as a way to modulate enzyme-driven conversion of a drug to its active form Have a strategic application.   Molecular interactions (particularly protein-protein Processes involved in transcription, translation, replication, mitosis, Proliferation control, cell cycle progression and control, apoptosis, cell-cell, cell-substratum and And cell-ligand interaction, intracellular signaling cascade, tumorigenesis, cell line Strain, as well as, but not limited to, embryonic development. Examples of cell ligands May include leptin and growth factors (eg, epidermal growth factor (EGF) , Nerve growth factor (NGF), platelet-derived growth factor (PDGF), and insulin-like increase Growth factors I and II (IGF-I and IGF-II)), transforming growth factor α And β (TGF-α and TGF-β), endorphins and endorphin receptors Putters, prostaglandins and their receptors, cytokines and their receptors Sceptors, neurotransmitters and their receptors, adrenergic receptors And cholinergic receptors. A ligand that can interact with a ligand The receptors include EGF, NGF, and PDGF receptors and leptin receptors -. EGF receptor dimers using methods and compositions of the invention A chemical analysis is provided in Example 11 (below).   Additional interactions that can be studied by practicing the invention include cell metabolism and Interactions involved in cell structure. These interactions include energy Interactions involved in energy metabolism, or the cytoplasm, cytoskeleton, Interactions that establish or alter the structure of Nera, nucleus, nuclear matrix or chromosome But not limited thereto. Interaction between extracellular matrix components, Alternatively, the interaction between the extracellular matrix component and the cell may also be It can be studied using the composition.   The invention will be further understood by the following non-limiting examples.                                  Example Example 1: Construction of a retrovirus encoding a β-galactosidase reporter system Preparation and transfection   Β-galactosidase (“β- gal ") A reporter system using complementation was constructed. Ten developed by Schreiber Using the protein complex characterized by Minutes offered. Belshaw, P.J. et al. Proc. Natl. Acad. Sci. USA, 93: 4604-4607 (199 6); Brown et al. Nature 369: 756-758 (1994); Chen et al. Proc. Natl. Acad. Sci. USA 92: 4 947-4951 (1995); and Choi, J. et al. Science, 273: 239-242 (1996), disclose these disclosures. Incorporated herein. In this protein complex, intracellular rapamyces Binding protein FK506-binding protein-12 (FKBP12) FKBP-rapamycin-associated protein (F RAP), and this interaction increases with the dose of rapamycin. Rapamycin is a small, cell-permeable molecule that, through independent determinants, Binds to intracellular proteins. Rapamycin simultaneously binds to two molecules of FKBP12 No, and FARP binds only to rapamycin in FKBP-12 rapamycin complex Therefore, only the heterodimer is formed in the rapamycin treatment. Ho, S.N The disclosure of Nature et al., 382: 822-826 (1996) is hereby incorporated by reference.   The β-gal system was combined with the FKBP12 / FRAP / rapamycin system as follows. 2 Produces two different retroviral constructs, each construct containing Δω or Δαβ-gal Mutant fusion proteins and the FKBP12- or FKBP-rapamycin junction of FRAP Either of the positions encodes (FKBP12-Δω and FRAP-Δα), respectively.   Δα or Δωβ-gal variants are described in Mohler and Blau, Proc. Natl. Acad. Sci . 93: 12423-12427 (1996), the disclosure of which is herein incorporated by reference. Invite.   In-frame coding sequence for FKBP12- and FKBP12-rapamycin binding domain Adapter oligonucleotide containing a XhoI site (CA TGGAGCTCGAGAG), with the Δα and Δ described by Mohler and Blau (supra). The ωβ-gal mutant was inserted at the NcoI site in ATG. Amino acid 2025 of human FRAP Ho2114 and two XhoI-SalI DNA fragments corresponding to the full length coding sequence of human FKBP12. The fragment was cloned into the XhoI site of the modified Δα and Δω mutants and FRAP- Δα and FKBP12-Δω were generated. Maintaining an appropriate reading frame is important when sequencing both constructs. Confirmed by constant.   FRAP-Δα and FKBP12-Δω cop to pWZL-Neo and pWZL-Hygro retroviruses Adapter oligonucleotides containing NcoI and BamHI sites for insertion of nucleic acid sequences Otide (GATCACCATGGACGCGTGGATCCC) is replaced with the BamHI and XhoI sites of the pWZL vector Inserted. Both sites initially present were destroyed by this insertion. next, The FRAP-Δα and FKBP12-Δω coding sequences were added to the modified pWZL vector using the NcoI-BamHI As a fragment.   The cDNAs encoding FKBP12-Δω and FRAP-Δα were transferred to the mouse Hygromycin or neomycin resistance of tropic retroviral vectors Each was inserted upstream of the gene. By using encephalomyocarditis virus IRES, Introduction of a single retroviral vector produces mRNA with two cistrons And Δα-β-gal-FRAP protein and drug-selective hygromycin tan Ensures translation of both parkin. The second retroviral vector is Δω-β- Produces gal-FKBP12 protein and neomycin resistance protein.   For calcium phosphate transfection for virus production and infection Thus, the proviral construct was introduced into the packaging cells. Package The supernatant medium containing the retrovirus from the transfected cells Harvest after ~ 72 hours and infect C2C12 cells in the presence of 8 μg / ml polybrene Used to let. Select single and double infected cells with appropriate drug did. Use both geneticin and hygromycin at a final concentration of 1 mg / ml. Used. Selected cells were expanded as a population for subsequent experiments.   The previously described MFG retroviral vector (Dhawan et al., Science, 254: 1509). -1512 (1991)), a background detected using Δα and Δω mutants Round β-gal was relatively low (Mohler, W.A. and Blau, H.M., Proc. Natl. Acad. Sci. USA, 93: 12423-12427 (1996), the disclosure of which is incorporated herein by reference. Splice donor / acceptor upstream of β-gal ATG (pWZL) By using a retroviral vector having a point mutation with a deleted sequence It was further reduced. These mutations result in a translation of the first coding sequence contained in the vector. Translation efficiency, but affects the expression of selectable markers that depend only on IRES. Absent. Using this vector, the same LTR (long terminal repeat) and wild-type One-half the amount compared to the vector containing the rice donor / acceptor sequence Flow protein was expressed. Such a decrease in translation is Regardless of the concentration, and the test protein to which they are fused, the resulting Reduces the spontaneous interaction of the β-gal mutant. As a result, in preliminary experiments The Δα and Δωβ-gal variants alone measured by a luminometer. Background enzyme activity is reduced from low to essentially undetectable Was done.   Infectious virus particles were isolated from each of the constructs shown in FIG. 2a by Pear et al. (1993) Proc. Natl . Acad. Sci. Package modified from that described by USA 90: 8392-8396 Transient transfection by calcium phosphate transfection into Produced by transfection. Retrovirus from packaging cells The supernatant medium containing 24-72 hours after transfection, and C2C12 cells were used to infect in the presence of 8 μg / ml polybrene. C2C12 muscle The blasts were either multiplexed with each retrovirus alone or simultaneously with both. Infected. All experiments were performed after selection using hygromycin and G418. To ensure that 100% of the cells contained both constructs. Geneticin and And hygromycin were used at a final concentration of 1 mg / ml. Pull selected cells Expanded as a population for subsequent experiments.   Example 2: Assay of binding and activity of β-galactosidase reporter system   After the addition of rapamycin to the medium, the transformation obtained as described in Example 1 The transformed cells were assayed for β-gal activity. As shown in FIG. 3, FKBP12- C2C12 cells expressing both Δω and FRAP-Δα were transformed with 10 ng / ml rapamycin ( Figure Exposure to 3b) for 12 hours or without any drug (FIG. 3a) Was tested. Only cells expressing both constructs show β-gal activity and The cells were easily visualized by X-gal staining (FIG. 3b). Nuclear interaction In contrast to prior art methods such as the yeast two-hybrid system Advantageously, quality staining is detected by this method. X-gal staining is as follows Performed as follows: cells are fixed in PBS plus 4% paraformaldehyde for 5 minutes And rinsed in PBS before staining. Indigo-generated X-gal staining at 37 ° C in PBS Las 1mg / ml X-gal, 1mM MgCl_Two, 5mM K_ThreeFe (CN)₆, 5mM K_FourFe (CN)₆Went all night in Was.   