JP2001252080A - Fused androgen receptor protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an androgen receptor protein that has excellent stability and is easy to handle. SOLUTION: The fused androgen receptor protein is characteristically produced by fusing the androgen receptor protein together with a saccharide-binding protein. This invention also provides a reagent for judging whether there is the interaction with the ligand prepared by using the fused androgen receptor protein.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a protein obtained by fusing an androgen receptor widely existing in vertebrate organisms to a sugar-binding protein, a gene encoding the protein,
The present invention relates to a method for producing a fusion protein and a reagent for analyzing the interaction of a chemical substance using the fusion protein. More specifically, the present invention seeks for a ligand having a pharmacological action via an androgen receptor, or determines whether a known chemical substance has the properties of a so-called exogenous endocrine disrupting chemical substance (screening test). The present invention relates to a biomaterial that can be used for a biomaterial.

[0002]

2. Description of the Related Art An androgen receptor (hereinafter referred to as AR)
Is also known as a member of the so-called nuclear receptor superfamily, and its endogenous ligands in vivo are testosterone and dihydrotestosterone. Here, the ligand refers to a low molecular weight chemical substance, and is generally a compound having a molecular weight of several hundreds to several thousands. AR
Binds to a region on a gene called ARE (androgen response element) as a ligand-AR complex in the presence of a certain concentration of endogenous ligand, and exerts an androgen effect by expressing a gene located downstream thereof. I do. Androgen receptors are deeply involved in the growth and development of living organisms, and abnormalities in the action process result in impaired sexual development and malignant mutation. These abnormalities related to androgen action have been energetically studied through the study of mutants of the androgen receptor (Critical Revie
ws in Eukaryotic Gene Expression, 5 (2), pp97-125).
AR is widely distributed in various tissues, especially in the pancreas,
It is widely distributed in stomach, kidney, prostate, liver, etc.

[0003] In addition to endogenous ligands that react with AR, there are many artificially designed ligands. 7α,
17α-dimethyl 19-nortestosterone (mibolerone), 17α-methyl-17β-hydroxy-estradi-4,
9,11-trien-3-one (R1881) and the like.
Both of these are agonists that bind to AR, but mibolerone is preferred for use in binding assays because of its poor reactivity with testosterone-estradiol binding globulin and the progestin receptor (The Prostate 5, pp581- 588 (1984)), especially when measuring using an AR sample from which tissue has been extracted.
The pharmacological applications of these agonists or antagonists are currently being extensively studied.

[0004] In recent years, there have been many reports that some of industrially used chemical substances interact with AR. These are widely referred to as endogenous endocrine disrupting chemicals (so-called environmental hormones), including chemicals reported as estrogen-like substances, and there is an urgent need to re-examine the chemicals currently used.
Among the androgen-related chemicals, DDE (p, p-1,1-dichloro-2,2-bis (p-chlorophenyl) ethylene), vinclozolin, DDT (o, p'-1,1,1-trichloro-2,2-bis (p
-Chlorophenyl) ethane), bisphenol A, butylbenzyl phthalate, etc. have been reported (Journal of
Endocrinology 158, pp327-339 (1998)). It is feared that an increasing number of potential endogenous endocrine disrupting chemicals will be identified as screening progresses in the future.

To search for the above pharmacological ligands and to measure their potential as endocrine disrupting chemicals, the Hershberger assay using castrated rats (Proc.
83, pp175-180)), rat AR equilibrium exchange binding assay, human AR whole cell binding assay using COS cells, YAS yeast androgen screen assay, CV-1 cell assay Methods, transcriptional activation assays using stable cell lines such as CV-1 cells, methods using isolated Leydig cells, and the like.
Numerous in vitro and in vivo assays are available (EDSTAC Final Report, Chapter Five, published by the US Environmental Protection Agency (EPA))
Appendices, August, (1998)). Although all of these methods have their advantages and disadvantages, in vitro receptor binding assays are classified into rat AR equilibrium exchange assay and human AR whole cell binding assay using COS cells. The advantage of these two binding assays is that the direct interaction between the ligand and the receptor can be seen, and by complementing the other assays, the essence of the chemical of interest becomes clearer. Becomes

