JP2001508286A - E. Immunogenic detoxification mutant coli LT-A toxin - Google Patents

Abstract

  (57) [Summary] Provided is an immunogenic detoxification protein comprising the amino acid sequence of subunit A of E. coli heat labile toxin (LT-A) or a fragment thereof, wherein at least amino acids Ala-72 of the A subunit are preferably Arg and Mutation. Toxoids are useful as vaccines against enterotoxigenic strains of E. coli and are produced by recombinant DNA means by site-directed mutagenesis. This is also an effective adjuvant.

Description

DETAILED DESCRIPTION OF THE INVENTION                   Immunogenic detoxifying mutant E. coli LT-A toxinField of the invention   The present invention relates to an immunogenic, detoxified, enterotoxin-producing strain of Escherichia coli (E. coli). Heat-labile toxin protein (LT) produced by With that protein Has at least the amino acid Ala-72 of the A subunit mutated. And the present invention Is a vaccine useful in the prevention or treatment of enterotoxin-producing E. coli infections Use as an adjuvant for other immunogenic proteins About. The toxoid of the present invention is a site-specific DNA encoding the wild-type toxin. Properly produced using recombinant DNA techniques by mutagenesis.Background of the invention   Heat-labile enterotoxin (LT) (produced by an E. coli enterotoxin-producing strain) Cholera toxin (CT) (produced by the strain V. cholerae) , A causative agent of traveler's diarrhea and cholera (Spangler (1992), Microbiol Rev  56: 622). LT and CT have 80% homology in primary structure and identical tertiary The structure is shown. They are composed of two functionally different domains: enzymes Active A subunit and B pentamer, the B pentamer Including rank. The A subunit is the target protein G, a GTP binding protein ADP-ribosylate (controls intracellular levels of cAMP) (Rappuoli and Pizz a (1991), Sourcebook of bacterial protein toxins, Academic Press NY). Increasing cAMP levels also induces intestinal secretion of water and chloride ions, May change transport.   CT and LT are both potent immunogens and antigens at the mucosal level Is a strong mucosal adjuvant when co-administered with See, for example, Jackson et al. (1993), Infect. Immun. 61; 4272; WO95 / 17211)). Wild type CT And the immunogenicity and adjuvant activity of LT have been extensively studied in animals. (Eg, Rollwagen et al. (1993), Vaccine 11: 1316). But those poisons Due to gender, the use of wild-type CT and LT in humans has previously been excluded. You. Trials to overcome the problems caused by the use of active holotoxins As such, two different approaches have been followed. One is B pentamer (Ie, the non-toxic domain of holotoxin) (eg, Holmgr (1992) Vaccine 10: 911) and the other genetically detoxifies LT and CT. (Eg, Fontana et al. (1995), Infect. Immun). . 63: 2356). Site-specific changes in both A and B subunits Immunological response induced by these molecules by mutagenesis and adjuvant A means is provided for investigating the basis of the response.   Examples of these experiments can be found below:     -Harford et al. (Eur J Blochem (1989) 183: 311) describe Ser-61-Phe and Gly-79- LT-A carrying the Lys substitution was generated.     -TSUji et al. (J. Biol Chem (1990) 265: 22520) possess a Glu-112-Lys substitution Generated LT-A.     -Burnette et al. (Infect. Immun. (1991) 59: 4266) carry an Arg-7-Lys substitution Generated CT-A. This study can also be found in WO92 / 19265.     -In WO93 / 13202, converted to Val-53, Ser-63, Val-97, Tyr-104, and Pro-106 Non-toxic CT and LT carrying differences are described.   A variant at the receptor binding site of the LT B subunit, i.e. the G33D mutation The body has been reported to lack the immunological properties of the natural B subunit. (Nashar et al. (1996) PNAS 93: 226), which discloses that binding to the receptor is an immunogen. It is important for gender. LT carrying mutant A subunit It has also been shown that non-toxic derivatives of (Eg, Magagnoli et al. (1996) 64: 5434), which is immune to ADP ribosylation activity. Suggests that it is not essential for its origin.   A great deal of data is available on adjuvanticlty But many questions also remain unanswered. In some studies, LT-B And CT-B have been suggested to have adjuvant activity, but The conclusions concluded are compromised by the inclusion of active toxins (Wilson et al. (1993) Vaccine 11 : 113). Studies using recombinant LT-B and CT-B have shown that these It has been suggested that they behave as bunts (eg, Douce et al. (1997), Infect . Immun. 65: 2821).   An assay to define the role of ADP-ribosylation activity in LT adjuvant activity Have produced conflicting results. Lycke et al. (Eur J Immunol (1992) 22: 2277 ) Describes a non-toxic LT derivative (LT-E112K). KL by oral route to mice When administered with H, it lost the adjuvant properties of wild-type LT. Soy sauce It has been suggested that adjuvant activity is associated with ADP-ribosylation activity. You. However, LT derivatives such as LT-K7 and LT-K63 (eg, Douce et al. (1997) Supra; Douce et al. (1996) PNAS 92; 1644; DiTommaso et al. (1996) Infect. Immun. 64: 974 ) (Lacking toxicity both in vitro and in vivo) Can elicit antibody responses to co-administered antigens in isolated mice Have been. LT-K63 was immunized intranasally with the synthetic peptide, followed by hydatid larvae (me asle) has been shown to induce specific CTL responses (Partidos et al. (1996) Immunol 89 : 483) and LT-K63 responds to H.pylori after intragastric immunization with H.pylori antigen Strongly amplify defenses. However, the anti-drugs induced by these non-toxic LT mutants Body titers were lower than the antibody titers obtained with the wild-type toxin, and two mucosal immunizations were performed. Detected only after epidemics (Douce et al. (1997), supra).   It is an object of the present invention to provide a method for LT that may be appropriate for use in humans. Retain as far as possible the immunogenic and immunogenic properties, detoxified LT It is to provide a form of.Summary of the Invention   According to a first aspect of the invention, E. coli heat labile toxin subunit A (LT-A) Immunogenic detoxification proteins containing amino acid sequences or fragments thereof In the proteins provided herein, the above sequences or fragments At least the amino acid Ala-72 is mutated.   As used herein, the term "detoxified" refers to when a toxoid is a wild-type toxin. Means reduced toxicity as compared to. Toxicity, mouse cells, CHO cells In the vesicles, by assessing morphological changes induced in Y1 cells, or preferably Can be measured by the rabbit ileal loop assay. For example, measured in Y1 cells `` Detoxified '' means that the toxoid is 10,000 times greater than the wild-type toxin Means a reduction in toxicity of more than   Tan used in an effective immunogenic composition without causing significant side effects For proteins, any residual toxicity should be sufficiently low. Within the scope of the present invention Certain variants may possess non-toxic activity.   As used herein, the term "residual toxicity" refers to a detoxified immunogenic protein. Can retain measurable toxicity. More specifically, the subject Immunogenicity and / or adjuvant while maintaining low enough toxicity to withstand Toxicity in the benefit / side trade-off to maximize bunt activity Levels can be optimized.   Therefore, these proteins have significantly lower toxicity than the wild-type protein. It has been detoxified in the sense that it has Sex can be preserved. The mutation causes a reduction in toxicity, which causes toxoid Suitable for use on   Most preferably, the toxicity of the toxoid is relative to a naturally occurring control. 10,0, as measured by assessing morphological changes induced in Y1 cells Rabbit ileal route performed more than 00 times or as described herein Decrease by more than 10-fold as measured by preassay.   As used herein, the term “toxoid” refers to a detoxified mutant toxin protein. Quality.   As used herein, reference to LT refers to various naturally occurring strain variants, as well as Do not significantly alter the characteristics of the subunits or the assembled holotoxin. And other mutations, including mutations. These mutations are, for example, It may be a conservative amino acid change that does not affect Brie construction.   References to LT-A also encompass fragments of LT-A, except that LT-A's flag Includes Ala-72 in the statement.   Most importantly, the toxoid is immune to the toxins from which it was derived. Must remain epidemiologically cross-reactive.   The immunogenic protein can be the LT subunit A toxoid, but is preferably Is an assembled holot containing LT-A toxoid and five LT-B subunits Holotoxoids, which themselves can be wild-type or Can be different.   LT-A derivatives (eg, fragments) or LT-A proteins from different E. coli strains In quality, the amino acid residues to be mutated are determined by Domenighini et al. (Molec. Microbio l. (1995) 15: 1165-1167), corresponding to Ala-72 as defined for LT-A. Amino acid residues. Ala-72 is the second α-helix of LT-A It is located in the third turn and faces the NAD binding site.   The mutation in Ala-72 can be a substitution, insertion, or deletion. Preferably different This is a substitution with an amino acid. The most preferred mutation is the substitution of Ala-72 for arginine. Yes, and its standard nomenclature is A72R.   The A72R variant retains residual toxicity, while other variants within the scope of the invention (Eg, a variant or chemical having one or more mutations at other sites) Toxoid which is further detoxified by tactical means).   Specific or individual amino acids (Ala-72 or May be a naturally occurring amino acid, or may be a modified amino acid. It can be an altered amino acid or a synthetic amino acid. However, the mutant must be Retains required immunogenic and detoxifying properties.   While retaining the steric effects of the substituted amino acids as much as possible, Substitutions that alter amphotericity and / or hydrophilicity are generally preferred. No.   The toxoids of the present invention can be chemically synthesized using conventional peptide synthesis techniques. However, it is preferably produced by recombinant DNA means.   Preferably, the toxoid is obtained in a substantially pure form.   According to a second aspect of the present invention, the immunogenic detoxified protein of the first aspect of the present invention. An immunogenic composition comprising a quality and a pharmaceutically acceptable carrier is provided. this The immunogenic composition can be a vaccine against the enterotoxin-producing strain of E. coli itself, Thus, an adjuvant may be further included as needed.   In addition to the typical properties of mutants lacking enzymatic activity, mutant proteins Also shows adjuvant activity.   Further, the immunogenic composition may be capable of eliciting an immunological response against another disease. May further be included. In such alternative compositions, the immunogenicity of the invention Can act as a mucosal adjuvant.   