JP2001333780A - Monoclonal antibody fused protein against antigen present on cell surface and method for producing the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To construct a system suitable for practical use for transporting a DNA. SOLUTION: This human type single-stranded immunoporter monoclonal antibody protein fusion protein which is a new transportation system of the DNA and a complex of the fused protein with the DNA are provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel single-chain immunoporter monoclonal antibody protein fusion protein which is a novel gene carrier, and a complex of the fusion protein and DNA.

[0002]

2. Description of the Related Art At present, recombinant virus vectors and synthetic liposomes have been put to practical use as gene carriers for gene therapy. However, although viral vectors have high gene transfer efficiency, they have drawbacks such as low cell specificity and the possibility of immunogenicity. Also,
The liposome method also has the disadvantage of low cell specificity. For this reason, only limited effects have been reported in clinical trials. To exploit the potential of gene therapy, the drawbacks of these vectors must be overcome.

[0003] In recent years, there has been a strong demand for the development of cancer chemotherapy which can overcome such disadvantages and can accurately target cancer cells. For that purpose, today, not only receptors such as transferrin receptor and nerve growth factor receptor, but also monoclonal antibodies against various cancer cells such as breast cancer cells and prostate cancer cells are immunotoxins that are bound to various proteintoxins. It is used. Squamous cell carcinomas excessively produce epidermal growth factor (EGF) receptors and grow very rapidly in vivo.
It is also known that the EGF receptor on the cell surface binds to and binds to an antibody, so that the EGF receptor is considered to be an excellent target for therapy for squamous cell carcinoma.

[0004] Epidermal growth factor receptor (EGFR) is one of the cell surface receptors and has been found to be localized on the surface of epithelial cells. On the other hand, for EGF,
Its physiological role has been extensively studied in tooth development, stomach and lung development. EGF interacts with specific cell surface receptors to stimulate the growth of various cells in vivo and in vitro. The EGF receptor has endogenous protein tyrosine kinase activity
It is a 170,000 dalton transmembrane glycoprotein consisting of 1186 amino acids. Expression of this EGF receptor is restricted to proliferating cells, and expression ends when the cells differentiate and stop proliferating. EGF expression also occurs after proliferating cells have differentiated into glandular cells. Furthermore, DNA synthesis is actively performed in peripheral cells at the center of the tumor, and the cells are proliferating rapidly. Therefore,
It can be said that there is a direct causal relationship between the expression of EGF receptor and the growth of malignant tumor cells.

[0005] Monoclonal antibodies against the EGF receptor (hereinafter, also referred to as “anti-EGF receptor monoclonal antibodies”) are mainly used for immunization with low-affinity EGF receptors overproduced in squamous cell carcinoma cells that overproduce EGF receptors. React. The present inventors have already reported that a monoclonal antibody against the EGF receptor was bound to gelonin, a 60S liposome-inactivating protein (Hirota, N., et al .; CANCER RESEARCH; 49, 7106).
-7109, Dec. 15, 1989). This monoclonal antibody-gelonin complex binds to the cell surface in proportion to the number of EGF receptors. This conjugate can be inserted into cells, inhibit protein synthesis, and kill cancer cells that overproduce the EGF receptor. Furthermore, the conjugate is slightly cytotoxic to normal human fibroblasts, but does not kill small cell lung cancer cells and mouse fibroblasts deficient in the EGF receptor. In contrast, free gelonin and mixtures thereof did not kill cells that overproduce the EGF receptor. These results suggested that this monoclonal antibody-gelonin conjugate could be used for targeted therapy against squamous cell carcinomas that overproduce the EGF receptor.

On the other hand, the present inventors have also reported a conjugate in which a monoclonal antibody recognizing the EGF receptor and pepromycin, which is an anticancer drug against squamous cell carcinoma, are linked (Osaku, M, et al .; ANTICANCER). RESEARCH, 11; 1951-
1956, 1991). This conjugate, at lower concentrations than PEP alone, kills squamous cell carcinoma A431 cells that overproduce the EGF receptor. We also reported that this conjugate could be a useful weapon for treatments utilizing EGF receptors, as the EGF receptor is overproduced in many cases of squamous cell carcinoma.

[0007] As described above, a conjugate of an anti-EGF receptor monoclonal antibody and an inactivated protein or an anticancer agent has been prepared, and clinical effects are expected. However,
At present, it is strongly desired to develop a wide variety of cancer therapies in view of the variety of diseases of cancer.

In response to this need, the present inventors have completed a novel gene delivery system that utilizes a monoclonal antibody that is internalized with the gene by EGF receptor-mediated endocytosis. We proposed to apply this monoclonal antibody to a gene delivery system for gene therapy of cancer. That is, the inventor of the present invention disclosed in Japanese Patent Application Laid-Open No.
It has been proposed to utilize a conjugate obtained by binding a monoclonal antibody against a receptor to polylysine via a disulfide bond in a gene delivery system.

However, the conjugate proposed in the invention according to Japanese Patent Application Laid-Open No. Hei 7-216000 does not have high transfection efficiency and high stability. Therefore, a conjugate having high transfection efficiency and excellent stability was desired. Therefore, the present inventor has disclosed in Japanese Patent Application Laid-Open No. 10-84959 that a Fab fragment of a monoclonal antibody against an EGF receptor is bound to polylysine with a non-degradable spacer to obtain a conjugate having higher transfection activity and more stability. . And, it was shown that a complex obtained by binding this conjugate to a gene constructs a gene delivery system targeting cancer cells that overproduce the receptor.