The kinetics of β-gal activation during rapamycin treatment was determined. Both fusion tags C2C12 cells expressing the protein were plated in duplicate in 96-well plates. La Pamycin was added to the culture medium and β-gal activity was measured at different time points. each For time points, six replicate samples were obtained from Mohler, W.A. and Blau, H.M., Proc. Natl . Acad. Sci. USA, 93: 12423-12427 (1996) (the disclosure of which is incorporated herein by reference). Assayed using the sensitive chemiluminescence assay described in (Incorporated). . In this assay, cells cultured in microtiter plates were , Lysate, and Galactolight Plus Assay Kit (Tropix, Bedford, MA) In 50 μl of a 1: 3 mixture of assay buffer containing Galacton Plus substrate from Dissolved in itchu. The reaction was allowed to proceed for 1 hour at room temperature. Light Emission Accelerat After addition of the or solution, luminescence was measured in a scintillation counter.   The results shown in FIG. 4 indicate that the interaction assay for the fusion protein was specific. And similar to the FKBP12 / FRAP / rapamycin protein complex alone assay 2 shows the kinetics and comparable dose response curves. Ho, S.N., et al., Nature, 382: 822-82. 6 (1996). Rapamycin induces a 30-fold increase in β-gal activity within 5 hours did. As a control, no rapamycin was added and background Did not detect more than β-gal activity. Two constructions as a second control Β-gal activity in cell populations expressing only one of the Did not increase above background.   FIG. 4b shows the dose response curve. β-gal activation depends on the dose of rapamycin. Existed. This appeared to be linear over the drug range of 0-10 ng / ml. . This linearity indicates that β-gal enzyme activity quantifies protein-protein interactions Provides support for what can act as a reporter for Dose response and Both reaction rates were observed by others (Ho, S.N. et al., Nature, 382: 82 2-826 (1996)), the fusion to the β-gal peptide is based on FKBP12 And does not interfere with the interaction of the FRAP protein. In addition, intrinsic FKBP12 and FRAP proteins produce β-gal activity in the presence of rapamycin. Ubiquitously expressed and interact with each other or with the fusion protein obtain. As described above, the detection of β-gal activity indicates that productive FRAP-Δα and FKBP12-Δ Omega dimers are formed in an intracellular environment that contains competing endogenous proteins And the resulting β-gal activity is dependent on the interaction of FRAP and FKBP-12 rapamycin. To reflect the use. Therefore, the β-gal fusion protein is FKBP12 / FRAP / rapa Protein phases in mycin complexes and other types of multiprotein complexes Can be used to monitor interactions.   It is also possible to detect and quantify binding activity in cell lysates. As shown in FIG. 5, both FKBP12-Δω and FRAP-Δα fusion proteins are expressed. Cells were expanded and lysed in the absence of rapamycin. 100ng / ml rapa Mycin was added to half of the sample and treated and untreated lysates. Β-gal activity was measured immediately (white bars), after 1 hour (black bars), or after 3 hours (grey bars). ). More than a two-fold increase in β-gal activity was observed one hour after drug administration. Observed in rapamycin treated lysates. Those exposed to rapamycin No statistically significant increase in β-gal activity was detected in control lysates Was. Using the methods and compositions of the present invention, protein-protein The ability to detect and quantify protein interactions is mature, fully folded. Shows that the interaction between the identified proteins can be detected and quantified; complexes Co-translation assembly leads to complex formation that can be monitored by β-gal activity Not required.Example 3: Triplicate fusions for quantification of protein-protein interactions   Protein interactions were studied in a quantitative manner in the systems described in the above examples. And the binding capacity of the binding moiety or a single fusion protein Any of the complementarity of the reporter subunits resulting from both activities present in quality To monitor the expression of system components to control the effect on Modified. In the above system, the β-gal fusion protein is It is expressed from the motor, but for some proteins its expression level Can be affected by a particular fusion partner. In particular, go Some proteins or domains are based on the stability or conformation of the β-gal domain. Can affect the application. As a result, the test proteins (putative binding moieties) Differences in the ability to complement that are not based on physiological mechanisms can be observed .   To circumvent these problems, three components (β-gal mutant, FKBP12 or FR AP, and a test protein). The most N-terminal component is , The test protein followed by FKBP12-Δω or FRAP-Δα (the fusion See the exemplary system of FIG. 2b, where the protein portions are indicated by X and X '. And). Due to the presence of the FKBP12 and FRAP moieties, the rapa Allows for mycin-mediated dimerization and β-gal in the presence of rapamycin The efficiency of complementation appears to depend on the FKBP12 / FRAP / rapamycin interaction. Purpose Containing an immobilized fusion protein and different interaction partners Of β-gal activity obtained by simple co-expression (in the absence of rapamycin) A pairwise value was determined. In parallel samples, β-gal activity was compared with a fixed amount of rapamycin. It was measured when inducing complementation. Between the absence and presence of rapamycin The ratio of β-gal activity that is determined by the relative ability of different protein pairs to interact with each other Showed power. A further advantage of this approach is the presence of FKBP12 and FRAP domains. Presents a flexible hinge between the β-gal mutant and the putative binding moiety being analyzed. To provide. This may result in an obstacle between β-gal and the protein of interest. Performance is reduced. In addition, recloning into more efficient viral vectors Enables direct testing of the functional integrity of the β-gal component in fusions without the need to I do.   The results were obtained with a three-part fusion of tetR-FKBP12-Δω or tetR-FRAP-Δα (FIG. 2b). See examples in). Co-expression of these constructs (where dimerization is , Driven by the tetracycline receptor (tetR) protein (Hinrichs , W. et al., Science, 264: 418-420 (1994), the disclosure of which is incorporated herein))). Readily produced β-gal positive cells. This is a functional three-part fusion (this Here, the dimerization of the most N-terminal peptide component is due to the C-terminal β-gal deletion mutant (Which efficiently drives complementation of the polypeptide) can be constructed.   Example 4: Myogenic modulator dimer using a complementary β-gal fusion protein Conversion   Using the β-gal complementation system, activators of muscle-specific proteins (myoD, Ogenin, myf5, MRF-4), inhibitors of myogenesis (ibid., Mtwist, I-mf), And HLH proteins, including ubiquitous E2A type proteins (E47, E12, HEB) Cous-loop-helix protein, the die of Murre et al. (1989) Cell 56: 777-783) Assay for merification and nuclear translocation.   In the first step, the myoD-Δα-β-gal (myoD-Δα) fusion construct and E12- The Δω-β-gal (E12-Δω) fusion construct was used for FRAP-Δα and FKBP12-Δω Operate on a selectable retroviral vector as described. Two constructions The product is introduced into C2C12 myoblasts. Appropriate for cells expressing both constructs After selection with the appropriate drug, β-gal activity is quantified using the chemiluminescence assay described above . β-gal activity indicates that heterodimerization of the fusion protein occurs in this cell type. Indicates that you are sick. If β-gal activity is detected, individual cells are stained with fluorescent X-gal Analyze using color to determine if the heterodimer is present in the nucleus. Wild type β-gal is specifically directed to the nucleus and the nuclear localization sequence (nls) (Hughes and Blau , Nature, 345: 350-352 (1990)). Activity from the gal hybrid protein can be detected in the nucleus. cell Knowing the site of localization in the quality or nucleus is a function of protein interactions (eg, (E.g., sequestration and inhibitory activity, or facilitating activity). This method is Fluor-X-Gal substrate (Mohler, W.A. and Blau, H.M., Proc. Natl. A cad. Sci., USA, 93: 12423-12427 (1996)). For example, desmin, and the possibility of creatine kinase in connection with β-gal localization) Sight Make it possible.   