According to a third aspect of the present invention, the toxoid of the first aspect is used as an adjuvant. Use is provided.   According to a fourth aspect of the present invention, the immunogenic detoxified according to the first aspect of the present invention is provided. Administering an immunologically effective amount of the selected protein to an E. coli enterotoxin-producing strain. To vaccinate a mammal. If necessary, exclusion of the present invention The immunogenic detoxified protein is separated from the immunogenic detoxified protein of the present invention in a continuous manner. Adjuvant for a second immunogenic protein administered simultaneously or simultaneously Can act as   According to a fifth aspect of the present invention, an immunogenic detoxified tandem according to the first aspect of the present invention. A DNA sequence encoding a protein is provided.   Preferably, the DNA sequence is a DNA that has been detoxified in a polycistronic unit. Encode both subunit A and subunit B. Alternatively, this DNA Only poisoned subunit A can be encoded.   According to a sixth aspect of the present invention, a vector comprising a DNA sequence according to the fifth aspect of the present invention. Is provided.   According to a seventh aspect of the present invention, the vector is formed using the vector according to the sixth aspect of the present invention. A transformed host cell is provided.   This host cell is suitably adapted to produce the desired immunogenic detoxified protein. Any transfected host capable of expressing the DNA sequence according to the fifth aspect. But is preferably a bacterium, most preferably E. coli.   In a further embodiment for the seventh aspect of the present invention, the host cell is a host cell as such. Protective species (eg, lacking wild-type LT and immunizing according to the first aspect of the invention) original E. coli strain mutated to a phenotype that expresses a sex detoxification protein.   According to an eighth aspect of the present invention, a host cell according to the seventh aspect of the present invention is cultured. Producing an immunogenic detoxified protein according to the first aspect of the present invention comprising the steps of: Process is provided.   According to a ninth aspect of the present invention, a DNA encoding wild-type LT-A or a flag thereof Subjecting the fragment to a site-directed mutagenesis according to a fifth aspect of the present invention. A process is provided for producing A.   According to a tenth aspect of the present invention, an immunogenic detoxifying tank according to the first aspect of the present invention. The protein is combined with a pharmaceutically acceptable carrier and, if necessary, an adjuvant. A process for the formulation of an immunogenic composition according to the second aspect, comprising the step of associating Seth is provided.   According to an eleventh aspect of the present invention, the subject is provided with the immunogen according to the second aspect. Administering to the subject an immunologically effective dose of the sexual composition. Methods for prevention or treatment are provided.Industrial applicability   The immunogenic detoxified protein of the present invention is useful for preventing infection by enterotoxin-producing strains of E. coli. It may constitute the active ingredient of a vaccine composition useful for prevention and treatment. Immunogenic detoxification The protein can also be used in a vaccine composition as a mucosal adjuvant. Obedience Thus, the composition is available for use in the pharmaceutical industry.Description of the drawings   Figures 1-5 show wild-type LT, mutant LT-A72R (also shown as "LTR72"), 1 shows the biochemical and biological properties of mutant LTK63: FIG. x is the chromatography profile on the column, peak I is the holotoxin And peak II corresponds to EDTA in buffer; FIG. FIG. 3 is a western blot of an in vitro digestion experiment; FIG. 4 shows the results of ADP-ribosylation in E. coli; and FIGS. 2 shows the results of toxicity experiments in vivo and in vivo.   FIG. 6 shows the serum anti-OVA antibody response after three intranasal immunizations (indicated by arrows). . FIG. 7 shows the IgG subclasses after these three immunizations. FIG. 8 shows the results after these three immunizations. Shows IgA levels in serum samples (8A) and nasal washes (8B) of Values and standard deviations are indicated).   FIG. 9 shows serum anti-LT Ig (9A) and IgA (9B) responses.   FIG. 10 shows an OVA-driven proliferative response. Background values (OVA on culture ) Varied between 1000 cpm and 3000 cpm.   FIG. 11 shows the intranasal immunization with wild-type LT, and mutant A72R, and mutant K63. Shows efficacy against systemic challenge. 11B pillars are average titers, points are individual forces Value. Sunspots indicate mice immunized with LTB and not protected against challenge. Shows the titer fromDETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION   The practice of the present invention will be, unless otherwise indicated, molecular biology, microbiology, recombinant DNA, And using conventional techniques of immunology, which are within the skill of the art. like this The technique is explained fully in the literature. For example, Sambrook et al., MOLECULAR CLON ING; A LABORATORY MANUAL, 2nd edition (1989); DNA CLONING, Volumes I and II (D.N G lover, 1985); OLIGONUCLEOTIDE SYNTHESIS (M.J.Gait, 1984); NUCLEIC ACID H YBRIDIZATION (B.D.Hames and S.J.Higgins eds. 1984); TRANSCRIPTION AND TRANSL ATION (B.D.Hames and S.J.Higgins eds. 1984); ANIMAL CELL CULTURE (R.I.Freshne y 1986); IMMOBILIZED CELLS AND ENZYMES (IRL Press, 1986); B. Perbal, A PRAC TICAL GUIDE TO MOLECULAR CLONING (1984); series, METHODS IN ENZYMOLOGY ( Academic Press, Inc.); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J.H.Mill er and M4.P. Calos ed. 1987, Cold Spring Harbor Laboratory), Methods in Enzy mology Volumes 154 and 155 (Wu and Grossman and Wu, respectively), Maye r and Walker (1987), IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR BIOLO GY (Academic Press, London), Scopes, (1987), PROTEIN PURIFICATION: PRINCIPLE S AND PRACTICE, 2nd edition (Springer-Verlag, N.Y.), and HANDBOOK OF EXPERIMEN TAL IMMUNOLOGY, Volume I-IV (ed by D.M.Weir and C.C.Blackwell 1986)See .   Standard abbreviations for nucleotides and amino acids are used herein. All publications, patents and patent applications cited herein are incorporated by reference. Is done.   In particular, the following amino acid abbreviations are used: Alanine A Ala Arginine R Arg Asparagine N Asn Aspartic acid D Asp Cysteine C Cys Glycine G Gly Glutamic acid E Glu Glutamine Q Gln Histidine H His Isoleucine I Ile Leucine L Leu Lysine K Lys Methionine M Met Phenylalanine F Phe Proline P Pro Serine S Ser Threonine T Thr Tryptophan W Trp Tyrosine Y Tyr Valin V Val   As mentioned above, examples of immunogenic detoxifying proteins that can be used in the present invention are: Derived from the natural amino acid sequence of the protein, in addition to the mutation sites described in detail Includes polypeptides having a small number of amino acid changes.   Rather than isolating and purifying proteins from natural sources, recombinant DNA A significant advantage of producing immunogenic detoxified proteins by technology is that equal amounts of protein Quality is lower than the starting material required to isolate proteins from natural sources Can be produced by using no starting material. Recombines protein Producing by technology also means that the protein is not normally present in the cell. In the absence of any such proteins. In fact, human tampa Protein compositions that are completely free of any traces of carbon contaminants are easily produced Can be done. Because only human proteins produced by recombinant non-human hosts Because it is a pending recombinant protein. Potential from natural sources Viral factors and viral components pathogenic to humans are also avoided. Also genetic Childly detoxified toxins are more toxic than more traditional chemically detoxified toxins Does not seem to return to form.   Pharmaceutically acceptable carriers are antibodies that are themselves harmful to the individual receiving the composition Includes any carrier that does not induce the production of A good career is typically a large Kina, slowly metabolized macromolecules (eg, proteins, polysaccharides, polylactic acid, Polyglycolic acid, polymeric amino acids, amino acid copolymers, lipid aggregates (eg Oil droplets or liposomes) and inactive virus particles). Such a key Carriers are well known to those skilled in the art. In addition, these carriers provide immunostimulants ( Adjuvant).   Preferred further adjuvants to enhance the efficacy of the immunogenic composition are Including, but not limited to: aluminum salts (alum) (eg, Aluminum hydroxide, aluminum phosphate, aluminum sulfate etc.), other specific Containing an immunostimulant (eg, muramyl peptide or bacterial cell wall component) Oil emulsion formulations (e.g., (1) MF59 (published international patents) Contain various amounts of MTP-PE (see below)), Microfluidizer (eg, Model 110Y microfluidizer) Formulated into submicron particles using Iser (Microfluidics, Newton, MA 02164) (2) SAF (10% squalene, 0.4% Tween 80, 5% pluronic block) Polymer L121 and thr-MDP (see below), Or microfluidized into an emulsion of less than Or vortexed to create a larger particle size emulsion Or (3) RIBI<sup>TM</sup>Adjuvant System (RAS) (Ribli Im mu From lulipid A (MPL), trehalose dimycolate (TDM) and cell wall skeleton (CWS) One or more bacterial cell wall components (preferably MPL + CWS (Detox<sup>TM</sup>) , Muramyl peptides (eg, N-acetyl-muramil-L-threonyl-D-isoglu Tamine (thr-MDP), N-acetyl-normuramyl-L-alanyl-D-iso-glutamine (no r-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2- (1 '-2'-Dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) -ethylamido (MTP-PE)), and cytokines (eg, interleukin (IL-1, I L- 2), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TMF), etc.) Including). Additionally, saponin adjuvants (eg, Stimulon<sup>TM</sup>(Cambridge Biosc ience, Worcester, MA)) or particles made therefrom (eg ISCOMS Stimulation complexes)) can be used. Plus Complete Freund's Adjuvant (CFA) And incomplete Freund's adjuvant (IFA) can be used. Alum and And MF59 are preferred.   The immunogenic detoxifying protein of the present invention can be used to treat or treat the human or animal body. Adjuvant of a second antigen in an immunologically active composition for inoculation of Kuching Can be used as   Immunogenic compositions (eg, antigens, pharmaceutically acceptable carriers and adjuvants) G) is typically a diluent (eg, water, saline, glycerol, ethanol) Etc.). In addition, auxiliary substances (eg wetting or emulsifying agents, pH buffered substances) Quality) can be present in such vehicles.   