In the rat AR equilibrium exchange binding assay, an organ such as the prostate is immediately excised, homogenized, suspended in a predetermined reaction solution, and suspended with a radiolabeled ligand such as tritium-labeled R1881 at a predetermined concentration. After the reaction, the radiolabel bound to the receptor and the free radiolabel are separated, and the amount of the bound or free label is measured. During the reaction between the radiolabel and the receptor, the change in the amount of the radiolabel that binds (or is released) by the action of the target chemical substance is measured, and the exchange rate with the label is determined to determine the reactivity of the chemical substance to AR. Is to determine the presence or absence of

[0007] The human AR whole cell binding assay using COS cells is performed by adding human A cells to COS cells, a monkey cell line.
Culturing after transformation with a vector constructed to express R,
In the assay system in which human AR is expressed in COS cells and reacted with a radio-labeled ligand, and the amount of bound or free label is measured, the effect is observed in the presence of a chemical substance in the assay system.

[0008] Since these binding assays require a great deal of time and labor and labor to prepare an AR sample, attempts have recently been made to obtain AR by genetic recombination technology. Example of full-length rat AR expressed in insect cells and baculovirus vector system (Journal of B
iological Chemistry, 267 (7), pp4939-4989 (1992), H
Example of expressing human AR in vaccinia virus vector system in eLa cells (Nucleic Acids Research, 22 (7),
pp1161-1166 (1994)) or glutathione in E. coli-
Human A fused to S-transferase (GST)
Example in which R was expressed (Molecular and Cellular Endcrinol
ogy 84, pp1-14 (1992)), an example of expression in E. coli in a form fused with a polyhistidine sequence (J. Steroid Biochem.
Molec. Biol. 57, pp 251-257 (1996)), an example of expressing human AR in a form fused with β-galactosidase (Molec.
cular Endocrinology 4 (12), pp1841-1849 (1990)).

When the above-mentioned binding assay is performed on a chemical substance, not only is the reactivity with the chemical substance itself examined, but also the organ extract (such as the so-called S9 mix), or By reacting with a drug-metabolizing enzyme (such as cytochrome P450) and examining the reactivity of a chemical substance metabolized in a living body, the overall reactivity of the chemical substance is extremely often evaluated.

These organ extracts and drug-metabolizing enzyme preparations often contain various non-specific and specific proteases.
It becomes an interfering factor in the form of decomposition. Specific proteases include trypsin, pepsin, thrombin, kallikrein, urokinase, etc.The distribution and abundance vary depending on the organ, but these specific proteases have a great effect on the reaction with AR together with non-specific proteases, Or, it causes difficulty in determining the evaluation of a chemical substance. Avoiding the effects of this protease is important.

The specific protease often recognizes basic amino acids such as lysine and arginine, aromatic amino acids, and hydrophobic amino acids. For example, trypsin selectively cleaves the carboxyl group side of arginine and lysine, and pepsin has broader specificity, but more preferably cleaves the carboxyl group of phenylalanine, tyrosine, tryptophan, cysteine, cystine and leucine residues. . Kallikrein B is X-phenylalanine-arginine-Y, chymosin is X-proline-
Histidine-leucine-serine-phenylalanine-methionine-alanine-isoleucine-Y, urokinase recognizes X-arginine-valine-Y, and thrombin recognizes arginine of a specific sequence.

An amino acid sequence recognized by a specific protease is often used in the above-mentioned GST fusion protein and the like. Their sequences include, for example, blood coagulation factor X
a, thrombin, and sequences recognized by enterokinase. Specifically, X-isoleucine-glutamic acid-glycine-arginine-Y and X-leucine-
Valine-proline-arginine-glycine-serine-
Y, X-aspartic acid-aspartic acid-aspartic acid-aspartic acid-lysine (or arginine)-
Y. Therefore, proteins having these sequences are not only cleaved by a specific protease, but also serve as targets for proteases present in organ extracts and the like.

[0013]

From the viewpoint that the preparation is easy without being affected by various interference environments, it is desirable to use various ARs by a gene recombination technique. AR also has very poor stability,
Particularly, when expressed as a GST fusion protein, it is often difficult to use it at around 25 ° C. Further, in the case of an AR fused with a polyhistidine sequence, a soluble AR and an insoluble AR are mixed, and there is a further problem from the viewpoint of maintaining the preparation of AR of a constant quality. Most AR expressed in insect cells is insoluble and requires treatment with denaturants such as urea and guanidine hydrochloride and unwinding of the protein,
The efficiency of rewinding and obtaining an active protein which requires much effort is generally very poor and disadvantageous. Furthermore, it is difficult to separate active and inactive proteins.