In the invention of Japanese Patent Application Laid-Open No. Hei 10-84959, a mouse monoclonal antibody is used as a species of the antibody after chemical modification, so that it can be used clinically for an immune reaction derived from a foreign animal. Did not reach. In addition, since it is a monoclonal antibody produced by chemically modifying and binding to lysine, which is a charged amino acid as a DNA binding portion, it has been difficult to stably mass-produce the antibody.

[0011]

SUMMARY OF THE INVENTION It is an object of the present inventors to improve the above-described gene delivery system in order to put a monoclonal antibody / DNA complex (immunogen) into practical use. Specifically, it aims to solve the problem of immunogenicity and to improve the DNA binding domain to enable mass production.

[0012]

In order to achieve the above object, the present inventors have made the following improvements in the immunogene method.
First, we solved a number of technical issues related to the design, culture conditions, and purification methods of the DNA-binding domain, and introduced gene transfer by the “recombinant immunogene method” using a single-chain antibody that does not require chemical modification of the antibody molecule. Successful.

The immunoporter of the present invention is disclosed in
As compared with the invention according to No. 84959, it is characterized in that it is a recombinant protein expressed in bacteria by adding a gene encoding an amino acid tail after preparing a single chain antibody of a monoclonal antibody. A normal antibody molecule has a heavy chain (H
Chain) and a light chain (L chain), and has a plurality of variable portions that are antibody binding sites. Here, the single-chain antibody refers to an antibody protein obtained by extracting only the variable region of the antibody and linking it with a linker, so that the single-chain protein has a function as an antibody. By preparing a gene encoding a single-chain antibody of such an antibody protein, there is an advantage that the antibody protein can be expressed as a recombinant protein expressed in bacteria and produced in large quantities.

In the monoclonal antibody fusion protein (immunoporter) of the present invention, the framework portion of the antibody molecule was successfully changed to a human type. Therefore, the problem of the immune reaction caused by the xenogeneic animal was solved, and the biggest problem in putting the immunogene method into practical use was solved. When the antigen recognition ability of the humanized antibody was examined, it was similar to that of the mouse type.

In the invention according to JP-A-10-84959, a continuous sequence of lysine, which is a charged amino acid, is added as a DNA binding portion. However, the addition of the continuous sequence of lysine significantly increases secretion efficiency even in yeast in producing a single-chain antibody. It was difficult to mass produce. Therefore, in order to improve the production efficiency and the gene transfer efficiency in the present invention, various amino acid tails to be bound to the carboxy or amino terminus of the antibody for forming a complex with DNA are designed, and one of these tails is incorporated. The gene for the chain antibody fusion protein was prepared. The expression efficiency in Escherichia coli and yeast was examined, and it was confirmed that the secretion efficiency was improved. It was found that a single-chain antibody having a charged amino acid tail was adsorbed to a column by a conventional purification method, and it was possible to purify it after trial and error. The antibody-specific gene transfer was successfully performed in vitro using the purified antibody, and the gene transfer efficiency was equal to or higher than that of Fab immunogene.

[0016]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention resides on a cell surface having a structure in which a peptide (hereinafter also referred to as an amino acid tail) as a DNA binding site is bound to a human-type monoclonal antibody against a receptor present on the cell surface. A monoclonal antibody fusion protein (immunoporter) against a receptor and a complex (immunogen) of a monoclonal antibody fusion protein against a receptor present on the cell surface, which is a complex of the antibody fusion protein and a therapeutic gene. By using the immunogene of the present invention, a target cancer cell can be treated by introducing it into a cell utilizing endocytosis, for example, via a cell surface receptor such as an EGF receptor. The present invention provides such a gene delivery system.

The peptide (amino acid tail), which is a DNA binding site in the immunoporter of the present invention, is charged by an electric charge.
Binds with DNA. That is, the peptide in the immunoporter is a peptide consisting of 90 or less amino acids charged with a positive or negative charge. If the peptide is charged with a positive charge, it can bind directly to DNA. When the peptide is charged with a negative charge, it can be bound to the DNA by coating the DNA with a positively charged polymer.

More specifically, the structure of the amino acid tail in the immunoporter of the present invention is a structure represented by [X _n Y] _m . Here, X is lysine, arginine,
Aspartic acid or glutamic acid, Y is lysine,
Amino acids excluding arginine, aspartic acid and glutamic acid, wherein n is 1 to 8 and m is 1 to 10. Alternatively, the structure of the amino acid tail in the immunoporter of the present invention is a structure represented by _Xn . Here, X is lysine, arginine, aspartic acid or glutamic acid, and n is 2 to 8.

When the amino acid represented by X is lysine or arginine, this amino acid tail has a positive charge and can directly bind to a nucleic acid such as DNA or RNA having a negative charge. When the amino acid represented by X is aspartic acid or glutamic acid, this amino acid has a negative charge. In this case, the nucleic acid-polymer complex can be made to have an excess of positive charge by including a nucleic acid such as DNA or RNA having a negative charge with a polymer having a positive charge such as polylysine or polyethyleneimine. Thus, [X _n Y] _m
The amino acid tail having the following structure can be bound to the nucleic acid / polymer complex, and further can form an antibody / polymer / nucleic acid complex.