All fusions between myogenesis regulators and the complementary β-gal mutants described in the following sections Joint constructs are known to result in heterodimerization of endogenous myogenesis regulators Can be tested on living muscle cells. In addition, the following controls are performed again Can be The myoD-Δα construct can be co-transfected into cells with FKBP12-Δω, and Thus, the E12-Δω construct can be co-introduced with FRAP-Δα. This combination of constructs Weak β-gal pepti, independent of complementation, heterodimerization of the non-β-gal portion of the molecule Some unusual mechanism that enhances complementation is present in the particular cell type being tested Should not result in β-gal activity unless FRAP-Δα and FKBP12- Δω can also be co-transfected and cells are positive for complementation in each cell type Treated with control rapamycin. In high serum medium (growth medium) Cells and cells in low serum medium (differentiation medium) produce different results.   Example 5: Growth factors and groups for heterodimerization and homodimerization In vitro assays for quality effects   Using the construct described in Example 4 above, C2C12 myoblasts were transformed into myogenic HLH fusions. Transduce with one of the constructs and the E12-Δω construct. C2C12 cells are an endogenous muscle Already containing the formed HLH protein and E12, the chimeric construct is Acts as a "tracer" for measuring degrees. The transduced cells are then Stimulating cells, by changing serum levels, or by fibronectin or Growth factors (TGF-β, bFGF, IGF-I) in the presence or absence of a substrate such as minin , And IGF-II). Then β-gal activity is measured as a function of time. Β-gal activity after growth factor stimulation Rapid changes in a given extracellular signal for the formation of a particular heterodimer May suggest a more direct mechanism of action. Slower changes occur when extracellular signals Indirectly, for example, competing factors that can sequester one or both of the fusion proteins Up-regulating expression can be shown to work. β-gal Changes in activity are measured by Northern blot in parallel samples. Can be correlated with the expression level of a known inhibitor of enzymatic (eg, Id protein) . The opposite of the change in β-gal activity obtained with each pair of test proteins in parallel experiments The kinetic comparisons are based on specific MRF (muscle regulator, Yun et al. (1996) Curr. Opin. Cell Bio. l. 8: 877-879; and Cossu et al. (1996) Trends Genet., 12: 218-223) Indicates whether bitters differ in their ability to respond to extracellular signals. Hete Identify growth factors or substrates that can affect rhodimer formation (or nuclear translocation) If so, the experiment is repeated on other non-myogenic cell types. Different cell types Analysis of the effects of specific growth factors on the cellular response of the corresponding signaling pathways Indicates whether the minutes are tissue specific or not.   These experiments on tissue culture cells were performed in growth and differentiation conditions as well as Specific response in response to known signal transducers Allows you to evaluate the relative affinity and compartmentalization of protein partners You. The interaction of these factors competes with the potent endogenous components present in the cell at that time. Together, they can be tested in relevant physiological backgrounds. Therefore, Numerous analyzes of the interactions of myogenic factors performed have been It has been performed in vitro, in purification systems, or in yeast (Benezra et al.). , Cell,61: 1213-1230 (1990); Lassar et al., Cell,66: 305-315 (1991); Hu et al., Mo. l. Cell. Biol.,12: 1031-1042 (1992); Chen et al., Cell,86: 731-741 (1996); and And Spicer et al., Science,272: 1476-1480 (1996). Interactions in mammalian cells Biochemical methods (eg, immunoprecipitation or Relatively low sensitivity of activation of the porter gene construct) Requires overexpression of quality and constructs, usually by transient transfection. Levels, potentially increasing interaction with increasing concentrations Level. The methods disclosed herein may be used at different times in the myogenic differentiation pathway. To study protein-protein interactions that are functionally related in . Clearly, the extracellular and intracellular environments are responsible for these proteins at different times. Determine the stoichiometry and abundance of the quality. As a result, the same dimerization partner , Cofactors, and kinases or phosphatases in signaling pathways Competition between different proteins is a complex that actually forms in intact cells Could have a significant effect on the body. Assess the nature of such endogenous interactions Cell-specific levels and the nature of the "competitive" environment at a given point in time Low expression levels are required to keep the quality unchanged. Advantageously, the present invention In the systems described in the specifications, the protein-protein interaction of interest is evaluated. Does not require high level expression of the introduced protein. In fact, transient Transfection assays or strong promoters and high translation efficiency In contrast to most retroviral vectors having The system disclosed therein provides for the natural endogenous production of a proposed test protein in a cell. Provide a level that does not disrupt the physical level.   Example 6:Analysis of inhibitory and myogenic HLH proteins in mice   Heterodimerization of inhibitory and myogenic HLH proteins in mice Can ping. Mtwist and I-mf suppress myogenesis in mammalian tissue culture systems It is shown to be. In addition, they are directly associated with myogenic HLH proteins. It has been proposed to operate via physical association (Hebrok et al., Dev. Biol.165 : 537-544 (1994); Rohwedel et al., Exp. Cell Res.,220: 92-100 (1995); Chen et al. , Cell,86: 731-741 (1996); Spicer et al., Science,272: 1476-1480 (1996)). Embryo During formation, Mtwist is expressed throughout epithelial segments and later cleared from sarcomere (Fuchtbauer, Dev. Dyn.,204: 316-322 (1995); and Stoetzel et al., Mech. De v.51: 251-263 (1995)). I-mf expression has not been analyzed during the early stages of somitogenesis. However, at 11.5 days after mating (post-cotium), I-mf is highly expressed in Are excluded from the sarcomere (Chen et al., Cell,86: 731-741 (1996)). Therefore, the embryo Based on their expression domains in these genes, these elements It is considered important because of the spatial and temporal limitations of the gram.   Further support for this hypothesis is that the myf5 coding region is targeted and lacZ By analysis of substituted myf5 / lacZ embryos. β-gal is a marker for myf5 expression pattern As a result, cells expressing myf5 also express Mtwist ( Fuchtbauer, Dev. Dyn.,204: 316-322 (1995); and Stoetzel et al., Mech. Dev.51 : 251-263 (1995)), in the presomitic mesoderm, all of the initiation of myogenesis And previously (Cossu et al., Trends Genet.,12: 218-223 (1996)) is detected. In late development, myf5 and myoD are expressed in Mtwist in somites before distinct sarcomere formation. (Ott et al., Development,111: 1097-1107 (1991); Fuchtba uer, Dev. Dyn.,204: 316-322 (1995); Stoetzel et al., Mech. Dev.51： 251-263 (1 995); and Cossu et al., Trends Genet.,12: 218-223 (1996)). These cells Does not express other detectable myogenic markers (Ott et al., 1991). Therefore, The reporter system disclosed in the specification provides for myf5 and Myf5 in these cells. oD protein interacts with Mtwist and / or I-mf in heterodimers Can be used to determine if it has been kept inactive by use. After outbreak Mtwist and I-mf are non-myogenic in which the expression of myogenic factors is eliminated It is expressed in most mesoderm. Smith et al. Cell Biol.,127： 95-105 (1 994); Fuchtbauer, Dev. Dyn.204: 316-322 (1995); Stoetzel et al., Mech. Dev.Five 1 : 251-263 (1995); and Chen et al., Cell,86: 731-741 (1996). Probably Mtwis t and I-mf indicate a sharp boundary between sarcomere and adjacent tissue at this time. Related to creating a world.   