In most cases, AR as a recombinant in the form of a fused protein such as a GST-fused protein utilizes a specific protease recognition sequence. When coexisting proteases are measured during measurement of substances, processed ligands and chemical substances. This is because the reactivity with the ligand does not change, but the activity per protein mass (specific activity) differs between the protein cleaved at the fusion portion and the fusion protein. Recombinants such as GST-fused proteins are
In the purification process, they are often intentionally treated with a specific protease and are prepared in an isolated form, but their preparations are as unstable as recombinant proteins produced without fusion. In some cases, the activity was extremely reduced during the purification, and the handling required remarkable attention even after the purification.

[0015]

Means for Solving the Problems The inventors of the present invention have conducted intensive studies to solve the above-mentioned problems, and as a result, GST fusion has been carried out by fusing a sugar-binding protein to the amino terminal of AR. It has been found that remarkable stabilization, which is not seen in immobilized proteins, is possible. Furthermore, by imparting resistance to specific protease at the junction for fusion, it is possible to measure chemical substances reacted with organ extracts etc. with the influence of coexisting proteases extremely reduced And completed the present invention.

That is, the present invention has the following configuration. (1) A fused androgen receptor protein obtained by fusing an androgen receptor protein with a sugar-binding protein. (2) The fused androgen receptor protein of (1), wherein the androgen receptor protein contains at least a ligand binding region. (3) The fused androgen receptor protein of (1), wherein the androgen receptor protein comprises at least a ligand binding region and a DNA binding region. (4) The fused androgen receptor protein of (1), wherein the androgen receptor protein comprises a ligand binding region, a DNA binding region transcription region and a hinge region. (5) The fused androgen receptor protein according to any of (1) to (4), wherein the androgen receptor protein is derived from any organism selected from the group consisting of fish, amphibians, reptiles, birds and mammals . (6) The fused androgen receptor protein according to any one of (1) to (4), wherein the androgen receptor protein is completely human. (7) The androgen receptor protein is fused to any one of (1) to (6), which has a partial amino acid sequence change known as a genetic polymorphism or a partial amino acid sequence change due to pathological mutation. Androgen receptor protein. (8) The fused androgen receptor protein of (7), wherein the androgen receptor protein is the following (a) or (b) androgen receptor protein. (A) a protein consisting of the amino acid sequence shown in SEQ ID NO: 11; (b) an amino acid sequence consisting of an amino acid sequence (a) in which one or several amino acids are deleted, substituted or added, and androgen Protein having receptor activity (9) The androgen receptor protein reacts with endogenous androgen, a synthesized agonist, an agonist or a chemical substance having an androgen-like or anti-androgen-like action (1) to (8) And b) the fused androgen receptor protein. (10) The fused androgen receptor protein according to any one of (1) to (9), wherein the sugar-binding protein is a maltose-binding protein. (11) The fused androgen receptor protein according to any one of (1) to (10), which has a specific protease-resistant amino acid sequence at a linking site of the sugar-binding protein. (12) A gene encoding the fused androgen receptor protein according to any one of (1) to (11). (13) A gene encoding the fused androgen receptor protein of (12), comprising the following gene (c) or (d): (C) a gene consisting of the base sequence described in SEQ ID NO: 10 (d) a base sequence in which one or several bases are deleted, substituted or added in the base sequence (c), and androgen A gene encoding a protein having a receptor activity ヲ (14) A vector carrying the gene of (12) or (13). (15) A transformant obtained by introducing the vector of (14) into a microorganism and expressing a gene encoding a fused androgen receptor protein. (16) The transformant according to (15), wherein the microorganism is Escherichia coli. (17) Escherichia coli is Escherichia coli
li) The transformant of (16), which is JM109. (18) A method for producing a fused androgen receptor, comprising collecting a fused androgen receptor from a culture solution obtained by culturing the transformant according to any one of (15) to (17). Method. (19) The method according to any one of (1) to (11), comprising the fused androgen receptor protein of any one of (1) to (11), a solvent for dissolving the chemical substance, and a diluent of the dissolved chemical substance. A reagent for detecting the presence or absence of interaction with a ligand.

