JP2001508291A - Methods for diagnosis and treatment of pathological conditions caused by insufficient ion transport - Google Patents

Abstract

(57) SUMMARY The present invention provides, in part, the role of the human thiazide-sensitive Na-Cl cotransporter, TSC; the human ATP-sensitive K ⁺ channel, ROMK; and the human Na-K-2Cl cotransporter, NKCC2. Abnormal ion transport, especially susceptibility to Bartter syndrome, Gitelman syndrome, hypokalemia alkalosis, hypokalemia alkalosis with hypercalciuria, kidney stones, hypertension, osteoporosis, and diuretic-induced hyperkalemia Based on identifying roles in causing the relevant pathological condition. In particular, the present invention provides the amino acid sequences of several human wild-type and altered variants of the TSC, NKCC2, and ROMK proteins, and their variants that can be used to diagnose disorders of ion transport. Provide the encoding nucleotide sequence.

Description

DETAILED DESCRIPTION OF THE INVENTION Methods for diagnosis and treatment of pathological conditions caused by insufficient ion transport Technical field   The present invention is directed to homozygous and heterozygous gene deficiencies in ion transport, In addition, nucleic acid molecules that cause various forms of Barter's syndrome and Gitelman's syndrome, It relates to the field of detecting and treating changes in proteins. For more details, see the book The invention provides that the individual has a mutation in one or more genes associated with ion transport. Compositions and methods for determining whether or not they have a mutation I do. Background art   background   In higher eukaryotes, the appropriate ionic composition and volume of intravascular space Maintenance is important for normal neuromuscular function and oxygen and nutrient delivery to tissues. You. The kidneys determine long-term settings of fluid and electrical balance, Plays a significant role in maintaining homeostasis except for a wide range of variations You. Impairment in these elements of renal function is probably due to electrical homeostasis Over the range of altered blood pressure due to changes in intravascular volume for abnormalities in Based on numerous clinical disorders. Mendel in body fluids and electrical homeostasis Testing for disability is an opportunity to examine in detail the fundamental mechanisms that govern this process. Provide a meeting. This effort provides insight into basic physiology, and also Identify targets that have more stable variations in common in the population ( Lifton, R.P., Proc. Nat. Acad. Sci. U.S.A. 92: 8545-8551 (1995)).   Bartter Syndrome is a hypokalaemic metabolic It is an autosomal recessive disorder characterized by alkalosis (Barter, F.C., et al., Am. J. Med. 33: 811-828 (1962)). Affected patients have elevated plasma renin activity (B atter, F.C. et al., Am. J. Med. 33: 811-828 (1962)), hyperaldosteronism (Go odman, A.D., et al. Eng. J. Med. 281: 1435-1439 (1969)), changed pros Taglandin metabolism (Dunn, MJ Kid. Int. 19: 86-102 (1981)) increased Levels of atrial natriuretic peptide (Imai, M. et al., J. Ped. 74: 738- 749 (1969); Graham, R.M. Et al., Hypertension 8: 549-551 (1986)), abnormal Platelet function (Rodrigues Pereira, R. et al., Am. J. Med. Gen. 15: 79-84 (1983)) ) And the vasoconstrictor effects of angiotensin II and norepinephrine Insensitive (Batter, F.C., et al., Am. J. Med. 33: 811-828 (1962); Silverbe rg, A.B. et al., Am. J. Med. 64: 231-235 (1978)) It is shown to have a multi-array. Of the disease in the affected patient Symptoms and signs reflect these diverse physiological findings, and the volume of vascular volume Depletion (Bettinelli, A. et al., J. Pediatr. 120: 38-43 (1992)), seizures (Iwata, F. Et al., Acta Paed. Japonica 35: 252-257 (1993)), Tetany (Bettinelli, A. J. et al. Pediatr. 120: 38-43 (1992)), muscle weakness (Marco-Franco, J.E. et al., Clin. Neph. 42: 33-37 (1994)), paresthesia (Zarraga Larrondo, S. et al., Nephr) on 62: 340-344 (1992)), and arthralgia with cartilage calcification (Smilde, TJ. et al., J. . of Rheum. 21: 1515-1519 (1994)). In the electrolyte composition Persistent abnormalities are impaired development and mental retardation in some affected subjects. (Simopoulos, A.P. et al., Nephron 23: 130-135 (1979)). electrolytic These deep disorders in quality homeostasis are associated with overeating in affected individuals. Misdiagnosis and / or abuse of diuretics (Okusa, M.D. and Bia, M.J. . Batter Syndrome. Hormone Resistance and Other Endocrine Paradoxes, Coh en, P. and Foa, P., 231-263 (Springer Verlag, New York, 1987)).   Bartter syndrome has at least two subsets (Gitelman syndrome (Gitelman syndrome). , H.J., Graham, J.B., and Welt, L.G., A new familial disorder characte rized by hypokaiaemia and hypomagnesemia, Trans. Assoc. Am. Phys. 79:22 1-235 (1966)) and "true Bartter's Syndrome" (Bettinelli, A. et al., J.P. ediatr. 120: 38-43 (1992))) . Gitelman syndrome is hypocalciurea and hypomagnesemia Dominant subset of patients with hypokalemia alkalosis in combination with G Say. On the other hand, true Barter syndrome is normal or hypercalciuria, and Typically refers to patients with normal magnesium levels. True barter patient Is clinically present at an early age (<5 years) with signs of vascular volume depletion It is said that. On the other hand, patients with Gitelman syndrome typically have significant hypovolemia Are present at an older age without B. (Bettinelli, A. et al., J. Pediatr. 120: 38- 43 (1992)). Nevertheless, the overlapping features of these disorders are This caused considerable confusion and confusion regarding classification, and many patients It has the characteristics of Gitelman syndrome, which was determined to have Barter syndrome (Rudi n, A. et al., Scand. J. Urol. Nephrol. 22: 35-39 (1988)). Diseases of these disorders The cause remains undetermined, the observed abnormality is primary, and primary Extensive speculation exists on secondary consequences based on various abnormalities (Clive, D.M., A m. J. Kid. Dis. 25: 813-823 (1995)). Currently to distinguish these obstacles There is no easy way to do this; discrimination is based solely on the evaluation of the clinical symptoms presented ing.   Dissection of the physiology of electrolyte omeostasis in the kidney reveals Gitelman syndrome and A number of potential candidate genes for Bartter's syndrome have been identified; Atrial natriuretic peptide and angiotensin II receptor (AT1 (Graham, R.M., et al., Hypertension 8: 549-551). (1986), Yoshida, H. et al., Kid. Int. 46: 1505-1509 (1994)). Another attractive Candidate genes include thiazide-sensitive NaCl cotransporter (thiazide-sensitive) Passive co-transporter, TSC). This is a significant increase in net renal sodium reabsorption. Sodium and chloride in this nephron segment are responsible for the function It is believed to be an important regulator of absorption (Ellison, D.H., Ann. Int. Med. . 114: 886-894 (1991)). This co-transporter is a drug used to treat hypertension. It is a target for one of the major classes, thiazide diuretics. Code TSC CDNA has recently been cloned from flounder bladder and rat kidney ( Gamba, G. et al., Proc. Natl. Acad. Sci. U.S.A. 90: 2749-2753 (1993); Gamba G. et al. Biol. Chem. 269: 17713-17722 (1994)). Rat-derived code The resulting protein contains 1002 amino acids and contains 12 putative transmembrane domains. And has long intracellular amino and carboxy termini. Gitelman syndrome Some characteristics of patients who have and receive thiazide diuretics The similarity is that a mutation in TSC that results in a loss of function occurs in Gitelman syndrome Raise the possibility of a change. This discussion suggests that TS as a candidate gene for Gitelman syndrome Motivate C exam.   In Example 1, Gitelman's syndrome is a disease in which Sia is placed in the distal convoluted tubule of the kidney. Lack of functional mutations in zide-sensitive Na-Cl cotransport protein (TSC) Demonstrates a genetically homozygous autosomal recessive trait arising. these The dominant clinical and pathological abnormalities seen in patients Can be explained by the resulting salt discharge from the plant.   These observations in patients with Gitelman syndrome suggest that Barter syndrome an allelic variant of lman syndrome or a mutation in a different gene The question of cause is left unresolved. Of salt excretion and urine concentration in barter patients Decreases and the occurrence of calcium excretion are due to the thick Thick limb (thick) suggests primary renal duct defects during ascending limb (TAL) (Gill, JR et al., Am . J. Med. 65: 766-772 (1978)). Bumetanide-sensitive Na-K-2Cl cotransporter (NKCC2 , Also known as SLCl2AI), an absorptive variant of this nephron segme Is a major regulator of sodium and chloride reabsorption of the plant (Greger, R.P. hysiol. Rev. 65: 760-797 (1985)). And the loss of function of this co-transporter It can result in many features found in affected patients. In fact, loop diuretics (this Co-transporter) is found in patients with Bartter syndrome (See Regger, R. et al., Klin). . Woschenschr. 61: 1019-1027 (1991)).   The cDNA encoding NKCC2 has recently been developed in rats (Gamba, G. et al., J. Biol. Chem. 26). : 17713-17722 (1994)), rabbits (Payne, J.A., et al., Proc. Natl. Acad. Sci. (U.S.A.) 91: 4544-4548 (1994)) and mice (Igarashi, P. et al., Am. Physiol. 269: F405-F418 (1995)); The secreted variant NKCCl (also known as SLCl2A2) is also a shark (Xu, J.-C Et al., Proc. Natl. Acad. Sci. (U.S.A.) 91: 2201-2205 (1994)) and human (Payne, J.A. et al., J. Biol. Chem. 270: 17977-17985 (1995)). Was done. All members of this family have 12 putative transmembrane spannings (spanning) domain and also shows structural and sequence similarity to TSC. According to a family survey with Bartter syndrome, Example 2 shows that inherited low potassium This variant of myeloid alkalosis causes mutations in the gene encoding NKCC2 Demonstrate what is caused by This finding explains the molecular basis of the disease. Clarification and possible clinical features of more common heterozygous harboring status Hinting.   In Examples 1 and 2, autosomal recessive low potassium with excretion of salt and hypotension Alkalosis caused by a mutation in one of the two genes Evidence is provided to demonstrate that this can be done. Thiazide sensation in the distal convoluted tubule of the kidney Mutations in the TSC encoding the receptive Na-Cl cotransporter (locus symbol SLC12A3, Shiba Often called NCCT), with pronounced hypocalciuria and hypomagnesemia Gitelm, characterized by salt excretion and hypokalemia alkalosis associated with An syndrome occurs (Example 1 and Simon, DB et al., Nature Genet. 12: 24-30). (1996)). Bumetanide-sensitive Na-K-2C in the kidney of the thick ascending limb (TAL) of Henle loop l Mutations in NKCC2 (symbol SLC12A1) encoding symporters are prominent Salt excretion and low potassium associated with hypocalcemia and often nephrocalcinosis Produces Barter syndrome, characterized by blood alkalosis (Example 2 and Si mon, D.B. et al., Nature Genet. 13: 183-188 (1996)). Typically, Barter's disease Are born prematurely with polyhydramnios and exhibit significant dehydration during the neonatal period However, Gitelman patients typically have an older age with neuromuscular signs and symptoms (Wang, W. et al., Ann. Rev. Physiol. 54: 81-96 (1992)).   Mutations in genes whose products regulate the activity of either of these symporters May have the potential to lead to a similar clinical phenotype. Apical ATP-sensitive K⁺Cha Is involved as one such regulator of the Na-K-2Cl cotransporter in TAL (Wang, W. et al., Ann. Rev. Physiol. 54: 81-96 (1992); Giebisch, G., Kidn. ey Int. 48: 1004-1009 (1995)). K in TAL⁺Level is Na⁺And Cl^-Of the level Is much lower, so the K⁺Availability is rate-limited to symporter activity Constant; K enters cells from tubules⁺Enable sustained co-transport activity Must be "recirculated" into the lumen in order to do so. K in regulating symport transport activity⁺ This important role of the channel is due to potassium escaping virtually Na-K-2Cl cotransport activity Demonstrated by the ability of channel antagonists (Giebisch, G., Kidney I nt. 48: 1004-1009 (1995)).   Many features of this control channel (low signal channel conductance, Activation by low levels of ATP and protein kinase A (PKA) and voltage Regulation K with insensitivity to and calcium)⁺Channel (IRK) Has been cloned (Ho, K. et al., Nature 362: 31-38 (1993)). This switch Channel ROMK (locus symbol KCNJ1) is a member of the IRK family of potassium channels. Prototype, containing two transmembrane domains, and a characteristic H5 pore domain Contains segments homologous to This channel contains a PKA phosphorylation site Is required for normal channel activity. By the same chromosome 11 locus Multiple encoded ROMK isoforms are generated by alternative splicing (Ya no, H. et al., Mol. Pharmacology 45: 854-860 (1994)); Shuck, M.E. J. et al. Bi ol. Chem. 269: 24261-24270 (1994)); these isoforms are specifically identified in the kidney. Is expressed on the apical cell membrane of TAL and on additional distal nephron segments (Lee, W.S. et al., Am. J. Physiol. (Renal Fluid Elec.) trol. Physiol.) 268: F1124-31 (1995) Boim, M.A. et al., Am. J. Physiol. (Renal  Fluid Electrol. Physiol.) 268: F1132-40 (1995); Hebert, S.C., Kidney Int. 4 8: 1010-1016 (1995)). This channel recycles potassium in TAL And is thought to be involved in net renal potassium secretion in distal nephrons .   The present invention relates to several types of deficiencies in ion transport, in particular Barter syndrome and Gi. Provide compositions and methods that can be used to distinguish and diagnose telman syndrome I do. The present invention is further directed to identifying heterozygous carriers of these disorders. Provided are compositions and methods that can be used. If the carrier has severe clinical symptoms , The condition is still mild to moderate. Summary of the Invention   The present invention relates, in part, to a human thiazide sensitive Na-Cl cotransporter, TSC; Sex K⁺Channel, ROMK; and the role of the human Na-K-2Cl cotransporter, NKCC2, Ion transport, especially Bartter's syndrome, Gitelman's syndrome, hypokalemia alcalo Cis, hypokalemia alkalosis with hypercalciuria, kidney stones, high Associated with susceptibility to blood pressure, osteoporosis, and diuretic-induced hypoalkalosis Based on identifying roles in different pathological conditions. Specifically, the present invention relates to TSC, NKC C2 and several human wild-type and altered variants of the ROMK protein Provided are amino acid sequences, nucleotide sequences encoding these variants. these Proteins and nucleic acid molecules can diagnose ion transport disorders and It can be used in developing methods and medicaments for treating pathology. BRIEF DESCRIPTION OF THE FIGURES   FIG. Family of Gitelman syndrome used for linkage studies. Gi used for linkage studies 1 shows the relationship of a family with telman syndrome. Painted individuals with Gitelman syndrome Indicated by symbols; individuals without Gitelman syndrome are indicated by unfilled symbols; Individuals who died are indicated by a diagonal line in the symbol. Sampling for genetic research Individuals who did not do so are indicated by points in the symbol. Give each family a unique family number, and Each individual in the family is numbered in the upper left corner of the symbol. Below each symbol, on chromosome 16 The genotypes at the loci are shown in the order of each map. See Figure 3). In the descending order, the loci are D16S419, D16S408, TSC SSCP, D16S494, and D16S389. TSC SSCP is a variant identified in TSC The different variants are given different allele numbers and are listed in Table 1 for each variant. Shows the nature of SSCP allele 1 indicates a wild-type SSCP variant. Gitelman syndrome The putative haplotypes that separate at the same time are shown in squares, Haplotypes are distinguished by hatched or white boxes, respectively.   FIG. Characterization of the human genome TSC locus. A. Cosmid conting over the TSC locus.The thin horizontal line is cosmid black Shows the cloned human genomic DNA; the vertical line indicates the restriction endonucleus. This shows the site cleaved by EcoRI. Independent clones, those shown And shows the 5 'to 3' direction of transcription.   B. Intron-exon organization of the TSC gene.The gray box indicates the TSC gene Show Song. The gene consists of 26 coding elements that encode a 1021 amino acid protein. Consists of Kisong. Indicates the first codon of each exon: the first codon of each exon The position in the base codon is indicated by a subscript (for example, 1672 is the exon 4 Indicating that the first base is the second base in codon 167). Positive for each intron The exact size is unknown.   C. Sequence of human TSC protein.Shows the sequence of human TSC protein in one letter code You. The corresponding sequence of rat and flounder TSC is shown below the human sequence; Amino acids that are identical compared to the sequence are indicated by dots, while the TSCs of these species differ. Amino acids. To the transmembrane domain considered from the hydrophobicity index plot Add shadows and number them from M1 to M12. Gitelman syndrome allele The amino acids mutated in are highlighted and shown in white on a black background. these The variants are numbered and correspond to the variants shown in FIG. 1, Table 1, and FIG. Let   FIG. Multipoint linkage analysis of Gitelman syndrome and loci on chromosome 16.Duplicate Perform a several-point linkage analysis to identify loci D16S419, D16S408, D16S494, and S16S389. Tested for linkage of Gitelman syndrome to a segment of chromosome 16 including . The order of these loci in their maps is the nearest Shown as the distance between adjacent loci (Gyapay, G. et al., Nature Genet. 7: 246-339 (1994) Shen, Y.S. et al., Genomics 22: 68-76 (1994)). Gitelman crossing this section Shows multi-point rod values for the linkage of the syndrome, thereby having D16S408 Revealed a rod value of 9.5 in the zero recombinant fraction and the adjacent locus D Trait inheritance in 11 centiMorgan interval defined by 16S419 and D16S494 Shows a 1000: 1 probability of a preferred location for a locus. At the top of the diagram are specified by CEPH ancestry The location of the TSC locus, and the location of the Gitelman locus in disease families. The rod-1 support section for the position, so that they overlap. Reveal. In addition, the molecular variants in TSCs show Gitelman disease at zero recombination ratio Shows linkage to the climatic group (see FIG. 1).   FIG. A novel variant of a patient with Gitelman syndrome.Have Gitelman syndrome Variant in the patient identified by SSCP and DNA as described in the method It was subjected to sequence analysis. A representative example is shown. Native gels (panels A, B, C, E, F) or the autoradiogram of the variant detected on denaturing gel (panel D) Shown to the left of each panel; patients are identified as in FIG. 1 and have Gitelman syndrome Subjects are indicated by an asterisk; arrows indicate variants specific to a family with Gitelman syndrome You. The corresponding modified (upper) and wild-type (lower) DNA sequences are shown on the right side of each panel. Shown in The mutant base is indicated by an asterisk; in panel D, the deletion in the variant The three bases in the wild-type sequence are shown in parentheses. Unlock all sequences with respect to genes It is shown in the sense direction. Except for panels D and E, the mutated codon and two 9 bases corresponding to adjacent codons are indicated.A.Variant is R209 in GIT102 to W Altering variant;B.The variant changes P349 in GIT107 to L;C.Variant Changes C42l in GIT102 to R;D.Coding PS561 by deletion of 3 bases Changes the sense sequence CCTTCA to CCA, which causes codon 561 in GIT108 Is deleted;E. FIG.A variant in the sense direction is intron 15 in GIT102, Change the susceptible 3 'splicing site CAG to CAT.F.The variant is in GIT111 Change R955 to Q.   FIG. Schematic diagram of TSC and mutations in patients with Gitelman syndrome.TSC protein Are 12 transmembrane domains with cytoplasmic amino and carboxy termini (Gamba, G. et al., Proc. Natl. Acad. Sci. U.S.A. 9 0: 2749-2753 (1993); Gamba, G. et al. Biol. Chem. 269: 17713-17722 (1994 )). Identifies exon mutation sites identified in patients with Gitelman syndrome; The numbers correspond to the variants numbered in FIGS. 1, 2c and Table 1. consensus Mutations that alter splicing sites are not shown; these are shown in Tables 1, 3, and And 4 are shown.   