In the case of the amino acid tail of the present invention, since the amino acid tail binds to DNA by charge, it is advantageous that the charged amino acids are as long as possible. On the other hand, in terms of the secretion efficiency in yeast, the secretion efficiency is significantly reduced if the charged amino acid is long, so that the balance between the two is important. Since a sequence of eight consecutive lysines can be secreted, secretion is possible if the value of n, which is the number of charged amino acids, is 8 or less. In addition, when the length of the tail is increased, the cell secretion disorder may occur because the thickness exceeds the thickness of the cell membrane through which the tail is secreted. However, when the value of m is 5, the secretory disorder is not exhibited even though the length of the DNA binding portion exceeds the thickness of the cell membrane through which the DNA is secreted. Therefore, the secretion impairment due to the length of the DNA binding portion is the same even after further repetition, and the value of m is 10
Secretion is possible if: n is less than or equal to 8 and m
Is less than or equal to 10, the amino acid tail having the structure of [X _n Y] _m is composed of 90 or less amino acids. In addition, since the function of [X _n Y] _m is independent of the antibody molecule, its position can function as a DNA binding site at either the amino terminal side or the carboxyl terminal side.

Further, the present invention is a method for producing a monoclonal antibody fusion protein (immunoporter) against a receptor present on the cell surface. The immunoporter of the present invention can be produced by the following steps. (1) using a mRNA extracted from a hybridoma cell capable of producing a monoclonal antibody against a receptor present on the cell surface as a template, amplifying a single-chain antibody gene of a mouse monoclonal antibody by PCR,
(2) a single-chain antibody gene of a human-type monoclonal antibody is prepared by converting the framework part of the mouse-type monoclonal antibody; and (3) an amino acid tail is encoded in the single-chain antibody gene of the human-type monoclonal antibody. And (4) expressing the human-type single-chain immunoporter gene in bacteria to produce a recombinant human-type single-chain immunoporter protein. obtain.

Here, the production of a single-chain antibody gene of a humanized monoclonal antibody is based on the sequence derived from a mouse.
In other words, it is to replace with a sequence derived from a human antibody gene.
As described above, a single-chain antibody is defined as the variable region (V
H, VL) with a linker. VH and VL consist of a framework region (FR) that forms the inside of an antibody and maintains its shape, and a CDR (hypervariable region) for recognizing a foreign antigen. The antibody molecule of the EGF receptor has a structure of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Thus, taking the EGF receptor as an example, the task of humanization is to replace a total of eight framework regions, four each in VH and VL, with human-derived sequences. Some of the amino acids in the framework are known to be important for interacting with the amino acids in the CDR and maintaining the conformation of the CDR. From such findings, the position of such an amino acid sequence is predicted, and it is important to replace such amino acid sequence except for such a portion.

The antibody fusion protein (immunoporter) of the present invention thus obtained then forms a complex with a gene to become an immunogene. The monoclonal antibody and the DNA that is the gene are bound by an electric charge. That is, the amino acid tail described above is bound to the immunoporter of the present invention, and the monoclonal antibody and the gene are bound via the amino acid tail. As described above, the amino acid tail is a positively charged tail or a negatively charged tail. In the case of a positively charged tail, the amino acid tail directly binds to DNA. Let the antibody bind.

In principle, any DNA can be bound to an immunoporter to form a complex, and this complex is transferred into cells targeted as an immunogene via a mechanism of insertion (endocytosis). Can be done. As described above, the gene that can be introduced into cells by the immunogene is not particularly limited, and any of the genes can be bound to the immunoporter of the present invention to perform cancer treatment or the like depending on the purpose of use. The present invention provides a monoclonal antibody against the EGF receptor as well as a monoclonal antibody targeting other receptors present on the cell surface, as long as it can be introduced into cells via an endocytosis mechanism. The same can be applied.

As one of the most suitable objects of the present invention, the present invention can be applied to cancer cells such as squamous cell carcinoma cells overexpressing the EGF receptor. For example, by efficiently introducing a thymidine kinase gene of a herpes virus into this kind of cancer cells and then administering ganciclovir, the cancer cells can be selectively killed. Other tumor suppressor genes include, for example, WT-1 for Wilms tumor and Rb for retinoblasts.

Furthermore, those in which the oncogene (oncogene) is overexpressed can be suppressed by introducing an antisense expression vector or the like. Furthermore, other cancers to which the complex of the present invention and endocytosis can be applied include, for example, Beckwith-Wie
demann syndrome (eg, hepatoma, rhabdomyosarcoma, Wilms tumor, etc.), bladder cancer, Ewing sarcoma and the like. That is, the present invention can be applied to so-called gene therapy by binding the gene and introducing it into cancer cells.

[0027] The present invention further provides a polypeptide comprising an amino acid sequence represented by amino acid numbers 1-258 shown in SEQ ID NO: 1 of the sequence listing. This sequence is the amino acid sequence of a mouse-type single chain antibody against the epithelial cell receptor obtained from the B4G7 antibody. In the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, a polypeptide having a structure in which one or several amino acids are deleted, substituted or added is also within the scope of the present invention, as long as it has an activity of binding to an epidermal growth factor receptor. Is within. here,
Deletion, substitution or addition of one or several amino acids means conversion of up to 10 amino acids. In addition, amino acid numbers 39-44, 58-74, 107-115, 165-17 of the sequence
5, portions 191-197 and 231-238 are antigen recognition sites, and converting this portion results in loss of the activity of binding to the epidermal growth factor receptor, which is inappropriate.