Typically, the immunogenic composition will be injectable, either as a liquid solution or a suspension. Solid solution suitable for solution or suspension in liquid vehicles before injection. Body forms can also be prepared. The preparation can also be emulsified or pharmaceutically acceptable. Liposo for enhanced adjuvant effects as described above under possible carriers Can be encapsulated.   An immunogenic composition used as a vaccine comprises an immunologically effective amount of an antigenic poly Includes the peptide, as well as any other components described above, as needed. "Immunologically An `` effective amount '' is the amount of that amount administered to the individual, either in a single dose or as part of a series. It means that the administration is effective for treatment or prevention. This amount depends on the individual being treated. Health and physical condition, taxonomic groups of individuals to be treated (eg, non-human Primates, primates, etc.), the ability of the individual's immune system to synthesize antibodies, the degree of protection desired, Depends on vaccine prescribing, assisting physician in treating medical situation, and other relevant factors Change. This amount should be in a relatively wide range that can be determined by routine testing. Is expected.   The immunogenic composition can be administered parenterally (eg, either subcutaneously or intramuscularly). Conventionally administered). Further formulations suitable for other modes of administration are Including oral and pulmonary formulations, suppositories and transdermal applications. Dosing treatment is a single dose schedule Schedule or multi-dose schedule. Vaccines are used with other immunomodulators They can be administered together.   As used herein, the term “recombinant polynucleotide” refers to a genomic, cDNA, semi- Synthetic, or polynucleotides of synthetic origin, are intended to By operation, (1) binding to all or a part of the polynucleotide that naturally binds Or (2) link to a polynucleotide other than the polynucleotide linked naturally. Or (3) not naturally occurring.   As used herein, the term "polynucleotide" refers to a ribonucleotide or A polymeric form of nucleotides of any length, of any of the deoxynucleotides Say. This term refers only to the primary structure of the molecule. Thus, the term double-stranded And single-stranded DNA and RNA. A known type of modification (eg, known in the art Labeling, methylation, “caps”, one or more naturally occurring nucleotides and Substitution with logs, internucleotide modifications (eg, uncharged linkages (eg, methylphos Phonates, phosphotriesters, phosphoramidates, carbamates, etc.) and Has a charged linkage (eg, phosphorothioate, phosphorodithioate, etc.) ), Pendant moieties (eg, proteins (eg, nucleases, toxins, Antibody, signal peptide, poly-L-lysine, etc.) Those having a calator (eg, acridine, psoralen, etc.), chelators Containing (eg, metals, radioactive metals, boron, metal oxides, etc.), alkylation Agents, those having modified linkages (eg, alpha anomeric nucleic acids, etc.) ), As well as unmodified forms of polynucleotides).   "Replicons" function as autonomous units of polynucleotide replication in cells Any genetic element (eg, plasmid, chromosome, virus, cosmid, etc.) That is, it can replicate under its own control. This may include a selectable marker.   A "vector" causes the replication and / or expression of the attached segment. A replicon to which another polynucleotide segment is attached.   "Control sequences" are necessary to effect expression of the coding sequence to which they are linked. Refers to a polynucleotide sequence. The nature of such control sequences depends on the host organism. In prokaryotes, such control sequences are commonly associated with a promoter. , A ribosome binding site, and a transcription termination sequence; common in eukaryotes In addition, such control sequences include promoters and transcription termination sequences. The term " `` Sequence '' is intended to include, at a minimum, all components whose presence is necessary for expression. And additional components whose presence is advantageous, such as leader sequences and Fusion partner sequence).   "Operably linked" means that the components so described are those components Juxtaposition in a relationship that allows it to function in its intended manner. Code array A control sequence "operably linked" to a control sequence is one in which the expression of the coding sequence matches the control sequence. In such a way as to be achieved under optimized conditions.   An “open reading frame” (ORF) is a polypeptide encoding a polypeptide. Region of a nucleotide sequence; this region may be part or all of the coding sequence. The coding sequence can be shown.   A “coding sequence” is usually mediated by mRNA when placed under the control of appropriate regulatory sequences. A polynucleotide sequence that is translated into a polypeptide. The boundaries of the code array are , The translation start codon at the 5 'end and the translation stop codon at the 3' end. Ko Sequence can include, but is not limited to, cDNA and recombinant polynucleotide sequences. Not determined.   "PCR" is described in Saiki et al., Nature 324: 163 (1986); and Scharf et al., Science (1986). 233: 1076-1078; and U.S. 4,683,195; and U.S. 4,683,202 Polymerase chain reaction technology.   As used herein, x is y if x is not naturally associated with y in the same manner. Is "heterologous" with respect to; that is, x is not naturally associated with y, or x is Does not combine with y in the same manner as found in nature.   "Homology" refers to the degree of similarity between x and y. Distribution derived from one form The correspondence between a sequence and another sequence can be determined by techniques known in the art. For example, They can be determined by direct comparison of polynucleotide sequence information. Or Homology depends on conditions for forming a stable duplex between homologous regions (eg, S₁Use before digestion Hybridization under the conditions used), followed by 1 Digestion with strand-specific nuclease (s), followed by digestion fragmentation Can be determined by determining the size of the   The term "polypeptide" as used herein refers to a polymer of amino acids, And no specific length of the product; therefore, peptides, oligopeptides and proteins Protein is included within the definition of polypeptide. The term also refers to a polypeptide References to post-expression modifications (eg, glycosylation, acetylation, phosphorylation, etc.) are also excluded. Do not remove. For example, one or more amino acid analogs (eg, unnatural amino acids , Polypeptides having a substituted bond, and Other modifications known in the art, both naturally occurring and non-naturally occurring. Is included in the definition.   A polypeptide or amino acid sequence “derived from” the indicated nucleic acid sequence The amino acid sequence of the polypeptide encoded by the sequence or a portion thereof (where the portion is At least 3-5 amino acids, more preferably at least 8-10 amino acids, more preferably More preferably consists of at least 11-15 amino acids) Has or is immunologically identical to the polypeptide encoded by this sequence , Polypeptide. This terminology also refers to the number of expressed points from the indicated nucleic acid sequence. Including repeptides.   Proteins can be monoclonal or polyclonal, specific for the protein It can be used to generate any antibody. To generate these antibodies Methods are known in the art.   "Recombinant host cells", "host cells", "cells", "cell cultures", and other Such terms include, for example, the recipient of a recombinant vector or other transfer DNA. Microorganisms, insect cells, and mammals that can be or are used as Animal cells are shown and include the progeny of the first cell transformed. Single parent cell Offspring may be in form or due to natural, accidental or deliberate mutations Not necessarily completely identical to the first parent in the genome or in the total DNA complement It is understood that it is good. An example of a mammalian host cell is the Chinese hamster ovary (CHO) cells and monkey kidney (COS) cells.   Specifically, a "cell line" as used herein is continuous or extended in vitro. Refers to a population of cells that can proliferate and divide. Often, cell lines are single A clonal population derived from progenitor cells. In addition, spontaneous or induced changes Are likely to occur in the karyotype during storage or transfer of such clonal populations. Is known in the art. Thus, cells derived from the mentioned cell lines are It may not be exactly the same as the cell or culture, and the cell line referred to And the like. The term "cell line" also includes immortalized cells. Preferably , The cell line may be a hybrid to a non-hybrid cell line or to only two cell types Includes   As used herein, the term "microorganism" refers to prokaryotic and eukaryotic microbial species. (Eg, bacteria and fungi), the latter including yeasts and filamentous fungi.   As used herein, “transformation” refers to the method used for insertion (eg, , Direct uptake, transduction, F-junction or electroporation) And the insertion of an exogenous polynucleotide into a host cell. Exogenous polynucleotide Can be maintained as a non-integrated vector (eg, a plasmid), or Alternatively, it can be integrated into the host genome.   "Genome" is a DN derived from a restriction fragment cloned into a vector. A collection or library of A molecules. This is all of the genetic material of an organism Or a portion.   "CDNA" means a complementary DNA sequence that hybridizes to the complementary strand of DNA.   "Purified" and "isolated" refer to polypeptide or nucleotide sequences. When referring to a column, the indicated molecule is substantially free of other biological macromolecules of the same type. Means to be present. As used herein, the term "purified" Preferably at least 75% by weight of the same type of biological macromolecule present, more preferably Preferably at least 85% by weight, even more preferably at least 95% by weight, most Preferably means at least 98% by weight (but water, buffer, and other low (Especially those having a molecular weight of less than 1000).   Once the appropriate coding sequence has been isolated, a variety of different expression systems; Expression systems used with biological cells, baculoviruses, bacteria and yeast Can be expressed. i. Mammalian system   Mammalian expression systems are known in the art. Mammalian promoters MRNA that binds to a coding sequence (eg, a structural gene) Any DNA sequence capable of initiating downstream (3 ') transcription to Promoter initiates transcription Region, which is usually placed proximal to the 5 'end of the coding sequence, and Are usually located 25-30 base pairs (bp) upstream of the transcription start site. TATA box is It may lead RNA polymerase II to initiate RNA synthesis at the correct site. Mammalian promoters are also usually located within 100-200 bp upstream of the TATA box , Upstream promoter elements. The upstream promoter element is responsible for transcription Determine the speed to be initiated and can work in either direction (Sambrook et al. (198 9) "Cloning gene expression in mammalian cells"Molecular Cloning: A La boratory Manual. 