FIG. Family with Bartter syndrome. Show family relationships. Affected subject, affected No, surviving unsampled, and dead subjects The body is filled, unfilled, dotted, And the symbols with diagonal lines. Arrows indicate cases that serve as indices. Close to NKCC2 Indicate the genotype of the relevant loci and place them in chromosomal order ( Locus is identified on the left side of pedigree BAR152. NK of each kindred Number new SSCP variants detected in CC2 and indicate wild-type SSCP variants with a + You. Affected offspring of a related marriage are homozygous for all loci associated with NKCC2. Found to be conjugated and homozygous for the new SSCP variant It is.   FIG. Characterization of the human genomic NKCC2 locus. A. Intron-exon mechanism. Gray box encodes NKCC2 protein 26 exons are shown. The first codon of each exon is indicated; the second or Indicates an exon beginning with the third base by subscript 2 or 3, respectively.   B. Human NKCC2 protein sequence (single letter code). Corresponding rat and mouse The human sequence is shown below the human sequence; amino acids that are identical to human residues are indicated by dots. On the other hand, these species show different residues. From the hydropathy plot The transmembrane domains are shaded and numbered from M1 to M12.   C. Location of NKCC2 on human genome map. NKCC2 marker NKCGT7-3 and 15q Figure 2 shows a multiple point association analysis of the above loci. 15q locus to the right of 15qter locus These maps are shown in order. And the centrifugal inference between adjacent loci Show constant gene distance; lod plot of NKCC2 association for each location on the map Plot the core. lod score 3c flanked by D15S132 and D15S209 Has a peak at M intervals, and positions within this interval are 1 Supported by odds above 00: 1.FIG. Novel variants of NKCC2 in patients with Bartter syndrome.Modified by SSCP And subjected to DNA sequence analysis. A typical autoradiogram example Shown at the top of each panel, the sense strands of the wild-type (left) and mutant allele (right) The corresponding DNA sequence is shown at the bottom of each panel. Number the patient as shown in FIG. And subjects with Bartter's syndrome are indicated by an asterisk. Symbol n1 is unrelated The relevant normal subject is indicated. Arrow indicates variant specific to family with Bartter syndrome You. In panels a and b, the box at the top of the sequence diagram shows the insertion or insertion of one base. Indicates the position of the deletion. In panels d and e, the asterisk at the top of the sequence diagram Indicates a variant base.A.By insertion of one base into codon ATG M195, This results in a frameshift mutation.B.Codon CGG R302 by deletion of one base Causes a frame shift.C.The last base of exon 14 (this is codon 648 (Corresponding to the first base) changes from G to A and changes from D648 to N648.D.Kod G to T transversion at the first base of Changes to 272.   FIG. Important pathways and disorders that alter renal sodium reabsorption. nephron FIG. Plasma is filtered through a crescent-shaped structure showing glomeruli, and the filtrate is Sodium is reabsorbed as it passes through the freon. Physiology of sodium reabsorption Filtered nutrients that show biological modulators and are usually reabsorbed by each pathway Shows the percentage of um. Produced by mutations in certain regulators of sodium reabsorption Indicate a hurdle. Key regulators of sodium reabsorption are: Na in the proximal tubule⁺−H⁺ Exchange; Na-K-2Cl co-transport in thick ascending limb; Na-Cl co-transport in distal convoluted tubule Transport; composed of at least three different subunits in the distal nephron Is electrogenic sodium reabsorption through epithelial sodium channels . This last path is K⁺And H⁺Is indirectly involved in the secretion of   FIG. Family with Bartter syndrome. Show family relationships. Affected subject, affected No, surviving unsampled, and dead subjects Filled, unfilled, and dotted symbols for the body, respectively , And the symbols with diagonal lines. Arrows indicate cases that serve as indices. Close to NKCC2 Indicate the genotype of the relevant loci and arrange them in chromosomal order; These five loci are linked within 3 cM intervals; GT7-3 is the same as NKCC23. On the same PAC clone. Below these genotypes, each family detected by ROMK Number the new SSCP variants of. And these are the numbered modifications of FIG. Corresponding to body; wild-type SSCP variants are indicated by +. The relationship to NKCC2 is related It can be seen that it is excluded in the families BAR159 and BAR161. Smell in all four families To identify novel ROMK variants that co-segregate with disease.   FIG. Novel variants of NKCC2 in patients with Bartter syndrome. Modified by SSCP And subjected to DNA sequence analysis. Typical autoradiogram Examples are shown at the top of each panel, showing the sense of wild-type (left) and mutant alleles (right) The corresponding DNA sequence of the strand is shown at the bottom of each panel. Number the patient as shown in Figure 10. And subjects with Bartter's syndrome are indicated by an asterisk. The symbol n1 is Indicates an unrelated normal subject. Arrows indicate variants specific to Bartter syndrome families And are numbered as in FIG. In panels b and c, above the sequence diagram Boxes indicate the positions of base pair insertions or deletions. In panels a and d , The variant base is indicated by an asterisk at the top of the sequence diagram.A.For substitution of one base Therefore, the codon TAC (Y60) in BAR159 is changed to TAG (Stop60). This strange Differences are homozygous in affected family members, but are unaffected in family members. This is not the case with members.B.By inserting one base, the base in BAR161 A frameshift occurs at don 13-14. This mutation affects the affected member of this family. The bar is homozygous.C.The four base deletion spanning codons 313-314 is: A frameshift mutation occurs; the affected subject has a different on another ROMK allele. Has missense mutation (A195V) (data not shown).D.Place one base The exchange changes the codon AGC (S200) to AGG (R200); Eliminate phosphorylation sites. Affected subjects had Nansen on other ROMK alleles. Mutation (W58Stop).FIG. Location of ROMK mutation in patients with Bartter syndrome. The schematic diagram of R0MK2 And shown as two penetrations of the plasma membrane at the H5 domain containing the channel pore (Ho, K. et al., Nature 362: 31-38 (1993)). Identified in patients with Bartter syndrome Identify the location and outcome of the mutation. Embodiment of the Invention   I. General description   The present invention is directed, in part, to pathological conditions associated with abnormal ion transport, in particular, Bartter. Syndrome, Gitelman syndrome, hypokalemia alkalosis, hypercalciuria Hypokalemia alkalosis, kidney stones, hypertension, osteoporosis, and diuresis Sia in susceptibility to drug-induced hyperkalaemia Zide-sensitive Na-Cl cotransporter, TSC; human ATP-sensitive K⁺Channel, ROMK; Based on the identification of the role of the Na-K-2Cl cotransporter, NKCC2. In particular, the present invention provides a TSC Human wild-type and altered modifications of NK, NKCC2, and ROMK proteins The amino acid sequence of the human body, and the nucleotide sequence encoding these variants. Offer. These proteins and nucleic acid molecules are useful in diagnosing and It can be used in the development of methods and medicaments for treating these conditions.   II. Specific embodiments   A. TSC, NKCC2, or ROMK protein   The prior art of the present invention has identified: Probably wild-type rats and wild-type One allele of thiazide-sensitive Na-Cl cotransporter protein (TSC) in native flounder Amino acid sequence of gene variant; probably wild-type human ATP-sensitive K⁺Channel tongue Amino acid sequences of several allelic variants of protein (ROMK); Wild-type rat, wild-type rabbit, and wild-type mouse Na-K-2Cl cotransporter tan Amino acid sequence of one allelic variant of protein (NKCC2). However, the present invention Previously, changes in human variants (homologs) of these proteins were abnormal. This could result in a viable individual suffering from the symptoms caused by transport. Of the TSC and NKCC2 proteins in the naturally occurring human Wild-type variants were not characterized; for TSC, ROMK and NKCC2 proteins The altered human variant has not been characterized; and TSC, NKCC2, or Analyze samples for the presence of wild-type or altered variants of the ROMK protein Such as Gitelman syndrome and Bartter syndrome, which can be identified by No pathological condition leading to normal ion transport was indicated. The invention is, in part, Several allelic variants of wild-type human TSC protein, wild-type human NKCC2 Proteins, altered variants of human TSC protein that cause impaired ion transport, etc. An altered variant of human NKCC2 protein that causes impaired ion transport Amino acid sequence of an altered variant of human ROMK protein that results in defective transport of proteins In addition, the nucleic acid sequence of the encoding nucleic acid molecule is provided.   In one embodiment, the present invention relates to human TSC, NKCC2, and ROMK proteins. Of the ability to produce previously unknown wild-type and altered variants Provided using the cloned nucleic acid molecules described herein.   As used herein, wild-type human TSC protein refers to wild-type human TSC. A protein having the amino acid sequence of a type allelic variant. Example 1 DNA sequencing is not relevant to identify DNA molecules encoding wild-type TSC. The analysis was performed on DNA isolated from 50 healthy individuals. FIG. 2 and Table 3 show human TSC proteins. 1 provides the amino acid sequences of some wild-type allelic variants of protein. The present invention Wild-type TSC proteins have been specifically identified and characterized herein. Do not use undue experimentation in accordance with the Allelic variants that can be isolated and characterized. For the sake of convenience All wild-type human TSC proteins of the present invention are collectively referred to as wild-type TSC proteins. Or the wild-type human TSC protein of the present invention.   The term "wild-type human TSC protein" refers to any naturally occurring human TSC protein that has normal TSC activity. Includes allelic variants of the human TSC protein present. Generally, TSC protein Is a wild-type allelic variant of the wild-type TSC protein described herein. Sequence number May have amino acid sequences that differ slightly from the sequences provided in detail in / Have. Allelic variants are those that differ slightly from those mentioned above. Has a amino acid sequence, but is equivalent to the wild-type TSC protein described herein It has the ability to transport Na, Cl, Ca, and Mg at the level. Typically, wild-type TS Allelic variants of the C protein are derived from the wild-type TSC sequence described herein. Contains conservative amino acid substitutions that occur, or TSC proteins isolated from non-human organisms, such as homologs of Amino acid substitutions at different sites. FIG. 2 and Table 3 show the conserved amino acid residues. Represents a group.   As used herein, mutated or altered human TSC protein Has the amino acid sequence of a mutated or altered allelic variant of human TSC Protein. Figure 4, Table 1 and Table 4 show the number of human TSC proteins. The amino acid sequence of the mutated or altered allelic variant is provided. Departure A light mutated or altered TSC protein has been specifically identified herein. And characterized proteins, as well as excessive according to the methods outlined below Includes allelic variants that can be isolated and characterized without undue experimentation. Simple All the mutated or altered human TSC proteins of the present invention Are collectively a mutated or altered TSC protein, or a mutation of the present invention. Termed altered or altered human TSC protein.   The term “mutated or altered human TSC protein” has normal TSC activity. Not including all naturally occurring allelic variants of the human TSC protein. one Generally, a mutated or altered allelic variant of a TSC protein is described herein. SEQ ID NO: for the wild-type TSC protein described in To be provided in detail May / have a slightly to radically different amino acid sequence from the sequence. Mutated Alternatively, the altered allelic variant is one or more that are transported by wild-type TSC. It lacks or has a reduced ability to transport ions. Typical Allelic variants of a mutated or altered TSC protein include: Non-conservative amino acid substitutions derived from the wild-type sequence described in A TSC protein isolated from an organism other than Substitution of amino acids other than amino acids, frameshift mutation, insertion of a stop codon, or Includes deletion or insertion of one or more amino acids in the TSC sequence.   As used herein, wild-type human NKCC2 protein refers to human NKCC2. Refers to a protein having the amino acid sequence of a wild-type allelic variant. In Example 2 DNA sequencing was used to identify DNA molecules encoding wild-type NKCC2. The analysis was performed on DNA isolated from 50 healthy healthy individuals. Figure 6 shows the identification Amino acid sequence of the wild-type allelic variant of the human NKCC2 protein Offer. Changes were found in the intron region, but changed in the exon region. No formation was observed. The wild-type NKCC2 protein of the present invention is specifically described herein. Identified and characterized proteins, and methods outlined below Thus, allelic variants that can be isolated and characterized without undue experimentation including. For convenience, all wild-type human NKCC2 proteins of the invention Collectively, the wild-type NKCC2 protein of the present invention or the wild-type human NKCC2 protein Say.   The term “wild-type human NKCC2 protein” refers to a human NKCC having normal NKCC2 activity. Includes all naturally occurring allelic variants of the two proteins. Generally, NKCC2 A wild-type allelic variant of a protein is a wild-type NKCC2 tag disclosed herein. SEQ ID NO: Amino acid sequences that differ slightly from those provided in detail in Can have / has columns. Allelic variants may be slightly different from those mentioned above. The wild-type NCCCS protein described herein has a different amino acid sequence It has the ability to transport levels of Na, Cl, K, and Ca equal to the size of the matrix. Typically Indicates that an allelic variant of the wild-type NKCC2 protein Contains conservative amino acid substitutions derived from the native sequence or contains NKCC2 homologues (human Amino acids by corresponding sites in NKCC2 protein isolated from other organisms) Including the substitution of   As used herein, a mutated or altered human NKCC2 protein Has the amino acid sequence of a mutated or altered allelic variant of human NKCC2. Protein. FIG. 8 and Table 7 show some of the human NKCC2 proteins. An amino acid sequence of a mutated or altered allelic variant is provided. Of the present invention A mutated or altered NKCC2 protein has been specifically identified herein. Proteins characterized by excessively high yields, as well as methods outlined below. Allelic variants that can be isolated and characterized without undue experimentation. Simplicity All mutated or altered human NKCC2 proteins of the invention for the purpose of Collectively, the mutated or altered NKCC2 protein, or the altered NKCC2 protein of the present invention. Called a different or altered human NKCC2 protein.   The term “mutated or altered human NKCC2 protein” refers to normal NKCC2 activity. Not including all naturally occurring allelic variants of the human NKCC2 protein No. Generally, a mutated or altered allelic variant of the NKCC2 protein is SEQ ID NOS for wild-type NKCC2 protein described herein In detail Can have / have a slightly to radically different amino acid sequence from the provided sequence . Mutated or altered allelic variants are transported by wild-type NKCC2 Are unable to transport one or more ions or are substantially more Transports ions at low speed. Typically, a mutated or altered NKCC2 protein Allelic variants of protein are: non-derived from the wild-type sequence described herein. Conservative amino acid substitutions, NKCC2 homologs (NKCC2 proteins isolated from non-human organisms) Substitution of an amino acid different from the amino acid found at the corresponding position in A frameshift mutation, insertion of a stop codon, or one or more amino acids in the NKCC2 sequence. Includes no acid deletion or insertion.   As used herein, wild-type human ROMK protein refers to the field of human ROMK. Refers to a protein having the amino acid sequence of a native allelic variant. Example 3 50 unrelated healthy DNA molecules to identify the DNA molecule encoding wild-type ROMK. DNA from the body was sequenced. Wild-type allele of the identified human ROMK protein Amino acid sequence of gene variant only To be disclosed. Changes in the intron region Was found. However, all the ROMK-encoding DNA molecules tested so far No change was observed in the exon region. Wild-type ROMK protein of the present invention Are proteins specifically identified and characterized in the art, and Isolated and characterized without undue experimentation according to the methods outlined below Includes allelic variants obtained. For the purpose of simplicity, all wild-type The wild-type ROMK protein of the present invention or the wild-type human It is called ROMK protein.   The term "wild-type human ROMK protein" refers to a human ROMK protein having normal ROMK activity. Includes all naturally occurring allelic variants of the protein. Generally, ROMK tampa SEQ ID NO: What is the array provided in detail in It has a slightly different amino acid sequence. Allelic variants are also those mentioned above. Has a slightly different amino acid sequence from that of ATP, but has the ability to be an ATP-sensitive K transporter. Have. Typically, allelic variants of the wild-type ROMK protein are described herein. Contains conservative amino acid substitutions resulting from the wild-type sequence described in The corresponding position in the molog (ROMK protein isolated from non-human organisms) Amino acid substitutions.   As used herein, a mutated or altered human ROMK protein is Has the amino acid sequence of a mutated or altered allelic variant of human ROMK Refers to protein. Figures 11 and 12 and Table 10 show the numbers of human ROMK proteins. Provided are the amino acid sequences of some mutated or altered allelic variants. Book The mutated or altered ROMK proteins of the invention have been specifically identified herein. And characterized proteins, as well as excessively according to the methods outlined below Allelic variants that can be isolated and characterized without undue experimentation. Simple For convenience purposes, all mutated or altered human ROMK proteins of the invention The quality is collectively the mutated or altered ROMK protein, or the altered Called a different or altered human ROMK protein.   The term “mutated or altered human ROMK protein” has normal ROMK activity. And all naturally occurring allelic variants of the human ROMK protein. Generally, mutated or altered allelic variants of the ROMK protein are described herein. SEQ ID NO: for the wild-type ROMK protein described in the publication Provided in detail Has a fundamentally different amino acid sequence from a slightly different amino acid sequence Get / have. Mutated or altered allelic variants are identified by wild-type ROMK. One or more ions cannot be transported. Typically, the mutated or unusual The allelic variant of the ROMK protein that has been Non-conservative amino acid substitutions from the ROMK homolog (isolated from non-human organisms) Different from the amino acid found at the corresponding site in Acid substitutions, frameshift mutations, insertion of stop codons, or one or more in the ROMK sequence Includes deletions or insertions of the above amino acids.   TSC, NKCC2 and ROMK proteins of the present invention (wild type and mutated variants) Is preferably in isolated form. Tamper as used herein Is usually associated with proteins using physical, mechanical, or chemical methods. When TSC, NKCC2, or ROMK protein is removed from a cell component It is said to be released. One skilled in the art will recognize that isolated TSC, NKCC2, or ROMK proteins Standard purification methods can easily be used to obtain The nature and extent of isolation , Depending on the intended use.   By cloning nucleic acid molecules encoding TSC, NKCC2, and ROMK, Produce defined fragments of the clear TSC, NKCC2, and ROMK proteins. It becomes possible. As discussed below, the TSC, NKCC2, and ROMK Protein fragments can be used to generate domain-specific antibodies, TSC, NKCC2, or RO. Identify agents that bind to MK proteins, and TSC, NKCC2, or ROMK Particularly useful in identifying intracellular or extracellular binding partners of .   