Further, the present invention relates to a polypeptide comprising an amino acid sequence represented by amino acid numbers 1-258 shown in SEQ ID NO: 2 in the sequence listing. The sequence is a human-type single chain antibody (CaC described later) obtained by converting the framework region of the mouse-type antibody into a human antibody type.
Array). In the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, a polypeptide having a structure in which one or several amino acids have been deleted, substituted or added is also within the scope of the present invention so long as it has an activity of binding to an epidermal growth factor receptor. Is within. Here, deletion, substitution or addition of one or several amino acids means conversion of up to 10 amino acids. Amino acid numbers 39-44, 58-74, 107-115, 165-175 of the sequence as in the case of the mouse antibody
, 191-197 and 231-238 are antigen recognition sites,
Converting this moiety results in loss of activity binding to the epidermal growth factor receptor and is inappropriate.
In this specification, a monoclonal antibody against the EGF receptor will be described as an example, but the present invention is not limited to this range.

[0029]

[Example] (Preparation of single-chain antibody gene) Amplification of single-chain antibody gene by PCR using Pharmacia's recombinant single-chain antibody preparation kit and mRNA extracted from B4G7 antibody-producing hybridoma cells as template did. A phage expressing a single-chain antibody was obtained according to the manual of the kit incorporated into the Pharmacia vector pCANTAB5E. Phage was screened and concentrated using formalin-fixed A431 cells as antigen (4.
), And cloned to identify a strongly positive clone. Prepare plasmid from clone (pCANTAB5E
-scB), after determining the nucleotide sequence, further modification to incorporate a His tag was performed to obtain an expression vector pBH. FIG. 1 shows the nucleotide sequence and amino acid sequence of the single-chain antibody portion of pBH. The other parts of the vector are almost the same. In FIG. 1, the underlined portion indicates the single-chain antibody gene (VH-Linker-VL),
The three italicized portions indicate a g3 secretion signal sequence, a single-chain antibody internal linker amino acid sequence, and an E-tag amino acid sequence from the top, respectively.

(Expression and purification of single-chain antibody gene) The above pBH was introduced into Escherichia coli HB2151, and 1 mM of IPTG was added.
Time expression induction was performed. Collect Escherichia coli, 4 ° C, PBS, 1m
The mixture was stirred in M EDTA, 0.1% tween20 to obtain an extract. It was dialyzed against PBS, and the single-chain antibody scBH present in the dialysate was purified with a Qiagen Ni-NTA column.

(Evaluation of antibody titer of single-chain antibody) B4G7 antibody labeled with horseradish peroxidase (HRP) and an unlabeled B4G7 antibody, single-chain scBH antibody or a recombinant immunoporter scHBFL described later were mixed and mixed with formalin. Competition ELISA was performed using the fixed A431 cells as an antigen. The results are shown in FIG. As shown in FIG. 2, the single-chain scBH antibody recognized the same antigen (EGF receptor) as the B4G7 antibody, and the binding force per antibody monovalent was about 1/3.

(Conversion of Single-Chain Antibody Gene to Immunoporter Gene) Various immunoporter genes were prepared by modifying the single-chain antibody gene scBH. The scHBFL gene encoding an immunoporter having a positively charged tail was prepared by adding the following nucleotide sequence to scBH. That is, the sequence shown in FIG. 3A was added to the 5 ′ end and 3 ′ end of the scBH gene to prepare scHBFL. At the 5 'end, CAGGTGCAGCTGCAGCAG (GlnValGlnLeuGlnG, which is the VH region of the scBH gene)
(ln), a gene encoding a histidine tag was added. At the 3 ′ end, AAGT which is the VL region of the scBH gene
TGGAAATAAAA (LysLeuGluIleLys) and GATTATAAAGAT (AspTyrLysA), which is a linker to maintain tail motility
sp), the tail LysLysLysLysLysLysLysLys (ie,
A gene encoding (Lys) ₈ ) and a restriction enzyme EcoRI cleavage site (GAATTC) for integration into a vector were added.

By adding the nucleotide sequence shown in FIG. 3 (2) to scBH, scHBFL20, which is also an immunoporter gene having a positively-charged tail, was prepared. 5 'end and 3' of scBH gene
The following sequences were added to the ends to prepare scHBFL. Five'
At the end, CAGGTGCAGC, the VH region of the scBH gene
A gene encoding a histidine tag was added to TGCAGCAG (GlnValGlnLeuGlnGln). At the 3 'end, scBH
AAGTTGGAAATAAAA (LysLeuGluIle
Lys) with the linker GATTATAAAGATGACGATGAC (As
pTyrLysAspAspAspAsp), the tail LysLysLysLysHi
sLysLysLysLysHisLysLysLysLysHisLysLysLysLysHisLysL
a gene encoding ysLysLysHis (ie [(Lys) ₄ His] ₅ ) and an EcoRI cleavage site (GA
ATTC).

