JP2001518291A - Transgenic model containing TCR alpha and beta chains - Google Patents

Abstract

SUMMARY OF THE INVENTION The present invention relates to one or a limited number of transplanted antigens, including at least one transplanted antigen capable of rejecting tissue transplants containing transplanted antigens and, if applicable, other selected antigens. Genetically modified non-human mammals having a population of CD4-positive T cells specific for the selected antigen. The genetically modified mammal according to the present invention has a T cell receptor gene that encodes a T cell receptor specific for a transplantation antigen. Genetically modified mammals are particularly useful for studying mechanisms of tolerance or rejection to tissue grafts, and immune tolerance in pregnancy. The animals are also useful for testing agents for biological activity that promotes or reduces immune tolerance.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention has limited T cells that can increase immune responsiveness to only one or a limited number of antigens and can tolerize one or more antigens. It relates to a genetically modified non-human mammal. The present invention also relates to a method of testing a biologically active compound using such a genetically modified mammal.

[0002] Immune tolerance is a state of non-responsiveness of the immune system specific for a particular antigen. An important aspect of tolerance is self-tolerance, a self-antigen presented against it on normal tissue and a potential risk situation, such as a non-self Responsive. It is generally supported that the immune system is non-reactive with self-antigens but retains a broad repertoire of receptors sufficient to recognize any non-self antigens presented to it. (Central tolerance: c
central tolerance). It is also generally accepted that there must be some failure-safety mechanisms that operate to minimize the effects of any mistakes that may lead to self-reactivity (peripheral tolerance: periphe
ral tolerance). A possible mechanism for tolerance, particularly peripheral tolerance, is described by Cobold et al. 1996 Immunol. Rev .. 149
: 5-33.

[0003] Tolerance is evident in therapies that require the introduction of foreign antigens into the body, such as tissue transplantation and vaccination, and in diseases characterized by immunosuppression, such as AIDS, and in self-tolerance that results in autoimmune diseases. It is a practically important problem in diseases characterized by weakness. However, techniques for studying tolerance or investigating the effect of drug compounds on tolerance have hitherto been limited.

[0004] Until relatively recently, neonatal tolerance induction was the first technique for experimental studies of tolerance. Specific tolerance to the grafted skin was induced in mice by neonatal injection of spleen cells from different lines. The resulting mice were tolerant of skin grafts from the donor strain. Proceeding from a neonatal challenge model, transgenic methods for introducing foreign transgenes into mice have enabled the study of specific antigens in a defined genetic background that are processed as self by the immune system.

[0005] Techniques for inducing tolerance in the mature adult immune system have also been developed. Mouse CD
Monoclonal antibodies to the 4 and CD8 antigens are powerful tools for tolerating a variety of different antigens in adult mice. Clearing of CD4 or CD8 T cells is not required; blocking with either the (Fab ¹ ) ₂ fragment or the non-clearing isotype of anti-CD4 or anti-CD8 antibodies is particularly effective. CD4 and CD8
Antibody combinations can be used for prolonged periods that have been found to be necessary to induce tolerance in some of the more difficult skin graft systems (Cobbol).
d et al, 1990 Eur. J. Immunol. 20: 2747-2
755).

[0006] The discovery that tolerance could be induced in organs transplanted between non-depleted CD4 and CD8 antibodies given together was a major breakthrough (eg, Cob
bold et al. 1990). Since skin grafts can be used both as tolerogens and late-stage challenge, the system provides a consistent read-out for in vivo rejection / tolerance independent of developing a hypothesis about effector cells or antigens, Required for measurement. The main advantage of this approach over the benefits of neonatal tolerance induction or the introduction of foreign transgenes is that events that occur without the thymus (by removing it) and without other exposure to antigens during differentiation of the immune system It is possible to focus. This allows for more precise control of the timing of tolerance induction and antigen challenge. By using different organs as grafts, there is also a wide choice of how antigens are presented for tolerance.

However, due to the complexity of the immune system and immune response, there is a limited amount of specific information that can be obtained in relation to rejection and tolerance mechanisms in all of the techniques described.

It is therefore an object of the present invention to provide a simplified system for monitoring immune responsiveness and / or tolerance to a particular antigen or a limited number of antigens.

Another object of the present invention is to provide a system for testing the effect of a treatment on immune responsiveness and / or tolerance to a particular antigen or a limited number of antigens.