The reporter system disclosed herein is useful for in vivo development of myogens during embryonic development. Allows for a detailed study of the interaction between sexual inhibitors and activators, It can provide new insights into the complex process of pattern formation during the somitogenesis. like that The study was not limited to mice, but C.I. elegans, Drosophila, Xenopus, Zebraf It can be easily performed in tissues and other experimental organisms. To date, in the embryo Uses Methodology to Enable In Situ Visualization of Protein Complexes in Japan Not possible. As a result, when and where such HLH heterodimers occur during embryonic development No clear evidence is available as to whether this interaction can occur.   Example 7:Detection of HLH heterodimer in mouse embryo   The β-gal complementation assay is useful for protein-protein interactions in vivo Well suited for the detection of Myf5-Δα, MyoD-Δα and Mtwist-Δω fusion tamper Build quality. Mediation of β-gal complementation using these fusion proteins is described above. During the performance of the experiment. Well-established transgenic technology Using (Thomas and Capecchi, Nature,324: 34-38 (1986); and Capecch i, Science,244: 1288-1292 (1989)), one of the myf5, MyoD or Mtwist alleles Mouse systems can be created in which one has been replaced with the corresponding fusion protein. Obedience Thus, myf5-Δα, MyoD-Δα and Mtwist-Δω fusion proteins It is expressed under the control of an intrinsic promoter. Test protein expression Can be demonstrated in mice. Next, Mtwist-Δω transgenic mice Can be crossed with myf5-Δα and MyoD-Δα transgenic mouse line. Analysis of progeny to identify mice with both fusion proteins I can do it. β-gal activity is based on the fact that Mtwist-Δω is physically fused with myf5-Δα or MyoD-Δα. It should only occur in those embryonic cells that associate with the protein. This minute Analysis shows that Mtwist actually interacts with myf5 and MyoD during and Enables mapping to suppress the intrinsic phenotype.   Example 8:Targeting strategies and manipulation of required constructs   By inserting the myf5-Δα fusion protein coding sequence into the myf5 locus Can be expressed under the control of an endogenous myf5 regulatory element. Fusion of myf5 with ATG A similar insertion of wild-type β-gal at the myf5 locus resulting in This shows that the expression pattern is accurately reproduced. The targeting construct has been published Based on the myf5 / lacZ targeting construct (Tajbakhsh and Buckingham, Proc. Natl. A cad. Sci. USA,91: 747-751 (1994); Tajbakhsh et al., Neuron,13: 813-821 (1994) And Tajbakhsh et al., Nature,384: 266-270 (1996)) with the following differences: (1 ) The fusion protein contains the complete myf5 coding sequence fused to Δαβ-gal. (2) Melting Synthetic protein coding sequence is neomycin flanking the FRT site (FLP recombinase target) With a resistance gene. This is due to the integration of the targeting construct into integrated ES cells G418 Enable selection. (3) Diphtheria toxin expression cassette is compatible with myf5 mouse genomic DNA Located at the 5 terminus of the homology region. During homologous recombination, linkage within the homologous region In which the diphtheria toxin expression cassette is eliminated after integration (C apecchi, Science,244: 1288-1292 (1989)). Compare rather than homologous recombination Clones resulting from random integration retain diphtheria toxin expression and Clones are selected in culture for killing. Surviving clones Was characterized by PCR for proper integration of the construct at the myf5 genomic locus. Only by Southern blotting.   Subsequently, the neomycin selection cassette was replaced with a modified version of the previously described technology. (Fiering et al., Genes Dev.,9: 2203-2213 (1995)). Succinctly Contains FLP recombinase, Internal Ribosomal Entry Site (IRES), and GFP Plasmids expressing bicistronic messages are transiently transformed into E Transfect into S cell clone. GFP-positive cells were fluorescent-activated And clone classification using the FACS. In these cells, FLP has two FRTs. Sequence between sites deleted, and only β-gal coding sequence remains in ES cell genome I do. Aliquots of sorted clones were tested for G418 sensitivity, PCR and Southern blot. Lot method confirms correct deletion of neomycin cassette in sensitive clones Admit. This approach of eliminating selectable markers, as described, Avoid interference between the exogenous promoter driving the promoter and the endogenous control sequences (Ols on et al., Cell,85: 1-4 (1996)).   The targeting constructs for MyoD and Mtwist are also described (Rudnicki et al., Cell,71: 383 -390 (1992); Chen and Behringer, Genes Devel.,9: 686-699 (1995)) And relevant constructs can be made for each. Based on these available reagents And according to the scheme proposed above for the myf5-Δα strategy, M yoD-Δα and Mtwist-Δω fusions with ES cell endogenous MyoD and Mtwist genes Vectors for targeting in loci (Chen and Behringer, Genes Devel.9: 68 6-699 (1995)). In each case, the differences between the strains Available genomes in targeting constructs because they are known to reduce frequency Use an ES cell line that is syngeneic with the DNA homology region. The above myf5 "knock-in" method The same FLP-mediated ablation methodology used was targeted to MyoD and Mtwist Applies to the deletion of the neomycin resistance marker from the locus. This "in-out" The strategy is that the fusion protein coding region regulates endogenous regulatory elements. Beneath and assemble with minimal exogenous flanking DNA sequences.   Example 9:myf5- Δα / Mtwist-Δω and MyoD-Δα / Mtwist-Δω transge Analysis of engenic   For each construct, multiple ES cell clones are injected into the blastocyst. False pregnancy The chimeric progeny obtained in the female transplant are tested for germline transmission, Obtain heterozygous mice. One important control in this experiment was the “knock The expression pattern of the “-in” fusion protein is Is to accurately mimic the reported expression pattern . To this end, a system is provided which allows for the rapid detection of the fusion protein. Generates β-gal mutant (Δμ) capable of strong complementarity with either Δα or Δω Create the transgenic mouse strain that will appear. Δμ is a strong chicken β-A Extensively expressed from the Kuching promoter. MyoD-Δα, myf5-Δα and Mtwi The st-Δω transgenic mouse strain was exchanged with each Δμ transgenic mouse. Clutter. The identity of any of these fusion proteins with a strongly complementary Δμ mutant Expression results in β-gal activity that is easily detectable, and therefore The expression pattern of synthetic proteins can be monitored by X-gal staining of embryos. You.   The Mtwist-Δω mouse line was transformed with MyoD-Δα and myf5-Δα transgenic Crosses with Us strains. To use heterozygous mice for these crosses On average, one quarter of the embryos are double heterozygotes. Preparation of mount using X-gal Staining of whole embryos and histological sections allows these embryos to be Analyze at Mtwist-MyoD or Mtwist-myf5 interaction is a rare event, As a result, sections were also more sensitive to detect cells with lower β-gal signals. Stain with highly fluorescent fluor-X-Gal fluorescent substrate. (Mohler, W.A. and Bl au, H.M., Proc. Natl. Acad. Sci., USA,93: 12423-12427 (1996)).   The advantage of this approach is that in cells where the above interactions occur in vivo. Only β-gal activity appears. This approach provides an insight into nascent myogenesis. Allows a thorough analysis of the interaction between the inhibitor and the activator. In particular, This method allows for the detection of heterodimers in in vivo settings (developing mouse embryos). Analysis of the co-expression and physical interaction of two such proteins Noh. This is known to be related to multiple control processes like Mtwist Of particular importance in the case of factors (Chen and Behringer, Genes Devel.9 : 686-699 (1995)), achieving its function through interaction with different determinants it is conceivable that.   