Further, a novel single-chain antibody gene (scHBH) was prepared by the following method, and a gene encoding a negatively charged tail was further connected to prepare a negatively charged immunoporter gene, DS4x5. The scHBH gene was prepared by adding the base sequence shown in FIG. 3 (3) to the scBH gene, which is the above single-chain antibody gene. At the 5 'end, CAGGTGCAGCTGCAGC which is the VH region of the scBH gene
A gene encoding a histidine tag was added to AG (GlnValGlnLeuGlnGln). At the 3 'end, the VL region of the scBH gene, ACAAAGTTGGAAATAAAA (ThrLysLeuGluIleL
ys) to a linker (CATCACCATCACCATCACGGTGGCGGTTCT) and an EcoRI cleavage site (GAATTC) for integration into a vector
Was added to prepare a gene that could be incorporated into an E. coli expression vector. Further, a gene encoding a histidine tag and a short linker GGTGGCGGTTCT (GlyGlyGlySer) were added to the 3 'end of the scBH gene VL region ACAAAGTTGGAAATAAAA (ThrLysLeuGluIleLys), and Pich was added.
A gene that could be integrated into ia was also made.

The scBH was prepared by adding the above nucleotide sequence to scBH.
A base sequence having the structure shown in FIG. 3 (4) was added to the 3 ′ end of scHBH to prepare DS4x5, a negatively-charged immunoporter gene. The above-mentioned short linker (GGTGGCGGTTCT) linked to the scHBH gene is added to the negative charge tail AspAspAspA.
spSerAspAspAspAspSerAspAspAspAspSerAspAspAspAspSer
AspAspAspAspSer ([(Asp) ₄ Ser] ₅ ) and an EcoRI cleavage site (GAATTC) for integration into the vector were added. Details of the added sequence are shown in FIG.

Gene expression of scHBFL, scHBFL20 and D4Sx5 was attempted. In addition, (Lys) ₈ Ser (K8S), (Arg) ₈ Ser (R8S), [(Arg) ₈ S
er] ₂ (R4Sx2), [(Arg) ₈ Ser] ₅ (R4Sx5), [(Lys) ₄ Se
r] ₅ (K4Sx5), [(Lys) ₄ His] ₅ (K4Hx5) and the negative charge tails (Gln) ₈ Ser (E8S), (Asp) ₈ Ser (D8S),
[(Asp) ₄ Ser] ₂ (D4Sx2) was prepared.

(Expression of recombinant immunoporter gene)
The expression of the recombinant immunoporter gene was performed using a Pichia expression kit manufactured by vitrogen. First, the Xho I cleavage site ctcgag sequence in the neomycin resistance gene region of pPIC9K manufactured by Invitrogene
The Sca I cleavage site in the cillin resistance gene region
By substituting with agtatt, pPIC9Kdel was prepared. FIG. 4 shows the entire nucleotide sequence of the obtained pPIC9Kdel.

Then, the following sequences were added to the 5 'end of the scHBFL, scHBFL20 and D4Sx5 genes by PCR. That is, CTC GAG AAA AGA, scHBFL20 and D4 per scHBFL
For Sx5, CTC GAG AAA AGA GAG GCT GAA GCT was added. And Invitrogen's pPIC9 (scHBFL gene),
Xho I-Ec of pPIC9Kdel (scHBFL20 and D4Sx5 genes)
Inserted at the oRI site. According to the kit, the prepared plasmid was digested with restriction enzyme BglII, introduced into Pichia pastris GS115 strain by electroporation, and selected with minimal medium to obtain a transformant. The transformed strain was grown on an agar medium containing methanol, and classified into two groups, MetS (sensitive strain) and Met + (resistant strain), based on the degree of methanol tolerance. According to the kit, methanol was added to the medium to induce expression. scHBFL
Regarding 20 and D4Sx5, many were considered to be degradation products, and normal products could not be obtained. Therefore, the transformed strain
After acclimation to a medium containing 0.5M to 1M NaCl, 0.5M
When expression was induced in a medium containing 1 to 1 M NaCl, it was possible to increase the yield of normal products. FIG. 5 shows the results of Western blotting in which a protein was detected with an anti-Flag antibody using the culture supernatant of the culture medium in which expression was induced. In FIG. 5, the position of the target antibody protein is indicated by an arrow. Antibody protein was detected in all the clones measured.

(Purification of Recombinant Immunoporter) The recombinant immunoporter was purified as follows. scHB
For FL, cells were centrifuged from the medium in which expression was induced, and the supernatant was dialyzed against PBS. It is Ni made by Qiagen
The mixture was affinity-purified using -NTA resin and dialyzed against PBS. 0.5M for scHBFL20 and D4Sx5
The culture supernatant induced in the medium containing NaCl was washed with 20 mM Tris
HCl (pH7.5) -250 mM NaCl 3 times diluted, Pharmacia ion exchange resin STREAMLINE-S (-Q for D4Sx5)
After washing with the same buffer, 20 mM Tris HCl (pH 7.
5) Eluted with -1M NaCl. Next, Clontech TAL
It was adsorbed to ON resin and eluted with 100 mM EDTA (pH 8.0). 0.5MN for eluted sample to prevent adsorption to filtration membrane
aCl was added and ultrafiltration concentrated. The concentrated sample
1M Argin to prevent immunoporter from adsorbing to resin
ine HCl-5% Glycerol (1M Sodium Glutam for D4Sx5
ate -5% Glycerol)
Purified on an ex 75 gel filtration column. The fraction containing the immunoporter was dialyzed against 0.6 M NaCl and further concentrated by ultrafiltration.