[0017]

BEST MODE FOR CARRYING OUT THE INVENTION The sugar-binding protein used in the present invention includes maltose-binding protein (MB
P) Other than cellulose-binding protein, mannose-binding protein, glucosamine-sialic acid-binding protein, etc.
Various sugar-binding proteins can be used. It is preferable to use a sugar-binding protein of the same origin as the host to be expressed, and when using Escherichia coli as a host, a combination with a maltose-binding protein derived from Escherichia coli is preferable. However, the present invention is not limited to Escherichia coli as a host, and sugar-binding proteins may be used in other hosts, for example, Bacillus sp.
Prokaryotic microorganisms such as Pseudomonas,
Expression systems using eukaryotic microorganisms such as yeast, insect cells, animal cells, plant cells, and expression vectors corresponding thereto can be used.

The androgen receptor (AR) of the present invention may be derived from mammals such as humans, rats and mice, birds such as chickens, and the like.
Those derived from reptiles such as crocodile, those derived from amphoteric species such as frogs, and those derived from fish such as trout and medaka can be used. From the perspective of the impact of chemical substances on the environment, the importance of AR using any source remains the same, but in the search for ligands as pharmacological effects, those derived from humans, especially completely human Things are more important.

It is known that AR has a transcription activation region and a binding portion (DNA binding region) to an androgen response DNA sequence (ARE), a hinge region, a transcription regulatory region, and a ligand binding region. A main object of the present invention is to search for a potential in the reactivity of a chemical substance with AR, a pharmacologically effective ligand through AR, and for this purpose, AR includes at least a ligand binding portion (ligand binding domain; LBD). Further, it preferably contains a DNA binding region, and more preferably contains a hinge region. When checking the binding property of the ARE to the DNA portion, it can be selected and used according to the purpose, for example, by expressing a protein downstream from the DNA binding region.

The AR of the present invention also includes ARs having altered ligand binding ability in the above-mentioned mutation studies. Various mutants having altered ligand binding ability reflecting abnormalities in a living body can be used. Here, the mutation refers to substitution, addition or deletion of one or several amino acids.
AR corresponding to the so-called single nucleotide polymorphism (SNPS)
The present invention can exert its power in studying the mutants at the protein level.

The endogenous androgen in the present invention refers to testosterone, dihydroxytestosterone and the like, and the synthetic agonist refers to mibolerone, R1881, and derivatives of these with testosterone and dihydroxytestosterone. The exogenous endocrine disrupting substances include vinclozolin, DDE (p, p-1,1-dichloro-2,2-bis (p-
Chlorophenyl) ethylene), vinclozolin, DDT
(O, p'-1,1,1-trichloro-2,2-bis (p-chlorophenyl) ethane), bisphenol A, butylbenzylphthalate / diethylstiberol, hydroxyflutamide, etc. It includes those in which the interaction is confirmed at least at the protein level.

The specific protease-resistant amino acid sequence referred to in the present invention is, for example, a blood coagulation factor X as described above.
a, an amino acid sequence recognized by a specific protease such as thrombin, enterokinase, or a protease present in an organ extract, specifically, X-isoleucine-glutamic acid-glycine-arginine-
Y, X-leucine-valine-proline-arginine-glycine-serine-Y, X-aspartic acid-aspartic acid-aspartic acid-aspartic acid-lysine (or arginine) -Y Refers to an array. In consideration of the recognition sequence of the specific protease as described above, any amino acid sequence may be used as long as basic amino acids such as arginine and lysine, and phenylalanine, leucine, valine, proline, and the like are reduced as compared with general amino acid sequences. Therefore, for example, a repeating sequence of glycine-serine or a combination sequence of glutamic acid and aspartic acid can be used for the connecting portion. These sequences are not particularly limited as long as care is taken so that the sugar-binding protein and the AR protein are not sterically hindered and a sufficient expression level can be ensured.

As the gene sequence corresponding to the AR protein used in the present invention, a natural sequence can be used as it is, a base sequence can be changed without amino acid mutation, and a codon of a host to be used can be used. Selection tendency (Codo
n Usage).