The use of β-gal complementation mutants can also extend to I-mf analysis. I-mf is also an embryo Is involved as a negative regulator of myogenesis in the brain (Chen et al., Cell,86： 731 -741 (1996)). Interestingly, however, I-mf and Mtwist are Co-expressed across nodes. Their presence in the same cell is simply myogenic HL Finger of existence of redundant mechanism for suppression of H regulator activity It is not clear whether it is a target or whether the two factors have distinct functions . In the first case, both I-mf and Mtwist are expected to associate with the same factor . In the second case, the differences and interactions with different factors are based on our experimental approach. Should be detectable using the   Example 10:Protein interaction by fluorescence-activated cell sorting (FACS) analysis   C2C1 coinfected with FRAP-Δα and FKBP12-Δω (described in Examples 1 and 2) The β-gal activity of the two cell populations was determined by FACS in the presence and absence of 10 ng / ml rapamycin. Assayed. FACS is a method well known in the art, for example, Nolan et al. (1988) Proc. Natl. Acad. Sci. USA85: Implemented in accordance with 2603-2607 did. Using this assay, increased β-gal activity was observed 90 minutes after rapamycin treatment. In most cells (FIG. 6A). In the presence and absence of the drug A range of expression levels was observed, as evidenced by the width of the emission peak (FIG. 6A). (Compare light and dark profiles). This width is Expression of each of the retroviral vectors, possibly after uptake into target cells Depends on changes in efficiency. This interference occurs in the absence of rapamycin. 25% of the cells expressing the lowest β-gal activity were collected (FIG. 6B). Treated and untreated cell populations were reassayed in the presence and absence of CS analysis resulted in non-overlapping peaks, which were processed (light peaks) and unprocessed (dark peaks). ) Supported by the finding that they show distinct differences between the populations (Figure 6C). Therefore Of the cells that are distinguished by the expression (or non-expression) of the complementary fusion protein Overlapping populations can be identified and isolated by FACS.   Example 11:Monitoring EGF receptor dimerization in living cells   Epidermal growth factor (EGF) receptor sig acting through receptor dimerization A previously unrecognized mode of regulation of the null pathway is that protein Using methods according to the present invention to monitor protein-protein interactions It was made clear. Fused to a weakly complementary β-galactosidase (β-gal) deletion mutant A chimeric protein containing the extracellular and transmembrane domains of the EGF receptor It was expressed in blast cells. Treatment of cells with EGF results in a rapid increase in β-gal enzyme activity. The resulting chimera receptor dimerization as assessed by the increase. By EGF Further processing involves the addition of an inhibitor of EGF receptor tyrosine kinase. If not, did not restimulate dimerization. These results indicate that the dimer receptor Tyrosine kinase activity inhibits further dimerization of the receptor Reveals the existence of the deback mechanism.   Method   Construction of chimeric receptors. The weakly complementary Δα and Δω deletion mutants of β-gal Extracellular and membrane of human EGF receptor, respectively, for the formation of mela receptor molecules The polypeptide was ligated to a polypeptide sequence containing a transduction domain. Chimeric receptors are The cytoplasmic domain of the scepter and associated tyrosine kinase activity were deleted. The method was as follows. Extracellular human EGF receptor (amino acids 1-655) And a sequence encoding the transmembrane domain, an NcoI site at the 5 'end of the PCR product. Polymerase primer using primers that incorporate an XhoI site at the 3 ′ end Amplified by reaction (PCR). This fragment is a protein kinase C (PKC) Arginine 656 and Arginine 656 And 657 are removed, destroying the consensus PKC recognition sequence. By threonine 654 The starting amino acid sequence is thr-leu-glu-ser-met, and the β-gal sequence is started. It has a met residue. The glu and ser codons are generated by the binding sequence and Is not natural to any of the β-gals.   The DNA encoding the chimeric receptor can be retro- Inserted into viral vector. In constructs containing the EGF receptor-Δα fusion, The selectable marker was the neo gene, which encoded G418 resistance; while the EGF receptor The puter-Δω fusion specifies hygromycin resistance (FIG. 1B). Therefore, EGF The scepter PCR product is digested and the NcoI and X of the pWZL-Δα and pWZL-Δω vectors are digested. Cloned into the hoI site. pWZL-Δα-neo and pWZL-Δω-hygro plasmid LacZΔα and Δω deletion mutants in pWZL-neo and pWZL-hygro, respectively. Was constructed by cloning. Mohler et al., Supra: and Rossi et al. (1997 ) Proc. Natl. Acad. Sci. USA 94: 8405-8410. Plasmid, Lipofectua Transfected into φNX cells using Min (Life Technologies) After 72 hours, the virus-containing supernatant was collected. 10% CO_Two20% fetal bovine serum (FBS) C2F3 mouse myoblasts maintained in added DME (Rastinejad et al. (1993) Cell 72: 9 03-917) was incubated in the virus supernatant overnight. Both structures Selecting cells containing the build in 1 mg / ml G418 and 1 mg / ml hygromycin Each antibiotic was maintained in 400 μg / ml.   EGF treatment and FACS analysis Cells were treated with mouse salivary gland EGF (Sigma) 100 ng / ml. In some experiments, tyrphostin AG1478 (Calbiochem) was treated with 100 nM. After all treatments, rinse cells with phosphate buffered saline (PBS) and trypsinize Afterwards, it was resuspended in PBS + 5% FBS. Fluorescein di-β-D-galactopyranoside (F DG; Molecular Probes) was loaded into cells by hypotonic shock as described . Fiering et al. (1991) Cytometry 12: 291-301 and Nolan et al. (1988) Proc. Natl. Aca d. Sci. USA 85: 2603-2607. Performed 1-2 hours after trypsinization, Cells were kept on ice until analysis by a rotor.   The chimeric receptor was a monoclonal mouse anti-human EGF receptor at 1: 100 dilution. Phycoerythrium with sceptor antibody (clone EGFR1, Dako) and 1: 100 dilution -Labeled horse anti-mouse IgG (Vector) or fluorescein-labeled goat anti-mouse IgG (C appel) was used to detect by immunofluorescence. Trypsinize cells And stained in PBS + 5% FBS. For each sample, 50 FACS analysis data Collected for 00 cells. Cells are cloned on a Becton-Dickinson FACS Vantage And run a Becton-Dickinson FACScan at the Stanford Shared FACS facility. Was analyzed. Data analysis is simplified with FlowJo software (Tree Star, Inc.) Was. The data displayed here as a FACS profile was generated using autofluorescence correction. And adjusted for autofluorescence. Alberti et al. (1987) Cytometry 8: 114-119. Average fluorescence data is calculated by subtracting the average fluorescence of untransduced cells loaded with FDG substrate. And adjusted for autofluorescence and endogenous mammalian β-gal activity.   result   Receptor dimerization assay Retro encoding selectable marker (Figure 7B) Each of the two chimeric DNAs was cloned into a viral vector and Was transduced into a blast cell line. After selection with C418 and hygromycin, To measure the cleavage products of a fluorogenic substrate using an activated cell sorter (FACS) , Β-gal enzyme activity was monitored. In the absence of EGF, transduced cells The population consists of a mixture of cells with high and low levels of β-gal activity (FIG. 7C, light gray curve). This is because EGF receptors are dimerized in the absence of EGF. That is not unexpected, assuming it can. Gadella et al. Cell B iol. 129: 1543-1558. After stimulation of the cell population with EGF, a large number of cells An increase was shown (FIG. 7C, dark gray curve). Use antibodies specific for human EGF receptor FACS analysis shows that cells express a wide range of levels of chimeric receptors (FIG. 7D, gray curve). Clones from this population were isolated and expressed in the absence of EGF β-gal activity level in the presence of low background levels of gal activity and EGF The increase was screened. One such clone, compared to the population, It has low levels of chimeric receptor expression (FIG.7D, dark gray curve) and β- It showed a several-fold increase in gal activity (FIG. 7E). This is the dimerization of chimeric receptors Is shown. Dimerization involves TGF-α, heparin-binding EGF-like growth factor, and β-cell After stimulation with other EGF-like growth factors that bind and activate EGF receptors such as Were also observed; but act via related receptors rather than EGF receptors Was not observed with EGF-like factors such as heregulin alpha. Beerli et al. Biol. Chem. 271: 6071-6076. Expressed as mean fluorescence of cells or β-gal activity Dimerization can be detected by EGF treatment for a short time of about 1 minute. Dimerization increased rapidly with longer exposures (FIG. 7F).   