Fragments of TSC, NKCC2, and ROMK proteins are used for standard peptide synthesis It can be made using the techniques and amino acid sequences disclosed herein. is there Alternatively, fragmentation of TSC, NKCC2, and ROMK proteins using recombinant methods Can be made. Figures 2, 5, 7 and 12 and Table 1, 3, 4, 7, and 10 represent the TSC, NKCC2, and ROMK proteins described herein. Identify amino acid residues that are altered from wild-type residues in variants with altered proteins . Fragments containing these residues / alterations may have altered variant-specific anti-TSC antibodies , An anti-NKCC2 antibody, or an anti-ROMK antibody.   As described below, the TSC, NKCC2, and ROMK families of proteins Members may be used for, but not limited to: 1) TSC, N Markers to identify agents that block or stimulate KCC2 or ROMK activity 2) Identify binding partners that bind to TSC, NKCC2, or ROMK proteins And target or bait for isolation; 3) TSC, NKCC2, or ROMK protein Identification of agents that block or stimulate the activity of proteins, and 4) TSC, N Assay target to identify KCC2, or ROMK-mediated activity or disease.   B. Anti-TSC, anti-NKCC2, or anti-ROMK antibody   The invention further provides for the selection of one or more of the TSC, NKCC2, or ROMK proteins of the invention. An antibody that selectively binds is provided. Most preferred antibodies are TSC, NKCC2, or ROMK Binds to the altered variant of the protein but does not bind to the wild-type variant Alternatively, it binds to wild-type variants of TSC, NKCC2, or ROMK Does not bind to the modified variants. Particularly contemplated anti-TSC antibodies, anti-NKCC2 antibodies, or ROMK antibodies include monoclonal and polyclonal antibodies, as well as antigen binding Domains and / or fragments containing one or more complementarity determining regions.   Antibodies are generally used to isolate TSC, N Appropriate mammalian accommodation using KCC2 or ROMK protein or fragment Prepared by immunizing the Lord (Harlow, Antibodies, Cold Spring Harb or Press, NY (1989)). Figures 2, 5, 7, and 12 and Tables 1, 3, 4, 7, , And 10 are species of the TSC, NKCC2, and ROMK proteins described herein. TSC, NKCC2, and TSC have been shown to be mutated in various altered variants. And some regions of the ROMK protein. Fragments containing these residues The anti-TSC antibody, anti-NKCC2 antibody, or anti-RO Particularly suitable for producing MK antibodies.   Methods for preparing proteins for use as immunogens, and BSA, KLH, or Or immunogenic binding of a protein having a carrier, such as another carrier protein. Methods for preparing coalescence are well known in the art. In some situations, for example For example, direct conjugates using carbodiimide reagents can be used; And ligation reagents as provided by Pierce Chemical Co., Rockfold, IL May be effective.   Administration of a TSC, NKCC2, or ROMK immunogen is commonly understood in the art As appropriate, by injection over a suitable period of time, and using the appropriate adjuvant This is generally done. Antibody titration during immunization schedule May be performed to determine the suitability of   The polyclonal antiserum produced in this way is sufficient for some applications However, for pharmaceutical compositions, monoclonal antibody preparations are preferred. Desired An immortalized cell line secreting the monoclonal antibody of , Kohler and Misstein standard methods, or lymphocyte or spleen cell It can be prepared using modifications that affect killing. Immortalization to secrete desired antibodies The cell line is a protein or peptide fragment whose antigens are TSC, NKCC2, and ROMK. Screening by immunoassay. Secretes the desired antibody If a suitable immortalized cell culture is identified, cells can be grown in vitro or ascites. Can be cultured either by production of   The desired monoclonal antibody is then recovered from the culture supernatant or from the ascites supernatant Is done. Monoclonal antiserum or polyclonal containing immunologically significant portions Antisera fragments can be used as antagonists and intact antibodies. Can be used. F (ab ')_TwoAn immunologically reactive fragment of the fragment (eg, For example, the use of Fab, Fab ') is often preferred and particularly preferred in therapeutic settings. No. Because these fragments are generally more than intact immunoglobulins This is because the immunogenicity is low.   Antibodies or fragments can also be produced by recombinant means, using current technology. Can be produced. Regions that specifically bind to the desired region of the transporter may also be It can be produced in the context of a source, chimeric or CDR-grafted antibody.   As described below, anti-TSC, anti-NKCC2, or anti-ROMK antibodies Useful as a modulator of C, NKCC2, or ROMK activity; TSC, NKCC2, or RO Useful in immunoassays for detection of MK expression / activity, and TSC, N For purification of wild-type and altered variants of KCC2 and ROMK proteins Useful for   C. Nucleic acid molecule encoding TSC, NKCC2, or ROMK   As described above, the present invention provides, in part, TSC, NKCC2, and ROMK proteins. Isolate a human-derived nucleic acid molecule that encodes a wild-type or altered variant of quality Based on Accordingly, the present invention is further directed to the present invention as defined herein. Wild-type and altered TSC, NKCC2, and ROMK proteins disclosed in the specification A nucleic acid molecule encoding a variant (preferably, an isolated variant) is provided. Simple For convenience, all TSC, NKCC2, or ROMK-encoding nucleic acid molecules are TSC, N A nucleic acid molecule encoding KCC2 or ROMK, the TSC, NKCC2 or ROMK gene, Or TSC, NKCC2, or ROMK. Nucleus encoding the identified wild-type TSC The nucleotide sequence of the acid molecule is provided in FIG. 2 and Table 3. Change identified The nucleotide sequence of the nucleic acid molecule encoding the modified TSC is shown in FIGS. 1 and 4. Nucleic acid molecule encoding the identified wild-type NKCC2 The reotide sequence is provided in FIG. Nucleus encoding altered NKCC2 identified The nucleotide sequence of the acid molecule is provided in FIG. 8 and Table 7. Change identified The nucleotide sequence of the nucleic acid molecule encoding the ROMK is provided in FIG. 11 and Table 10. You.   As used herein, a "nucleic acid molecule" is a paper as defined above. Encodes a peptide or is complementary to a nucleic acid sequence encoding such a peptide Is defined as a typical RNA or DNA molecule. Particularly preferred nucleic acid molecules are described herein. A nucleotide sequence identical to or complementary to the human cDNA sequence disclosed in It has a nucleotide sequence. Genomic DNA, cDNA, mRNA, and antisense molecules, Nucleic acid sequences based on different backbones or derived from natural sources or Nucleic acids containing another base, whether synthesized or not, are specifically contemplated. But this Nucleic acid molecules such as TSC, NKCC2, or ROMK isolated from non-human organisms Any prior art encoding a non-human homolog and a known human ROMK protein Are further defined as novel and non-obvious to nucleic acid molecules of   As used herein, a nucleic acid molecule refers to a nucleic acid molecule that binds another polypeptide. "Isolated" when it is substantially separated from the contaminating nucleic acid it encodes; It is said. One of skill in the art will recognize the isolated nucleic acid encoding TSC, NKCC2, or ROMK Nucleic acid isolation procedures can be readily used to obtain the molecule.   The invention further provides a nucleic acid molecule encoding a TSC, NKCC2, or ROMK of the invention. Provide ragment. As used herein, TSC, NKCC2, or ROMK A fragment of a nucleic acid molecule that encodes Refers to the part. Fragment size is determined by the intended use . For example, if the fragment is a TSC such as the intracellular or extracellular domain, NKCC2, or Or if selected to encode the active portion of the ROMK protein, Is sufficient to encode a functional region of the TSC, NKCC2, or ROMK protein. Must be length. Fragments serve as nucleic acid probes or PCR primers Used when probing, the length of the fragment It is selected to obtain a relatively small number of false positives. 2, 7, 11 and Tables 1-4, 6, 7, 9, and 10 are selective hybridization probes or PCR Fragments of the TSC, NKCC2, and ROMK genes that are particularly useful as primers Identify. Such fragments may be TSC, NKCC2, and ROMK wild-type or Regions conserved among altered variants, previously identified TSCs, NKCC2, and Homologous regions shared with the ROMK gene, as well as the TSC, NKCC2, and ROMK genes Region that has been altered in the altered variant of   Probe or specific primer for polymerase chain reaction (PCR) Genes encoding TSC, NKCC2, and ROMK proteins Code a TSC, NKCC2, or ROMK of the present invention used to synthesize a child sequence Fragments of the nucleic acid molecule (eg, synthetic oligonucleotides) are Techniques (eg, the phosphotriester method of Matteucci et al., J Am Chem Soc (1981) 103 : 3185-3191) or using automated synthesis methods. Sa In addition, larger DNA segments can be prepared by known methods (eg, TSC, NKCC2, or R A group of oligonucleotides that define various modular segments of the OMK gene Synthesis, followed by construction of a fully modified TSC, NKCC2, or ROMK gene (Ligation of oligonucleotides).   The nucleic acid molecules encoding TSC, NKCC2, or ROMK of the present invention can Can be further modified to include a detectable label for the purpose. Listed above As such, using such probes, wild-type or altered TSC, NKCC2, And nucleic acid molecules encoding other allelic variants of the ROMK protein You. And, as described below, using such a probe, TS as a means for diagnosing pathological conditions caused by on-transport The presence of altered variants of the C, NKCC2, or ROMK protein can be diagnosed. Various Such labels are known in the art and are described herein in TSC, N It can easily be used with molecules encoding KCC2, or ROMK. With appropriate signs Biotin, radiolabeled nucleotides, biotin, etc. It is not limited to them. One skilled in the art encodes a labeled TSC, NKCC2, or ROMK Any art-known label may be used to obtain the nucleic acid molecule.   D. Nuclei encoding other wild-type and altered forms of TSC, NKCC2, and ROMK Isolation of acid molecules   As described above, in the pathology / severity of ion transport-mediated defects Identification of the role of TSC, NKCC2, and ROMK proteins Allelic variants of TSC, NKCC2, and ROMK proteins, and unusual ions Some of the TSC, NKCC2, and ROMK proteins confer transport-related pathology The altered variants can be identified. Based on these observations, those skilled in the art will appreciate that In addition to the sequences described in this document, other wild-type TSC, NKCC2, and ROMK proteins It is possible to isolate nucleic acid molecules encoding the type and altered variants.   Essentially, one of skill in the art would screen an expression library prepared from cells. Human TSC, NKCC2, and ROMK proteins to generate antibody probes for Quality amino acid sequences can be readily used. Typically, purified proteins (hereinafter Mammals, such as rabbits immunized with monoclonal antibodies) or TSC, NKCC2, or ROMK protein using polyclonal antisera Normal or altered variants to obtain the appropriate coding sequence. Are human cDNA or genomic expression libraries prepared from affected individuals (eg, , Λgt11 library). The cloned cDNA sequence is Can be expressed as a synthetic protein or directly expressed using its own regulatory sequences. Or use control sequences that are appropriate for the particular host used to express the enzyme. Can be expressed by different constructs. Figures 2, 7, and 11, and Tables 1-4, 7, 9 and 10 are the respective mutated modifications of the TSC, NKCC2 and ROMK proteins Identify key agonist domains that have been shown to involve changes in the body. Such regions may be used as probes, diagnostic antibodies, and TS for the production of therapeutic antibodies. C, N KCC2 is a preferred source of the antigenic portion of the ROMK protein.   Alternatively, a sequence encoding a TSC, NKCC2, or ROMK described herein Some of the individuals have normal ion transport or are the result of abnormal ion transport. TSC, NKCC2, or ROMK of proteins from individuals suffering from different pathological conditions Synthesized as a probe to recover DNA encoding family members And can be used. Oligomers containing about 18-20 nucleotides (about 6 (Encoding ~ 7 amino acid stretch) is a stringent condition or false positive Hybridization under sufficiently stringent conditions to eliminate excessive levels of Screen the genomic DNA or cDNA library to obtain It is prepared and used to make Using this method, TSC, NKCC2, And isolation of altered and wild-type variants of the sequences coding for and ROMK I can do it.   In addition, a pair of oligonucleotide primers is used for polymerase chain reaction (PCR) A nucleic acid molecule encoding TSC, NKCC2, or ROMK prepared for use in , Or fragments thereof, can be selectively amplified / cloned. PC like this The denaturation / annealing / extension cycle of the PCR to use the R primer Nucleic acid molecules that are well known in the art and encode other TSC, NKCC2, or ROMK It can be easily adapted for use in isolating. Figures 2, 7, and 11, And Tables 1-4, 6, 7, 9, and 10 as probes or primers Regions of the human TSC, NKCC2, and ROMK genes that are particularly well suited for use with I do. Generally, this preferred primer encodes TSC, NKCC2, or ROMK. Adjacent to one or more exons of a nucleic acid molecule.   E. FIG. Methods for identifying pathological conditions associated with abnormal ion transport   The present invention further provides a Na-K-2Cl cotransporter (NKCC2), a thiazide-sensitive Na- Activity of Cl cotransporter (TSC) and ATP-sensitive potassium channel (ROMK) And methods for identifying cells and individuals expressing altered variants. Using such methods, altered ion transport (particularly Barter's syndrome and Gi biological and pathological processes associated with various variants of telman syndrome) Progression of such conditions, sensitivity of such conditions to treatment, and such The effectiveness of treatment of the condition may be diagnosed. The method of the present invention can be used to reduce ion transport (especially, Gitelman syndrome and Barter syndrome) In particular, it is particularly useful in distinguishing between Gitelman syndrome and Barter syndrome. It is for. Specifically, wild-type or altered TSC, NKCC2, and ROMK proteins The presence of the altered variant is a wild-type or altered TSC, NKCC2, or ROMK protein. Variants, or nucleic acids encoding one or more of these proteins, It can be identified by determining whether it is expressed. Expression of altered variants Deviation from normal levels of TSC, NKCC2, or ROMK expression is indicative of abnormal TS To diagnose pathological conditions mediated by C, NKCC2, or ROMK activity / expression To distinguish between various ion transport deficiencies and to carry ion transport deficiencies Can be used as a means for identifying   Using various immunological and molecular genetic techniques, TSC, NKCC2, or ROMK A wild-type or altered variant of the protein is found in a particular cell and / or It can be determined whether the protein is expressed / produced at the level at which it is expressed. Preferred A good method is to use wild-type or mutated forms of TSC, NKCC2, or ROMK proteins. Identify if expressed.   Generally, an extract containing nucleic acid molecules or an extract containing proteins is Prepared from cells. The extract is then assayed and TSC, NKCC2, or ROMK A protein or nucleic acid molecule encoding TSC, NKCC2, or ROMK Determine if it is produced. The type of protein / nucleic acid molecule to be expressed, or The extent / level of expression is a measure of the nature and extent of TSC, NKCC2, or ROMK activity. provide.   For example, a sample of nucleic acid molecules suitable for performing diagnostic tests based on nucleic acid molecules Is obtained from the subject and prepared using conventional techniques. DNA is, for example, Can be prepared by simply boiling the sample in SDS. Most typically For nucleic acid samples, blood samples, buccal swabs, hair follicle preparations, Nasal aspirate is used as a source of cells to provide nucleic acid molecules. Next The extracted nucleic acid is then subjected to, for example, the polymerase chain reaction ( PC R) subject to amplification using a nucleic acid molecule encoding TSC, NKCC2, or ROMK Alternatively, the fragment can be selectively amplified. Then the amplified fragment Size (typically after restriction endonuclease digestion) was determined using gel electrophoresis. Or the nucleotide sequence of the fragment is determined (eg, See, for example, Weber and May, Am J Hum Genet (1989) 44: 388-339; Davis, J. et al. Na turc (1994) 371: 130-136). Then, the obtained fragment or Indicates that the size of the sequence is known wild type, And the putatively altered variant. Using this method , TSC, NKCC2, and the presence of wild-type or altered variants of the ROMK protein Can be distinguished and identified.   Alternatively, one or more single nucleotides within a nucleic acid molecule encoding TSC, NKCC2, or ROMK The presence or absence of base pair polymorphism is determined by conventional methods (manual and automated fluorescent DNA sequencing). Method, selective hybridization probe, primer extension method (Nikiforov, T . T. Nucl Acids Res (1994) 22: 4167-4175); Say (OLA) (Nickerson, D. A. Proc Natl Acad Sci USA (1990) 87: 8923-8. 927); allele-specific PCR method (Rust, S .; Et al., Nucl Acids Res (1993) 6: 3623- 3629; RNase mismatch cleavage, single-stranded conformation polymorphism (SSCP) (Orita, M. Proc Natl Acad Sci USA 86: 2766-2770 (1989)), denaturing gradient gel electrophoresis. (DGGE) and the like. Departure The clear diagnostic method is that one of many sequence variations is present in the sample. Biochip technology under development to be used to identify whether Especially well suited for use in Those skilled in the art will recognize that TSC, NKCC2, or ROMK Whether the sample contains nucleic acid molecules encoding wild-type or altered variants of the protein Any nucleic acid analysis method for use in determining You.   To perform a protein-based diagnostic test, an appropriate protein sample is Obtained and prepared from the subject using conventional techniques. Protein samples are examples For example, by simple mixing of the SDS and sample, followed by salt precipitation of the protein fraction, Can be made. Typically, for protein samples, blood samples, oral Swab, nasal aspirate, or tissue expressing TSC, NKCC2, or ROMK protein A native cell biopsy is used as a source of cells to provide protein molecules. It is. The extracted protein is then TSC, NKCC2, Or to determine the presence of wild-type or altered variants of the ROMK protein. Can be analyzed. For example, variants of a particular size or charge of a protein Can be identified using the mobility of Alternatively, specific for wild-type or altered variants Different antibodies can be used. One of skill in the art will recognize that the sample is TSC, NKCC2 or Known to determine whether it contains wild-type or altered variants of Protein analysis methods can be easily adapted.   Expression of TSC, NKCC2, or ROMK also affects naturally occurring TSC, NKCC2, or ROK. To identify disorders resulting from an increase or decrease in MK gene expression Method can be used. Specifically, nucleic acid probes for detecting mRNA are TSC, NKCC2 Or to detect cells or tissues that express the ROMK protein, and Can be used to detect the level of expression.   