(Gene Transfer by Recombinant Immunoporter) Gene transfer by a recombinant immunoporter was performed as follows. For schBFL, purified scHBFL
And a plasmid (β-galactosidase expression vector) were mixed and allowed to stand for 30 minutes. Poly-L-lysine was further mixed and allowed to stand for 30 minutes, and then added to a culture solution containing 10% serum. Two days later, the cells were fixed and subjected to X-Gal staining, the number of blue-stained cells was counted, and the gene transfer efficiency was examined. FIG. 6 shows the results for NA cells and A431 cells. For schBFL, poly-L-
No gene transfer was observed without the addition of lysine.
Here, poly-L-lysine is thought to act as a protective agent to prevent DNA degradation.

For scHBFL20, the following standard gene transfer method was used. First, DNA (0.25 μg) and scHBFL20 (2.5 μ
g) was mixed in 15 μL HBS [20 mM Hepes (pH 7.4), 150 mM NaCl] and allowed to stand for 30 minutes, and then quickly mixed with a PEI (polyethyleneimine: average molecular weight 25K) solution (15 μL, HBS), and further mixed for 30 minutes.
Left for a minute. Then, 0.5 mL of [DMEM, 10% FBS, Kanamy
[cin] was dropped into a 24-well-culture dish. In addition, 40
After time, X-gal staining was performed and blue-stained cells were counted.
When a scHBFL20 / DNA / PEI complex was formed in HBS, the gene was transferred in a scHBFL20-dependent manner (FIG. 7). Also, scHBFL20 / DNA
/ PEI complex formation with PBS (20 mM Na-PO4 (pH 7.4), 150 mM NaC
l], the scFv dependency of gene transfer was eliminated (FIG. 8). Here, PEI seems to act as a protective agent, similarly to poly-L-lysine.

(Conversion of single-chain antibody gene from mouse type to human type) Mouse type single-chain antibody obtained from B4G7 antibody
Based on the scBH antibody sequence, a database was searched for a human antibody framework amino acid sequence similar to the framework amino acid sequence other than the variable loop domain (antigen recognition site; underlined in the lower figure) of the scBH antibody. CDR out of them
Humanization was performed by selecting a framework that does not replace amino acids presumed to be important for maintaining the loop conformation and amino acids conserved at the VL / VH interface as much as possible. In addition, assuming that the antigen-binding ability was changed by conversion to a human type, a chimeric antibody in which either the VH or VL region was a mouse type (derived from scBH antibody) was also prepared.

Here, a modified mouse (BB) in which various restriction enzyme sites were introduced into the scBH antibody gene for producing a chimeric antibody.
(Type) The nucleotide sequence and amino acids of the gene are shown in FIG. FIG.
, The amino acid numbers 9-126 are the VH region, the amino acid numbers 127-141 shown in italics are the linker sequence, and the amino acids 142-248 are the VL region. Based on the mouse type B, a type D was designed in which the framework portion of the VH region was replaced with a human-derived sequence. In addition, Ca-type and C-type sequences that retain amino acids thought to be important in the mouse-type framework part in D-type
v Designed the type. When these three structures are compared and arranged in the order closer to the human antibody, the D type is closest to the human antibody, followed by the Ca type and Cv type. In addition, C-type, which is a sequence of the human-type VL region, was also designed.

The mouse / human chimeric antibody thus produced is shown in FIGS. The CvB type shown in FIG. 10 is a Cv type in which the VH region is human, and a mouse type in the VL region
It is a type B chimera. The CaB type shown in FIG. 11 is a Ca-type chimera whose human VH region is a human type and a B-type chimera whose VL region is a mouse type. DB type shown in FIG.
Type and VL region are mouse type B chimeras. 14 to 16 show the prepared humanized antibodies. That is, the CvC type shown in FIG. 14 is a humanized antibody in which the VH region is Cv type and the VL region is C type. In the CaC type shown in FIG.
Type and VL regions are human type C antibodies. DC shown in FIG.
The type is a human antibody in which the VH region is D-type and the VL region is C-type.
9 to 16, the italic letters indicate the sequence added to the antibody gene and the linker sequence connecting VH and VL, and the underlined part indicates the variable loop domain.

(Expression of human single-chain antibody gene) Restriction enzyme sites (NcoI and EcoRI) were introduced into both ends of the human single-chain antibody gene obtained above, and the Escherichia coli expression vector pET22b manufactured by Novagen was used. PET22bhc modified to high copy type
It was introduced at the Nco I-Eco RI site. The prepared expression vector
It was introduced into Novagen E. coli strain BL21 (DE3), and expression was induced with IPTG. Anti-5x single-chain antibody in all E. coli proteins
Detection was performed by Western blotting using a His antibody (Qiagene). The result of the Western blot is shown in FIG. The Psh AI-Sca I region of Novagen's pET22b was
PET22bhc was prepared by substituting the PvuII-ScaI fragment of pBluescript II SK (-) manufactured by GEN. FIG. 18 shows the entire nucleotide sequence of pET22bhc.

(Purification of human single-chain antibody) Expression-induced Escherichia coli cells were dissolved in a solubilization buffer (6 M Guanidine HCl, 20 mM).
M Tris HCl (pH8.0), 10 mM b-mercatoetanol, 25 mM Imi
dazol) and the solubilized protein was centrifuged. The single-chain antibody in the supernatant containing the solubilized protein was
Affinity purification was performed by adsorption to LON resin and elution with a solubilization buffer containing 0.1 M EDTA. The purified single-chain antibody solution was dialyzed against a refolding buffer and finally dialyzed against PBS to rewind the protein.
The refolding buffer is 20 mM Tris HCl (pH 7.
4), 0.5M NaCl, 1mM b-mercatoetanol in 6M urea
A sample containing M, 2M, and 1M was prepared, and dialysis was performed sequentially from a sample having a high urea concentration to a sample having a low urea concentration.