In the present invention, when Escherichia coli is used as a host for producing a fused AR protein, the strain may be Escherichia coli which is usually used for molecular biology and production of useful bioactive substances. ) JM
109, BL21, etc. can be used, but there is no particular limitation as long as it is a strain suitable for industrial production, ensuring safety and exhibiting stable productivity.

The sugar-binding protein fusion AR of the present invention is used for studying the reactivity with a chemical substance at the protein level. The reactivity can be evaluated by a radioisotope method using tritium-labeled endogenous AR ligand or synthetic ligand, fluorescent A
A method of synthesizing an R ligand to detect a state of fluorescence, a method of detecting a minute amount of heat at the time of binding to a ligand,
It can be evaluated by various methods such as a method of detecting a ligand that has reacted with R or a free ligand using a biological material such as an antibody.

As the composition for reacting the AR of the present invention, those described in the above-mentioned documents can be appropriately used. For example, a buffer having a buffering capacity at pH 6 to 8 is 20 to 300 mM, a mild reducing agent such as dithiothreitol is 1 to 20 mM, a stabilizer such as glycerol, gelatin, bovine serum albumin or globulin is 0.01 to 30.
% By weight, metal salts such as sodium molybdate, sodium vanadate, sodium chloride and potassium chloride 0.5
３００300 mM or the like can be used.

In addition to the reagent for detecting the presence or absence of interaction with the ligand according to the present invention and the fused androgen receptor protein according to the present invention as described above, a solvent for dissolving a chemical substance, A diluent of said chemical. Here, as a solvent for dissolving a chemical substance, water, a buffer solution, methanol,
Ethanol, DMSO, DMF and the like can be mentioned, and a solvent suitable for the properties of the chemical substance can be selected, and an appropriate concentration can be set. Ultrapure water is preferred for chemicals with good water solubility, and 100% DMSO for others. Further, the diluted solution of the dissolved chemical substance is used for adjusting the concentration of the chemical substance to an appropriate concentration at the time of reaction with the receptor, and includes a buffer, a solvent, a protein, and the like. The diluent is not particularly limited as long as it has a composition that does not affect the reaction with the receptor protein, but is preferably the same as the reaction composition of the receptor protein. In addition, as an auxiliary reagent for separating the ligand bound to the receptor from the free ligand (B / F separation), a suspension containing dextran, charcoal solution or hydroxyapatite resin is appropriately used. F separation can be performed and the reaction can be evaluated. Further, in this case, as the separation means, centrifugation, separation with filter paper, a filter or the like is preferable. After reacting a receptor with a chemical substance (ligand), the receptor-ligand complex or free ligand can be evaluated by chromatography means such as HPLC, capillary electrophoresis, etc., and evaluated using an antibody or the like. Can also.

[0028]

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples.

Example 1 A synthetic oligonucleotide having the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 was used as a primer pair, and a PCR-Ready Human cDNA (Prostate, Spl.
PCR was performed using PFU turbo (Stratagene) DNA polymerase with een, Kidney and Liver (manufactured by Maxim Biotech) as a template. The composition of the performed PCR reagent (per 100 μL) was 10 μL of PFU turbo 10-fold concentration buffer, 6 μM of 25 mM magnesium chloride solution.
L, dNTP solution 10 μL, primer solution of SEQ ID NO: 1
(10 pmol / μL) 4 μL, SEQ ID NO: 2 primer solution (10 pmol / μL) 4 μL, human prostate cDNA library 1 μL, PFU turbo (2.5 U / μL) 1 μL, sterile M
64 μL of illiQ water. The PCR cycle was 95 ° C. for 30 seconds after preheating at 95 ° C. for 2 minutes.
25 times at 72 ° C. for 1 minute and 30 seconds. As a result of this PCR, a gene fragment of about 1400 base pairs corresponding to amino acids 471 to 917 of AR was confirmed. Using MagExtractor PCR & Ge
l After cleaning up with Clean up kit (manufactured by Toyobo Co., Ltd.), primers of SEQ ID NO: 1 and SEQ ID NO: 2 were introduced.
After digestion with BamHI and SalI (manufactured by Toyobo) for 3 hours, the mixture was ligated to a maltose-binding protein fusion vector (pMalc2e; manufactured by New England Biolab) digested with the same restriction enzymes using T4 ligase (manufactured by Toyobo),
Competent Escherichia coli JM109 strain (manufactured by Toyobo) was transformed at 42 ° C. for 45 seconds.