[0010] Surprisingly, it has been found that mice having only CD4-positive T cells, all of which have a single T cell receptor specific for the same transplantation antigen, can reject skin grafts. Previously, the role of CD4 + T cells in graft rejection was primarily to provide T cell support, either to render CD8 + T cells cytotoxic or to allow B cells to make antibodies. It was thought that there was. That is, a CD8-positive T cell receptor transgenic mouse was created (Hamme).
ling et al. 1993 Immunol. Rev .. 133: 93-
104). Furthermore, if such CD4 T cell receptor "monoclonal" mice were found to reject the graft, they would not be expected to be able to tolerize the transplantation antigen. Previously, it was often hypothesized that tolerance worked either by eliminating certain T cells (clonal elimination) or by triggering another population of suppressor cells. In fact, tolerance can be effectively induced by treatment with a non-depleting anti-CD4 antibody.

[0011] In one aspect, the invention provides genetically modified populations of CD4-positive T cells that are specific for one or a limited number of selected antigens, including at least one transplantation antigen. Provided a non-human mammal, wherein the mammal is capable of immune response to a transplantation antigen and is tolerized to the transplantation antigen.

[0012] Preferably, the genetically modified animal according to the present invention is capable of rejecting tissue transplants containing transplantation antigens and, if applicable, other selected antigens.

The genetically modified animal according to the present invention has a T cell receptor gene that encodes a T cell receptor specific for a transplantation antigen. The T cell receptor gene will generally be stably integrated into its genome. Most T cell receptors are organized in α and β chains encoded by another gene. T used in the present invention
Cell receptor genes are derived, for example, from cloned α and β chain genes for T cell receptors specific for transplantation antigens, or synthesized and prepared using sequence information from the cloned genes. It may be derived from a chain gene. In another alternative, the genes are derived from α and β chain genes for T cell receptors that are not necessarily specific for transplantation antigens. In that case, the well-known method,
The gene sequence may be altered to achieve the specificity of the transplant antigen, for example, by using site-directed mutagenesis.

Preferably, the genetically modified animal according to the present invention lacks a normal population of CD8 positive T cells, or B cells, or both. More preferably, the animal does not have functional CD8 positive T cells or B cells. The absence of lymphocytes other than CD4-positive T cells provides a simpler system for studying the activity of the immune system for selected transplantation antigens.

[0015] The absence of CD8 positive T cells and B cells was the result of animals having a deficiency in lymphocyte receptor recombination such that the CD8 T cell receptor or B cell receptor (antibody) was not expressed. May be. For example, RAG-1 and / or RA
Mice deficient in the activity of G-2 (recombinase activating genes Nos. 1 and / or 2) are unable to initiate VDJ recombination within the lymphocyte receptor gene and thus have mature lymphocytes Cannot generate sphere. RAG mutations are therefore used in the present invention to make functional lymphocytes other than specific CD4 lymphocytes directed against transplantation antigens (and specific CD4 lymphocytes directed to any other selected antigen) Can be eliminated. RAG-1 ^{− / −} mice are described in Alt et al. 1992 Ann. N. Y. Acad. Sci. 651: 277
-294 and Mombaerts et al. 1992 Cell 68 (
5): 869-77.

CD4 specific for transplantation antigen (or other selected antigen, if applicable)
The population of positive T cells is generally the majority of the complete CD4 positive T cell population of the animal,
For example, 50-60% or more of CD4 positive T cells will be formed.
In the case of recombination deficiency, such as RAG-deficiency, all functional CD4-positive T cells will be specific for the transplantation antigen (or other selected antigen).

The transplantation antigen to which CD4-positive T cells are directed is not expressed by the animal itself,
Or any transplantation antigen that is not expressed by the animal in a form recognizable by CD4-positive T cells. A transplant antigen is defined as a tissue antigen that can be introduced into the body in a tissue transplant in a manner that is recognized by the immune system. Tissue antigens are antigens found on body tissues and organs. Tissue implants for the purposes of the present invention include a fetus in the environment of the mother.

In a particular species, there are characteristic transplantation antigens, each of which may be present in any given individual of that species, or in any given group of individuals, such as a strain, or You may be absent. The transplantation antigen may occur in a variety of different forms so that it can be recognized as foreign between different individuals or between different groups of individuals within a species. The transplantation antigen may be a major transplantation antigen, such as a major histocompatibility complex (MHC) antigen, or a minor transplantation antigen, such as a mouse male transplantation antigen H-
Y, mouse β ₂ -microglobulin antigen H-1, or mitochondrial antigen.