(Evaluation of antibody titer of human single-chain antibody) B4G7 antibody labeled with horseradish peroxidase (HRP) and unlabeled B4G7 antibody or single-chain scBH antibody were mixed, and formalin-fixed A431 cells were used as antigen. A competitive ELISA was performed. FIG. 19 shows the results of measuring the antibody titers of the above-mentioned mouse, chimeric and human antibodies. As shown in FIG.
Except for the types, the chimeric and humanized single-chain antibodies had almost the same binding ability as the mouse type (BB type: the amino acid sequence of the VH / VL portion was the same as scBH).

(Conversion of human single-chain antibody gene to immunoporter gene) pPIC9K was obtained by site-directed mutagenesis.
The ccatgg sequence at the Nco I cleavage site in the His4 gene region of del
Replaced by ccatag. PPIC9Kde incorporating D4Sx5 gene
The same mutation was introduced into l to obtain pPIC9Kdd-D4Sx5. pP
FIG. 20 shows the entire nucleotide sequence of IC9Kdd.

The PCR method of the humanized single chain antibody gene
Introduce the base sequence CTC GAG AAA AGA GAG GCT GAA GCT at the 5 'end, and change the base sequence of the 3' His tag to 5'-GTTGACATC
AAACACCATCACCATCACCATGGTGGCGGTTCTTAAGAATTC Using restriction sites of Xho I and Nco I, pPIC9Kdd
-Introduced into the same site of D4Sx5. In the subsequent method, a human single-chain antibody immunoporter was obtained by using a method similar to the method described above in the expression and purification of the recombinant immunoporter gene.

[0050]

Industrial Applicability According to the present invention, a novel DNA delivery system, a human single-chain immunoporter monoclonal antibody protein fusion protein and a complex of the fusion protein and DNA are provided.

[0051]

[Sequence list] <110> Name of applicant: Keio Gijuku <120> Title of the invention: Monoclonal antibody fusion protein against antigen present on cell surface and method for producing the same <160> Number of sequences: 2 <210> sequences No .: 1 <211> Sequence length: 258 <212> Sequence type: Amino acid <213> Origin: Mouse epidermal growth factor receptor antibody <400> Sequence MGHHHHHHHVVQLQQSGAELVR PGAS 25 VKLSCTASGFNIKDTLMHWVK QRPE 50 QGLEWIGWIDPEDGNTKYVRK FQGK 75 ATITADTSSNTAVGSTYVYTSATITATSTSAGGTSVTS 125 SGGGGSGGGGSGGGGSDIELT QSPA 150 SLSASVGETVTITCRTSENIY SYFA 175 WYQQKQGKSPHLLVYNAKTLA EGVP 200 SRFSGSGSGTGTFSLKINSLQP EDFG 225 IYFCQHHYGSLHTFGGGTKLE IKHH 250 HHHHGGGS 258 <210> SEQ ID NO: 2 <211> Sequence length: 258 <212> Sequence type: Amino acid <213> Origin: Human epidermal growth factor receptor antibody <400> Sequence MGHHHHHHQVQLVQSGAEVKK PGAS 25 VKVSCKASGFNIKDTLMHWVR QAPG 50 QGLEWMGWIDPEDGNTKYVRK FQGR 75 VTMTRDTSTSTVYMELSSLRS EDTA 100 VYYCARGGSYGNWAYWGQGTT VTVS 125 SGGGGSGGGGSGGGGSDIQMT QSPS 150 SLSASVGDRVTITCRTSENIY SYFA 175 WYQQKSGKAPKLH GSHH GSH HGS TGH HGS TGVP HGS TF HGS TGH HGS TF HGS TG HGS TF HGS TG HGS TG HGS

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence and amino acid sequence of the single-chain antibody portion of pBH.

FIG. 2 is a graph showing the antibody titer of a single-chain antibody.

FIG. 3 is a diagram showing the structure of a sequence added for producing the produced immunoporter.

FIG. 4 is a view showing the entire nucleotide sequence of pPIC9Kdel.

[Fig. 5] Fig. 5 shows that the protein in the medium for which expression was induced was subjected to anti-Flag.
It is a photograph which shows the western blot detected with the antibody.

FIG. 6 is a diagram showing gene transfer efficiency by schBFL.

FIG. 7 is a diagram showing the efficiency of gene transfer by scHBFL20 under HBS.

FIG. 8 is a diagram showing gene transfer efficiency using scHBFL20 under PBS.

FIG. 9 is a diagram showing the nucleotide sequence and amino acid sequence of a mouse improved single-chain antibody gene of BB type.

FIG. 10 shows the nucleotide sequence and amino acid sequence of a single-chain antibody gene of a CvB mouse / human chimera.

FIG. 11 is a diagram showing the nucleotide sequence and amino acid sequence of a single-chain antibody gene of a CaB-type mouse / human chimera.

FIG. 12 is a view showing the nucleotide sequence and amino acid sequence of a single-chain antibody gene of DB mouse / human chimera.

FIG. 13 is a view showing the nucleotide sequence and amino acid sequence of a single-chain antibody gene of BC mouse / human chimera.