After the transformation, the cells were spread on an LB agar medium containing ampicillin and allowed to stand at 37 ° C. overnight. The resulting colonies were inoculated into 20 LB cultures and cultured at 37 ° C. overnight. 100 μL of a culture solution of each colony cultured overnight was mixed with 1 g of yeast extract (manufactured by Gibco) and trypton (manufactured by Gibco)
1.5 g, sodium chloride (manufactured by Nacalai Tesque) 0.5
g in 50 ml (hereinafter referred to as SB medium)
In addition, 1 mL of 1M glucose (manufactured by Nacalai Tesque) and 10 mL
0μg / mL ampicillin solution (Nacalai Tesque) 60μ
The cells were subcultured together with L and cultured at 37 ° C. for about 3 hours. O
After confirming that D660 nm is between 0.8 and 1.2, 100 mM isopropylthiogalactoside (IPT
G: manufactured by Nacalai Tesque) 100 μL, and added at 30 ° C.
Induction culture was performed for hours. After induction culture, the cells were collected by centrifugation and stored frozen at -20 ° C until crushed.

Example 2 The cells obtained in Example 1 were mixed with the above-mentioned Molecular and Cellular Endoscope so that the OD660 was 10 as the cell concentration.
It was crushed by the crushing solution and the method described in crinology 84, p1-14 (1992). After crushing, streptomycin sulfate (manufactured by Nacalai Tesque) was added to a concentration of 0.02 g / mL. After nucleic acid removal, tritium-labeled mibolerone (manufactured by Daiichi Pure Chemicals) was added to a final concentration of 3 nM. The binding activity of AR was evaluated by the dextran charcoal method in the same manner as described. The reaction was performed at 7 ° C. About half of the 20 colonies showed clear AR binding activity. FIG. 1 shows the time course of the binding activity. As a control, 200 nM non-radiolabeled mibolerone (manufactured by Daiichi Pure Chemicals) was co-existed with tritium-labeled mibolerone, and as an indicator of the binding activity, the signal difference between the presence and absence of the non-radiolabeled mibolerone was determined as an activity value. And From FIG. 1, it was found that the compound exhibited extremely clear AR binding activity.

Example 3 One clone of Example 2 whose binding activity was confirmed was selected, and a plasmid was purified from the cells by a conventional method. Using this plasmid as a template, a synthetic oligonucleotide pair of SEQ ID NO: 3 and SEQ ID NO: 4 and Quick Change Site-Directed M
Using a utagenesis Kit (manufactured by Stratagene), the lysine residue at the link between the maltose-binding protein and AR is changed to a glutamic acid residue, and a specific protease (including not only enterokinase but also a protease such as trypsin) is used. The potential target sequence was eliminated. Reaction conditions and the like were performed according to the method described in the protocol of the kit, and a single colony carrying the expression vector into which the mutation was introduced was obtained.

A plasmid was prepared from the obtained single colony by a conventional method, and primers of SEQ ID NOs: 5 to 9 and ABI
The nucleotide sequence was determined using PRISM BigDye Terminator Cycle Sequencing Kit. The reagent composition and reaction conditions were performed according to the protocol attached to the kit, and the measurement and analysis were performed using the ABI PRISM model 310. The results of the obtained nucleotide sequence and amino acid sequence are shown in SEQ ID NOS: 10 and 11. Next, a method of manufacturing another embodiment with respect to the change of the connecting portion will be described. In order to change the sequence between AvaI and BamHI in the junction of the pMalc2e vector to amino acids mainly composed of glycine and serine, synthetic oligonucleotides of SEQ ID NO: 12 and SEQ ID NO: 13 were prepared, and a complementary pair was formed by heat treatment. Later, the vector and the complementary pair DN
A was digested with AvaI and BamHI, and ligated with DNA ligase to obtain a mutant vector. After ligation, competent Escherichia
Transformation was performed using E. coli JM109, and a single colony was selected. As a heat treatment, each primer is prepared with sterile MilliQ water so as to have a concentration of 50 pmol / μL.
This was performed by repeating the procedure twice. By this operation, AvaI-BamH
It was possible to introduce -glycine-serine-glutamic acid-serine-serine-glycine-serine-glycine-glycine- between I. After the introduction, a transformant was obtained by inserting the AR gene fragment in the same manner as in Example 1.