Only the altered variant of the TSC protein in the sample as provided above The presence of (homozygous state) is a diagnosis of Gitelman syndrome. TSC protein If the altered variant is present in a sample further comprising a wild-type variant of TSC (Heterozygous condition), carriers of Gitelman syndrome and lower levels of active TSC Diagnosis of individuals expressing bells. Reduced levels of active TSC are Decrease in calcium, increase in bone density, and calcium deposition and It leads to a tendency for hypokalemia induced by urine. Levels with increased TSC expression Increased urinary calcium, decreased bone density, and high blood pressure and kidney stones This is a diagnosis of the tendency. Altered variant of NKCC2 protein in sample Is present (homozygous state) in the diagnosis of some variants of Bartter syndrome is there. Altered variants of the NKCC2 protein further include wild-type variants of NKCC2 If present in the sample (heterozygous state), Diagnosis of individuals expressing lower levels of active and active NKCC2. Decreased NKCC2 activity Gender includes increased urinary calcium, decreased bone mass, and kidney stones, osteoporosis, and Leads to a tendency for hypokalemia induced by diuretics. ROMK tag in sample The presence of only the altered protein (homozygous state) is Diagnosis of some variants. The altered variant of ROMK protein is If present in a sample that further contains the biotype variant (heterozygous state), the bar Diagnosis of carriers of Tarr syndrome and individuals expressing lower levels of active ROMK is there. Reduced ROMK activity is associated with increased urinary calcium, decreased bone mass, and increased kidney Calculi, and lead to osteoporosis tendencies.   Alternatively, the expression of TSC, NKCC2, or ROMK is also a naturally occurring TSC, NKCC2 Or to identify reagents that increase or decrease the level of ROMK gene expression Method. For example, release TSC, NKCC2, or ROMK proteins The appearing cells or tissues are affected by the agent's effect on TSC, NKCC2, or ROMK expression. To determine the result, it can be contacted with a test reagent. TSC, NKCC2, or ROMK Reagents that activate expression are used as agonists of TSC, NKCC2, or ROMK activity. Reagents that reduce the expression of TSC, NKCC2, or ROMK may be used It can be used as an antagonist of C2, or ROMK activity.   F. RDNA molecules containing nucleic acid molecules encoding TSC, NKCC2, or ROMK   The present invention relates to one or more wild-type or altered TSC, N described herein. A sequence encoding KCC2, or ROMK, or a nucleic acid molecule described herein Further provided is a recombinant DNA molecule (rDNA) comprising a fragment of In this specification When used in rDNA, rDNA molecules are DNA molecules that have been subjected to in vitro molecular manipulation. is there. Methods for producing rDNA molecules are well known in the art and include, for example, Samb See rook et al., Molecular Cloning (1989). In preferred rDNA molecules DNA sequence encoding TSC, NKCC2, or ROMK (TSC, NKCC2, or ROMK (Encoding a wild-type or altered variant of the protein) may comprise one or more expression control elements. Operably linked to a sequence and / or vector sequence. Most preferably, TSC The nucleic acid molecule encoding NKCC2, NKCC2, or ROMK may comprise one or more of the nucleic acids described herein. Encodes the above novel altered or wild-type variants.   One of the sequences encoding the TSC, NKCC2, or ROMK of the present invention is operably linked. Selection of the vector and / or expression control sequence to be used is, as is well known in the art, Desired functional properties (eg, protein expression) and host to be transformed Depends directly on the cell. The vector contemplated by the present invention is at least rDNA Replication of the sequence encoding TSC, NKCC2, or ROMK contained in the molecule or It may direct insertion into a chromosome and preferably expression.   Used to regulate the expression of an operably linked protein coding sequence Expression control elements are known in the art and include inducible promoters, Promoters, secretion signals, enhancers, transcription terminators, and other Including but not limited to regulatory elements. Preferably easily controlled Use an inducible promoter (eg, responsive to nutrients in the host cell's medium) Is done.   In one embodiment, the nucleic acid molecule comprises a nucleic acid molecule encoding TSC, NKCC2, or ROMK. A vector is a prokaryotic replicon (ie, a prokaryotic vector transformed with it). In a product host cell (eg, a bacterial host cell), the recombinant DNA molecule can DNA sequences capable of directing replication and maintenance). Such a repli Cones are well known in the art. In addition, vectors containing prokaryotic replicons It may also include a gene whose expression confers a detection marker such as drug resistance. Representative bacterial drug resistance genes include ampicillin or tetracycline. It is a gene that confers resistance.   Vectors containing prokaryotic replicons can be used in bacterial host cells (eg, E. coli). coli Expression of gene sequences encoding TSC, NKCC2, or ROMK (transcription and translation) ), Further comprising a prokaryotic or viral promoter. I can see. Promoters are responsible for binding RNA polymerase and causing transcription. An expression control element formed by the enabling DNA sequence. For bacterial hosts A compatible promoter sequence is typically used to insert a DNA segment of the invention. Provided in a plasmid vector containing convenient restriction sites. like this A typical vector plasmid is Biorad Laboratories (Richmond, CA) PUC8, pUC9, pBR322, and pBR329 available from Pharmacia (Piscataway) N PPL and pKK223 available from J.   Expression vectors compatible with eukaryotic cells (preferably compatible with vertebrate cells) Expression vectors) also contain sequences encoding TSC, NKCC2, or ROMK. Can be used to obtain variants of the rDNA molecule. Eukaryotic cell expression vectors are It is well known in the art and is available from several commercial sources. Teens Typically, such vectors are convenient for insertion of the desired DNA segment. Provided with restriction sites. Representative of such vectors are PSVL and PKSV-10 (Pharmacia), pBPV-1 / pML2d (International Biotechnologies, Inc. . ), PTDT1 (ATCC, # 31255), such as the vector pCDM8 described herein. It is a nuclear expression vector.   Eukaryotic expression vectors used in the construction of the rDNA molecules of the present invention are eukaryotic cells. Further includes a selection marker (preferably a drug resistance selection marker) that is effective in I can see. Preferred drug resistance markers are those whose expression results in neomycin resistance. Gene (ie, the neomycin phosphotransferase (neo) gene) You. Southern et al., J Mol Anal Genet (1982) 1: 327-341. Alternatively, select marker Can be on separate plasmids and the two vectors are Drugs introduced by transfection and appropriate for selectable marker Selected by culturing in the presence of an organism.   G. FIG. Contains nucleic acid molecules encoding exogenously supplied TSC, NKCC2, or ROMK Host cells   The present invention relates to a human wild-type or altered TSC, NKCC2, or ROMK protein of the invention. Further provided is a host cell transformed with the nucleic acid molecule encoding the protein. Host Cells can be either prokaryotic or eukaryotic. TSC, NKCC2, and Eukaryotic cells useful for the expression of ROMK proteins are based on cell culture methods. Compatible and propagate the expression vector and TSC, NKCC2, or ROMK gene There is no restriction as long as it is compatible with the expression of the product. With preferred eukaryotic host cells Thus, yeast, insect, and mammalian cells (preferably, vertebrate cells (eg, Cells from mouse, rat, monkey, or human fibroblast cell lines)) Without limitation, most preferably, human TSC, NKCC2, or ROMK protein Are cells that do not naturally express.   Any prokaryotic host expresses rDNA molecules encoding TSC, NKCC2, or ROMK Can be used to Preferred prokaryotic hosts are E. coli. coli.   Transformation of a suitable cell host with an rDNA molecule of the present invention is accomplished by well known methods. Is done. The method will typically depend on the type of vector used and the host system used. Dependent. For transformation of prokaryotic host cells, electroporation and Salt and salt treatment methods are typically used. For example, Cohen et al., Proc Acad Sci USA ( 1972) 69: 2110; and Uaniatis et al., Molecular Cloning, A Laboratory Manual, See Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982). When. For transformation of vertebrate cells with vectors containing rDNA, electroporation , Cationic lipid or salt treatment methods are typically used. For example, Gr aham et al., Virol (1973) 52: 456; Wigler et al., Proc Natl Acad Sci USA (1979) 76 : 1373-76.   Well transformed cells (ie, cells containing the rDNA molecules of the present invention) are It can be identified by known techniques. For example, it can be obtained by introducing the rDNA of the present invention. Cells can be cloned to produce a single colony. These colonies Can be harvested, lysed, and their DNA content ern, J Mol Biol (1975) 98: 503, or Berent et al., Biotech (1985) 3: 208. Can be tested for the presence of rDNA using methods as described, Alternatively, proteins produced from cells can be assayed through immunological methods .   H. Production of TSC, NKCC2, or ROMK proteins using rDNA molecules   The invention further provides a human wild-type or altered TSC, NKCC2, or ROMK protein. Provide a method for producing quality, comprising the steps of TSC, N described herein. KCC2, or one of the nucleic acid molecules encoding ROMK, is used. In a general sense, Production of recombinant human wild-type or altered TSC, NKCC2, or ROMK proteins Typically, the method includes the following steps.   First, a nucleic acid molecule encoding a TSC, NKCC2, or ROMK protein (eg, 2 and 7) are obtained. Code TSC, NKCC2, or ROMK If the sequence to be transcribed is not interrupted by introns, it may be useful for expression in any host. That is appropriate. If not, the nucleic acid encoding TSC, NKCC2, or ROMK A spliced variant of the molecule is generated and used, or Nucleic acid molecules containing introns can be used in eukaryotic expression systems that are compatible You.   The nucleic acid molecule encoding TSC, NKCC2, or ROMK is then preferably TSC To obtain a variant of an expression unit comprising a sequence encoding NKCC2, NKCC2, or ROMK In operable connection with a suitable control arrangement, as described above. The expression unit is used to transform a suitable host, and Cultivated under conditions that allow the production of TSC, NKCC2, or ROMK proteins. Nourished. TSC, NKCC2, or ROMK protein is added to the medium or cells as needed. Protein recovery and purification, some impurities may be tolerated In some cases, it may not be necessary.   Each of the above steps can be performed in various ways. For example, the desired code distribution Sequences can be obtained from genomic fragments and used directly in a suitable host . Construction of expression vectors operable in a wide variety of hosts involves the use of replicons and regulatory sequences. And is achieved using the appropriate combination. Control sequences, expression vectors, and Transformation methods will depend on the type of host cell used to express the gene, and may vary. And they are discussed in detail above. Appropriate restriction sites are usually available If not, it is necessary to provide an excisable gene for insertion into these vectors. For example, it can be added to the end of the coding sequence. Those skilled in the art will have a TSC, NKCC2, or ROMK Use with coding sequences to produce TSC, NKCC2, or ROMK proteins To this end, any host / expression system known in the art can be readily adapted. Expressed Expression systems that result in the production of lipid vesicles containing the modified protein are particularly well suited. Such lipid-containing vesicles can be agonists or TSC, NKCC2, or ROMK proteins. And well-suited for identifying antagonists.   I. Ion transport   As provided above, changes in TSC, NKCC2, or ROMK proteins are Cause pathological conditions, which are the result of abnormal ion transport. Therefore, the present invention TS Wild-type and altered variants of C, NKCC2, and ROMK proteins are Na, Ca, Cl For altering the extracellular or intracellular concentrations of, Mg, and / or K Can be used. Generally, Na, Ca, Cl, Mg, and / or K extracellular or The intracellular concentration may be TSC, NKCC2, or ROMK protein expression, or TSC, NKCC2 Alternatively, it can be changed by changing the activity of the ROMK protein.   Alter the extracellular or intracellular concentrations of Na, Ca, Cl, Mg, and / or K There are a number of situations in which Abnormal extracellular or intracellular pH may be Retention, elevated blood pressure, chronic respiratory and metabolic acidosis, inflammation, sperm Activation / inactivation, leading to hydroencephaly, glaucoma, colitis, etc.   Thus, a TSC, NKCC2, or ROMK protein, or a TSC, NKCC2, or RO MK gene expression is determined by extracellular or intracellular Na, Ca, Cl, Mg, and / or K concentrations. Can be used as a target or means for changing For example, TSC, NKCC2, Or the ROMK gene is used to increase the expression of TSC, NKCC2, or ROMK And can be expressed. This allows extracellular and intracellular ions Means and methods for changing the level are provided.   Pathological conditions characterized by inappropriate extracellular or intracellular ion concentrations Exists. For example, Barter syndrome, Gitelman syndrome, hypokalemia Rhosis, hypokalemia alkalosis with hypercalciuria, kidney stones, Hypersensitivity to hypertension, osteoporosis, and diuretic-induced hyperkalemia, It is associated with abnormal intracellular or extracellular ion concentrations. Therefore, TSC, NKCC2, or ROMK activity / expression is targeted as a means of treating these conditions. TSC, NKC Various methods for regulating C2, or ROMK activity / expression, are discussed in detail below. It is.   J. Identification of drugs that bind to TSC, NKCC2, or ROMK proteins   Another embodiment of the present invention is directed to the TSC, NKCC2, and ROMK tags described herein. Methods for identifying agents that are protein agonists or antagonists provide. Specifically, agonists and agonists of TSC, NKCC2, or ROMK proteins Antagonists first began with the TSC, NKCC2, and ROMK tanks described herein. Identified by the ability of the agent to bind to one of the wild-type or altered variants of the protein Can be done. The agent that binds to TSC, NKCC2, or ROMK protein is then Stimulates or blocks ion transport in cells that express NKCC2, NKCC2, or ROMK Ability can be tested.   In particular, a TSC, NKCC2, or ROMK protein is mixed with the drug. TSC, N After mixing under conditions that allow the association of the drug with KCC2 or ROMK, the mixture is TS To determine whether the drug has bound to the C, NKCC2, or ROMK proteins, Is analyzed. An agonist or antagonist may be a TSC, NKCC2, or ROMK protein. Identified as capable of binding to proteins.   The TSC, NKCC2, or ROMK protein used in the above assays was isolated And partially purified proteins, which can be fully characterized proteins Quality that has been altered to express a TSC, NKCC2, or ROMK protein. Vesicles or to express TSC, NKCC2, or ROMK proteins It can be any of the fractions of cells that have been altered. Additionally, TSC, NKCC2, or ROMK Protein can be complete TSC, NKCC2, or ROMK protein, or TSC, NKCC2 Or a particular fragment of the ROMK protein. TSC, NKCC2, or ROMK proteins may, for example, shift in molecular weight or change in cellular ion content As long as it can be assayed for drug binding, It will be apparent to those skilled in the art that   To identify whether a drug binds to TSC, NKCC2, or ROMK protein The method used for priming depends on the nature of the TSC, NKCC2, or ROMK protein used. based on. For example, a gel shift assay may be used to determine whether a drug is a TSC, NKCC2, or ROMK protein. Can be used to determine whether it binds to a soluble fragment of protein Meanwhile, patch clamps, potential clamps, ion-sensitive microprobes, or Ion-sensitive chromophores are drugs whose TSC, NKCC2, or ROMK Binds to cells expressing the protein and affects the activity of the expressed protein Can be used to determine if One skilled in the art will recognize that certain drugs may be TSC, NKCC2 Or a number of techniques to determine whether it binds to the ROMK protein. Easy to use.   Once binding is demonstrated, the drug can be used in cell or oocyte expression systems, and in TSC, N Using an assay to detect KCC2, or ROMK activity, use TSC, NKCC2, or ROMK More about the ability to modulate the activity of wild-type or altered variants of the protein Can be tested. For example, potential or patch clamp, ion sensitive micro Lobe or ion-sensitive chromophore, as well as Xenopus oocytes Or expression in recombinant host cells binds to TSC, NKCC2, or ROMK proteins. Drugs agonize or activate TSC, NKCC2, or ROMK activity It can be used to determine if it can be antagonized.   As used herein, an agent reduces TSC, NKCC2, or ROMK activity. If so, the drug may antagonize TSC, NKCC2, or ROMK activity. It is. Preferred antagonists selectively antagonize TSC, NKCC2, or ROMK Nize and to any other cellular proteins, especially other ion transport proteins Has no effect. In addition, preferred antagonists include TSC, NKC Decreases C2 or ROMK activity, more preferably more than 90% of TSC, NKCC2 or Or reduces ROMK activity, most preferably all TSC, NKCC2, or ROMK activity. Remove.   As used herein, an agent increases TSC, NKCC2, or ROMK activity. If so, the drug is said to agonize TSC, NKCC2, or ROMK activity . Preferred agonists selectively select for altered variants of TSC, NKCC2, or ROMK. Antagonize any other cellular proteins, especially other ion transport proteins Quality is not affected. In addition, preferred agonists have greater than 50% TSC , NKCC2, or ROMK activity, preferably greater than 90% of TSC, NKCC2, Or increases ROMK activity, most preferably more than twice the level of TSC, NKCC2, or Or increase ROMK activity.   Agents assayed in the above manner may be randomly selected or rationally Can be selected or designed. As used herein, a drug may be a TSC, NKCC2, or Or random selection without considering the specific sequence of the ROMK protein, Are said to be randomly selected. An example of a randomly selected drug Is a chemical or peptide combinatorial library, or The use of biological growth broth.   As used herein, an agent refers to the sequence of a target site and / or Based on non-random criteria considering its conformation related to the action of the drug When selected, it is said to be reasonably selected or designed. Drugs are TSC, N By utilizing the peptide sequence that constitutes the protein of KCC2 or ROMK It can be rationally selected or rationally designed. For example, reasonably selected Peptide drugs whose amino acid sequence is TSC, NKCC2, or ROMK May be a peptide that is identical to a fragment of   The agents of the present invention include, for example, peptides, small molecules, and vitamin derivatives, as well as To carbohydrates. One of skill in the art will recognize that the structural properties of the agents of the present invention are not limited. Can be easily recognized. One class of agents of the invention is the amino acid sequence Are selected based on the amino acid sequence of the TSC, NKCC2, or ROMK protein, It is a peptide drug.   The peptide agents of the present invention can be prepared using standard solid phase (or liquid) as known in the art. Phase) can be prepared using peptide synthesis methods. In addition, these peptides DNA to be loaded is synthesized using a commercially available oligonucleotide synthesizer. And can be produced recombinantly using standard recombinant production systems. Solid Production using phase peptide synthesis involves amino acids not encoded by the gene. If you do, you will need it.   Another class of agents of the invention is the important class of TSC, NKCC2, or ROMK proteins. Antibodies that are immunoreactive with the location. As described above, antibodies are used as antigenic regions TSC, NKCC2, or ROMK protein intended to be targeted by the antibody Obtained by immunization of a suitable mammalian subject with a peptide comprising those portions of quality. It is. Key regions include the domains identified in FIGS. 5, 7, and 12.   K. Use drugs that bind to TSC, NKCC2, or ROMK proteins   As provided in the Background section, TSC, NKCC2, and ROMK proteins It is involved in regulating intra- and extracellular ion concentrations. TSC, NKCC2, or ROMK tamper Agents that bind to proteins and act as agonists or antagonists Biological and pathological processes associated with TSC, NKCC2, or R0MK function and activity Can be used to regulate the process. See TSC, NKCC2 or ROMK for details. The biological or pathological process mediated by TSC, NKCC2, or ROMK Binds to a protein and has an agonist or agonist of TSC, NKCC2, or ROMK activity Can be modulated by administering to the subject an agent that acts as an antagonist .   As used herein, a subject is a mammal whose TSC, NKCC2, or Limitations that require modulation of pathological or biological processes mediated by ROMK The mammal can be any mammal. The term "mammal" belongs to the class of mammals Individual. The invention is particularly useful for treating a human subject.   