Time course of EGF receptor dimerization Receptor dimer with time course To track the final outcome of the culture, cells from the same clone as described above containing EGF After culturing for 0 to 24 hours in FACS, it was analyzed by FACS. Dimerization is EGF Peaked after 2 to 4 hours, and then decreased (FIG. 8). Increase rate of dimerization And subsequent reduction in dimerization varied from experiment to experiment, but the overall pattern Is consistent and observed in the original population of uncloned cells Was done. In contrast, chimeras on the cell surface by immunofluorescence using FACS Measurement of sceptor levels is measured over a period of time when dimerization is significantly reduced. It was shown that the amount of chimeric receptor on the surface remained essentially constant (FIG. 8, Broken line). Reduced dimerization may be due to a lack of EGF from the medium or receptor dimer It was concluded that this was due to any of the inhibitions of the transformation.   Feedback regulation of EGF receptor dimerization: duration of dimerization decline The response to the second EGF treatment is minimal, Despite the continued presence of the receptor, cells may It suggested that it is resistant to mermerization. By contrast, after EGF treatment, cells were Incubation for several hours in medium lacking Could be restimulated. This indicates that the continued presence of EGF in the medium It has been shown that the dimerization of Puter is the basis for continued inhibition. this For their results, signalin via the endogenous wild-type EGF receptor in cells It is possible to explain that DNA inhibits chimera receptor dimerization. This temporary A test of the theory is a very specific inhibitor of the EGF receptor tyrosine kinase. This was possible using the bitter, AG1478. Levitzki et al. (1995) Science 267 : 1782-1788.   Therefore, after treating cells expressing the chimeric receptor with EGF overnight, EGF or Was re-treated with tyrphostin. As shown in Figure 9A (left panel) Sample I received one overnight treatment with 100 ng / ml EGF. Samples II and III After overnight treatment with EGF, the cells were treated with 100 ng / ml EGF for 2 hours (sample II) or 100 nM Retreated with lophostin AG1478 for 2 hours (sample III). Sample IV with 100ng / ml EGF once For 2 hours, and sample V did not. The results (Figure 9A, right panel) Treatment of cells with tyrphostin led to increased dimerization and Generates dimerization levels comparable to the peak levels observed after one 2 hour treatment EGF receptor tyrosine kinase activity Indicates that it is involved in inhibition. Tyrphostin treatment also affected unstimulated cells. Treatment of the cells with EGF caused an increase in the amount of β-gal activity observed. cell With EGF and tyrphostin or EGF alone for a period ranging from 0 to 24 hours. Processed. Cells receiving both tyrphostin and EGF are treated for up to 6 hours Over time, cells showed greater β-gal activity than cells that received only EGF (FIG.9B) . By 8 hours of treatment, EGF-treated cells and EGF + tyrphostin-treated cells There was no difference in receptor dimerization. Repeat tyrphostin every 4 hours Administration did not further prolong the increase in β-gal activity.   These results indicate that receptor tyrosine kinase inhibition It can be shown that the feedback inhibition can be reduced. Protein kinase C phosphorylation Activates EGF by phosphorylating receptors at sites within the cytoplasmic domain. May decrease the receptor binding affinity for However, as discussed herein The chimeric receptor used in the experiments described below has a known site of PKC phosphorylation. Due to the deletion, the inhibition of dimerization observed at this receptor is It must be mediated through the extracellular or transmembrane region of the puter.   These results also demonstrate that EG in living cells using the methods and compositions of the present invention. It demonstrates that it is possible to monitor F receptor dimerization. Further The result is that receptor kinase activity regulates dimerization, It shows that it is involved in the first process after ligand binding in transmission. About 1 minute Later, dimerization following treatment of the cells with EGF was measurable, indicating that β-ga l Complementation can monitor the rapid production of newly formed protein dimers. Indicates that is possible. EGF binding, receptor internalization, Previous data on substrate and substrate phosphorylation also indicate that the receptor To respond within Felder et al. Cell. Biol. 117: 203-212; And Kiyokawa et al. (1997) J. Am. Biol. Chem. 272: 18656-18665. Receptor dimer Chimera receptor remains on the cell surface, even though the transformation decreases after several hours And refractory to further dimerization in response to EGF. But intrinsic Inhibition of the sex receptor tyrosine kinase allows for further dimerization. Les Inhibition of scepter dimerization was achieved by tyrphostin in the first treatment with EGF. Observed in observations including increased dimerization beyond levels observed in Germany As such, it begins shortly after receptor activation.   Kinetics of complementarity reflect association kinetics of binding partners EGF receptor dye Reduced merification is due to β-gal complementation to monitor FRAP and FKBP12 interactions In contrast to observations that use gender. See Examples 1, 2 and 10, supra; See also Rossi et al. (1997), supra. Rapamycin between FRAP and FKBP12 Using β-gal complementation to detect mediated interactions, the addition of rapamycin The earliest time point later showed the most delayed increase in β-gal activity, but β-gal Activity continued to increase for at least 20 hours. This leads to the formation of an active β-gal complex Due to the stabilization of the chimeric protein interaction. But the EGF receptor In dimerization, the most rapid increase in β-gal activity was observed after addition of EGF to the medium. Observed at earliest time point, however, β-gal activity after 2-4 hours Fell. The difference between these results is due to the observed die for β-gal complementation. Mermerization kinetics is not merely a reflection of β-gal complementation kinetics or stabilization, but at least Shows to some extent reflects the interaction kinetics of the non-β-gal portion of the chimeric protein You. This result also indicates that β-gal complementation was not Indicates that the node can be monitored.   Comparison with conventional methods Receptor dimerization typically involves chemical crosslinking and And immunopurification followed by in vitro methods such as gel electrophoresis Came. (1987) Biochemistry 26: 1443-1451. Now, EGF receptor Immersion is also associated with fluorescence resonance energy transfer. fer) (FRET). Gadella et al. (1995) supra. Fluorescein And rhodamine-labeled EGF are added to the cells and the dimerization of the receptor is observed microscopically. It was measured. Incubation at low temperatures and fixation of the cells will allow for receptor Necessary to prevent internalization, do not The problem was avoided in this experiment by using a new mutant receptor. FRET Also used to study the interaction of fluorescently labeled molecules in cells or cell membranes But labeling and introducing these molecules at sufficiently high concentrations is cumbersome there is a possibility. Green for FRET analysis on genetically expressed proteins It has recently been shown that fluorescent proteins can be modified and used. Miyawaki et al. (19 97) Nature 388: 882-887. GFP signal, however, when using β-gal Cannot be amplified enzymatically as in   Therefore, β-gal complementation can be used to monitor receptor dimerization in living cells. To provide a quick way for. The method binds multiple receptors and High for pharmacological agents that can act as either It can be used for throughput screening. With only the join data Cannot tell whether the drug elicits a response; By analysis, identification of the response includes in vitro analysis after cell disruption. β-gal complement Gender is also new in regulating signaling pathways in the case of membrane receptors. Novel dimers in mammalian "two-hybrid" assays can provide insight Enables screening of computerized partners.   The foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity of understanding. However, it will be apparent to those skilled in the art that certain changes and modifications may be made. It is white. Therefore, the above description and examples should not be construed as limiting the scope of the invention. You should not be excused.