Example 4 Escherichia coli JM109 having a plasmid containing SEQ ID NO: 6 obtained in Example 3 was induced after culture in the same manner as in Examples 1 and 2, and the activity was measured. The reaction was carried out at a temperature of 7 ° C., 25 ° C., and 30 ° C.
When the time course up to the time was confirmed, it became clear as shown in FIG. 2 that 25 ° C. was the most reactive condition. This shows a clear advantage over the conventional AR in which the activity measurement was practically impossible unless the temperature was about 4 ° C. or under ice cooling.

Example 5 The AR sample prepared in Example 4 was reacted with tritium-labeled mibolerone having a final concentration of 3 nM at 7 ° C. for 3 hours. At this time, testosterone (manufactured by Nacalai Tesque), dihydroxysterone (manufactured by Wako Pure Chemical Industries), mibolerone, R
1881 (manufactured by Daiichi Pure Chemicals), bisphenol A (manufactured by Nacalai Tesque) and diethylstiberol (manufactured by Nacalai Tesque) were changed from a final concentration of 1 nM to 100 μM, and the effect on binding activity was examined. The reaction mixture is PIPES
It contains 50 mM (pH 7.4), glycerol 10%, sodium molybdate 10 mM, potassium chloride 150 mM, and dithiothreitol 5 mM. Fig. 3 shows the results.
~ 8. It is confirmed from the dose response in each figure that these representative chemical substances having so-called anti-androgen action competitively inhibit the AR reaction in a concentration-dependent manner.

[0036]

As described above, the present invention can provide a stable and easy-to-operate androgen receptor protein, and can be used for screening drugs and endocrine disrupting substances. In particular, when using an androgen receptor protein into which a protease-resistant amino acid sequence is introduced, when measuring a chemical substance treated in a metabolic system of a living body such as S9 mix, it is necessary to accurately measure without being affected by mixed proteases. Became possible.

[0037]

[Sequence list] SEQ ID NO: 1 Sequence length: 36 Sequence type: Number of nucleic acid chains: Both forms Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence AATTAAGGAT CCGAGGCGGG AGCTGTAGCC CCCTAC 36

SEQ ID NO: 2 Sequence length: 60 Sequence type: Number of nucleic acid strands: Both forms Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ATGCATGTCG ACTCACTGGG TGTGGAAATA GATGGGCTTG ACTTTCCCAG AAAGGATCTT 60

SEQ ID NO: 3 Sequence length: 32 Sequence type: nucleic acid Number of strands: Both forms Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGGATGACG ATGACGAGGT ACCGGAATTC GG 32

SEQ ID NO: 4 Sequence length: 32 Sequence type: Number of nucleic acid strands: Both forms Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CCGAATTCCG GTACCTCGTC ATCGTCATCC CC 32

Sequence number: 5 Sequence length: 24 Sequence type: Number of nucleic acid chains: Both forms Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CTGGGTGCCG TAGCGCTGAA GTGT 24

SEQ ID NO: 6 Sequence length: 24 Sequence type: Number of nucleic acid strands: Both forms Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGTCGTCAGA CTGTCGATGA AGCC 24

SEQ ID NO: 7 Sequence length: 24 Sequence type: Nucleic acid number of strands: Both forms Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGCCAGGGTT TTCCCAGTCA CGAC 24

SEQ ID NO: 8 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Both forms Topology: Linear Sequence type: Other nucleic acids Synthetic DNA sequence GTGCGCCAGC AGAAATGATT GCAC 24

SEQ ID NO: 9 Sequence length: 24 Sequence type: Number of nucleic acid strands: Both forms Topology: Linear Sequence type: Other nucleic acids Synthetic DNA sequence CACGTGGACG ACCAGATGGC TGTC 24