2nd edition ).   Mammalian viral genes are often highly expressed and have a broad host range. Thus, sequences encoding mammalian viral genes are particularly useful promoters. Provide the data sequence. SV40 early promoter, mouse mammary tumor virus LTR promoter Motor, adenovirus major late promoter (AdMLP), and herpes simplex A viral promoter is an example. In addition, due to non-viral genes The resulting sequence (eg, the mouse metallothionein gene) is also a useful promoter. Provide a sequencer. Expression is determined by the promoter being glucosided in hormone-responsive cells. Constitutive or regulatory (inducible), depending on what can be induced with corticoids It can be either.   An enhancer element (D Enhancer) usually increases expression levels. Enhancers are of the same type Or a regulatory DN capable of stimulating transcription up to 1000-fold when linked to a heterologous promoter A sequence, synthesis begins at the normal RNA start site. Enhancers also But more than 1000 in normal or flipped orientation or from promoter May be located either upstream or downstream of the transcription start site, at either nucleotide distance. Active (Maniatis et al. (1987)Science 236: 1237; Alberts et al. (1989)Molecular Bi ology of the Cell , 2nd edition). Enhancer elements derived from viruses are: They can be particularly useful because they have a broader host range than usual. SV40 early remains Denko Enhancer (Dijkema et al. (1985)EMBO J.4: 761) and Rous sarcoma virus Long terminal repeat (LTR) (Gorman et al. (1982b)Proc.Natl.Acad.Sci.79: 6777) and hi Tocytomegalovirus (Boshart et al. (1985)Cell 41: 521) / Promoter is an example. In addition, some enhancers are regulated Possible, and the presence of inducers (eg, hormones or metal ions) Active only in the presence (Sassone-Corsi and Borelli (1986)Trends Genet.2: 215 (Maniatis et al. (1987) Science 236: 1237).   DNA molecules can be expressed intracellularly in mammalian cells. Promoter arrangement The rows can be directly linked to the DNA molecules. In this case, the first N-terminal of the recombinant protein The amino acid is always methionine, encoded by the ATG start codon. As desired If present, the N-terminus is tamper proof by in vitro incubation with cyanogen bromide. Can be cut from the substrate.   Alternatively, the foreign protein may also be a component of the foreign protein in mammalian cells. A key encoding a fusion protein consisting of a leader sequence fragment By making a mela DNA molecule, it can be secreted from the cells into the growth medium. Preferred Alternatively, leader fragments that can be cleaved either in vivo or in vitro There is a processing site encoded between the gene and the foreign gene. Leader sequence Fragments are usually hydrophobic amino acids that direct the secretion of proteins from cells. Encodes a signal peptide consisting of an acid. Three parts of adenovirus Is a leader sequence that provides for the secretion of foreign proteins in mammalian cells. It is an example.   Usually, transcription termination and polyadenylation sequences recognized by mammalian cells are: A regulatory region located 3 'to the translation stop codon, and Along with the element, adjacent to the coding sequence. 3 'end of mature mRNA is site-specific transcription Formed by post-cleavage and polyadenylation (Birnstiel et al. (1985)Cell 41: 349 Proudfoot and Whitelaw (1988) "Termination of eukaryotic RNA and 3'-terminal processing. Gu "Transcription and splicing(Edited by B.D.Hames and D.M.Glover); Proudfoot (1989)Trends Biochem.Sci.14: 105). These sequences are encoded by DNA Directs the transcription of an mRNA that can be translated into a polypeptide. Transcription terminator / poly Examples of adenylation signals include those derived from SV40 (Sambrook et al. (1989) Culture Expression Of Cloned Genes In Mammalian Cells "Molecular Cloning: A Laboratory Manual ).   Some genes can be found in the presence of introns (also called intervening sequences) It can be expressed more efficiently. However, some cDNAs Vector (also called splice donor and acceptor sites) (Eg, Gothing and Sambrook (1981)Nature 293: 620). Introns are splice donor and acceptor sites And intervening non-coding sequences within the coding sequence. They are the primary transcript poly After adenylation, they are removed by a process called "splicing" (Nevi ns (1983)Annu.Rev.Biochem.52: 441; Green (1986)Annu.Rev.Genet.20: 671; Padget t et al. (1986)Annu.Rev.Biochem.551119; Krainer and Maniatis (1988) RNA Sp Ricing "Transcription and splicing(Edited by B.D.Hames and D.M.Glover)).   Usually contains a promoter, polyadenylation signal, and transcription termination sequence. The components described are assembled into an expression construct. Enhancer, functional splice Introns with donor and acceptor sites and leader sequences are also included. It can also be included in the expression construct if desired. Expression constructs are often (Eg, stable maintenance in the host (eg, mammalian cells or bacteria) In extrachromosomal elements (eg, plasmids). Mammalian replication system Include those derived from animal viruses, which are trans-acting factors Need. For example, papovavirus (for example, SV40 (Gluzmnan (1981)Cell 23 : 175) or a plasmid containing the polyoma virus) replication system Replicate to extremely high copy numbers in the presence of T antigen. Mammalian replicons Examples include bovine papillomavirus and Epstein-Barr virus Including those that do. In addition, a replicon may have two replication systems, thus For example, in mammalian cells for expression and for cloning and amplification. To be maintained in a prokaryotic host. Such mammals - An example of a bacterial shuttle vector is pMT2 (Kaufman et al. (1989)Mol.Cell.Biol.9: 946) and And pHEBO (Shimizu et al. (1986)Mol.Cell.Biol.6: 1074).   The transformation procedure used depends on the host to be transformed. Heterogeneous polynucleated Methods for the introduction of otide into mammalian cells are known in the art, and Kistran-mediated transfection, calcium phosphate precipitation, polybrene-mediated Transfection, protoplast fusion, electroporation, liposomes Encapsulating the polynucleotide (s) in the genome and nucleating the DNA Including direct microinjection.   Mammalian cell lines that can be used as hosts for expression are known in the art, And many immortalized cells available from the American Type Culture Collection (ATCC) Cell lines (Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney Monkey (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), And a number of other cell lines. ii. Baculovirus system   The polynucleotide encoding the protein can also be included in a suitable insect expression vector. It can be inserted and operably linked to control elements in the vector. Vector constructs use techniques known in the art.   Generally, components of an expression system include a transfer vector (usually a bacterial plasmid), This is a fragment of the baculovirus genome and the expressed heterologous gene (single Or more) of convenient restriction sites for insertion; Wild-type baculovirus having a sequence homologous to a urovirus-specific fragment (This allows for homologous recombination of the heterologous gene into the baculovirus genome) And suitable insect host cells and growth media.   After inserting the DNA sequence encoding the protein into the transfer vector, the vector and And wild-type viral genomes are And transfected into an insect host cell. Packaged recombinant ui Ruth is expressed and recombinant plaques are identified and purified. Baculoi Materials and methods for the Rus / insect cell expression system are described, inter alia, in Invitrogen, San Diego C It is commercially available in kit form from A ("MaxBac" kit). These technologies are common Are well known to those skilled in the art, and are described in Summer and Smith,Texas Agricultural Exper iment Station Bulletin No.1555 (1987) ("Summer and Smith" below) Will be fully described.   Before inserting the DNA sequence encoding the protein into the baculovirus genome, Promoter, leader (if desired), coding sequence of interest, and transcription termination The above-described components, including the sequence, are usually used in intermediate transplacement constructs (translocation ). This construct is a single gene and operably linked Adjusting elements; each operably linked adjusting elements of its own set Multiple genes with the same set of genes; or multiple genes regulated by the same set of regulatory elements. It may contain several genes. Intermediate transposition constructs are often replicon (eg, Extrachromosomal elements that can be stably maintained in the host (eg, bacteria) Mid)). Replicons have a replication system, which is To be maintained in a suitable host for cleaning and amplification.   Currently, the most commonly used transfer vectors for introducing foreign genes into AcNPV The target is pAc373. Many other vectors known to those of skill in the art have also been designed I have. These include, for example, changing the polyhedrin start codon from pVL985 (ATG to ATT) And introduces a BamHI cloning site 32 base pairs downstream from the ATT; Luckow and And Summers,Virology(1989)17: 31).   Plasmids also usually contain polyhedrons for selection and propagation in E. coli. Phosphorpolyadenylation signal (Miller et al. (1988)Ann.Rev.Microbiol.,42: 177)) and And prokaryotic ampicillin resistance (amp) Gene and origin of replication.   Baculovirus transfer vectors usually contain a baculovirus promoter. No. The baculovirus promoter binds to the baculovirus RNA polymerase. And downstream (5 'to 3') transcription of a coding sequence (eg, a structural gene) into mRNA Is any DNA sequence that can initiate The promoter is usually at the 5 'end of the coding sequence. It has a transcription initiation region located adjacent to the edge. This transcription initiation region is usually It contains a polymerase binding site and a transcription initiation site. Baculovirus transfer vector Can also have a second domain called an enhancer, which, if present, , Usually distal to the structural gene. Expression is either regulated or constitutive Can be   Structural genes that are abundantly transcribed later in the viral infection cycle are particularly useful Provide a motor sequence. Genetics encoding the viral polyhedrin protein Examples include sequences derived from offspring (Friesen et al. (1986) Baculovirus Regulation of gene expression "The Molecular Biology of Baculoviruses(Walter Doerfler Ed.); EPO Publication Nos. 127 839 and 155 476; and the gene encoding th e p10 protein, Vlak et al. (1988),J.Gen.Virol.69: 765).   