────────────────────────────────────────────────── ─── Continuation of front page    (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, I T, LU, MC, NL, PT, SE), CA, JP (72) Inventor Rossi, Fabio             United States California 94025,             Menlo Park, Roble Avenue             Number 3 743 (72) Inventor Moller, William             United States Wisconsin 53705,             Madison, Stevens Street               2653

Claims (1)

[Claims] 1. A reporter component,   A first low affinity reporter subunit coupled to a first putative binding moiety Including   Wherein the first low affinity reporter subunit comprises at least a second low parental reporter subunit. An associated reporter subunit can produce a detectable signal, wherein the association is A reporter system component mediated by the first putative binding moiety. 2. 2. The reporter of claim 1, wherein said first putative binding moiety is a protein. System components. 3. The protein is a member of a signaling cascade, a cell surface receptor ー, proteins that regulate apoptosis, proteins that regulate cell cycle progression , Proteins involved in tumor development, transcription regulatory proteins, translation regulatory proteins , Proteins that affect cell interactions, cell adhesion molecules, ligand-receptors Proteins that are members of pairs, proteins involved in the folding of other proteins And proteins involved in targeting to intracellular compartments 3. The reporter component of claim 2, wherein 4. A reporter system, comprising the reporter system component of claim 1, and Less than a first putative binding moiety coupled to a second putative binding partner A reporter system, further comprising a second low affinity reporter subunit. 5. The mutual binding affinities of the putative binding moieties are determined by the first reporter subunit. Greater than the binding affinity of the second reporter subunit and the second reporter subunit, A reporter system according to claim 4. 6. 6. The method of claim 5, wherein the generation of the signal is dependent on binding of the putative binding moiety. Reporter system. 7. Wherein the first putative binding moiety and the second putative binding moiety are proteins. The reporter system according to claim 4. 8. The protein is a member of a signaling cascade, a cell surface receptor ー, proteins that regulate apoptosis, proteins that regulate cell cycle progression , Proteins involved in tumor development, transcription regulatory proteins, translation regulatory proteins , Proteins that affect cell interactions, cell adhesion molecules, ligand-receptors Proteins that are members of pairs, proteins involved in the folding of other proteins And proteins involved in targeting to intracellular compartments The reporter system of claim 7, wherein 9. Wherein the first reporter subunit and the second reporter subunit are , Each comprise a protein, and the proteins associate to catalyze the reaction and 8. The reporter system according to claim 7, which is capable of producing a releasable signal. 10. The associated reporter subunit catalyzes a reaction, wherein the detectable 10. A reporter according to claim 9 which produces a product that can be directly detected as a strong signal. -System. 11. The first subunit and the second subunit are capable of hydrolyzing enzymes. 8. The reporter system according to claim 7, which is an affinity binding mutant subunit. 12. Wherein said first and second subunits have a low affinity for β-galactosidase 12. The reporter system according to claim 11, which is a binding mutant subunit. 13. The component comprising the low affinity reporter subunit and the first putative 2. The reporter system component of claim 1, comprising a fusion protein comprising a binding moiety. 14． The low-affinity reporter subunit comprises a low-affinity β-galactosidase. 14. The reporter system component according to claim 13, comprising a sex binding mutant subunit. 15. A nucleic acid encoding the fusion protein of claim 13. 16. Further comprising a regulatory sequence that provides for expression of the putative binding protein. 16. The nucleic acid according to 15. 17． A viral vector comprising the nucleic acid according to claim 15. 18. A cell transformed with the nucleic acid of claim 15. 19. A nucleic acid encoding a reporter system component according to claim 13, and at least A cell transformed with a nucleic acid encoding a second said reporter system component. 20. Wherein said fusion protein comprises said reporter subunit and said putative binding moiety 15. The reporter of claim 14, further comprising an additional protein sequence between System components. 21. Determining the occurrence of a bond between the first putative bond and the second putative bond The method comprises the following steps:   a) providing a reporter system comprising:     A first low affinity reporter sub-coupled to the first putative binding moiety A first component comprising a unit, and     A second low affinity reporter subcoupled to the second putative binding moiety A second component comprising a unit;   Wherein the first low affinity reporter subunit comprises at least the second low affinity reporter subunit. Can associate with an affinity reporter subunit to produce a detectable signal; Is mediated by the binding of the first putative binding moiety to the second putative binding moiety, Process;   b) combining the first component with the second component;   c) a step of detecting the presence or absence of the signal A method comprising: 22. The binding affinity of the putative binding moieties with each other is determined by the first reporter subunit. Greater than the binding affinity of the first reporter and the second reporter subunit 22. The method of claim 21. 23. The first putative binding moiety and the second putative binding moiety are proteins; A method according to claim 21. 24. The protein is a member of the signaling cascade, the cell surface receptor Proteins that regulate apoptosis, proteins that regulate cell cycle progression Quality, proteins involved in tumor development, transcription regulatory proteins, translation regulatory proteins Quality, proteins affecting cell interactions, cell adhesion molecules, ligand-receptors Proteins that are members of a protein pair, proteins involved in the folding of other proteins Select from the group consisting of proteins and proteins involved in targeting to intracellular compartments 24. The method of claim 23, wherein the method is performed. 25. The first reporter subunit and the second reporter subunit Each comprise a protein, and the proteins associate and catalyze the reaction, 22. The method of claim 21, which is capable of producing a detectable signal. 26. The associated reporter subunit catalyzes a reaction, wherein the detectable 26. The method of claim 25, wherein the method produces a product that can be directly detected as a strong signal. 27. The first subunit and the second subunit are β-galactosida 27. The method of claim 26, wherein the subunit is a low affinity binding mutant subunit. 28. Each of the first component and the second component comprises a fusion protein; A method according to claim 21. 29. The low-affinity reporter subunit comprises a low-affinity β-galactosidase. 29. The method of claim 28, comprising a sex binding mutant subunit. 