FIG. 14 shows the nucleotide sequence and amino acid sequence of a single-chain antibody gene of a CvC human antibody.

FIG. 15 is a diagram showing a base sequence and an amino acid sequence of a single-chain antibody gene of a human antibody of CaC type.

FIG. 16 shows the nucleotide sequence and amino acid sequence of a single-chain antibody gene of a DC human antibody.

FIG. 17 is a photograph showing a Western blot in which the expression of a single-chain antibody gene was detected.

FIG. 18 is a view showing the entire nucleotide sequence of pET22bhc.

FIG. 19 is a graph showing the antibody titer of a humanized single-chain antibody.

FIG. 20 is a view showing the entire nucleotide sequence of pPIC9Kdd.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 16/28 C12P 21/02 C 19/00 21/08 C12P 21/02 (C12P 21/02 21/08 C12R 1:19) // (C12P 21/02 (C12P 21/02 C12R 1:19) C12R 1:84) (C12P 21/02 (C12P 21/08 C12R 1:84) C12R 1:19) (C12P 21 / 08 (C12P 21/08 C12R 1:19) C12R 1:84) (C12P 21/08 C12N 15/00 ZNAA C12R 1:84) A61K 37/02 F term (reference) 4B024 AA01 BA44 CA04 DA06 DA12 EA03 EA04 GA11 HA01 4B064 AG27 CA02 CA06 CA19 CC24 DA05 4C084 AA01 AA13 BA07 BA22 CA25 DA27 NA14 ZB262 4C085 AA14 BA21 BB50 CC07 DD23 DD33 DD41 EE05 4H045 AA11 BA41 BA54 CA40 DA76 EA28 FA74

Claims (15)

[Claims] 1. A fusion protein capable of carrying a gene by binding to the gene, comprising a human-type single-chain monoclonal antibody against an antigen present on a cell surface, and a peptide which is a gene binding site. A monoclonal antibody fusion protein against an antigen present on a cell surface, which is a fusion protein comprising: 2. The monoclonal antibody fusion protein according to claim 1, wherein the antigen present on the cell surface is an epidermal growth factor receptor. 3. The monoclonal antibody fusion protein according to claim 1, wherein the peptide is a peptide comprising 90 or less amino acids charged to a positive charge. 4. The monoclonal antibody fusion protein according to claim 1, wherein the peptide is a peptide comprising 90 or less amino acids charged to a negative charge. 5. The method according to claim 1, wherein the peptide is [X _n Y] _m (where X
Is an amino acid selected from the group consisting of lysine, arginine, aspartic acid and glutamic acid, Y is an amino acid excluding lysine, arginine, aspartic acid and glutamic acid, n is 1 to 8, and m is 1 to 1
The monoclonal antibody fusion protein according to claim 1, which has a structure represented by 0). 6. The peptide according to claim 1, wherein the peptide has a structure represented by X _n (where X is lysine, arginine, aspartic acid or glutamic acid, and n is 2 to 8).
A monoclonal antibody fusion protein against the receptor present on the cell surface as described above. 7. A complex of the monoclonal antibody fusion protein, which is a complex of the monoclonal antibody fusion protein according to claim 1 and DNA. 8. The complex of the monoclonal antibody fusion protein according to claim 7, wherein the gene is a gene having an anticancer effect. 9. The peptide according to claim 9, wherein said peptide is positively charged.
The monoclonal antibody fusion protein complex according to claim 7, which is a peptide comprising 0 or less amino acids and is directly bound to a gene. 10. The peptide according to claim 7, wherein the peptide is a peptide consisting of 90 or less amino acids charged to a negative charge, and bound to a gene coated with a positively charged polymer. Complex of monoclonal antibody fusion protein. 11. A method for preparing a monoclonal antibody fusion protein against a receptor present on a cell surface, comprising: (1) extracting from a hybridoma cell capable of producing a monoclonal antibody against a monoclonal antibody against a receptor present on the cell surface. Using mRNA as a template, a single-chain antibody gene of a mouse monoclonal antibody is amplified by PCR, and (2) a single-chain antibody of a human monoclonal antibody is converted by converting the framework portion of the mouse monoclonal antibody. Gene, and (3) a human-type single-chain immunoporter gene by adding a gene encoding an amino acid tail to the single-chain antibody gene of the human-type monoclonal antibody;
(4) A method for producing a monoclonal antibody fusion protein comprising a step of obtaining a recombinant human single-chain immunoporter protein by expressing the human single-chain immunoporter gene in bacteria. 12. A method for introducing the complex of the monoclonal antibody fusion protein according to claim 7 into a cell via a cell surface receptor. 13. The method according to claim 12, wherein the gene is introduced into cells by endocytosis. 14. A polypeptide comprising an amino acid sequence represented by the following (a) or (b): (A) amino acid numbers 1-2 shown in SEQ ID NO: 1 in the sequence listing
A polypeptide consisting of the amino acid sequence represented by 58. (B) a polypeptide having an activity of binding to an epidermal growth factor receptor, wherein one or several amino acids of (a) are deleted, substituted or added. 15. A polypeptide comprising an amino acid sequence represented by the following (c) or (d): (C) amino acid numbers 1-2 shown in SEQ ID NO: 2 in the sequence listing
A polypeptide consisting of the amino acid sequence represented by 58. (D) A polypeptide having an activity of binding to an epidermal growth factor receptor, wherein one or several amino acids of (c) are deleted, substituted or added.