The DNA encoding the appropriate signal sequence may be a secreted insect or baculo The gene for the lus protein (for example, the baculovirus polyhedrin gene (Carbo nell et al. (1988)Gene,73: 409)). Alternatively, mammalian cell post-translational modification (Eg, signal peptide cleavage, proteolytic cleavage, and phosphorylation) Signals are likely to be recognized by insect cells, and secretion and nuclear accumulation Signals required for invertebrate cells are also conserved between invertebrate and vertebrate cells. It is believed that leaders of non-insect origin (eg, human α-interfero (Maeda et al. (1985),Nature 315: 592); Human gastrin-related peptide, Lebacq-Ve rheyden et al. (1988),Molec.Cell.Biol.8: 3129; Human IL-2, Smith et al. (1985)Proc.Nat ' l.Acad.Sci.USA ,82: 8404; mouse IL-3, (Miyajima et al. (1987)Gene 58: 273); And human glucocerebrosidase, Martin et al. (1988)DNA,7: 99 to the gene encoding Origin) can also be used to provide secretion in insects.   The recombinant polypeptide or polyprotein can be expressed intracellularly, or When expressed using a suitable regulatory sequence, it may be secreted. Non-fused foreign protein Good intracellular expression usually requires an appropriate translation initiation signal preceding the ATG initiation signal. Requires a heterologous gene that ideally has a short leader sequence containing Desired N-terminal methionine can be used for in vitro incubation with cyanogen bromide. It can be cleaved from a more mature protein.   Alternatively, a recombinant polyprotein or protein that is not naturally secreted is Consists of a leader sequence fragment that provides for secretion of foreign proteins in insects By producing chimeric DNA molecules encoding the fusion protein, insect cells can be Can be secreted. Leader sequence fragments are usually associated with the endoplasmic reticulum Encodes a signal peptide consisting of hydrophobic amino acids that directs transposition.   Insertion of a DNA sequence and / or gene encoding a precursor of an expression product of a protein After transfection, the insect cell host is transferred to the transfer vector, usually by co-transfection. Co-transformed with heterologous DNA and genomic DNA of wild-type baculovirus. Construction Promoters and transcription termination sequences are usually 2 to 2 of the baculovirus genome. Contains a 5 kb fragment. Heterologous DNA at desired site in baculovirus virus Methods for introduction are known in the art. (Summers and Smith supra; Ju (1987); Smith et al.,Mol.Cell.Biol.(1983)Three: 2156; and Luckow and Summe rs (1989)). For example, the insertion is polyhedral by homologous double crossover recombination. The insertion can also be into a gene such as the phosphorus gene; It may be to a genetically engineered restriction enzyme site. Miller et al. (1989),Bioassays Four: 9l . The DNA sequence is a clonin instead of a polyhedrin gene in the expression vector. When flanked, it is flanked both 5 'and 3' by a polyhedrin-specific sequence, And placed downstream of the polyhedrin promoter.   The newly formed baculovirus expression vector is subsequently transfected with an infectious recombinant baculovirus. Packaged with culovirus. Homologous recombination is infrequent (about 1% to about 5%) Occur; therefore, the majority of the virus produced after co-transfection , Still a wild-type virus. Thus, methods for identifying recombinant viruses is necessary. Advantages of this expression system allow recombinant viruses to be distinguished Visual screening. Polyhedrin protein (this is a natural virus Is much higher in the nucleus of infected cells later in viral infection. Generated by bell. The accumulated polyhedrin protein is also used for embedded particles. Form an occlusion body. These obstructions (size 1 A bright luster that is highly refracted (up to 5 μm) and they are easily visualized under a light microscope Make it look like Cells infected with the recombinant virus lack occluders. Recombination Transfection supernatant was used to distinguish the virus from wild-type virus. Plaques are formed on insect cell monolayers by techniques known to those skilled in the art. sand That is, plaques are present in the presence (indicating wild-type virus) or absence (recombinant e (Indicating virus) under a light microscope. "Current Pr otocols in Microbiology, Vol. 2 (ed. by Ausubel et al.) 16.8 (Supplement 10, 1990); Summers And Smith, supra; Miller et al. (1989).   Recombinant baculovirus expression vectors can be used to infect some insect cells Developed in For example, recombinant baculoviruses include, among others:Aedes aeqypti ,Autographa californica,Bombyx mori,Drosophila melanogaster,Spodopte ra fruqiperda ,andTrichoplusia ni(PCT publication number W O89 / 046699; Carbonell et al. (1985)J.Virol.56: 153; Wright (1986)Nature 321: 718; Smith et al. (1983)Mol.Cell.Biol.3: 2156; and, generally, Fraser et al. (1989).In Vitr o Cell.Dev.Biol .twenty five: 225).   Cells and cell culture media are used for heterologous polypep in baculovirus / expression systems. Commercially available for both direct and fusion expression of tides; cell culture techniques Is generally known to those skilled in the art. See, for example, Summers and Smith (supra). thing.   The modified insect cells can then be grown in a suitable nutrient medium, and The nutrient medium is a stable medium for the plasmid (s) present in the modified insect host. Enable maintenance. If the expression product gene is under induction control, the host will grow at high density. Can be propagated and expression can be induced. Alternatively, if expression is constitutive, The product is continuously expressed in the medium, and the product is removed for purpose and depleted The nutrient medium must be continuously circulated while increasing nutrients. The product is Chromatography (eg, HPLC, affinity chromatography, ion Exchange chromatography, etc.); electrophoresis; density gradient centrifugation; It can be purified by such techniques. As appropriate, the product is Qualitatively any insect protein (also secreted into the medium or isolated from insect cells To remove host debris (eg, proteins, lipids, Further purified to provide a product at least substantially free of Can be done.   To obtain protein expression, recombinant host cells derived from the transformants are Incubated under conditions that allow expression of the protein-encoding sequence. You. These conditions will vary depending on the host cell chosen. But this article The condition can be easily ascertained by a person skilled in the art based on what is known in the art. iii. Bacterial system   Bacterial expression techniques are known in the art. The bacterial promoter is a bacterial RNA polymer. Ligase and downstream of the coding sequence (eg, structural gene) to mRNA (3 '' ) Any DNA sequence that can initiate transcription. A promoter is usually It has a transcription initiation region located adjacent to the 5 'end. This transcription start region is usually Includes RNA polymerase binding site and transcription start site. Bacterial promoters also May have a second domain called the operator, which is in close proximity to the RNA It may overlap with the lase binding site, where RNA synthesis begins. The operator is left The gene repressor protein can bind to the operator, thereby causing specific genetic Inhibits offspring transcription, thus allowing for negatively regulated (inducible) transcription. Constructive Expression can occur in the absence of a negative regulatory element (eg, operator) . In addition, positive regulation is based on the gene activator protein binding sequence (which If present, usually (5 ′) adjacent to the RNA polymerase binding sequence). You. Examples of gene activator proteins are catabolite activator proteins Protein (CAP), which converts the lac operon in Escherichia coli (E. coli). Helping to start the photo (Raibaud et al. (1984)Annu.Rev.Genet.18: 173). Therefore, the key Nodal expression can be either positive or negative, thereby enhancing or reducing transcription. Either reduce it.   Sequences encoding metabolic pathway enzymes provide particularly useful promoter sequences. Sugar metabolizing enzymes (eg, galactose, lactose (lac(Chang et al. (1977)Nature 19 8 : 1056), and maltose). You. Further examples include promoter sequences derived from biosynthetic enzymes (eg, tryptotype). fan(trp(Goeddel et al. (1980) Nucl. Acids Res. 8: 4057; Yelverton et al. (1981) Nucl. Acids Res. 9: 731; U.S. Patent No. 4,738,921; EPO Publication Nos. 036776 and 121. 775))). g-Laotamase (bla) Promoter system (Weissmann (1981) -Feron Cloning and Other Mistakes "Interferon 3(I. Gresser)), Bacteriophage λPL (Shimatake et al. (1981)Nature 292: 128) and T5 (U.S. Patent No. 4,689,406). The promoter system also provides useful promoter sequences. In addition, non-naturally occurring synthetic promoters also function as bacterial promoters I do. For example, one bacterial promoter or bacteriophage promoter The transcriptional activation sequence of another bacterial promoter or bacteriophage promoter Operon sequence, which creates a synthetic hybrid promoter (US Pat. No. 4,551,433). For example,tacThe promoter istrppromoter andlacRegulated by repressorlacHive consisting of both operon sequences Lidtrp-lacPromoter (Amann et al. (1983)Gene twenty five: 167; de Boer et al. (1983 )Proc.Natl.Acad.Sci.80:twenty one). In addition, bacterial promoters are used to control bacterial RNA A naturally occurring non-bacterial source that has the ability to bind to and initiate transcription Promoter. Naturally occurring promoters of non-bacterial origin also Matched RNA poly to generate high expression levels of some genes in prokaryotes Can be paired with merase. Bacteriophage T7 RNA polymerase / promoter -System is an example of a paired promoter system (Studier et al. (1986)J.Mol.Biol.189 : 113; Tabor et al. (1985)Proc Natl.Acad.Sci.82: 1074). In addition, Hybrid Pro The motor also has a bacteriophage promoter andE.coliOperator area (EPO Publication No. 267 851).   In addition to a functioning promoter sequence, an efficient ribosome binding site also Useful for expression of foreign genes in eukaryotes.E.coliIn, Riboso The site binding site is called the Shine-Dalgarno (SD) sequence, and includes the initiation codon (ATG) and And a nucleotide of sequence 3-9 located 3-11 nucleotides upstream of the start codon. Including Otides (Shine et al. (1975)Nature 254: 34). The SD array is the same as the SD arrayE.coli 16S r By promoting the binding of mRNA to ribosome by base pairing with RNA 3 'end Possible (steitz et al. (1979) "Nucleic acid and messenger RNA Otide Sequence "Biological Regulation and Development: Gene Expression(R.F.Go ldberger))). Weak ribosome binding sites for eukaryotic and prokaryotic genes (Sambrook et al. (1989) "Cloning in Escherichia coli"). Gene Expression "Molecular Cloning: A Laboratory Manual).   