For certain transplantation antigens, especially some of the minor transplantation antigens, CD4 + T cells specific for a single antigen may not be sufficient to reject tissue grafts. In the case of these minor transplantation antigens, additional CD4-positive T cells with specificity for one or a few additional antigens are provided, for example by stable integration of additional specific T cell receptors (TCRs) into the animal. . Mouse male transplantation antigen H-
Y is conveniently an example of a minor transplant antigen sufficient on its own for graft rejection in animals with only HY antigen-specific TCRs.

In another aspect, the invention provides a method of screening for a biologically active compound, the method comprising administering the compound to a genetically modified non-human mammal as described above and transplanting the compound Observing the effect of the compound on the ability of the mammal to reject or retain a transplant containing the antigen.

In the case of a single male / female transplant antigen, for example a male HY antigen, the method according to the invention uses graft tissue from a female recipient mouse and a cogenic male donor mouse. be able to. If no male or female gene is used, the recipient and donor animals are preferably from strains of similar genotype, and the donor strain is transgenic for the transplantation antigen. this is,
This means that the system is as simple as possible, the only antigenic difference between donor and recipient being the transplantation antigen (and other selected antigens if applicable).

The present invention relates to the use of conventional immunology during the transplantation or during tolerance induction or maintenance, and even during and after gestation, of any particular change in the T cell population, such as activation markers or cytokine production. Enable to be monitored by technology. The so-called "Toleramouse" is an ideal tool for investigating the mechanisms of immunosuppression and tolerance induction. Previously, if the frequency of T cells for any single antigen was too low for direct observation using simple immunization techniques such as immunofluorescent or cytokine staining assays, such experiments would be routine syngeneic. It had to be performed in either breeders or similar genotype mice.

Studies of tolerance mechanisms in pregnancy may be performed on pregnant animals, particularly pregnant animals described herein near or after the end of gestation. Particularly useful are pregnant females having one or more male fetuses presenting a male transplant antigen, wherein the pregnant female has TCRs for the male transplant antigen. Pregnant animals with male and female fetuses can be compared. Useful studies include looking at T cell markers, including T cell populations and cytokine profiles.

The present invention relates to i) a tolerogenic or immunosuppressive (adverse) effect that is required or not required; ii) a therapeutic agent once it has been established or a suitable therapeutic agent such as a CD4 monoclonal It will be particularly useful for testing potential or existing therapeutic agents for interference with any tolerance process during induction of tolerance by antibodies.

More particularly, the present invention provides: i) a tolerizing effect on CD4 monoclonal antibodies in the same manner;
ii) does not interfere with tolerogenic drugs; iii) enhances immune responsiveness in diseases characterized by immunosuppression, such as AIDS and cancer; iv) screens for agents that interact with other drugs or vaccines in the desired manner. May be used for:

The present invention is now further described in the following examples, which are not intended to limit the scope of the invention in any manner.