As used herein, TSC, NKCC2, or ROMK-mediated production Physical or pathological processes are dependent on TSC, NKCC2, or ROMK proteins. Refers to a wide variety of cellular events mediated by Pathological processes are harmful Refers to the category of biological process that produces the effect. For example, TSC, NKCC2, and The pathological process mediated by ROMK is hypokalemia alkalosis Hypokalemia alkalosis with hypercalciuria, kidney stones, hypertension, Includes susceptibility to osteoporosis and diuretic-induced hyperkalemia. these Pathological processes reduce the activity of TSC, NKCC2, or ROMK proteins or It can be adjusted using increasing agents. Preferably, the drug is TSC, NKCC2, or Or modified protein of ROMK so that it is otherwise inactivated Acts to activate the body.   As used herein, a drug refers to the extent or severity of a process. If so, it is said to modulate the pathological process. For example, a drug is a drug If the agent contributes to normal intracellular and extracellular ion concentrations, It is said to adjust.   L. Agonists and antagonists of TSC, NKCC2, or ROMK proteins Administration of   TSC, NKCC2, or ROMK protein agonist or antagonist, Parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or via buccal route Can be done. Alternatively, or concurrently, administration can be by the oral route. Throw The dosage given should be the same for the recipient's age, condition, and weight, if any. Sometimes depending on the type of treatment performed, the frequency of the treatment, and the nature of the effect desired You. For example, abnormal ion transport (eg, water retention, increased blood pressure, chronic respiratory Or pathological conditions caused by metabolic acidosis, inflammation, etc.) Therefore, agents that modulate the activity of TSC, NKCC2, or ROMK will have Administered physically or locally. Inject such drugs as described below. There are many ways that can be easily adapted to provide.   The present invention further provides a TSC, NKC identified by the methods described herein. A composition comprising an antagonist or agonist of C2, or ROMK protein. provide. While individual needs vary, determination of optimal ranges of effective amounts of each component is It is within the purview of those skilled in the art. A typical dosage is 0. Contains 1-100 μg / kg body weight. Preferred The recommended dosage is 0. Contains 1-10 μg / kg body weight. The most preferred dosage is 0. 1-1μg / kg Including weight.   In addition to the pharmacologically active agent, the compositions of the present invention can be used for delivery to the site of action. Excipients and the like, which facilitate the processing of the active compounds into preparations which can be used pharmaceutically. And a suitable pharmaceutically acceptable carrier, including adjuvants and additives. Parenteral administration Suitable formulations include aqueous solutions of the active compounds in water-soluble variants (eg, water-soluble salts). )including. In addition, suspensions of the active compounds and, if appropriate, oily injection suspensions A cloud may be administered. Suitable lipophilic solvents or vehicles include fatty oils (eg, For example, sesame oil) or synthetic fatty acid esters (eg, ethyl oleate or Glyceride). Aqueous injection suspensions increase the viscosity of the suspension Substances, and include, for example, sodium carboxymethylcellulose, sorby Toll, and / or dintran. Suspension, if necessary May also include stabilizers. Liposomes also provide an agent for delivery into cells. Can be used to encapsulate.   Pharmaceutical formulations for systemic administration according to the invention may be enteral, parenteral or topical. It can be formulated for administration. In fact, all three types of formulations contain the whole body of the active ingredient. Can be used simultaneously to achieve administration.   Suitable formulations for oral administration include hard gelatin capsules or soft gelatin capsules. Cells, pills, tablets (including coated tablets), elixirs, suspensions, syrups Preparations, inhalants, and controlled release variants thereof.   M. Combination treatment   Agents of the invention that modulate the activity of TSC, NKCC2, or ROMK, alone or in particular Provided in combination with another agent that modulates certain biological or pathological processes Can be done. For example, an agent of the invention that reduces TSC, NKCC2, or ROMK activity, Administered in combination with other drugs that affect the target ion transporter (eg, diuretics) Can be done. As used herein, two drugs are two drugs administered simultaneously. Or administered separately in such a way that these drugs act simultaneously If so, it is said to be administered in combination.   N. Animal models and gene therapy   TSC, NKCC2, and ROMK genes, and TSC, NKCC2, and ROMK Proteins can also serve as targets for gene therapy in various situations. An example For example, in one application, a TSC, NKCC2, or ROMK deficient non-human animal Use a standard knockout procedure to inactivate the KCC2 or ROMK gene. Or if such animals are non-viable, inducible A TSC, NKCC2, or ROMK antisense molecule binds to TSC, NKCC2, or ROMK It can be used to regulate expression. Alternatively, the animal is a TSC, NKCC2, or RO Include MK or in a tissue-specific manner TSC, NKCC2, or ROMK or Antisense TSC, NKCC2, or ROMK expression units that direct the expression of antisense molecules. May be modified to include In such use, TSC, NKCC2, and Is a non-human mammal whose expression of ROMK is altered by inactivation or activation An animal (eg, a mouse or a rat) is created. This is a targeted recombination Such may be accomplished using a variety of procedures known in the art. Once created , TSC, NKCC2, or ROMK-deficient animals, TSC, NKCC2, or ROMK in a tissue-specific manner Animals that express TNF or antisense molecules are: 1) TSC, NKCC2 , Or to identify biological and pathological processes mediated by ROMK 2) Identify proteins and other genes that interact with TSC, NKCC2, or ROMK. 3) provided exogenously to overcome TSC, NKCC2, or ROMK deficiency And 4) TSC, NKC that increase or decrease activity Serve as an appropriate screen to identify mutations in C2 or ROMK To be used.   For example, expressing the TSC, NKCC2, or ROMK human minigenes in a tissue-specific manner Transgenic mice and produce TSC, NKCC2, or ROMK, usually Allows you to test the effects of protein overexpression in cells and tissues without Noh. This strategy uses another protein, bcl-2 (Veis et al., Cell 75 : 229 (1993)). Such an approach is , NKCC2, or ROMK proteins and can be easily applied to specific tissue regions. To address the potential beneficial effects of TSC, NKCC2, or ROMK Can be used for   In another embodiment, the gene therapy is a TSC, NKCC2, or ROMK-mediated organism. Used as a means to regulate a biological or pathological process. For example, The subject to be treated has a gene encoding a modulator of TSC, NKCC2, or ROMK expression. A transgenic expression unit (eg, a nucleic acid molecule encoding an antisense, or a TSC NKCC2, or a nucleic acid molecule encoding ROMK, or a functional TSC, NKCC2, or Or a ROMK expression unit). Such regulators Can be produced constitutively or are inducible in the cell or specific target cells. Or it can be either. This allows TSC, NKCC2, or ROMK regulators Is capable of sustained or inducible supply of the protein, or protein expression in the subject. You.   The following examples are intended for illustration, but are not to limit aspects of the invention. Not intended.                                 Example 1       Inherited hypocalciuria (Gitelman form of Barter syndrome) Hypokalemia alkalosis is associated with thiazide-sensitive Na-Cl cotransporter Caused by mutations in Method Gitelman Recruitment of family with syndrome. 11 Collected Gitelman Syndromes Earlier (Iwata, F. et al., Acta Paed. Japonica 35: 252-257 (1993); Macro-Franco, J.E. et al., Clin. Neph. 42: 33-37 (1994); Zarraga Larrondo, S Et al., Nephron 62: 340-344 (1992); Smilde, TJ. Et al. of Rheum. 21: 1515-1 519 (1994); Okusa, M.D. and Bia, M.J., Bartter's Syndrome, Hormone Res. istance and Other Endocrine Paradoxes (Cohen, P. and Foa, P) 231-263 (Springer Verlag, New York, 1987); Gitelman, H.J., Trans. Assoc. Am. P hys. 79: 221-235 (1966); Cushner, H.M. Amer. J. Kid. Dis. 16: 495-5 00 (1990); Sutton, R.A.L., et al., Miner. Elect. Metab. 18: 43-51 (1992)). Surviving families (GIT102) were evaluated for metabolic alkalosis in hypokalemia Determined through the index cases mentioned for. Genomic DNA, Gitelman Syndrome Were prepared by standard procedures from venous blood of members of a kindred (Bell, G. et al. Proc. Natl. Acad. Sci. USA 78: 5759-5763 (1981)).   Cloning and characterization of human genome TSC. Part encoding TSC protein Separate human and mouse cDNAs were obtained from flounder (Gamba, G et al., Proc. Natl. Acad. Sci. U.S.A. 90: 2749-2753 (1993)) or rat (Gamba, G. et al., J.B. iol. Chem. 269: 17713-17722 (1994)). Amer. J. Physiol. Printing, 1995) or human kidney cDNA library Was used as a template and isolated by PCR. Release the resulting cDNA segment Radiolabeled (Feinberg, A.P. et al., Anal. Biochem. 132: 6-13 (1983)), and Screen human genomic cosmid libraries by hybridization Library and screening procedures were described above. (Shimkets, R.A., et al., Cell 79: 407-414 (1994)). The cloned clone Template to duplicate products of digestion and specific exons or cDNA fragments. Specified by hybridization. Genome fragment with TSC exon Were digested with Sau3AI for complete cosmid DNA and BamHI digested pBluescript. Subcloned by ligation of the product into a mouse or human TSC cDNA. The resulting clones that hybridize are isolated and used on an ABI373 instrument. DNA sequence analysis by dideoxy chain termination according to the following standard protocol: Provided.   Marker development, genotyping, and linkage analysis. Cosmid contig (cont ig) of the Sau3AI subclone with the previously described hybridization ( Shimkets, R.A., et al., Cell 79: 407-414 (1994)). And screened. This screen identified clone phTSCGT-14. Sequence analysis revealed an interrupted sequence of (GT) (Clive, D.M. , Am. J. Kid. Dis. 25: 813-823 (1995)); Design primers and use direct PCR from genomic DNA from unrelated subjects. (Primers hTSCGT14-A: 5'-GTGAGCCACTGCGCTTAGCTG-3 '; hTS CGT14-B: 5'-CTGCTGAGCTCTGGTCTGGAG-3 ').   CEPH and disease pedigree genotyping were performed for the loci shown in the text. 1 μCi of [I-³²Except for labeling by inclusion of [P] dCTP As described previously (Shimkets, R.A. et al., Cell 79: 407-414 (1994)). Was performed by the polymerase chain reaction using specific primers (Gyapay, G et al., Nature Genet. 7: 246-339 (1994); Shen, Y.S. et al., Genomics 22: 68-76. (1994)). All genotypes were collected by two researchers of unknown disease status. Were evaluated separately.   Analysis of linkage was performed using the LINKAGE program (Lathrop, G.M., et al., Proc. . Natl. Acad. Sci. USA 81: 3443-3446 (1984)). Gitelman syndrome, 99% Has penetrance, sporadic prevalence of 0.001, and a mutant allele frequency of 1 in 200 As an autosomal recessive trait.   SSCP And DNA sequencing. Single-strand conformation polymorphism (Orita, M. et al., Proc. Natl. Ac ad. Sci. USA 86: 2766-2770 (1989)), which has been previously described (Shimkets, R.A. et al., Cell 79: 407-414 (1994)), 27 sets for separate direct PCR using CEPH control genomic DNA Using specific primers (Table 2). The amplified product is Under non-denaturing conditions and as described previously (Shimkets, R.A. et al., Cell 79 : 407-414 (1994)), modification of molecules by electrophoresis under denaturing urea gel The body was analyzed. The identified variants are eluted from the gel and amplified again by PCR. Width and described previously (Shimkets, R.A. et al., Cell 79: 407-414 (19 94)) and sequenced using the ABI373 instrument as described. In all cases, the DNA The sequence was confirmed by sequencing both DNA strands.   result Family with complex Gitelman syndrome   30 patients with Gitelman syndrome from 12 unrelated families were initially Collected for study; 11 of these were complex families with two or more affected individuals. Patients who have suffered, and 11 of these families have been reported previously ( See law). In 8 families, the sample was taken from two or more affected members. (Figure 1), and sampling of one affected subject in four families did. Diagnosis of metabolic alkalosis of hypokalemia is idiopathic hypokalemia Based on the findings of sickness (serum potassium <3.0meq / l; nl> 3.5meq / l), Blood pressure and metabolic alkalosis in the absence of diuretic treatment (serum bicarbonate> 29meq / l, nl <26meq / l). All patients studied had elevated plasma renin activity. Had the property. Diuretic abuse is eliminated by the absence of detectable diuretics in urine Was.   Gitelman's syndrome was determined by Bettinelli's criteria (Betinelli, A. et al., J. Pediatr. 120: 38-43 (1992)) and distinguished it from Bartter syndrome: in all of these families The index cases in this study are marked hypocalciuria (<2 mg / kg / day, nl> 4 mg / kg / day) , Hypomagnesi-1 cumemia (<0.5meq / l, nl 0.8-1.0meq / l), and Had symptom presentation. 27 patients had persistent muscle weakness, recurrent seizures on exertion (Recurrent cramping with exertion), limb cramps, whole body tetany, and call With various muscle symptoms, including periodic paralysis with compromise Illness The state was presented. Other manifestations include seizures, paresthesias, polyuria / polydipsia, and soft Included joint pain with bone calcification. Classified as unaffected complex family Subjects are over 20 years of age, clinically asymptomatic, and have normal serum potassium and And magnesium levels. All diagnoses were prospective. Suffering Subjects were offspring of two clinically normal parents and had two consecutive diseases. Consistent with recessive genetic traits, except for family GIT112 present in different generations; In family GIT102, the disease is also found in cousins, but in kin It is absent in some of these individuals (FIG. 1).   Cloning and characterization of human TSC. As a candidate gene for Gitelman syndrome To enable testing of TSCs in mice, we used mouse or flounder TSC cDNA. Genomic DNA encoding the human homologue of TSC by hybridization to Smid clones were identified (see methods). Identify the five clones obtained. I charged. With those maps, they overlap and a single 55kb It was revealed that the contig was defined (FIG. 2a). Intron of gene Determine the exon structure, which allows the human TSC protein to consist of 26 exons (Fig. 2b, 2c); all intron-exo The border of the protein has the usual 5'GT and 3'AG consensus splicing sites. The encoded human protein is 89% identical to rat TSC and 63% to flounder TSC. % Identity (FIG. 2c). There are 17 human proteins not found in rats This additional segment comprises an exon that is a separate exon Coded during 20. By Southern blotting, this protein in the human genome Indicates the presence of a single gene encoding the protein (data not shown).   The polymorphic gene marker (TSCGT-1) at this locus was Identified by identification of nucleotide repeats. Insensitive using specific primers Amplification of this segment from the genomic DNA of the subject (see Methods) Thus, this marker presents three alleles of the polymorphism, and 45 unrelated 48% heterozygous in healthy Caucasian subjects. This marker The same marker was placed on four different cosmids from the cloned contig. Markers in disease families, and Linkage analysis of TSC variants that have been shown to be related to the TSC locus (Data not shown).   The polymorphic gene marker (TSCGT-1) at this locus was Identified by identification of nucleotide repeats. Insensitive using specific primers Amplification of this segment from the genomic DNA of the subject (see Methods) Thus, this marker was shown to be polymorphic. This means three alleles Presenting offspring and 48% heterozygous in 45 unrelated Caucasian subjects Show. This marker contains four independent costs from the cloned contig. By finding this same marker on the mid, and subsequently, Analysis of TSC variants using this marker (Data not shown).   Using this marker, human gene maps can be linked by CEPH phylogeny. Placed TSC on the Pairwise analysis shows that markers on human chromosome 16 Revealed strong evidence of linkage to car clusters. Multipoint Linkage analysis confirmed the linkage to chromosome 16. The peak lod score is D 10.1 during the 3 cM interval flanked by 16S408 and D16S494, and Preferred position ratio in the septum is 950 to 1 over the next most probable interval (FIG. 3). With these findings, TSCs can be placed on human genetic maps and To identify highly valuable genetic markers that span the TSC locus, We note the link between this segment of chromosome 16 and Gitelman syndrome. Can be tested.   Gitelman Link between syndrome and TSC. A very informative marker spanning the TSC locus Was genotyped in a complex Gitelman syndrome kindred (FIG. 1). Link , Analyzed under a pre-specified model of recessive trait (see Methods). Pair Gitelman syndrome and locus D1 in zero recombinant fractions by wise linkage analysis Revealed a maximum lod score of 6.3 for association with 6S408. Multipoint association analysis (Figure 3) confirms strong evidence of association, which is in the zero recombinant fraction Gitelman syndrome showed a maximum lod score of 9.5 for association with D16S408 (association For more than 3 billion to 1 ratio). Adjacent markers are pairs with Gltelman syndrome Demonstrates the recombination (Figures 1 and 3) and is flanked by loci D16S419 and D16S494 Genes at a ratio greater than 1000: 1 for the 11 cm Morgan spacing I do. Within this interval, lod-1 support intervals place genes in 7 cM segments . This includes the location of the TSC gene (FIG. 3). These findings suggest Gitelman syndrome Reveals that there is no recombination between and the segment of chromosome 16 containing TSC And this indicates that the genetic homogeneity of the trait and the autosomes in all the families studied Consistent with both recessive transmission.   Gitelman TSC mutations in patients with Syndrome. Complete link between TSC and Gitelman syndrome Findings motivate research into mutations in this gene in affected subjects. I got it. Twenty-seven pairs of specific primers were used for the exon and intron-exo of the gene. The 150-300 base pair segment of the primer boundary is combined with the template as described in the method. Amplified by polymerase chain reaction using genomic DNA from affected subjects These primer sets consist of the coding region of the gene and Covers splicing sites. The variant is converted to a single-chain conformation polymorphism ( SSCP) and subjected to DNA sequence analysis (FIG. 4).   17 different molecular modifications inferred to alter the structure of the encoded protein Variants were identified on the 26 mutant alleles (Tables 1 and 4, FIG. 4). On the other hand, Such variants are detected on 26 alleles from control subjects Was not done. Three variants were found in Gitelman patients from both parents. They were found to be homozygous having the transgene (Tables 1 and 4). These breaks All of the variants co-segregate with disease in a complex family (FIG. 1), and Gitelman syndrome vs. D16S408, a variant of TSC and a multipoint linkage of D16S494, A recombinant fraction of zero for both D16S408 and D16S408 results in a lod score of 10.6 (de Data is not shown). These specific variants were used in unrelated Caucasian control subjects None of the 80 alleles from the body were detected.   