30. Step (a) comprises forming cells with one or more nucleic acids encoding the fusion protein. 29. The method of claim 28, comprising transmuting. 31. 4. The method of claim 3, wherein step (c) comprises detecting the signal in the cell. The method according to 0. 32. The one or more nucleic acids encoding the fusion protein are linked to the putative binding tag. 31. The method of claim 30, further comprising a sequence that regulates protein expression. 33. The fusion protein is encoded by a viral vector. The method of claim 30. 34. Wherein said fusion protein comprises said reporter subunit and said putative binding moiety 29. The method of claim 28, further comprising a protein sequence between 35. 22. The method of claim 21, wherein the degree of binding is quantified. 36. The method comprises the steps of: coupling the first coupling portion to the second coupling portion; Further comprising the step of detecting the effect of the third portion, wherein the method further comprises the step of: Later and before step (b), the step of combining the reporter system with the third part 22. The method of claim 21, further comprising: 37. The method further comprises determining the potential agonist activity or antagonism of the third part. 37. The method of claim 36, further comprising determining a strike activity. 38. 32. The method of claim 31, wherein the subcellular localization of the signal is determined. 39. Step (b) comprises combining the first component and the second component in the presence of a substance. To determine the effect of the substance on the binding between the first binding portion and the second binding portion. 22. The method of claim 21, comprising determining. 40. The substance is a putative binding inhibitor of a binding moiety having a predetermined binding affinity Here, the absence of the signal in step (c) means that the substance is bound. 40. The method of claim 39, wherein the method provides an indication that the inhibitor is a combination inhibitor. 41. Said substances have low or substantially binding affinity to each other Is a putative promoter for binding between the binding moieties having no, where in step (c) The presence of the signal in the above means that the substance promotes the binding of the binding moiety. 40. The method of claim 39, wherein the method provides an indication of the status of a user. 42. The first reporter subunit and the second reporter subunit And the first and second binding moieties are each a protein Is;   Wherein the components provided in step (a) are each And a fusion protein comprising the binding moiety;   Here, step (b) comprises the steps of: combining a nucleic acid sequence encoding the first component and the second component; In a cell that is thought to contain the substance that inhibits or promotes the binding of the binding moiety. Expressing; and   Here, step (c) is the presence of the signal in the cell or a lysate of the cell. Or detecting the absence, thereby inhibiting the binding or binding between the binding moieties or Determines the presence or absence of the substance acting as a promoter in the cell 40. The method of claim 39, comprising: 43. Such substances may be proteins, lipids, carbohydrates, nucleic acids, and small molecule drugs. 40. The method of claim 39, wherein the method is selected from the group consisting of: 44. Binding the first binding moiety to members of a plurality of different second putative binding moieties. A method of screening, comprising the following steps:   a) providing a plurality of reporter systems, each of which comprises: under:     A first low affinity reporter subunit coupled to the first binding moiety; A first component comprising:     A second component of one of the plurality, wherein each of the second components is Second low affinity reporter coupled to one of the second putative binding moieties Subunits, wherein in each of the second components the second putative joint The minutes are different, the ingredients; Wherein the first low affinity reporter subunit comprises the second low affinity reporter subunit. The first binding site and the different second putative in association with a sex reporter subunit Binding to one of the binding moieties can produce a detectable signal;   b) combining the first component with each of the plurality of second components individually to form a plurality of binding members; Generating an assay sample, wherein each of said plurality of binding assay samples Comprises the first component and a different one of the second components; and   c) detecting the presence or absence of the signal in each of the binding assay samples Outgoing process A method comprising: 45. The first component and the second component are respectively the binding moiety and the 45. The method of claim 44, comprising a fusion protein comprising a reporter subunit. . 46. In step (b), the component is expressed from a nucleic acid sequence introduced into a cell. 46. The method of claim 45, wherein 47. The plurality of second putative binding moieties are linked by members of the cDNA library. 47. The method of claim 46, wherein the method is loaded. 48. 48. The method of claim 47, wherein said cells are eukaryotic cells. 49. 49. The method of claim 48, wherein said cells are mammalian cells. 50. 50. The method of claim 49, wherein said cells are human cells. 51. 45. The method of claim 44, wherein in step (c) the signal is quantified. . 52. A connection between the first connection portion and a second putative connection portion of one of the plurality; 45. The method of claim 44, wherein cells that have undergone conjugation are separated from cells that have not had said conjugation. The method described. 53. 53. The method of claim 52, wherein the separation is by fluorescence activated cell sorting. 54. The first binding moiety is a cell surface receptor, a transcription regulatory protein, a translation Regulatory proteins, replication proteins, splicing proteins, signal transduction Proteins, cell-cell adhesion molecules, cell-substratum adhesion molecules, cell cycle proteins, cancer Gene products, tumor suppressor proteins, membrane receptors, tans that regulate apoptosis Proteins, developmental regulatory proteins, proteins that affect cell interactions, and other proteins. Proteins involved in protein folding, proteins involved in targeting to intracellular compartments Selected from the group consisting of proteins, viral proteins, and cytoskeletal proteins 45. The method of claim 44, wherein said method is selected. 55. The method according to claim 39, wherein the substance is a peptide, a drug, or a synthetic analog. The described method. 56. The first putative binding moiety and the second putative binding partner are the same 5. The reporter system according to claim 4, comprising a child. 57. A method for determining the occurrence of an association between a first part and a second part, said method comprising: The following steps:   a) providing a reporter system, wherein the reporter system comprises:     A first low affinity reporter subunit coupled to the first portion; A first component comprising:     Second low affinity reporter subunit coupled to the second portion A second component comprising Including;   Wherein the first low affinity reporter subunit comprises at least the second low affinity reporter subunit. Can associate with an affinity reporter subunit to produce a detectable signal; Is mediated by an association between the first part and the second part;   Here, the association between the first part and the second part is mediated by a third part. The process;   b) combining the first component, the second component, and the third component; To   c) a step of detecting the presence or absence of the signal A method comprising: 58. The association between the first portion and the second portion includes a plurality of further portions; 58. The method of claim 57, mediated by minutes. 59. The low affinity reporter subunit comprises an enzyme and an inhibitor of the enzyme. The reporter system according to claim 1, comprising: 60. The substance influences the binding between the first binding portion and the second binding portion. 40. The method of claim 39, wherein the upstream event directly or indirectly effects the resulting upstream event. Method.