EXAMPLES Example 1- Method for Construction of Transgenic Mice Mice: CBA / Ca (Harlan / Olac, UK) mice are bred under specific pathogen-free conditions and all experimental mice are Sir William Dance School Obpathology (Sir William Dunn School of Path)
, Oxford Animal Facility, held in a filtration cage system (Maximizer, Thorens Caching Inc., Haze).
lton PA, USA). RAG-1 ^{− / −} mice bred on an H-2 ^k background were transformed with Dr. B. Stockinger (NIMR, London, UK). Generation of A1 (M) Transgenic Mice To generate transgenic mice, we used TCRsα and β chains from A1 CD4 + T cell clones isolated from CBA / Ca mice (Tonomari et al. Cell Immunol. 96: 147-
62). The A1 clone, in the context of H2-E ^k, the present but female male recognizes the absence of minor histocompatibility antigen H-Y. TCR expression was identified using primers specific for the Vα and Vβ gene families (Ca
sanova et al. 1991. J. Exp. Med. 174 (6): 1
371-83), cloned and sequenced to check for productive rearrangements. The α chain is encoded by LVα10-Jα30-Cα (
EMBL accession number AJ000157), and the β chain is LVβ5.1-Vβ8.2.
-Dβ2-Jβ2.3-β2 (EMBL accession number AJ000
158) (FIG. 1). EcoRI-Ec containing productively rearranged α or β chains
The oRI fragment was generated by RT-PCR. Oligonucleotides used for α chain amplification were: GCGAATCACAAGCACCATGAAGAGGCTG [SEQ ID NO: 1] and GCGAATTCCAGAC CTCAACTGGACCACAG [SEQ ID NO: 2]. The oligonucleotide used for the amplification of the β-strand was: GCGA
ATTCAGAGGAAGCATGTCTAACACT [SEQ ID NO: 3] and G
CGAATTCAGGATGCATAAAAGT TTGTCTCAGG [SEQ ID NO: 4]. The full-length cDNA was converted to human CD2 in pBluescript.
Cloned into minigene (VA). The SalI-XbaI fragment was converted to CBA / Ca
Used for microinjection into oocytes. Transgenic A
The 1 (M) founder was maintained on a CBA / Ca background and propagated homozygously. Southern blot analysis showed that the A1 (M) line had a single copy per haplotype for each of the transgenic Vα and Vβ chains. Skin Grafting A small piece of approximately 0.5 cm ² of tail skin was removed as previously described (Cobbold and Waldmann 1986, Transplantation).
41: 634-639; and Qin et al. 1990. Eur. J.
Immunol. 20: 2737-2745), and grafted onto the outer chest wall of anesthetized recipient mice. If two grafts were given at the same time, they were placed side by side on a similarly prepared graft bed. Plaster casts were removed on day 7 and the grafts were observed daily and rejection was defined as the day when no viable graft tissue was observed. The statistical significance is the LogRank method (Peto
et al. 1977. Br. J. Cancer 35: 1-39). All methods are UK Home Office Animal (scientific method) Act of 1
986. Immunofluorescence analysis and antibodies Thymus, spleen and lymphoma were removed and red blood cells were lysed by isotonic shock. Cells were 0.1% (w / v) NaN ₃ , 1% (w / v) bovine serum albumin (BSA), and 5% (v / v) heat-inactivated normal rabbit serum (HINRS: F).
(to block the c receptor) at 4 ° C. in phosphate buffered saline (PBS). The antibodies used were: CD3ε (KT3-FITC), Vβ8 (KJ
16-FITC), Vβ8.2 (F23.2-FITC), CD4-PE (Sigma P2942), CD8α-QR (Sigma R3762), B220-QR (
Sigma R4262), CD25 (PC61-biotin), CD44-QR (Sigma R5638), SA-APC (Pharmingen 13049A), and FITC goat anti-mouse IgG (Sigma F0257). After labeling and washing, cells were fixed in 1% formalin and stored at 4 ° C. in the dark. Four color analysis was performed using a FACSort (Becton Dickinson, Oxford, UK) using dual laser (488 nm and 633 nm) excitation and CellQ.
Performed with data capture and cross-beam color compensation using west3.1 software. At least 50,000 events were saved in list mode for further analysis and gating on forward and side scatter.