These 17 variants are scattered throughout the gene (FIG. 2c, FIG. 5). this Thirteen variants are missense (Tables 1 and 4) and Changes residues that are all identical in normal human and flounder (FIG. 2C) , These species last shared a common ancestor 400 million years ago. Non-conservative amino acid substitution There is a strong bias for exchange (11/13 missense variant); Change the encoded amino acid, and two introduce a proline residue. Or remove (Tables 1 and 4). Two other variants, the splice site Alter the consensus sequence, thereby linking intron 15 to exon 16. Changed the CAG 3 'consensus splicing sequence to CAT (variant # 5 in GIT102) , Tables 1 and 4), and changes GT to TT at the junction of exon 24 and intron 24 (# 13 in GIT105). Both of these splice site variants are normal Apparently little protein is produced. One variant (# 7 in GIT108) has three salts Deletion of a base pair, which results in deletion of a serine residue at codon 561; This serine residue is a potential protein in the cytoplasmic carboxy terminus of the protein. It is the phosphorylation site of kinase C (Fig. 2c). Finally, one variant (in GIT112 # 10) introduces a premature termination codon, which allows the encoded The last 54 amino acids are deleted from the protein. Shows the sequence of the sense strand of the gene. The underlined sequence is the intron-exon sequence The consensus splicing site at the junction is shown; the bold sequence in GIT108 is Indicate the segments deleted in the variant. Variant # is the variant of FIGS. Indicates a number.Primers (5'-3 ') are all inside the intron except for the following: hTSCex1A -Reverse and hTSCex1B-forward, these are located inside exon 1; hT SCex26-forward is located at the beginning of exon 26, and hTSCex26-reverse is normal Is located distal to a large stop codon. The DNA sequence of each codon is shown. Consequences of each variant sequence on the encoded protein Is shown. I₁₀₁₇I is the isoleucine residue in which ATC substitution from ATC is encoded at position 1017. Indicates that the group is not changed. Consideration   Very likely to disrupt TSC function, and are specific to families with Gitelman syndrome Completeness of Gitelman syndrome with TSC, combined with the findings of a number of independent variants The finding of a strong association suggests that mutations in TSC may Constructs a proof that it causes Gitelman syndrome, which is a set. Low potassium Blood alkalosis and a small number of patients with normal or hypercalciuria Patients, so-called "true barter" patients (Bettinelli, A. et al., J. Pediatr. 120: 38- 43 (1992)) have a mutation in this same gene or a different gene Demonstration of a mutation in is required for further studies.   Pathogenesis of the disease   The diverse physiological properties of Gitelman syndrome all result from mutations in TSC Must be. From the physiology of autosomal recessive traits and known syndromes, we Indicates that the mutant allele has incomplete reversion of sodium and chloride in distal convoluted tubules. It is thought to cause a loss of normal TSC function, leading to absorption. This loss is And chloride leakage is expected, resulting in some blood loss and And metabolic alkalosis. Reduced vascular volume is due to renin-angiote Activates the synthin system, thereby increasing renin and aldosterone levels Let it. Elevated aldosterone levels can be seen in efforts to protect intravascular volume Leads to increased electrogenic sodium reabsorption through epithelial sodium channels . Sodium reabsorption through this channel will result in the elimination of potassium and hydrogen ions. And this results in hypokalemia and metabolic Causes calosis. These are all characteristic features of Gitelman syndrome . The first defect in this TSC function is how magnesium deficiency and low Whether or not to cause calciuria remains a concern, but these same shadows Hibiki in patients taking thiazide diuretics (specific inhibitors of TSC) It should be noted that these observations are further attributed to mutations in TSC. Supports the interpretation of loss of performance. Importantly, these latter anomalies It is now clear that there must be a secondary consequence of the primary loss in the TSC. is there.   Gitelman Allele prevalence and transmission   An abnormal segregation ratio and pattern of traits in some families is due to Gitelman syndrome Confusing understanding of group traits. The findings of this association are Consistent with our genetic homogeneity. Linked findings suggest that dominant traits with incomplete penetrance Favors recessive traits more than 100,000-fold better than any of the mitochondrial traits I do. Incidence in different branches of some families (eg, GIT102 and GIT112) The findings of the affected subject now indicate the different fractions at which additional mutant alleles are introduced. It can be explained from a molecular point of view by a spouse in a fork. For example, three people of GIT102 Affected offspring (subjects 12, 14, and 15) were tested for variants R421 and W209 It is a complex heterozygous type (variants # 3 and # 4, FIG. 1, Tables 1 and 4). R421 Also gave family members11 who were affected cousins their common ancestors This subject also has a third independent variant. A consensus splice from her father The modified variant (variant # 5; Tables 1 and 4, FIG. 1) has changed.   Finding independent mutant alleles introduced in different branches of a family Suggest that mutant alleles are not rare in the population. Moreover, relatives Marriage is not prominent in families with Gitelman syndrome, and a high percentage of The finding of a synthetic heterozygosity is consistent with this concept. With human and flounder The striking conservation of this protein's 629 amino acids between This means that many of these residues are required for normal protein function. Suggest that These observations indicate that alleles producing Gitelman syndrome alleles are altered. It suggests that the different potential target sizes prove to be large. This is a collective Gives a relatively high proportion of the new mutant alleles in the introduction. So far It is known that one residue is mutated more than once on an independent mutant allele. The observations support the claim that Gitelman's mutation is a large target size. This disease The true morbidity of the disease is unknown, but a minimal view of the morbidity of the disease based on clinical characteristics The build-up is at least 1% in Swedish and Italian populations. Suggests the prevalence of terrorism. Once the spectrum of the mutation is defined, various The true prevalence of the variant allele in the population is determined independently of phenotypic effects Can be   Given the recessive trait of Gitelman syndrome, Gitelman families studied to date A high proportion of affected offspring is prominent for heterozygous parents in (Fig. 1). After removing index cases in these families, 23 offspring of two heterozygous parents 22 of them have Gitelman syndrome. This is the expected 8 affected subjects Much more than. This high percentage of affected offspring is associated with those with abnormal segregation ratios. Confirmation of a biased family bias can be reliably obtained by a preferred identification. Another theory Ming is a distortion of segregation, with more than 50% of offspring expected from heterozygous parents With the transmission of the mutant allele to Expand using mutant allele identification The segregation ratios of Gitelman alleles in isolated families were determined without bias confirmation. Can be determined to directly assess the likelihood ofPossible relevance in heterozygotes   By identifying mutations that cause relatively severe disease in homozygotes, Moderate effects in heterozygous conditions where alleles are much more common Increase the likelihood of having One skilled in the art will recognize that moderately reduced blood pressure and / or In Gitelman syndrome, including a predisposition to hypokalemia induced by diuretics Some possible phenotypes can be inferred. Hypertension is caused by increased kidney kidney Co-ops frequently associated with blood pressure sensitivity to lium reabsorption and dietary salt effects It is a common multifactorial trait. Individuals who are heterozygous for the Gitelman mutation Prevents the onset of hypertension by having reduced renal sodium reabsorption Which can reduce the set point of sodium balance, reduced vascular content Leads to volume, and low blood pressure. Such alleles for blood pressure in the general population The potential impact of the offspring on the true morbidity and blood pressure of such heterozygotes Depends on their quantitative effects (both unknown). Hypertension disease Clinical outcomes typically occur after reproductive age, so these alleles Does not appear to increase reproductive fitness.   Hypokalemia alkalosis is a relatively one of diuretic treatments of many unknown causes. This is a common complication. Mutant TSC allele has sodium to distal nephron And further increase chloride delivery to contribute to the development of this complication obtain. This effect is greatest in patients taking loop diuretics such as furosemide. And these mutations may result in certain combinations of pharmacological treatments. May predispose to complications.   Identification of specific mutations that cause Gitelman syndrome allows for heterozygous protection. Identify cohorts of individuals and their response to blood pressure and pharmacological intervention To their homozygous wild-type progeny or other controls Can test these hypotheses. Further complicate drug treatment, explain Subjects with incapable hypokalemia or hypokalemia have a Gltelman mutation Can be a candidate for having a body.   Finally, the identification of the molecular basis for Gitelman's syndrome has helped to genetically diagnose the disorder. Provided. Earlier presentations indicated that some patients with this disorder had diuretic disturbances. You are mistakenly considered to be a user or have bulimia. In fact, in this specification One of the patients listed in is handed over to a locked psychiatric ward and She was properly diagnosed because hypokalemia persisted for two weeks in this environment. It was only when Therefore, the ability to make a genetic diagnosis of a molecule is And practical clinical benefit.                                 Example 2Bartter syndrome (inherited low potassium alkalosis with hypercalciuria) Is caused by a mutation in the Na-K-2Cl cotransporter NKCC2 Method Family with Barter syndrome. BAR138 has been previously reported (Di Pietro, A. et al., P. ed. Med. Chir. 13: 279-280 (1991)). Index cases that seriously affected other families Collected by confirmation. Genomic DNA can be converted to Bartter syndrome by standard procedures. Prepared from venous blood of members of the family (Bell, G., Karam. J. et al., Proc. Natl. A. cad. Sci. (U.S.A.) 78: 5759-5763 (1981)).   Cloning and characterization of the human genome NKCC2.   Rabbit (Payne, J.A. et al., Proc. Natl. Acad. Sci. (U.S.A.) 91: 4544-4548 (1 994)) or rats (Gamba, G. et al., J. Biol. Chem. 26: 17713-17722 (1994)). Oligonucleotide primers corresponding to any of the NKCC2 cDNA sequences Was used to perform PCR using the human kidney cDNA library as a template. NKC The corresponding human cDNA encoding C2 was sequenced; the sequence was sequenced from both DNA strands. Were determined. Radiolabeled segments from the 5 'and 3' ends of human NKCC2 cDNA And has been described previously (Shimkets, R.A., et al., Cell 79: 407-414 (1994). )) Hybridization of human PAC library 35 Was used for screening. Connect the intron-exon boundary to the genomic DN Both strands of the A fragment were determined by sequencing. NKCC2 single Genomic fragments with parts of introns and neighboring exons are used as templates Based on the structure of the PAC clone or genomic DNA, and the related gene TSC Using primers that are probably present in each exon, long-range PCR (long- range PCR, Expand^TM Long PCR System; Boehringer-Manheim) Was. DNA sequence analysis was performed using the ABI373 instrument according to the following standard protocol. By the dideoxy chain termination method.   Marker development, genotype, and association analysis. Sau3AI subclone of NKCC2PAC clone Loans are hybridized as previously described (Shimkets, R. et al. A. et al., Cell 79: 407-414 (1994)) screen for (GT) n repeats. I did it. In this screening, clone NKCGT7-3 containing (GT) sequence was identified. (McCredie, D.A., et al., Aust. Paed. J. 10: 286-295 (1974)); Primers flanking unique sequence repeats and genomic DNs of unrelated subjects Used to perform PCR from A (NKCGT7-3F: CACTAGGCTATTGTGTGGCTC; NKCGT7-3 R: GTCTGTCCTCCACACTAG).   Genotyping of CEPH and disease families for loci indicated in the text , The product was added to the reaction mixture at 1 μCi [I-³²Except for labeling by inclusion of [P] dCTP And as previously described (Shimkets, R.A. et al., Cell 79: 407-414 (1994)). ), Specific primers (Gyapay, G et al., Nature Genet. 7: 246-339 (1994)). Was performed by polymerase chain reaction. All genotypes, disease status Scores were scored independently by two unknowing researchers. Link analysis, LINK AGE Program, Lathrop, G.M. et al., Proc. Natl. Acad. Sci. (U.S.A.) 81: 3443- 3446 (1984)).   SSCP And DNA sequencing. Single-strand conformation polymorphism (Orita, M. et al., Pr. oc. Natl. Acad. Sci. USA 86: 2766-2770 (1989)). Child variants were sought. The TSC primers were as previously described. (Example 1 and Simon, DB et al., Nature Genet. 12: 24-30 (1996)); Two exons were replaced with 27 sets of specific primers (based on the genomic structure of the gene) Screening was performed using Table 6). Primer pairs as previously described (Shimkets, R.A., et al., Cell 79: 407-414 (1994)). Separate PCR using genomic DNA from family members or CEPH controls Used for. The amplified product was prepared under three different non-denaturing conditions and Denatured urine as described (Shimkets, R.A. et al., Cell 79: 407-414 (1994)). Molecular variants were analyzed by electrophoresis under elementary gel. Variant identified Was eluted from the gel, reamplified by PCR, and in all cases both The DNA from the strand was sequenced. All SSCP genotypes are independently amplified Confirmed.   result Family with Barter syndrome.At least one diagnosed as having Bartter syndrome Four families with human subjects were studied. One of these cases was previously reported (Di Pietro, A et al., Ped. Med. Chir. 13: 279-280 (1991)). this In three of these families, at least one affected subject had related blood. It is known that they are descendants of marriage (Fig. 6). In addition, in family tree BAR156, Two second cousins in the target case are also affected. The index cases (Table 5) are all Premature birth with a body weight of less than 2 kg with demonstrated polyhydramnios and markedly lower Severe dehydration associated with lithemia and hyperreninemia hyperaldosteronism In the neonatal period. All have pronounced hypocalciuria, and Three had evidence of ultrasonography for nephrocalcinosis; none of these patients had low magnetic There was no symptoemia. Early and severe presentation, hypercalciuria, amniotic fluid Multiple cases and nephrocalcinosis all have mutations in TSC as the cause of those diseases. With patients previously classified as having Gitelman syndrome and found to (Simon, DB et al., Nature Genet. 12: 24-30 (1996) )).   TSC Evolution. Bartter Syndrome Causes Thiazide-Sensitive Na-Cl Cotransporter (TSC) To determine if it was due to a mutation in And genotyped a marker highly linked to this locus on chromosome 16. . If Bartter's syndrome is due to a mutation in TSC, we will add these families. Affected subjects in this trait locus and closely linked Were predicted to be homozygous at the gene locus (Lander, E.S., et al., Science 236: 156). 7-1570 (1987)). D16S408 is linked to TSC at a recombination ratio of 1% (Simon, D .B. Et al., Nature Genet. 12: 24-30 (1996)). This marker is Have been shown to be heterozygous in all subjects; Analysis of linked adjacent markers indicates that these subjects have the same haplotype Was confirmed not to have the two inherited copies (data not shown). This These findings do not support mutations in TSC as a cause of Barter syndrome. this The conclusion is further on molecular variants due to single-stranded conformational polymorphisms (SSCPs). Of all 26 exons encoding TSC proteins (Orita, M. et al., Proc. Natl. Acad. Sci. (U.S.A.) 86: 2766-2. 770 (1989)). Variants that alter the encoded protein are Were not detected (data not shown).   Characterization of human NKCC2. NKC on its potential role in Bartter syndrome To study C2, we characterized the human NKCC2 locus (FIG. 7). . Dominant variants of human NKCC2 cDNA isolated from human kidney cDNA library Encodes a 1099 amino acid protein, which is expressed in rabbits (Payne, J.A. et al., P. roc. Natl. Acad. Sci. (U.S.A.) 91: 4544-4548 (1994)) (95% amino acid Gamba, G. et al., J. Biol. Chem. 26: 17713-17722 (1994). ) (93% identity) characterized by strong sequence similarity to NKCC2 cDNA Show. Furthermore, human NKCC2 is derived from NKCC1 from shark rectal gland (Xu, J.-C. et al., Proc. N atl. Acad. Sci. (U.S.A.) 91: 2201-2205 (1994)) (60% identity) and TSC (Simon, D.B. et al., Nature Genet. 12: 24-30 (1996)) (47% identity) Indicates similarities to be considered in the amino acid sequence.   Plasmid artificial chromosome (PAC) containing the human genome NKCC2 locus (Ioannou, P.A. Et al., Nature Genet. 6: 84-89 (1994)). One (NKCC2-6A) was found to contain all of the code exons. to this Yo Thus, it was possible to determine the intron-exon structure of a gene (see Methods. When). The NKCC2 protein is encoded in 26 exons (FIG. 7a); Trons range in length from 120 base pairs to 15 kb, and the coding region It spans all 80 kb in genomic DNA. The location of the intron-exon boundary is exon 1 9 are very similar to those found in the TSC (Simon, D.B. et al., N. ature Genet. 12: 24-30 (1996)). Three other variants of exon 4 are of other species (Igarashi, P. et al., Am. J. Physiol. 269: F405-F4l8 ( 1995)), encoded in genomic DNA. Somatic cell hybrid DNA as template By using primers from the genomic sequence that directs the PCR used, KCC2 was placed on human chromosome 15 (data not shown).   A (GT) dinucleotide repeat was identified at the cloned NKCC2 locus. This repeat is polymorphic in genomic DNA and has 5 alleles and 50 It was demonstrated to have 42% heterozygosity in unrelated subjects. This mer To localize NKCC2 on the human genetic map in a CEPH reference pedigree Genotyped; analysis linked loci to clusters at 15q15-21 Revealed. Multiple point analysis showed that the three centers adjacent to D15S132 and D15S209 The highest lod score of 13.3 was obtained for linkage to the zymorgan compartment (FIG. 7c). The preferred ratio for positions in this interval is the position in the next most probable compartment There was a possibility of more than 100 times the position (FIG. 7c).   Homozygous form of NKCC2 in Barter family.We found that in NKCC2 and in it Genotype members of the Barter syndrome family for four markers adjacent to Classified. In each family, all affected offspring of a related marriage are identified for each marker pair. It was homozygous for the progeny. And these haplotypes are Cosegregated, which results in Barter syndrome and NKCC2 It provides strong evidence to support the linkage of the locus (FIG. 6). In addition, BAR138 The affected subject is not known to be a descendant of a related marriage, but she also All markers tested in the segment were homozygous.Mutations in NKCC2 in Bartter syndrome. The data in these chains is Strongly suggest that the syndrome contributes to mutations at the NKCC2 locus, Motivates research into functional mutations at this locus in these patients I can. The primers in the NKCC2 intron were converted from the genomic DNA of the affected subject to PC Used to point R, and the products were analyzed by SSCP. Single new Variants are found in each kindred, and each is distinct from each other in disease phenotype. (Figures 6 and 8). All these variants are the two affected brothers in BAR156. Except for his younger brother, he is homozygous in the affected subject. In this ancestry, fingers The target case is homozygous for the new variant. Her affected second cousin Puts one inherited copy of the same variant with her haplotype part These subjects have a second, and so far undetected, Probably inherits the variant on the allele that the mother has inherited. These modifications The body tests 80 alleles from unrelated subjects without Bartter syndrome Was not observed. And, there is no variant that changes the amino acid sequence. It has not been detected in the relevant unaffected subject.   Analysis of the DNA sequences of these variants will alter the protein encoded by each. (Fig. 8). The variant in BAR152 is the first transmembrane domain. One base pair insertion to introduce a frameshift mutation at codon M195 in the in. BA The variant in R138 has a one base pair deletion in codon R302 in the fourth transmembrane domain. As shown, this also results in a frameshift mutation. Both of these variants It is rare to obtain proteins with normal functions.   