DNA molecules can be expressed intracellularly. The promoter sequence is directly associated with the DNA molecule. Where the first amino acid at the N-terminus is always methionine, Is encoded by the ATG start codon. If desired, the N-terminal methionine can be By in vitro incubation with cyanogen bromide or by bacterial methionine N Incubation with terminal peptidases, either in vivo or in vitro (EPO Publication No. 219 237).   Fusion proteins provide an alternative to direct expression. Usually endogenous bacteria The DNA sequence encoding the N-terminal portion of the protein or other stable protein is Fused to the 5 'end of the heterologous coding sequence. Upon expression, this construct is Noic acid sequence fusions are provided. For example, the bacteriophage lambda cell gene It is linked to the 5 'end of the gene and can be expressed in bacteria. The obtained fusion tag The protein is preferably one in which the processing enzyme (factor Xa) is derived from a foreign gene. Retain a site that cleaves bacteriophage proteins (Nagai et al. (1984)Natu re 309: 810). The fusion protein alsolacZ(Jia et al. (1987)Gene 60: 197),trpE(Al len et al. (1987) J. Biotechnol. 5:93; Makoff et al. (1989).J.Gen.Microbiol.135: 11) AndChey(EPO Publication No. 324 647). Two a The DNA sequence at the junction of the amino acid sequence may encode a cleavable site, Need not be coded. Another example is a ubiquitin fusion protein. This Such fusion proteins are preferably processing enzymes (eg, ubiquitin-specific). That cleaves ubiquitin from foreign proteins Made in the ubiquitin region that carries By this method, natural foreign protein Can be isolated (Miller et al. (1989)Bio / Technology 7: 698).   Alternatively, the foreign protein also provides for secretion of the foreign protein in bacteria Encoding a fusion protein consisting of a signal peptide sequence fragment It can be secreted from cells by creating a DNA molecule (US Pat. No. 4,336,336). issue). Signal sequence fragments usually direct protein secretion from the cell A signal peptide consisting of hydrophobic amino acids. Protein is Growth medium (Gram-positive bacteria) or periplasmic space (located between the inner and outer membranes of cells) (Gram-negative bacteria). Preferably processing There is a site, which can be cleaved either in vivo or in vitro, It can be encoded between a null peptide fragment and a foreign gene.   DNA encoding the appropriate signal sequence may be a secreted bacterial protein (eg, ,E.coliOuter membrane protein gene (ompA(Masui et al. (1983),Experimental Manipulati on of Gene Expression Ghrayeb et al. (1984)EMBO J.Three: 2437), andE.coliArca Rephosphatase signal sequence (phoA(Oka et al. (1985)Proc.Natl.Acad.Sci.82: 7212 )). As a further example, α-alpha from various Bacillus strains Using the signal sequence of the Millase gene,B.subtilisHeterologous protein derived from Can secrete quality (Palva et al. (1982)Proc.Natl.Acad.Sci.USA 79: 5582; EPO Publication No. 24 4 042).   Usually, the transcription termination sequence recognized by bacteria is located 3 'to the translation stop codon. Regulatory region, thus flanking the coding sequence with the promoter. This These sequences provide the transcription of an mRNA that can be translated into the polypeptide encoded by the DNA. To be oriented. Transcription termination sequences often have a stem-loop structure to help terminate transcription. It contains a DNA sequence of about 50 nucleotides that can be formed. Relics with strong promoters A gene (for example,E.coliIntrpGenes and other biosynthetic genes) An example is a transcription termination sequence.   Usually, a promoter, signal sequence (if desired), coding sequence of interest, and The above components, including the transcription termination sequence, are co-located in the expression construct. Expression construct Is often maintained stable in replicons (eg, hosts (eg, bacteria)) Is maintained in a possible extrachromosomal element (eg, a plasmid). Replico Clones have a replication system, which means that whether they are expressed or cloned and amplified This allows it to be maintained in a prokaryotic host. In addition, Replico The plasmid can be either a high copy number or a low copy number plasmid. High copy Plasmids generally have a copy number in the range of about 5 to about 200, usually about 10 to about 150. Having. Hosts containing high copy number plasmids are preferably at least about 10, and More preferably, it contains at least about 20 plasmids. High or low copy number Any of the above vectors may affect the effect of the vector and foreign protein on the host. Depending on it can be chosen.   Alternatively, the expression construct can be integrated into the bacterial genome using an integrating vector. . An integrating vector is usually associated with a bacterial chromosome that allows the vector to integrate. At least one identical sequence. Integration is based on homologous DNA in the vector and bacteria It is clear that it results from recombination with the chromosome. For example, various Bacillus An integration vector constructed with DNA from the strain integrates into the Bacillus chromosome (EPO Publication No. 127 328). The integration vector may also be a bacteriophage or trans It may consist of a poson sequence.   Usually, extrachromosomal and integrated expression constructs are used to select for transformed bacterial strains. It may include a selectable marker that allows it. The selectable marker is expressed in a bacterial host Obtained and given the bacteria (eg, ampicillin, chloramphenicol, erythr) Romycin, kanamycin (neomycin), and tetracycline) resistance (Davies et al. (1978)Annu.Rev.Microbiol.32: 469). Choice Markers also include biosynthetic genes (eg, histidine, tryptophan, and Gene in the leucine biosynthetic pathway).   Alternatively, some of the above components may be placed together in a transformation vector. obtain. Transformation vectors are usually maintained in a replicon or A selectable marker that is either developed into an integration vector as described above Consists of   Expression vector and transformation vector (extrachromosomal replicon or integration vector) ) Have been developed for transformation into many bacteria. For example Expression vectors are, inter alia, the following bacteria: Bacillus subtilis (Palva et al. (1982)P roc.Natl.Acad.Sci.USA 79: 5582; EPO Publication Nos. 036259 and 063953; PC T Publication No.WO 84/04541), Escherichia coli (Shimatake et al. (1981)Nature 292: 128 Amann et al. (1985)Gene 40: 183; Studier et al. (1986)J.Mol.Biol.189: 113 ； EPO Gazette No. 036 776 and 136 829, and 136 907), Streptococcus cremor is (Powell et al. (1988)Appl.Environ.Microbiol.54: 655); Streptococcus lividan s (Powell et al. (1988)Appl.Environ.Microbiol.54: 655), Streptomyces lividans (rice (No. 4,745,056).   Methods for introducing exogenous DNA into a bacterial host are well known in the art and usually involve aCl_TwoOr other agents (eg, divalent cations and DMSO) Transformation of bacteria. DNA can also be transferred to bacterial cells by electroporation. Can be introduced. Transformation procedures usually vary with the bacterial species to be transformed. You. For example, (Masson et al. (1989)FEMS Microbiol.Lett.60: 273; Palva et al. (1982)Proc .Natl.Acad.Sci.USA 79: 5582; EPO Publication Nos. 036259 and 063953; PCT Publication Publication No.WO 84/04541, Bacillus), (Miller et al. (1988)Proc.Natl.Acad.Sci.85: 856; Wang et al. (1990)J. Bacteriol.172: 949, Campylobacter), (Cohen et al. (1973)Proc.Nat l.Acad.Sci .69: 2110; Dower et al. (1988)Nucleic Acids Res.16: 6127; Kushner (1978 ) "Improved method for transforming Escherichia coli using plasmids derived from ColEl. "Genetic Engineering: Proceedings of the International Symposium on Gene tic Engineering (Ed. H.W.Boyer and S.Nicosia); Mandel et al. (1970)J.Mol.Biol.53 : 159; Taketo (1988)Biochem.Biophys.Acta 949: 318; Escherichia), (Chassy et al. ( 1987)FEMS Microbiol. Lett. 44: 173 Lactobacillus); (Fiedler et al. (1988)Anal.Bio chem 170: 38, Pseudomonas); (Augustin et al. (1990)FEMS Microbiol.Lett.66: 203, Staphylococcus), (Barany et al. (1980)J. Bacteriol.144: 698; Harlander (1987) Transformation of Streptococcus lactis by Lectroporation "Streptococcal Genetics (Ed. J. Ferretti and R. Curtiss III); Perry et al. (1981)Infec.Immun.32: 12 95; Powell et al. (1988)Appl.Environ.Microbiol.54: 655: Somkuti et al. (1987)Proc.4th Evr.Conq.Biotechnology 1: 412, Streptococcus). iv. Yeast expression   Yeast expression systems are also known to those skilled in the art. The yeast promoter is a yeast RNA polymer. Ligase and downstream (3 ') to mRNA of a coding sequence (eg, structural gene) Any DNA sequence capable of initiating transcription. The promoter is usually 5 'of the coding sequence. It has a transcription initiation region located adjacent to the end. This transcription initiation region is usually RN Includes A polymerase binding site ("TATA box") and transcription initiation site. Yeast The promoter also includes a second domain called the upstream activator sequence (UAS). Which, if present, are usually distal to the structural gene. UAS Allows for regulated (inducible) expression. Constitutive expression occurs in the absence of UAS. Key Nodal expression can be either positive or negative, thereby enhancing or reducing transcription. To either.   Yeast is a fermenting organism with an active metabolic pathway, and therefore, The loading sequence provides a particularly useful promoter sequence. Alcohol dehydro Genase (ADH) (EPO Publication No. 284 044), enolase, glucokinase, glucose -6-phosphate isomerase, glyceraldehyde-3-phosphate-dehydrogenase () G (AP or GAPDH), hexokinase, phosphofructokinase, 3-phosphoglycerol Mutase and pyruvate kinase (PyK) (EPO Publication No. 329 203) are examples. It is mentioned. Yeast encoding acid phosphatasePHO5Genes are also useful professionals Providing a motor array (Myanohara et al. (1983)Proc.Natl.Acad.Sci.USA 80: 1).   In addition, non-naturally occurring synthetic promoters can also be used as yeast promoters. Function. For example, the UAS sequence of one yeast promoter is replaced by another yeast promoter. Transcript activation region, which creates a synthetic hybrid promoter I do. Examples of such hybrid promoters bind to the GAP transcription activation region ADH regulatory sequences (US Pat. Nos. 4,876,197 and 4,880,734). Other examples of hybrid promoters include glycolytic enzyme genes (eg, GAP or PyK ) In combination with the transcriptional activation region,ADH2,GAL4,GAL10OrPHO5gene (EPO Publication No. 164556). Sa In addition, the yeast promoter binds to yeast RNA polymerase and initiates transcription It may include a naturally occurring promoter of non-yeast origin that has the ability to this Examples of such promoters are, inter alia, (Cohen et al. (1980)Proc.Natl.Acad.Sci.US A 77: 1078; Henikoff et al. (1981)Nature 283: 835; Holllenberg et al. (1981)Curr.Topics Microbiol.Immunol .96: 119; Hollenberg et al. (1979) "Yeast Saccharomy cescerevis. Expression of bacterial antibiotic resistance gene i in iae "Plasmids of Medical, Environme ntal and Commercial Importance (K> N> Timmis and A. Puhler eds.); Mercerau-Pui galon et al. (1980)Gene 11: 163; Panthier et al. (1980)Curr.Genet.Two: 109).   