[0028] Cytoplasmic cytokine staining was performed using phenol red-free RPMI.
50 ng / ml PMA (Sigma P8) in 1640 medium + 10% fetal bovine serum
139) +500 ng / ml ionomycin (Sigma I0634)
2 hours stimulation and 10 ng / ml Brefeldin A (Sigma B7651)
Was performed using spleen cells fed for an additional 2 hours (Ferrick et al.
 al. 1995. Nature 373: 255-257). After washing, remove cells
Fix in 2% v / v formaldehyde in PBS (20 min, 4 ° C) and wash
And infiltrated with PBS + 0.5% saponin (Sigma S-2149).
Add the following antibody conjugate in Saponin buffer for 30 minutes at 4 ° C
And then a rough wash with saponin buffer, then PBS + 0.1% aza
Washed with Id + 1% BSA, + 5% HINRS: anti-IL-2 (S4B6-F
ITC); Pharmingen 18004A), anti-IL4 (11B11-FITC)
Pharmingen 18194A), anti-IFN-γ (XMG1.2-FITC;
Pharmingen 18114A). Cells are antibodies against surface CD4 and CD44
And labeled in 1% formalin and FACSort
Analyzed as above above. Stimulation, staining and analysis conditions were normal CBA /
Ca CD4⁺Conditions were such that spleen cells were essentially negative for all cytokine cells. Treatment with CD4 monoclonal antibody Non-erased rat IgG2a anti-mouse CD4 (YTS 177.9 Qin et
 al. 1990) is a hybridoma in a hollow fiber bioreactor.
By growing and precipitating with 50% saturated ammonium sulfate.
Purified under sterile, low endotoxin conditions. (These are known to those skilled in the art.
This is a well-known standard technology. Examples of technologies can be found at http: //www/molbiol.ox.ac.uk/www/pa
Also available at thology / tig / mprod.html. ) Grafted A1 (M) ×
RAG^-/-Mice received 5 x 1 mg intraperitoneally for two weeks from the day of grafting.Results and discussion H-Y + H2-E^kOf thymus, spleen, and lymphoma from A1 (M) mice by three-color immunofluorescence
By analysis, the expression of the transgenic TCR predicts the T cell repertoire.
It was determined whether the measured functional modification was passed. The thymus of female A1 (M) mice
CD8⁺CD4^-Rather than CD4⁺CD8^-Have a strong bias toward the generation of
And increased positive selection of MHC-II restricted anti-HY TCR
Was as expected from This is because CD4 / C in peripheral lymphoid organs
D8 ratio exceeding 10: 1 and more than 90% CD3⁺Led to expression of the Vβ8.2 transgenic receptor on cells. In contrast, male A1 (M
) Mice have similar thymus (average 6 x 10⁶Whole thymus, whereas females are 8 × 10⁷), The mature CD4 / CD8 ratio is close to 1: 1 and with similar expression of Vβ8.2 against non-transgenic CBA / Ca mice, anti-HYY trans
Clonal elimination of transgenic T cells suggests endogenous TCR rearrangement deviations
. These A1 (M) mice were then replaced with RAG-1^-/-Crossbreed with background to express other TCR molecules encoded by endogenous TCR rearrangements
Eliminates all B and T cells, resulting in HY-specific CD4⁺Any ability of T cells to reject male graft skin could be unambiguously identified. Positive selection in females and male A1 (M) × RAG-1^-/-Selection of negatives in mice A1 (M) × RAG^-/-Immunofluorescent staining of mice showed that anti-HYTCR was functional, as a positive selection and CD3⁺CD4⁺CD8^-The thymus was observed only in the female thymus, whereas the male thymus was much smaller and almost CD4.⁺CD 8^-It was confirmed that there were no cells. We have these little CD4⁺CD8^-When observed in detail in cells, we found that male A1 × RAG-1^-/-And RAG-1^-/-We found those present in similar numbers in both controls, and none of them expressed CD3 but almost no CD11c⁺Expressed CD4 rather than T cells that had somewhat deviated from extinction.⁺It is suggested that it may be related to immature dendritic cells (Winkel et al. 1994).
Immunol. Lett. 40: 93-9). Lymphoma staining was CD4⁺It is only CD8⁺Not T cells are female A1 (M) × RAG-1^-/-Existed in
And clone elimination in males⁺The number of cells was determined as RAG-1.^-/-Ma
Were confirmed to have reduced to the numbers observed in the
D3^-CD11c⁺Met). Female A1 (M) x RAG-1^-/-TCR expression in normal CB as measured by CD3 or Vβ8.2 staining
Although lower than in A / Ca mice (about 30% of half fluorescence level), A1
(M) Similar to the founder, which may be characteristic of the CD2 expression system (G.
Stockinger, personal communication). Female A1 (M) x RAG^-/-Rejection of male skin by mice In the first experiment in two laboratories, a total of eight female A1 (M) × R
AG-1^-/-When mice received a single male skin graft, four of them rejected rapidly (within 16 days), and two more eventually rejected in a chronic fashion.
Was. Next, five A1 (M) × RAG-1^-/-Groups of mice were similarly grafted on male and female CBA / Ca skin in the same graft bed. Male graft
All rejected quickly (within 14 days), but the female graft remained completely healthy
(FIG. 2). A second group of five was grafted in a similar manner, but with CD4 function.
It was also treated with a saturating amount of monoclonal antibody that blocks in vivo. these
Rejection was CD4-dependent and male-specific, since all grafts of
It is proved that they were both. As exemplified in Table 1, non-erasable CD4 monochrome
The internal antibody is unlimited (ind) even after the antibody is no longer circulating.
efinity) produces tolerance (ability to receive fresh male skin grafts)
I will. Mechanism of CD4-dependent graft rejection A1 (M) × RAG-1^-/-Mice may be able to act as an effector of graft rejection on CD8⁺Should not have T cells or antibody producing B cells, this would be acceptable to reject two consecutive male grafts,
And two females A1 (M) × RAG grafted with a third male skin 7 days ago
-1^-/-Check by staining spleen cells from mice, for example new CD8 during graft rejection⁺If there were any hypothetical extensions of the population, this should be made visible. However, beyond the background
Eru CD3⁺CD8⁺There was no staining (FIG. 3) and CD25 expression was CD3 ⁺ CD4⁺It was confirmed that it was limited to a subset. Stay below detection level
Some CD8⁺TCR⁺If cells were present, these would be H-2E^kIt would not be able to interact effectively with the presented male antigen;
Should not contribute. Similarly, it may contribute to antibody responsiveness
Surface Ig⁺There were no B cells. Male graft is CD4⁺Tran on T cells
No clear evidence that it was being recognized by the Sgenic Anti-Male TCR
The majority (about 70%) of these are recent memories or recently activated cells
Vesicles (expressing CD44) as well as producing both IFN-γs;
And IL-4 in the laser range (FIG. 3). Interested
In fact, all T cells (CD44⁺And CD44^-) In this cytoplasm
According to the staining, it appears to be expressed IL-2.