The other two variants are among members of the NKCC family from distantly related species. Non-conservative missense mutations occur in conserved residues. At BAR156 A variant converts phenylalanine to valine at residue 272 in the third transmembrane domain. Replace. This valine residue is used for NKCC from human, rabbit, mouse, and rat. 2, and is conserved in shark and human NKCC1. Similarly, in BAR165 A variant of asparagine at amino acid 648 immediately adjacent to the twelfth transmembrane domain Replace the aspartic acid residue with aspartic acid; this aspartic acid residue also Conserved by all members of Millie.K⁺: Serum potassium (mM, nl 3.5-5.0 mM); HCO_Three： Serum bicarb onate) (mM, nl 23-26 mM); UCa / UCr: urine calcium: creatinine ratio (mM : MM; nl ratio 0.2-0.4). Renal calcification was determined by ultrasonography. Premature babies: born by 36 weeks of pregnancy . ND has not been implemented. All primers are in the intron except for the following: hNKCC2ex1A-reverse And hNKCC2ex1B-forward, these are in exon 1; hNKCC2ex26-reverse The orientation is distal to the normal stop codon. Consideration   Identification of individual mutations in NKCC2 that differentiate by disease has Characterize and frameshift or non-conserved at highly conserved residues Mutations in renal absorbable Na-K-2Cl cotransporter Constitutes evidence of causing Tarr syndrome. This finding is the basis of the molecular Establish a basis and allow genetic differentiation of this disorder from Gitelman syndrome. These findings provide insight into the molecular mechanisms underlying diseases inherited by ion transport in the kidney. Expand your knowledge. Five different genes that mediate sodium reabsorption in the kidney Mutations are now thought to be involved in four different Mendelian disorders (FIG. 9) (Shimkets, R.A., et al., Cell 79: 407-414 (1994); Hansson, J.H. Et al., Nature Genet. 11: 76-82 (1995); Chang, S.S., et al., Nature Genet. 12: 2 48-253 (1996); Simon, D.B., et al., Nature Genet. 12: 24-30 (1996)). further , Aldosteronism Treatable with Glucocorticoids (Lifton, R.P. et al., Nature  355: 262-265 (1992)), including the activity of mineralocorticoid receptors Mutations leading to overt and apparent mineralocorticoid excess syndrome (Mune, T. et al. Nature Genet. 10: 394-399 (1995)), Natrion in the distal nephron epithelium It works by increasing the activity of the microchannel.   Pathophysiology of the disease.Virtually all features of the pathophysiology of Bartter syndrome It can be explained by a mutation in the Na-K-2Cl cotransporter leading to a loss of capacity. This communal The feeder is placed on the thick ascending limb of the Henle loop and filtered of sodium Causes about 30% reabsorption of the amount (Greger, R., Physiol. Rev. 65: 760-797 (1 985)) (FIG. 9); consequently, loss of function is seen in affected patients This leads to significant salt elimination and reduced capacity, which causes dehydration. This allows Secretion of nin and increased levels of aldosterone, which lead to distant nephrogenesis. Ron amiloride-sensitive epithelial sodium channels through epithelial sodium channels Increased sodium reabsorption occurs. Sodium reabsorption through this channel Is indirectly related to the secretion of potassium and hydrogen ions, This produces hypokalemia alkalosis.   About 25% reabsorption of the filtered calcium also occurs in the thick ascending limb ( Sutton, R.A.R., et al., In The Kidney (ed. By Brenner, B.M. and Rector, F.C.) 551- 618 (Saunders, Philadelphia, 1981)). And this is this Nephron Segume Associated with sodium reabsorption in the plant. Therefore, re-absorption of sodium here The loss of yield is characteristic of hypocalciuria and kidney disease seen in these patients. It is expected to cause calcification.   Urine prostaglandin E2 levels are elevated in patients with Barter syndrome (Seyberth, H.W. et al., Pediatr. Nephrol. 1: 491-4). 97 (1987); Gill, J.R., Jr et al., Am. J. Med. 61: 43-51 (1976)); high PGE2 Levels can be produced by administration of loop diuretics (Dunn, MJ Kidney Int. . 18: 86-102 (1981). This results in a secondary increase in PGE2 levels Consistent with a genetic deletion of Na-K-2Cl function.   Classification of hypokalemia alkalosis. Inherited hypokalemia Alcalo Cis is genetically heterozygous and has at least two proteins Thick ascending limb Na-K-2Cl cotransporter (NKCC2) and distal convoluted tubule Na- It is now clear that mutations in the gene encoding Cl cotransporter (TSC) It is easy. Therefore, the clinical status of patients with mutations in these two genes And physiological characteristics are easily distinguishable. Hypokalemia alkalosis And presentation of neonatal period and hypercalciuria All patients with mutations in NKCC2, while hypokalemia alkalosis And all patients confirmed to have presentation and hypocalciuria after age 8 years Had a mutation in TSC (Simon, D.B., et al., Natuire Genet. 12: 24-30 (1996)). ).   All inherited hypokalemia alka with normal or hypotension Whether Rosis is due to a mutation in one of these two genes Or whether additional genetic heterozygotes are found . One group of patients had severe magnesium excretion, hypokalemia alkalosis. (Gullner syndrome) (Gullner, H.-G. et al., Am. J. Med. 71: 578-582 (1981)). Low potassium in these patients Mumemia has been reported to be associated with magnesium replacement. These patients And, perhaps, another of the spectrum of inherited hypokalemia alkalosis Seems like a different subset. Typically, low potassium in neonates Urinary prostaglandin levels in several patients with blood alkalosis Bell's findings suggest that hyperprostaglandinuria is another syndrome (high prostaglandin (Seyberth, H.W. et al., Pediatr. Nephrol). . 1: 491-497 (1987)). However, this result probably indicates that this group of patients A mutation in NKCC2 with hyperprostaglandinuria as a typical phenotype Prove that. Where the two supported by mutations in two different genes Evidence for different clinical syndromes of Gitelman syndrome or Bartter syndrome Support a logical framework for the classification of these patients as having any of the groups You.   Conversely, clinical and physiological features resulting from mutations in these two genes The scope of the signature also remains unspecified. Therefore, the patients studied Further phenotypic ranges are presented. Several people with hypokalemia alkalosis Patients have been reported to have normal urinary calcium; these patients , NKCC2, TSC, or another gene. As a result, genotype- Further testing of phenotypic relationships and specific phenotypes of specific mutant alleles Results, and stringent analysis based on variant analysis and clinical characteristics Kinds should be possible.   Disease morbidity. The proteins encoded by NKCC2 and TSC have similar high Closely related in terms of sequence, structure, and function that are conserved each time. From this The skilled artisan will appreciate the prevalence of mutant alleles in these genes, and the clinical disease Can be expected to be similar. But hypokalemia alkalosis Gitelman syndrome has been demonstrated by our experiments to recruit published patients with Patients (defined by presentation of hypocalciuria) with Bartter syndrome Significantly more than in patients with hypertension (defined by presentation of hypercalciuria) It is clear (Simon et al., Unpublished data). Greater morbidity and bars The morbidity associated with Tarr syndrome can reduce reproductive compatibility, thereby increasing this population. This results in an increased deletion of the mutant NKCC2 allele from the group.   There may also be differences in the rate of introduction of new mutant alleles at these loci. You. The most common sites for single base substitutions in mammals are these cytosine residues. Oligonucleotide Responsible for Methylation at the Group and Subsequent Deamination to Thymidine Nucleotides (Cooper, DN, et al., Hum. Genet. 83: 181-188 (1989)). This The prevalence of CpG dinucleotides in the coding regions of these two genes (prevalen There are significant differences in ce). The cytosine residue of CpG dinucleotide is TSC Occupies the first or second codon position of the 60 codons in There are only 30 such sites. This difference is simply due to differences in the amino acid sequence. As well as significant differences in codon usage. example For example, 30 of the 48 arginine codons in TSC have CpG dinucleotides However, only 15 of the 43 arginine residues in NKCC2 utilize such codons. (C2,1 df = 6.99, p <0.01). These differences are due to the CpG nucleic acid in NKCC2. It may reflect a stronger selection for otide, and code for these two genes. May be responsible for some of the large differences in the occurrence of GC base pairs in the 59% during SC, 45% during NKCC2).   Possible relevance in heterozygotes. Mutant NKCC2 allele is homozygous Although they have severe effects when combined, they also have the more common heterozygous It may have a phenotype that is detectable in the union. Among the possible phenotypes, Blood pressure is an appropriate reason for reduced sodium reabsorption in the thick ascending limb This leads to a lower set point of sodium balance and reduced intravascular volume. NKCC2 The ability of loop diuretics on hypotension due to the inhibition of this supports this possibility.   Another possible phenotype in heterozygotes is diuretic-induced low potassium Susceptible to bloodemia. Thiazide diuretics block TSC in distal convoluted tubules Harmful, commonly used antihypertensive agent; induced by thiazide Hypokalemia is a relatively common complication. About NKCC2 mutation Terozygosity results from increased distal resorption through the TSC in distal convoluted tubules. May compensate for reduced sodium reabsorption in the thicker ascending limb (Ellison, D.H. An n. Int. Med. 114: 886-894 (1991)) (Fig. 9). But by thiazide Inhibition of this latter cotransporter leads to distant nephrons with a marked potassium deficiency. Can be supplemented only by increased activity of epithelial sodium channels in This produces a significant discharge of salt. Therefore, heterozygous NKCC2 mutants are Can predispose to this specific complication of The carrier may make up a significant fraction of the patients who develop this complication.   The homozygous for the NKCC2 mutant has significant urinary calcium excretion This leads to early and severe nephrocalcinosis and significant demineralization of bone. NK Excretion of salt in the heterozygous form for the CC2 mutant is also associated with hypercalciuria Which results in nephrolithiasis (renal stones) and osteoporosis (bone demineralization) ), A potentially increased sensation for multifactorial traits with known inherited components Can cause receptivity. Interestingly, X-linked kidney chloride channels Have been shown to promote the development of nephrolithiasis (Lloyd, SE et al., N. 379: 445-449 (1996)), for the treatment of sodium and chloride in the kidney. Primary abnormalities cause stones to develop in a significant fraction of affected subjects Consistent with the view that it can be.   In addition to these mutations that are thought to cause loss of transport function, Variants in the gene may also lead to gain of function and potentially lead to the development of hypertension There is a possibility that it can contribute. Comparable situations are mutations that gain function are hyperblood Amiloride-sensitive epithelial sodium channels cause barotrauma Liddle syndrome Have been demonstrated (Shimkets, R.A., et al., Cell 79: 407-414 (1994); Hansson, J.H. et al., Nature Genet. 11: 76-82 (1995)). On the other hand, deletion of functional mutation Produces pseudohypoaldosteronemia type I, a salt excretory disease (Chang, S.S. et al. Nature Genet. 12: 248-253 (1996)) (Fig. 9).                                 Example 3  K ⁺ Barter syndrome (low) revealed by mutations in channel ROMK Genetically heterozygous for hypokalemia alkalosis with kaluria) Method Family with Barter syndrome. The families were recruited by identification of the affected index cases. Get Nom DNA is prepared from venous blood of members of a family with Barter syndrome by standard procedures. (Bell, G., et al., Proc. Natl. Acad. Sci. (U.S.A.) 78: 5759-5763 (198 1)).   Characterization of the human genome ROMK intron-exon junction. A single point of ROMK A genomic fragment containing a long and a portion of a neighboring exon is Nom DNA and published data (Shuck, ME et al., J. Biol. Chem. 269: 24). 261-24270 (1994)), using primers in each exon, PCR (long-range PCR) (ExpandTM Long PCR System; Boehringer-Mannheim) Was isolated. DNA sequence analysis of the product was performed using a standard process using the ABI 373A instrument. According to the protocol, dideoxy chain termination was used. Replace intron sequence with intron -To define primers to amplify exon boundaries and ROMK coding region Used (Table 9); additional linking sequences have been submitted to GENBANK.   Genotype and linkage analysis. The genotype classification of the locus indicated in the text As described previously (Simon, D.B. et al., Nature Genet. 13: 183-188 (1996)). Was performed by the polymerase chain reaction using specific primers. All remains Genotypes were scored separately by two researchers who were unaware of the morbidity . Analysis of linkage is described in the LINKAGE program, Lathrop, G.M. et al., Proc. Natl. Acad. Sc i. (U.S.A.) 81: 3443-3446 (1984)). By this, 99% Barter as an autosomal recessive trait with penetrance and 0.1% phenotypic replication The syndrome was identified.   SSCP And DNA sequencing. Polymorphism in single-stranded conformations (Orita, M. et al. Proc. Natl. Acad. Sci. (USA) 86: 2766-2770 (1989)). For molecular variants. NKCC2 and TSC primers have been previously described (Examples 1 and 2, and Simon, D.B. et al., Nature Genet. 12 : 24-30 (1996); Simon, D.B. et al., Nature Genet. 12: 24-30 (1996)). Plastic Immer pairs have been described previously (Simon, D.B. et al., Nature Genet. 13: 183. -188 (1996)) as a template for disease family members or control groups. Nom DNA was used to direct PCR. All primer pairs are 15 It produces products having a size between 0 and 300 base pairs. The amplified product is Different non-denaturing conditions and have been described previously (Simon, D.B. et al., Nature Ge net. 12: 24-30 (1996)), electrophoresis on denaturing urea gels The variants were analyzed. The identified variants are eluted from the gel and Amplified and in all cases DNA from both strands was sequenced. all All SSCP variants were confirmed by separate amplification.   result Family with Barter syndrome.   The present inventors have found that salts associated with hypercalciuria and prenatal position in the neonatal period. Excretion and hypokalemia associated with metabolic alkalosis with hypotension Nine families not previously reported to have Bartter syndrome Subjects from origin were investigated (Table 8). All patients had significantly increased plasma Aldos Had teron levels and plasma renin activity (data not shown). These illnesses Clinical and biochemical characteristics of individuals with previous mutations in NKCC2 Indistinguishable from the features found in patients found in Distinguished from those found in patients with mutations in C.NKCC2 Analysis   Affected subjects in these six kindreds were offspring of a marriage between a real cousin. Is known (Table 8). In these families, affected subjects Inherited markers from the same disease mutation and heterozygous great-grandparents Are likely to be heterozygous. Therefore, intra- and adjacent marker The test for homozygosity of the-is a test of linkage in such a kindred ( Lander, E.S., et al., Science 236: 1567-1570 (1987)). Therefore, we have: Highly polymorphic markers over a 3 cM interval, including NKCC2, in these relatives Car was genotyped; these loci were Homozygous in 5 previously studied families with Tarr syndrome Has been proven. In these three kindred families (BAR157, BAR181, BAR182) All affected subjects were as previously reported (Example 2, and Simo n, D.B. et al., Nature Genet. 13: 183-188 (1996)), based on mutations in NKCC2 In some or all of these families as disclosed (data not shown), Homozygous for the NKCC2 haplotype, consistent with Roter syndrome. Symmetry Homozygous by NKCC2 progeny in BAR159 and BAR161 pedigrees (Figure 10). In addition, at BAR159, the two affected offspring were NKCC2 Progeny inconsistent and unaffected offspring are compared to affected offspring Share the NKCC2 haplotype; in this family under a conservative model of trait loci By a traditional analysis of the chain in (see Methods), a lod score of -3.4 Negative chain with Furthermore, in affected members of any kindred, Loci closely linked to TSC are not homozygous (data Is not shown). These findings provide strong evidence for genetic heterogeneity in Barter syndrome And mutations in NKCC2 cause disease in BAR159 and BAR161 Indicates not to wake up. The conclusion is that all 26 exons encoding NKCC2 (Sim on, D.B. et al., Nature Genet. 13: 183-188 (1996)) for single-stranded conformation Polymorphism (SSCP) (Orita, M. et al., Proc. Natl. Acad. Scl. (U.S.A.) 86: 2766-2. 770 (1989)). Supported by failure to identify mutations in NKCC2 in affected subjects (Data not shown).   ROMK Analysis   These observations indicate that NKCC2 function, a functional That deletions in various mutations may explain disease in some of these families Motivated. The gene encoding ROMK has been cloned and A thron-exon organization has been defined (Yano, H. et al., Mol. P. harmacology 45: 845-860 (1994); Shuck, M.E. J. et al. Biol. Chem. 269: 242 61-24270 (1994)): differs at the amino terminus and in humans from 372 to 391 amino acids. Combine to produce three different ROMK proteins that vary in length up to noic acid There are five exons used in altering (Suck, M.E. Et al., J. Biol. Chem. 269: 24261-24270 (1994)). All isoforms are exon 5 Shares the nucleus of 372 amino acids encoded by; this 372 amino acid protein The quality corresponds to isoform R0MK2. All published intron sequence data To enable testing of all five exons and intron-exon boundaries Supplemented with additional intron sequence information disclosed herein (see methods). Thing).   Subjects with BAR159 and BAR161 were scanned for ROMK variants by SSCP. Cleaned. Homozygous ROMK variants have been shown to affect affected subjects in both families. And these variants segregated simultaneously with the disease (FIGS. 10 and 11a, b). These variants are not common in the population, so they Unaffected unrelated subjects and CEPH reference pedigree from Saudi Arabia Is not detected on 80 chromosomes derived from E. coli. This is achieved by homozygous mapping. We have identified these variants as rare and found that ROMK and The lod score for the Bartter syndrome linkage is 3.2, To support. Analysis of the DNA sequences of these variants was based on the homozygous variant in BAR159 ( Figure 11a) shows the termination of the chain from TAC encoding tyrosine and the first transmembrane domain. In the TAG that shortens the encoded protein before the codon, codon 60 (co (Don number) (Fig. 12). Homozygous variant in BAR161 Is a single into the sequence of six consecutive T residues spanning codon 13 to codon 14. This results in an insertion of the T-A base pair (FIG. 11b), which results in a forward coding from amino acid 15. Resulting in a frameshift mutation that alters the protein (Figure 12) Codon 54 causes premature termination. These findings suggest that mutations in ROMK Provides strong evidence for developing Barter syndrome in two families.   Seven additional Bartter syndrome families were then screened for ROMK variants. Learning. Two variants were identified in screening for NKCC2. Found in each of the two outbred families that were not indifferent. these None of the variants were found on 80 chromosomes from unaffected subjects. won. In BAR208, one variant resulted in a missense mutation and at codon 200 Replace arginine with serine (FIGS. 11d, 12).