DNA molecules can be expressed intracellularly in yeast. The promoter sequence is With the first amino acid at the N-terminus of the recombinant protein. The acid is always methionine, which is encoded by the ATG start codon. As desired N-terminal methionine, if present, can be used for in vitro incubation with cyanogen bromide. Can be cleaved from the protein.   Fusion proteins can be used for yeast expression systems, as well as for mammalian, baculoyl And alternatives in bacterial expression systems. Usually endogenous yeast protein Or the DNA sequence encoding the N-terminal portion of another stable protein Fused to the 5 'end of the sequence. Upon expression, this construct contains two amino acid sequences To provide a fusion. For example, yeast or human superoxide dismutase (S The OD) gene can be linked to the 5 'end of the foreign gene and expressed in yeast. obtain. The DNA sequence at the junction of the two amino acid sequences encodes a cleavable site May or may not be coded. See, for example, EPO Publication No. 196 056. thing. Another example is a ubiquitin fusion protein. Such a fusion protein Is a processing enzyme (e.g., to cleave ubiquitin from foreign proteins). (A ubiquitin-specific processing protease) site. It is made using a biquitin region. Therefore, this method allows natural foreign The protein can be isolated (see, for example, PCT Publication No. WO 88/024066).   Alternatively, the foreign protein also provides for secretion of the foreign protein in yeast Encoding a fusion protein consisting of a leader sequence fragment By making DNA molecules, cells can be secreted from the cells into the growth medium. Preferably Is a leader fragment that can be cleaved either in vivo or in vitro There is a processing site encoded between the gene and the foreign gene. Leader sequence Fragments are usually hydrophobic amino acids that direct the secretion of proteins from the cell. Encodes a signal peptide composed of:   The DNA encoding the appropriate signal sequence is the secreted yeast protein gene ( For example, the yeast invertase gene (EPO Publication No. 012873; JPO Publication No. 62,096,086) No. A) and the factor A gene (US Pat. No. 4,588,684)). Or yeast Leaders of non-yeast origin that also provide secretion in the mother (e.g., Ron Leader) (EPO Publication No. 060 057).   Preferred class of secretory leaders uses fragments of the yeast α-factor gene Which contains both a "pre" signal sequence and a "pro" region . The type of alpha factor fragment that can be used is the full-length pre-pro alpha factor reader. (Approximately 83 amino acid residues) as well as a shortened alpha factor leader (typically about 25 to about 50 Amino acid residues) (U.S. Pat. Nos. 4,546,083 and 4,870,008; EPO Publication No. 3242) No. 74). Further using alpha factor leader fragment to provide secretion The leader is a pre-sequence of the first yeast and a pro-region from the second yeast α-factor. And a hybrid α-factor leader produced using (For example, PCT Publication No.WO  89/02463).   Usually, the transcription termination sequence recognized by yeast is located 3 ′ to the translation stop codon. Regulatory region, and thus, together with the promoter, flank the coding sequence. This These sequences provide the transcription of an mRNA that can be translated into the polypeptide encoded by the DNA. Lead. Examples of transcription termination sequences and other termination sequences recognized by yeast, such as glycolysis Sequence encoding the enzyme.   Usually a promoter, leader (if desired), coding sequence of interest, and transcription The above components, including the termination sequence, are co-located in the expression construct. The expression construct is Often, replicons (e.g., stable in a host (e.g., yeast or bacteria) It is maintained in an extrachromosomal element that can be maintained (eg, a plasmid). A replicon may have two replication systems, and thus, for example, In the mother, and in procaryotic hosts for cloning and amplification, Precon can be maintained. Such a yeast-bacterial shuttle vector An example of this is YEp24 (Botstein et al. (1979)Gene 8: 17-24), pCl / 1 (Brake et al. (1984)Proc.N atl.Acad.Sci.USA 81: 4642-4646), and YRp17 (Stinchcomb et al. (1982)J.Mol.Biol .158: 157). In addition, replicons are available in either high or low copy numbers. Or the plasmid. High copy number plasmids generally have from about 5 to about 200, It usually has a copy number in the range of about 10 to about 150. Hosts containing high copy number plasmids Has preferably at least about 10, more preferably at least about 20. En High or low copy number vectors are compatible with the host and foreign Selection may be made depending on the effect of the protein. For example, see Brake et al. thing.   Alternatively, the expression construct may be integrated into the yeast genome using an integration vector. . The integration vector is usually located on the yeast chromosome, allowing the vector to integrate. Contains at least one sequence homologous and preferably flanks the expression construct Contains two homologous sequences. Integration occurs between the homologous DNA in the vector and the yeast chromosome. (Orr-Weaver et al. (1983)Methods in Enzymol.101:twenty two 8-245). For the integration vector, select an appropriate homologous sequence for inclusion in the vector. Can be directed to a specific locus in yeast. See Orr-Weaver et al. (Supra) thing. One or more expression constructs may be integrated, which may be the recombinant protein Influences the level of protein (Rine et al. (1983)Proc.Natl.Acad.Sci.USA 80: 6750). Baek The chromosomal sequence contained in the vector contains a single segment in the vector (this Chromosomal proximity cells in the vector). Two segments homologous to the fragment and adjacent to the expression construct (this Only resulting in stable integration).   Usually, extrachromosomal and integrated expression constructs allow for the selection of transformed yeast strains. And a selectable marker. The selectable marker is expressed in a yeast host. The resulting biosynthetic gene (e.g.,ADE2,HIS4,LEU2,TRP1,andALG7), And G4 18 resistance genes (resulting in yeast cells for resistance to tunicamycin and G418, respectively) Grant). In addition, suitable selectable markers also include toxic compounds (e.g., , Metals) can provide yeast with the ability to grow. For example,CUP1The existence of Allow yeast to grow in the presence of copper ions (Butt et al. (1987)Microbiol.Rev .51: 351).   Alternatively, some of the above components may be placed together in a transformation vector. The transformation vector is usually maintained in a replicon, as described above, Or a selectable marker that is either developed into an integration vector. It is.   Expression and transformation vectors (extrachromosomal replicons or integration vectors) ) Have been developed for transformation into many yeasts. For example Expression vectors have been developed, inter alia, for the following yeasts: Candida albica n s (Kurtz et al. (1986)Mol.Cell.Biol.6: 142), Candida maltose (Kunze et al. (1985)J.Basi c Microbiol .twenty five: 141), Hansenula polymorpha (Gleeson et al. (1986)J.Gen.Microbiol .132: 3459; Roggenkamp et al. (1986)Mol.Gen.Genet.202: 302), Kluyveromyces fragi lis (Das et al. (1984)J. Bacteriol.158: 1165), Kluyveromyces lactis (De Louvencour t et al. (1983)J. Bacteriol. 154:737; Van den Berg et al. (1990)Bio / Technology 8: 135) , Pichia guillerimondii (Kunze et al. (1985)J.Basic Microbiol.twenty five: 141), Pichia p astoris (Cregg et al. (1985)Mol.Cell.Biol.Five: 3376; U.S. Patent No. 4,837,148 and No. 4,929,555), Saccharomyces cerevisiae (Hinnen et al. (1978)Proc.Natl.Acad.Sc i.USA 75: 1929; Ito et al. (1983)J. Bacteriol.153: 163), Schizosaccharomyces pomb e (Beach and Nurse (1981)Nature 300: 706), and Yarrowia lipolytica (Dav idow et al. (1985)Curr.Genet.Ten: 380471, Gaillardin et al. (1985)Curr.Genet.Ten: 49).   Methods for introducing exogenous DNA into a yeast host are well known in the art, and are usually Intact cells transformed with spheroplasts or treated with alkali cations Includes any transformation of yeast cells. Transformation procedures are usually transformed It depends on the type of yeast. For example, (Kurtz et al. (1986)Mol.Cell.Biol.6: 142; Kunze et al. (1985)J.Basic Microbiol.twenty five: 141; Candida); (Gleeson et al. (1986)J.Gen.Microbio l .132: 3459; Roggenkamp et al. (1986)Mol.Gen.Genet.202: 302; Hansenula); (Das et al. (1 984)J. Bacteriol.158: 1165; De Louvencourt et al. (1983)J. Bacteriol.154: 1165; Va n den Berg et al. (1990)Bio / Technology 8: 135; Kluyveromyces); (Cregg et al. (1985)Mo l.Cell.Biol .Five: 3376; Kunze et al. (1985)J.Basic Microbiol.twenty five: 141; U.S. Patent No. 4,8 37,148 and 4,929,555; Pichia); (Hinnen et al. (1978)Proc.Natl.Acad.Sc i.USA 75: 1929; Ito et al. (1983)J. Bacteriol.153: 163; Saccharomyces); (Beach And Nurse (1981)Nature 300: 706; Schizosaccharomyces); (Davidow et al. (1985)Cur r.Genet .Ten: 39; Gaillardin et al. (1985)Curr.Genet.Ten: 49; Yarrowia) . 1. Preparation of LT-A72R mutant a. LT DNA source   A 1.5 kb SmaI-EcoRI fragment derived from plasmid pEWD299 (LT-A gene and And LT promoter region) (Pronk et al. (1985) J. Biol. Chem. 260: 13580; Spicer et al. (1981) Proc. Natl. Acad. Sci. USA 78:50), Bluescript KS vector (Stratagene) Was subcloned. The resulting vector (designated BS-LT-A) was Used for mutagenesis (Zoller and Smith (1982) Nucl. Acid. Res. 10: 6487). b. Mutation method   Site-directed mutagenesis was performed on Zoller and Smit on single-stranded DNA of the BS-LT-A vector. h (supra). Oligonucleotides used:   ^Five'GCTCACTTACGTGGACAGTCT^{3 '}(Oligo LT-A72R) Mutates the codon (GCA) of Ala-72 to an Arg codon (CGT).   Mutated SmaI-EcoRI fragment containing the mutated codon Ligated with a 0.57 kb EcoRI-HindIII fragment (Pronk et al .; Spicer et al.) Containing Cloning into the luescript KS vector (Stratagene), the vector BS-LTA72R Produced. c. Expression and purification of LT-A72R mutant   E. coli was transformed with the BS-LTA72R vector and Grow in B broth. The mutant protein LT-A72R was prepared using a controlled pore glass (CPG 350, Se rva) and A5M agarose column, then Sephacryl S-200^TMUsing Periplasm (Pronk et al .; Magagnoli et al. (1996) Infect Immun 64: 543). Purified from 4).   Aliquots of the purified material were analyzed on a Superdex 200HR column. Figure 1 shows the wild type LT and mutant LTK63 (Ser-63-Lys mutant-WO93 / 13202 and PiZza et al. (1994) J. Exp. ed. 6: 2147) compared to LT-A72R.   The LT-A72R is a single pilot corresponding to a fully assembled holotoxin. And the profile is the same as that of wild-type LT and LTK63. One. This indicates that the A72R mutation does not alter the structure of the A subunit, Subunits are efficiently exported to the periplasm, and AB_FiveExactly as a pair Prove that you can stand up. A 100 μl aliquot of A72R stored at 4 ° C. Analyzed in the same manner every two months for one year, no change in elution profile was detected. won. 2. Physical characterization a. Trypsin digestion   45 μg toxin (LT, LT-A72R, LTK63) was added to a final volume of 150 μl of 10 mM Tris (pH 7.5) at 37 ° C. ) Was treated with 9 μg of trypsin. 