Thus, it is clear that transgenic TCR ⁺ CD4 ⁺ T cells in A1 (M) × RAG-1 ^{− / −} are sufficient to reject male skin. The mechanism by which the animal gains tolerance with non-depleted CD4 antibodies is neither depletion nor the conversion of Th1 to Th2 cells. Tolerization may be by direct CD4 ⁺ T cell-mediated cytotoxicity, or indirectly, possibly by cytokine-mediated macrophage assistance or by other antigen-specific cytokine effector cells. Recent data indicating that neither Fas / FasL nor perforin are required for CD4-mediated rejection of different skins of MHC-I (Selvagi et al. 1996 Transplanat).
ation. 62 (12): 1912-5) tends to confirm the later hypothesis. The MHC-I restricted CD8 ⁺ arm of the immune response in normal mice is thus almost independent (Antoniou et al. 1996 Eur. J.
. Immunol. 26 (5): 1094-1020), and the amplification of the MHC-II restricted CD4 ⁺ response we have shown can itself provide all of the necessary T cell functionality for graft rejection . Example 2-A1 (M) × RAG - / - were tested tested various different agents of agents related immunosuppressive or tolerogenic effect in mice. The test method used is as follows and the results are provided in Table 1. a) Female A1 × RAG-1 − / − mice were given intravenously 10 ⁷ male A1 × RAG-1-/ − bone marrow or spleen cells. They were then grafted on male tail skin after an additional 6 weeks to test for tolerance, and without limitation (indefi
(nitely) accepted. Immunofluorescence analysis of peripheral blood and spleen cells showed a substantial deficiency of CD4 + T cells in tolerated mice, but not in non-tolerant controls given female bone marrow or spleen cells. b) In female A1 × RAG-1 − / − mice, 5 × 1 mg or 1 mg in a single injection
Non-erased rat IgG2a anti-mouse CD4 (YTS 177.9 Qin et
al 1990 Eur. J Immunol 20: 2737-2745)
Was given at the time of grafting the skin of the male CBA / Ca tail. Male grafts grafted on these grafts and subsequently on days 42 and 84 were accepted without limitation. Analysis of blood, lymphoma and spleen cells from these mice showed CD4
Th1 and Th2 cells by immunofluorescence staining for cytokines in both tolerant and control mice that proved that the + T cells were not clonally depleted and that did not receive the CD4 antibody but received an equivalent male skin graft Similar ratios could be identified. c) In female A1 × RAG-1 − / − mice, 5 × 1 mg of a monoclonal antibody against CD25 (PC61: Osawa et al. Immunol. le)
tte. 1989 20: 205-12) was given at the time of male CBA / Ca tail skin graft. d) Female A1 × RAG-1 − / − mice were given 5 × 1 mg of a monoclonal antibody against CD40 (MR1: Larsen et al. Transplant).
ation 1996 61: 4-9) was given at the time of male CBA / Ca tail skin grafting. e) Female A1 × RAG-1 − / − mice were given 5 × 1 mg of a monoclonal antibody against CD28 (37.51: Sperling et al. J. Immu).
nol. 1993 151: 6043-50) was given at the time of male CBA / Ca tail skin graft.