⁺Channel IRK It is highly conserved among members of the family, and Presents a protein kinase A phosphorylation site in the ruboxyl terminus; Has been shown to be phosphorylated by PKA and is Replacement of alanine with the normal K⁺What is required for channel activity Mutant ROMK shows an approximately 50% decrease in channel activity (Xu, Z-C. J. et al. Biol. Chem. 271: 9313-9319 (1996)). Present on other ROMK alleles A second variant in this kindred has another premature stop codon that occurs at codon 58. Which allows the protein encoded before the first transmembrane domain to be Shorten again (Figure 12). In BAR206, one variant is the last of codon T313. It shows a four base pair deletion over all of the bases and codon K314, thereby Causes a frame-shift mutation and encodes the forward encoded protein from amino acid 315 Changes in quality, ending with a new stop codon at position 350 (FIGS. 11c, 12). To this family The second variant in the amino acid 195 at the cytoplasmic carboxy terminus of ROMK This results in a substitution of valine for alanine (FIG. 12); And unrelated unaffected subjects stored in human ROMK Has not been observed. One additional non-NKCC2 variant not identified In the inbred BAR139, threonine is converted to methionine at amino acid M338. A single replacing ROMK variant was identified (FIG. 12); this variant was affected. Not found on 80 chromosomes from unsubjected subjects. At present, this No mutations on other ROMK alleles in affected subjects have been identified. K⁺: Serum potassium (mM, nl 3.5-5.0 mM); HCO_Three: Serum bicarbonate (mM, nl 23-2 UCa / UCr: urine calcium: creatine ratio (mM: mM; nl <0.4). Kidney stone Ash was determined by ultrasonography. Consang: descendants of kinship marriage. Primers hROMKex1, hROMKex2, hROMKex3, hROMKex4, and hROMKex5A-forward Is in the intron. All other primers are in exon 5.8. Consideration   Independence that dramatically changes channel structure and co-segregates with Bartter syndrome The findings of the ROMK mutants found that mutations in ROMK cause Barter syndrome. Testify. These findings establish the genetic heterogeneity of Bartter syndrome, and Has a relevance for genetic testing for the disease. In addition, these Role of ROMK in regulating Na-K-2Cl cotransporter activity in the gut and TAL K into the lumen⁺ Strongly supports in vivo net salt reabsorption by reverse recycling of invading cells I do. Mutations in NKCC2 and ROMK are the only mutations that cause Barter syndrome It is unknown whether this is a gene or if additional genes will be identified. Remains; therefore, all 15 families with independent barter mutations studied (Simon, D.B. et al., Nature Genet. 13: 183-188 (1996), and this study). Shows that NKCC2 variants are identified or involved by linkage in 10 families And ROMK mutations have been identified in 5 families. One outbred family Mutants in either ROMK or NKCC2 have not been found to date No. This may reflect incomplete sensitivity of mutant detection, or Can be explained by genetic heterogeneity. This finding is Six members, subunits, or mutations of human ion channels are found in humans Results in transporters that have been shown to affect blood pressure (Lifton, R.P., Sc ience 272: 676-680 (1996); Simon, DB et al., Nature Genet. 13: 183-188 (19 96)).   Homozygous immature termination and early flare in the encoded protein The findings of the time shift mutation (Figure 12) suggest that these ROMK mutants Provides very strong evidence that a sex loss occurs; this suggests that complete ROMK PKA phosphate as indicated by expression in Xenopus ovary cells required for activity (Xu, ZC. Et al., J. Biol. C.) hem. 271: 9313-9319 (1996)). In addition, the last 58 normal amino acids have been deleted Distal frameshift mutations in normal potassium channel function Strongly suggesting this essential role of the carboxy terminus. This variant and two The functional consequences of additional missense variants (A195V and M338T) are These can provide new insights into channel structure and function. Can be served. All mutations identified to date have been identified in all known ROMK isoforms. Thus, the activity of all isoforms is present in the shared core peptide, Expected to be affected by these mutations.   The pathophysiology seen in affected patients is the return of K from TAL cells to the renal duct.⁺of It can be explained by a loss of ROMK function that results in an inability to recycle, Lumen K too low to allow sustained Na-K-2Cl cotransporter activity⁺Raw level This results in the discharge of salt from this nephron segment. Excretion of this salt -Activation of the angiotensin system, increased aldosterone levels, and K⁺And And H⁺Epithelial sodium channel-mediated augmentation of distal nephrons in cell exchange Hypokalemia alkalo observed, causing delayed electrogenic sodium reabsorption Causes cis. Calcium reabsorption is due to Na in TAL⁺Related to reabsorption And Na in this segment⁺Loss of transport is characteristic of low calci in these patients. Leads to umuria.   At least one additional secreted potassium channel has been identified in TAL5 But the result is that these two K⁺Channels are not rich in features This indicates that this other channel cannot replace the loss of ROMK function. RO The MK isoform is also expressed at an additional distal site in the nephron, and this This same channel isoform has a net renal potassium secretion in the distal nephron (Lee, W.S. et al., Am. J. Physiol. (Renal Fluid Electrol. Physiol.) 268: F1124-31 (1995), Boim, M.A., et al., Am. J. Physio l. (Renal Fluid Electrol. Physiol.) 268: F1132-40 (1995), Hebert, S.C. Kidney Int. 48: 1010-1016 (1995)). Distal secretion is net kidney potassium Since this is a major determinant of secretion, deletion of this secreted potassium channel It is expected to produce impaired potassium secretion in response to Ron. as a result NKCC2 mutation (and intact distal K⁺Secretion) barter patient Higher potassium levels in the latter patients, from patients with mutations in ROMK Can be expected. Looking back, the same on both alleles Four patients with defined ROMK mutations have higher K⁺Show trends to levels (table 2, and Simon, D.B. et al., Nature Genet. 13: 183-188 (1996)) Are all well below the normal range. This finding suggests that ROMK isoforms Does not play an essential role in distal kidney potassium excretion in vivo And suggest. Further research will address this issue, and these two The Clinical Features of Patients with Mutations in the Gene of the Human Being Differentiated Clinically? Is needed to determine In addition, ROMK isoforms are also found in the brain, spleen, lungs, And expressed in the eye (Hebert, S.C., Kidney Int. 48: 1010-1016 (1995 )) Suggests an essential role for ROMK function in these organs There is no overt phenotype in patients with   Homozygous deficiency in ROMK function alters renal sodium handling Findings indicate that heterozygous carriers of the ROMK mutant are more dramatic due to haplotype deficiency. Raises the possibility of having a different phenotype. These potential phenotypes are Expected to be similar to previously suggested for two mutant heterozygotes (Simon, D.B. et al., Nature Genet. 13: 183-188 (1996)). It has dropped Includes blood pressure, and predisposition to osteoporosis and / or nephrocalcinosis. Hetero contact These possibilities can be tested using the ability to identify carriers of relapses. Likewise Increased renal sodium reabsorption underlies many variants of hypertension The finding is that acquisition of a functional mutation in ROMK results in increased renal sodium reabsorption. Raises the question of whether it contributes to elevated blood pressure. Net kidney The identification of ROMK as a key regulator of sodium reabsorption in the gut is implicated in this gene and A Variant of the Modulators of CD4 and ROMK Activity Play a Role in Determining Human Blood Pressure? Kano Motivate the decision. One skilled in the art will follow the methods and examples provided herein. Thus, the present invention disclosed in the present specification can be easily implemented.

[Procedure amendment] [Submission date] August 16, 1999 (August 16, 1999) [Content of amendment] 6.1 The description will be amended as follows. (1) specification page 7, line 2 from the bottom "Figure 2. Characterization of human genomic TSC locus." Shall be deemed to be replaced with a "Figure 2 (SEQ ID NO: 1 to SEQ ID NO: 24) of human genomic TSC loci Characterization. " (2) The description of page 8, lines 10 to 11 is " C. Sequence of human TSC protein. The sequence of human TSC protein is shown by one letter code. The corresponding sequence of rat and flounder TSC is shown below the human sequence . "Indicates" means " C. Sequence of human TSC protein (SEQ ID NO: 2) . The sequence of human TSC protein is shown by one letter code. Corresponding sequence of rat and flounder TSC (SEQ ID NO: 3 to SEQ ID NO: 24) Is shown below the human sequence. " (3) The description at page 10, lines 14 to 19, reads " Figure 7. Characterization of the human genomic NKCC2 locus . A. Intron-exon organization . Gray boxes indicate 26 exons encoding the NKCC2 protein. Exons beginning with the second or third base of the codon are indicated by subscripts 2 or 3, respectively, B. Sequence of the human NKCC2 protein (single letter code), corresponding rat and shark Figure 7 (SEQ ID NO: 25 to SEQ ID NO: 50) Characterization of the human genomic NKCC2 locus A. Intron-exon organization.The gray box indicates NKCC2 protein shows a 26 exons encoding indicating the first codon of the exon;.. the second or exon starting with the third base of the codon, respectively subscript 2 or 3 B The sequence of human NKCC2 protein (single letter code) (SEQ ID NO: 26) The corresponding rat and shark sequences (SEQ ID NOs: 27-50) are shown below the human sequence. (4) The third line from the bottom of page 14 of the description is “sequence number Is corrected to “SEQ ID NO: 2 and Table 3”. (5) The description, page 15, line 20 is changed to “SEQ ID NO: Is corrected to "Figure 4 and Tables 1 and 4". (6) In the description, page 16, line 15 Is corrected to “Fig. 7”. (7) In the description, page 17, line 7, "SEQ ID NO: Is corrected to “Fig. 8 and Table 7”. (8) In the description, p. To be disclosed. Is corrected to "The amino acid sequence is disclosed in Shuck et al., J. Biol. Chem. 269: 24261-24270 (1994)." (9) In the description, page 18, line 2, "SEQ ID NO: Is corrected to "Shuck et al." (10) The description, p. Is corrected to “Figure 11 and Figure 12 and Table 10”. (11) The description on page 43, lines 13 to 14 of the specification is “(primer hTSCGT14-A: 5′-GTGAGCCACTGCGCTTAGCTG-3 ′; hTSCGT14-B: 5′-C TGCTGAGCTCTGGTCTGGAG-3 ′)” Primer hTSCGT14-A: 5'-GTGAGCCACTGCGCTTAGCTG-3 '(SEQ ID NO: 51); h TSCGT14-B: 5'-CTGCTGAGCTCTGGTCTGGAG-3' (SEQ ID NO: 52)). (12) Table 2 on page 50 of the specification has been amended as shown in the separate document. (13) The description of page 60, lines 13 to 14 of the specification as “(NKCGT7-3F: CACTAGGCTATTGTGTGGCTC; NKCGT7-3R: GTCTGTCCTCCACACTAG)” is referred to as “(NKCGT7-3F: CACTAGGCTATTGTGTGGCTC (SEQ ID NO: 107); NKCGT7-3R” : GTCTGTCC TCCACACTAG (SEQ ID NO: 108)). (14) Table 6 on page 66 of the description has been amended as shown in the separate document. (15) Table 9 on page 78 of the specification has been amended as shown in the separate document.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/21 C12N 1/21 5/10 C12P 21/02 C C12P 21/02 C12Q 1/68 A C12Q 1 / 68 G01N 33/53 D G01N 33/53 C12N 5/00 A

Claims (1)

[Claims] 1. A method for determining the presence or absence of a mutant that confers a pathological condition mediated by altered ion transport, comprising the human thiazide-sensitive Na-Cl cotransporter gene, TSC; human ATP-sensitive K ⁺ Analyzing a nucleic acid sample for the presence of a mutation in a human gene selected from the group consisting of a channel gene, ROMK; and a human Na-K-2Cl cotransporter gene, NKCC2. 2. The method comprises the group consisting of Barter syndrome, Gitelman syndrome, hypokalemia alkalosis, hypokalemia alkalosis with hypercalciuria, kidney stones, hypertension, osteoporosis, and hypersensitivity to diuretic-induced hyperkalemia. 2. The method of claim 1, wherein the method is used to determine the presence or absence of a nucleic acid molecule that is characteristic of a more selected pathological condition. 3. The nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human TSC protein that is altered by one or more amino acids when compared to a wild-type human TSC protein, wherein the alteration in the TSC protein is determined by Gitelman The method according to claim 1, which is a diagnostic substance for a carrier of the syndrome (homozygous change) or Gitelman syndrome (heterozygous change). 4. The nucleic acid sample is analyzed for the presence of a nucleic acid molecule that encodes a human TSC protein, wherein the amino acid sequence is altered in one or more amino acids from an amino acid sequence selected from the group consisting of a wild-type TSC sequence. 5. The method according to 5. 5. 7. The method of claim 6, wherein the nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human TSC protein having an amino acid sequence selected from the group consisting of an altered TSC sequence. 6. The nucleic acid sample is analyzed for the presence of a nucleic acid molecule that encodes a human ROMK protein that is altered by one or more amino acids when compared to a wild-type ROMK protein, wherein the alteration in the ROMK protein is due to Bartter syndrome. The method according to claim 1, which is a diagnostic substance of a (homozygous state) or a Barter syndrome carrier (heterozygous state). 7. The nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human ROMK protein in which the amino acid sequence is altered in one or more amino acids from an amino acid sequence selected from the group consisting of a wild-type ROMK sequence. 7. The method according to 6. 8. The method of claim 7, wherein the nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human ROMK protein having an amino acid sequence selected from the group consisting of an altered ROMK sequence. 9. The nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human NKCC2 protein that is altered by one or more amino acids when compared to a wild-type NKCC2 protein, wherein the alteration in the NKCC2 protein is due to Barter syndrome The method according to claim 1, which is a diagnostic substance of a (homozygous state) or a carrier of Barter's syndrome (heterozygous state). 10. The nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human NKCC2 protein, wherein the amino acid sequence is altered in one or more amino acids from an amino acid sequence selected from the group consisting of a wild-type NKCC2 sequence. 10. The method according to 9. 11. The method of claim 10, wherein the nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human NKCC2 protein having an amino acid sequence selected from the group consisting of a mutated NKCC2 sequence. 12. The method comprising amplifying a nucleic acid molecule in the sample using a nucleic acid amplification method and primers that flank and selectively amplify at least one exon of the nucleic acid molecule encoding the TSC; 4. The method of claim 3, comprising identifying whether a mutation is present in the nucleic acid molecule. 13. The method comprising amplifying a nucleic acid molecule in the sample using a nucleic acid amplification method and primers that flank and selectively amplify at least one exon of the nucleic acid molecule encoding ROMK1; 7. The method of claim 6, comprising identifying whether a mutation is present in the nucleic acid molecule. 14． The method comprises the steps of amplifying a nucleic acid molecule in the sample using a nucleic acid amplification method and primers flanking and selectively amplifying at least one exon of the nucleic acid molecule encoding the NKCC2; 10. The method of claim 9, comprising identifying whether a mutation is present in the nucleic acid molecule. 15. A method for determining the presence or absence of a mutated protein that confers altered ion transport, comprising: a human thiazide-sensitive Na-Cl cotransporter protein, TSC; a human ATP-sensitive K ⁺ channel protein, ROMK; Analyzing a protein sample for the presence of a mutation in a protein selected from the group consisting of a Na-K-2Cl cotransporter protein, NKCC2. 16. The method comprises the group consisting of Barter syndrome, Gitelman syndrome, hypokalemia alkalosis, hypokalemia alkalosis with hypercalciuria, kidney stones, hypertension, osteoporosis, and hypersensitivity to diuretic-induced hyperkalemia. 16. The method of claim 15, used to determine the presence or absence of a mutated protein that is characteristic of a more selected pathological condition. 17． 16. The method of claim 15, wherein the protein sample is analyzed for the presence of a human TSC protein that is altered for one or more amino acids when compared to a wild-type human TSC protein. 18. 18. The method of claim 17, wherein the protein sample is analyzed for the presence of a human TSC protein in which the amino acid sequence has changed by one or more amino acids from the wild-type TSC sequence. 19. 19. The method of claim 18, wherein said protein sample is analyzed for the presence of a human TSC protein having an amino acid sequence selected from the group consisting of an altered TSC sequence. 20. 16. The method of claim 15, wherein the protein sample is analyzed for the presence of a human ROMK protein that is altered for one or more amino acids when compared to a wild-type human ROMK protein. 21. 21. The method of claim 20, wherein the protein sample is analyzed for the presence of a human ROMK protein in which the amino acid sequence has changed in one or more amino acids from a wild-type ROMK sequence. 22. 22. The method of claim 21, wherein the nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human ROMK protein having an amino acid sequence selected from the group consisting of an altered ROMK sequence. 23. 16. The method of claim 15, wherein the nucleic acid sample is analyzed for the presence of a nucleic acid molecule encoding a human NKCC2 protein that is altered by one or more amino acids when compared to a wild-type human NKCC2 protein. 24. 24. The method of claim 23, wherein the protein sample is analyzed for the presence of a human NKCC2 protein in which the amino acid sequence has changed by one or more amino acids from the wild-type NKCC2 sequence. 25. 25. The method of claim 24, wherein the protein sample is analyzed for the presence of a human NKCC2 protein having an amino acid sequence selected from the group consisting of an altered NKCC2 sequence. 26. 18. The method of claim 17, wherein the altered TSC protein is analyzed using a method selected from the group consisting of gel electrophoretic mobility, isoelectric point, and binding to a mutation-specific antibody. 27. 21. The method of claim 20, wherein the altered ROMK protein is analyzed using a method selected from the group consisting of gel electrophoretic mobility, isoelectric point, and binding to another specific antibody. 28. 24. The method of claim 23, wherein the altered NKCC2 protein is analyzed using a method selected from the group consisting of gel electrophoretic mobility, isoelectric point, and binding to another specific antibody. 29. An antibody that binds to altered human TSC protein but does not bind to wild-type human TSC protein. 30. 30. The antibody of claim 29, wherein the antibody does not bind to a human TSC protein whose amino acid sequence is selected from the group consisting of a wild-type TSC sequence. 31. 31. The antibody of claim 30, wherein said antibody binds to an altered human TSC protein having an amino acid sequence selected from the group consisting of an altered TSC sequence. 32. An antibody that binds to altered human ROMK protein but does not bind to wild-type human ROMK protein. 33. 33. The antibody of claim 32, wherein said antibody does not bind to a human ROMK protein whose amino acid sequence is selected from the group consisting of a wild-type ROMK sequence. 34. 34. The antibody of claim 33, wherein said antibody binds to an altered human ROMK protein having an amino acid sequence selected from the group consisting of an altered ROMK sequence. 35. An antibody that binds to altered human NKCC2 protein but does not bind to wild-type human NKCC2 protein. 36. 36. The antibody of claim 35, wherein the antibody does not bind to a human NKCC2 protein whose amino acid sequence is selected from the group consisting of a wild-type NKCC2 sequence. 37. 37. The antibody of claim 36, wherein said antibody binds to an altered human NKCC2 protein having an amino acid sequence selected from the group consisting of an altered NKCC2 sequence. 38. An isolated nucleic acid molecule encoding a human protein selected from the group consisting of a wild-type TSC protein, an altered TSC protein, a wild-type NKCC2 protein, an altered NKCC2 protein, and an altered ROMK protein. 39. A vector comprising the nucleic acid molecule of claim 38. 40. A host cell transformed to contain the nucleic acid molecule of claim 39. 41. 41. A method for producing an ion transport protein, comprising culturing the host of claim 40 under conditions wherein the nucleic acid molecule is expressed to produce the protein encoded thereby. 42. 42. A method of identifying an agent that affects ion transport, comprising determining whether the agent binds to a protein produced by the method of claim 41. 43. Having an amino acid sequence selected from the group consisting of a human wild-type TSC protein, a human altered TSC protein, a human wild-type NKCC2 protein, a human altered NKCC2 protein, and a human altered RO MK protein; Protein.