30 μl of sample for 5 minutes and 3 Collected after 0 min incubation, and the reaction was reconstituted with 3.6 μg trypsin Stopped with inhibitor. Add 10 μl of 4 × concentrated electrophoresis sample buffer, Added to each sample and the mixture was heated to 95 ° C. for 10 minutes. Protein, 15 % SDS mini gel and stain with Coomassie Brilliant Blue R-250 Or transfer to a nitrocellulose membrane followed by a 1: 300 dilution of rabbit anti-LT Incubated with lyclonal serum.   FIG. 2 shows the results of Western blot analysis. 5 minute incubation Later, trypsin almost immediately binds to the A1 and A2 domains of the A subunit. Causes nicking, and nicking is completed by 30 minutes. L No difference in sensitivity was detected between T, LT-A72R, or LTK63. b. ADP-ribosylation of polyarginine   LT (wild type and mutant) has been described by Lai et al. (BBRC 102: 1021, 1981). And the results are shown in FIG.   The ADP-ribosylation activity of LT-A72R is less than the activity of wild-type LT. At least two orders of magnitude lower: minimum concentration to obtain detectable activity is 0.5 μg for LT And 85 μg for LT-A72R. In contrast, LTK63 lacks activity at all. Have been. c. toxicity   In vitro toxicity was measured in Y1 adrenal cells (Donta et al. (1973) Science 183: 334) by LT Were evaluated by the following morphological changes caused by: This assay is In a titer plate, with a 2-fold dilution of LT, LT-A72R and LTK63, 50,000 Perform using cells / well, 80 pg / well for wild type, and mutant Starting from 40 μg / well. 48 hour incubation for morphological changes Read later.   In vivo toxicity was assessed using an ileal loop assay (De (1959) Nature 183: 1533). Valued. Two adult New Zealand rabbits (about 2.5 kg) were used for each assay. And 1 ml samples of toxins (wild-type, LT-A72R, LTK63) at various concentrations The control loop received 1 ml PBS. 18-20 hours later, each roux Measure the volume of liquid accumulated in the loop with a syringe and measure the length of each loop again did. Results from 4-6 repetitions (liquid volume per unit length of loop (ml / cm ) Are shown in FIG.   Consistent with ADP ribosylation results, LT-A72R showed 10% of wild-type LT in Y1 cells.^-Fiveof Toxic (FIG. 4) and about 20-fold less than wild-type in ileal loop assay Toxicity (Fig. 5). As previously reported, LTK63 was used in both assays. Was completely toxic. 3. Immunological characterization a. Mucosal adjuvant activity   The adjuvant activity of LT-A72R was determined by the protocol of Douce et al. (PNAS 92: 164-1648 (1995)). The test was conducted using a col. Groups of 10 BALB / c mice (female, 4-6 weeks old) Intranasally with 1 μg of toxin (LT, LT-A72R, LTB or LK-K63) and 10 μg of OVA Immunized. Animals are lightly anesthetized and 15 μl per nostril on days 0, 21 and 35 Immunized in quantity. Immune response was determined by serum samples taken on days 0, 20, 34 and 52 Tracked in Animals were sacrificed and nasal washes were performed with repeated flushing and 0.1 ml. This was performed by aspiration of 1 ml PBS containing% BSA.   LT-specific antibodies were measured using a GM1 capture ELISA. Each well on a 96-well plate The wells were incubated with 150 ng of GM1 ganglioside by overnight incubation at 4 ° C. I coated first. The wells were then washed three times with PBS (+ 0.05% Tween-20), Then 50 ng of toxin was added to each well. Incubate the plate at 37 ° C for 2 hours I did it. OVA-specific antibodies are assessed by coating each well with 60 μg / ml OVA. And incubated overnight at 4 ° C.   Plates were washed and wells were saturated with PBS (+ 1% BSA) at 37 ° C. for 1 hour . Serum from individual mice is tested starting at a 1:50 dilution in PBS; nasal lavage The liquid was tested starting undiluted. Incubate the plate at 37 ° C for 2 hours Was. Specific Ig was measured using horseradish peroxidase-conjugated rabbit anti-mouse Ig. Specified. The antibody is then prepared by adding o-phenylenediamine as a substrate. Clarified. After 10 minutes, the reaction is run at 12.5% H_TwoSO_FourBlock by adding Was.   IgG subclass using IgG1, IgG2a, IgG2b, or IgG3 biotinylated antibodies Were determined. Then add peroxidase-streptavidin to each well (1: 1000) and the plates were incubated at 37 ° C. for 1 hour. Bound antibody Was visualized as described above.   The absorbance was read at 490 nm, and the ELISA titer was measured in preimmune serum.   Specific titers of specific IgA in serum and mucosal washes were determined using biotin-conjugated goat anti-mouse IgA. measurement using an α-chain specific antibody followed by streptavidin-peroxidase. Was. Bound antibody was revealed using OPD substrate as described above. ELISA titer , Arbitrarily determined as.   Values are always normal using positive control samples on each plate It has become.   As shown in FIG. 6, wild type LT and LT-A72R produced the highest anti-OVA antibody response. Induced. LTK63 induced intermediate levels, and LTB gave a low response. Antigen characteristics Differential antibody response is detectable after a single immunization for wild-type LT and A72R variants However, LTK63 induced serum anti-OVA antibodies (as previously described). At least two immunizations were required for this.   OVA-specific IgG isotypes were measured in the serum pool of the last blood draw (Figure 7). High titers of anti-OVA IgG1, IgG2a and IgG2b as wild type as adjuvant Induced in the group receiving the LT or A72R mutant but with a dominant The isotype was IgG2a. OVA-specific IgG3 antibodies could never be detected. LTB was not a good adjuvant.   In all experiments, OVA-specific IgA was immediately released after one or two intranasal immunizations. Never detected. However, after the third immunization, the serum IgA response was And A72R and K63 mutants, but not LTB (Figure 8A ). A similar pattern was seen at the mucosal level (Figure 8B) and after the third immunization, 0V A-specific IgA was used for nasal washing of wild-type group and A72R and K63 mutant groups. Found in liquid but not found in control or LTB group Was.   The serum anti-LT antibody response is shown in FIG. Mice increase response after the first immunization and the first The immunization was significantly boosted over the second immunization. A72R mutant is a non-toxic K63 mutant Were more immunogenic, and both were much more immunogenic than LTB. b. OVA driven proliferative response   14-20 days after 2 or 3 intranasal immunizations with OVA + LT (wild type or mutant) Two or three mice per group were sacrificed and spleens were removed. Spleen Obtain a viable cell suspension and complete DMEM (10% FCS, 2 mM L-glutamine, 15 mM Hepes , 100U penicillin / streptomycin, 50 mM 2-mercaptoethanol) It became cloudy. 2 × 10^FiveSpleen cells / well were seeded in U-bottom 96-well plates and The cells were cultured in the presence of various concentrations of OVA for 5 days. [^ThreeH] thymidine for 16 hours after culture Added before (1 μCi / well). The cells are then harvested on a cell harvester and [^Three [H] thymidine incorporation was assessed by liquid scintillation counting (Figure 10).   Intranasal co-administration of antigen with wild-type or A72R or K63 mutant Induces priming of OVA-specific T cells with OVA alone or OVA + LTB It is clear that was much stronger than that detectable after immunization. c. In vivo antigen administration   LT LD₅₀And a group of 10 BALB / c mice (female, 9 weeks old) were treated with LT (12.5 μg, 2 5 μg, 50 μg, or 100 μg) or inoculated intraperitoneally with PBS. Was. 7 days after observation, LD₅₀Was determined as 20.4 μg.   Four-week-old BALB / c mice were treated with 1 μg of toxin (LT, LT-A72R, LT-K63, or LTB) Immunized intranasally on days 0 and 21 and LT (2 × LD₅₀) With antigen Gave. They were observed for death for 7 days. Serum on days 0, 20, and 35 And anti-LT titers were analyzed by ELISA (as described above).   All mice immunized with wild-type or mutant LT survived the challenge, Mice that received LTB survived only 30%. In the control group All mice died (FIG. 11A).   Serum from mice immunized with wild-type LT or A72R or K63 mutant It contained high and comparable levels of anti-LT antibodies (FIG. 11B). But received LTB In mice, the titers were 10-20 fold lower. Three LTBs surviving LT challenge Mice (open circles) had titers significantly higher than titers in animals that died. 4. Conclusion   ADP ribosylation activity is not required for LT adjuvant activity, but low levels The presence of different enzymatic activities indicates that faster and higher immune responses to co-administered antigens It may be useful to derive an answer.   The A72R variant of LT is an effective mucosal adjuvant. In addition, the mutant It can retain the immunogenicity of the native LT and induce protective immunity against LT. Therefore, It may also be useful for anti-diarrhea vaccination.   Of course, the present invention has been described above by way of example only, and modifications may be made to the invention. It is understood that this can be done within the scope and spirit.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 37/04 A61P 37/04 C07K 14/245 C07K 14/245 C12N 1/21 C12N 1/21 C12Q 1 / 48 C12Q 1/48 Z // (C12N 1/21 C12R 1:19)

Claims (1)

[Claims] 1. Support for E. coli heat labile toxin (LT-A) for use as a mucosal adjuvant Immunogenic detoxifying tan comprising the amino acid sequence of Bunit A or a fragment thereof The amino acid Ala-72 in the sequence or fragment. A protein that has been substituted with a arginine residue. 2. (I) a pharmaceutically acceptable carrier for use as a vaccine; and (Ii) Subunit A of E. coli heat labile toxin (LT-A) or a fragment thereof An immunogenic composition comprising an immunogenic detoxification protein comprising an amino acid sequence, Amino acid Ala-72 in the sequence or fragment is replaced with an arginine residue An immunogenic composition. 3. 3. The immunogenic composition of claim 2, further comprising a second immunogenic antigen. 4. E. coli heat labile toxin (LT-A) subunit A or Is the use of an immunogenic detoxification protein containing the amino acid sequence of the fragment. Wherein the amino acid Ala-72 in the sequence or fragment is an arginine residue Use, which has been replaced by 5. 5. Use according to claim 4, wherein the vaccine comprises a second immunogenic antigen. 6. A method of vaccinating a mammal, comprising: (i) a heat labile toxin (LT) of E. coli; -A) an effective amount of an excipient containing the amino acid sequence of subunit A or a fragment thereof An epidemiological detoxified protein, wherein the amino acid in the sequence or fragment is An effective amount of the protein, in which the amino acid Ala-72 is replaced with an arginine residue, and Optionally, (ii) administering together with a second immunogenic antigen.