[0030]

[Table 1]

Example 3 Construction of A1 (M) × RAG-1 ^{− / −} Mice from Sequence Information Only TCR transgenic mice are constructed using a mouse strain in which it is desired to express the TCR (eg, standard (Olac CBA / Ca strain) is a routine technique for microinjecting DNA encoding the TCR alpha and beta chains appropriate for fertilized eggs from the fertilized egg. The injected eggs are then transferred to a nanny and standard methods for selecting progeny that have stably integrated the DNA into their genome (usually tail D).
Progeny were classified by PCR typing of NA). Further checks are made using standard immunization techniques (staining with antibodies, T cell expansion against antigen, etc.) to confirm that the DNA is expressed as a functional TCR. These A1 (M) transgenic mice were then crossed with RAG-1 ^{− / −} deficient mice (Alt et al. 1992 and Mombaerts et al. 1992), and the progeny were bred to the A1 (M) parent for multiple generations. Backcrosses are selected for progeny that have both the TCR and the RAG1 ^{− / −} gene.

A1 TCR DNA can be made by a number of methods, including:
1) By cloning the mRNAs of the TCR alpha and beta chains as cDNA (standard method) from an original A1 CD4 ⁺ T cell clone, such as the A1 CD4 ⁺ anti-HYY T cell clone. 2) mRNA of TCR alpha and beta chains as cDNA (standard method) A1
By cloning from (M) or A1 (M) × RAG-1 ^{− / −} female mice or CD4 ⁺ anti-HYY T cell clones derived therefrom. 3) By using DNA sequence information to synthesize TCR alpha and beta chain genes. This can be readily achieved by providing a series of overlapping oligonucleotides of convenient length (eg, every 30-50 bases) so that the entire sequence on both strands is included. Simple annealing and ligation then produce full-length double-stranded DNA for each strand. This method requires only the appropriate TCR sequence information (eg, the sequence of FIG. 1) to generate A1 (M) mice using techniques known in the art for generating transgenic mice. 4) Other (relevant) TCR alpha and beta chain genes are mutated (standard methods for site-directed mutagenesis) to produce a known desired sequence (either the complete sequence or the complementarity determining regions (CDRs ), For example, the TCR shown in FIG.
By using DNA sequence information as a gene sequence.

Once the TCR alpha and beta chain genes have been cloned or synthesized, they are ligated into a suitable expression vector or cassette that allows them to be expressed in T cells. Zhumabekov et al. 1995
J. Immunol. The CD2 minigene cassette system described in Methods 185 (1): 133-40 is a suitable expression system.

[Sequence list]

[Brief description of the drawings]

FIG. 1. A1 TCR α and β chains and nucleic acid sequences encoding them.

FIG. 2. Female A1 (M) × RAG-1 ^{− / −} mice show CD4-dependent male skin specific rejection. Female A1 (M) × RAG-1 ^{− / −} mice were implanted with male and female CBA / Ca skin in the same graft bed. The survival plot shows half-life for 14 days (median) compared to female grafts (○; n = 5) that survived for more than 30 days.
male skin rejected by survival time (MST) (●; n = 5)
). The P value for statistical significance was <0.003 (L
ogRank method). The survival of male skin on similarly grafted A1 (M) × RAG-1 ^{− / −} female mice treated with 5 × 1 mg non-depleted CD4 antibody is also shown (closed squares; n = 5; MST> 30 days).

FIG. 3 Rejection A1 (M) × RAG^-/-Phenotypic and functional immunofluorescence analysis of mice. Two female A1 (M) × RAG-1 rejected two consecutive male skin grafts ^-/- Mice received a third graft, and their spleen cells were stained for multiple surface and intracytoplasmic antigens. Four-color immunofluorescence from one mouse
The following shows a typical example of the analysis. All samples are on forward and side scatter
Gated alive, and the dot plot in the top left panel is CD3
9 shows CD4-PE versus CD8α-QR staining of FITC-positive lymphocytes. Top right
Panel shows A1 (M) × RAG− compared to A1 (M) control (dashed histogram).
1^-/-(Filled histogram) shows no B cells expressing surface Ig. Center left panel is A1 (M) × RAG-1^-/-Show staining for CD44-QR of lymphocytes, to gate remaining anti-cytokine strains
Used as a basis (rat IgG1 anti-IFN-γ, middle right; rat IgG
G1 anti-IL-2, lower left; rat IgG1 anti-IL-4, lower right), except that C
D44⁺Cells are shown as filled histograms and CD44^-Cells painted
Shown as an uncollapsed histogram and a negative control histogram (positive
Background staining of isotype-matched rat IgG1 anti-IL4-FITC in normal mice
(Based on color) are indicated by dashed lines.

[Procedure amendment]

[Submission date] December 28, 2000 (2000.12.28)

[Procedure amendment 1]

[Document name to be amended] Drawing

[Correction target item name] All figures

[Correction method] Change

[Correction contents]

FIG.

FIG. 2

FIG. 3

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/50 C12N 15/00 A (72) Inventor Kobold, Steven Paul AX 1.3, UK Oxfordshire, Oxford, South Parks Road, Sir William Dunn School of Pathology (72) Inventor Zelenica, Diana OEX 1.3 RT UK Oxfordshire, Oxford , South Parks Road, Sir William Dunn School of Pathology F-term (reference) 2G045 AA29 AA40 CA01 CA18 CA19 CB01 CB17 DA36 DA77 FB03 FB07 4B024 AA11 BA63 CA04 DA02 GA1 1 HA01 HA12 HA15 4B065 AA91X AB01 AC14 BA02 CA24 CA44 CA46 4H045 AA10 AA30 CA42 DA51 DA86 EA50 FA74

Claims (19)

[Claims] 1. A population of one or a limited number of CD4-positive T cells specific for a selected antigen, including at least one transplantation antigen, capable of immune response to the transplantation antigen; And genetically modified non-human mammals that are tolerant to transplantation antigens. 2. The genetically modified mammal of claim 1, which is capable of rejecting tissue transplants containing transplantation antigens and other selected antigens. 3. The genetically modified mammal according to claim 1, wherein a T cell receptor gene encoding a T cell receptor specific for a transplantation antigen is stably integrated in its genome. 4. The genetically modified mammal according to any one of claims 1 to 3, which lacks a normal population of CD8 positive T cells or B cells or both. 5. The genetically modified mammal according to claim 4, wherein the mammal does not have a functional CD8 positive T cell or B cell. 6. A lymphocyte receptor such that T cell or B cell receptors, other than T cell receptors for a limited number of selected antigens, if present, are not expressed. The genetically modified mammal according to any one of claims 1 to 5, wherein the mammal is defective in recombination. 7. The genetically modified mammal according to claim 1, wherein a gene involved in lymphocyte receptor recombination is inactivated or deleted. 8. The genetically modified mammal according to claim 7, wherein one or both copies of the RAG-1 and / or RAG-2 genes are inactivated or deleted. 9. The genetically modified mammal according to any one of claims 1 to 8, wherein the transplantation antigen is a male or female transplantation antigen. 10. The genetically modified mammal according to claim 9, wherein the transplantation antigen is a male transplantation antigen HY. 11. The genetically modified mammal of claim 10, wherein the T cell receptor specific for HY is encoded by the nucleic acid sequence shown in FIG. 12. A genetically modified mammal according to any one of claims 1 to 11 for use in tolerance studies. 13. The genetically modified mammal according to any one of claims 1 to 12, for use in studies of agent screening. 14. A method of screening for a biologically active compound, comprising:
14. Administering to a genetically modified non-human mammal according to any one of claims 1 to 13 and observing the effect of the compound on the ability of the mammal to reject or retain a transplant comprising a transplant antigen. The above method, comprising: 15. The method of claim 14, further comprising using the biologically active compound identified by the method of claim 14 as an agent that enhances or induces or suppresses tolerance. . 16. A method comprising enhancing or inducing or suppressing tolerance by a biologically active compound identified by the screening method of claim 14. 17. Applying a suitable tissue transplant to a mammal according to any one of claims 1 to 13 under conditions that promote tolerance or rejection, and apply one or more immunological indicators, such as A method of investigating immunological changes in tolerance or rejection, comprising monitoring changes in cytokine levels or T cell activation markers. 18. The method of claim 1, wherein said conditions promote tolerance or rejection of the transplant.
14. A method of studying tolerance or rejection of a transplant, comprising applying a suitable tissue transplant to a mammal according to any one of claims 13 to 13 and evaluating a biological change in said animal. 19. The method of claim 1, wherein the at least one fetus presents the transplantation antigen.
Pregnant female animal according to any one of claims 13 to 13 and monitoring a change in one or more immunological indicators, such as cytokine levels or T cell activation markers, during pregnancy. How to study immune tolerance.