SEQ ID NO: 10 Sequence length: 2517 Sequence type: Nucleic acid Number of strands: Both forms Topology: Both forms Sequence type: cDNA to mRNA sequence ATGAAAACTG AAGAAGGTAA ACTGGTAATC TGGATTAACG GCGATAAAGG CTATAACGGT 60 CTCGCTGAAG TCGGTAAGAA ATTCGAGAAATACTACGAGATCAGGATCAGCAGA CCGGATAAAC TGGAAGAGAA ATTCCCACAG GTTGCGGCAA CTGGCGATGG CCCTGACATT 180 ATCTTCTGGG CACACGACCG CTTTGGTGGC TACGCTCAAT CTGGCCTGTT GGCTGAAATC 240 ACCCCGGACA AAGCGTTCCA GGACAAGCTG TATCCGTTTA CCTGGGATGC CGTACGTTAC 300 AACGGCAAGC TGATTGCTTA CCCGATCGCT GTTGAAGCGT TATCGCTGAT TTATAACAAA 360 GATCTGCTGC CGAACCCGCC AAAAACCTGG GAAGAGATCC CGGCGCTGGA TAAAGAACTG 420 AAAGCGAAAG GTAAGAGCGC GCTGATGTTC AACCTGCAAG AACCGTACTT CACCTGGCCG 480 CTGATTGCTG CTGACGGGGG TTATGCGTTC AAGTATGAAA ACGGCAAGTA CGACATTAAA 540 GACGTGGGCG TGGATAACGC TGGCGCGAAA GCGGGTCTGA CCTTCCTGGT TGACCTGATT 600 AAAAACAAAC ACATGAATGC AGACACCGAT TACTCCATCG CAGAAGCTGC CTTTAATAAA 660 GGCGAAACAG CGATGACCAT CAACGGCCCG TGGGCATGGT CCAACATCGA CA CCAGCAAA 720 GTGAATTATG GTGTAACGGT ACTGCCGACC TTCAAGGGTC AACCATCCAA ACCGTTCGTT 780 GGCGTGCTGA GCGCAGGTAT TAACGCCGCC AGTCCGAACA AAGAGCTGGC AAAAGAGTTC 840 CTCGAAAACT ATCTGCTGAC TGATGAAGGT CTGGAAGCGG TTAATAAAGA CAAACCGCTG 900 GGTGCCGTAG CGCTGAAGTC TTACGAGGAA GAGTTGGCGA AAGATCCACG TATTGCCGCC 960 ACTATGGAAA ACGCCCAGAA AGGTGAAATC ATGCCGAACA TCCCGCAGAT GTCCGCTTTC 1020 TGGTATGCCG TGCGTACTGC GGTGATCAAC GCCGCCAGCG GTCGTCAGAC TGTCGATGAA 1080 GCCCTGAAAG ACGCGCAGAC TAATTCGAGC TCGAACAACA ACAACAATAA CAATAACAAC 1140 AACCTCGGGG ATGACGATGA CGAGGTACCG GGATCCGAGG CGGGAGCTGT AGCCCCCTAC 1200 GGCTACACTC GGCCCCCTCA GGGGCTGGCG GGCCAGGAAA GCGACTTCAC CGCACCTGAT 1260 GTGTGGTACC CCGGCGGCAT GGTGAGCAGA GTGCCCTATC CCAGTCCCAC TTGTGTCGAA 1320 AGCAAAATGG GCCCCTGGAT GGATAGCTAC TCCGGACCTT ACGGGGACAT GCGTTTGGAG 1380 ACTGCCAGGG ACCATGTTTT GCCCATTGAC TATTACTTTC CACCCCAGAA GACCTGCCTG 1440 ATCTGTGGAG ATGAAGCTTC TGGGTGTCAC TATGGAGCTC TCACATGTGG AAGCTGCAAG 1500 GTCTTCTTCA AAAGAGCCGC TGAAGGGAAA CAGAAGTACC TGTGCGCCAG CAGAAATGAT 15 60 TGCACTATTG ATAAATTCCG AAGGAAAAAT TGTCCATCTT GTCGTCTTCG GAAATGTTAT 1620 GAAGCAGGGA TGACTCTGGG AGCCCGGAAG CTGAAGAAAC TTGGTAATCT GAAACTACAG 1680 GAGGAAGGAG AGGCTTCCAG CACCACCAGC CCCACTGAGG AGACAACCCA GAAGCTGACA 1740 GTGTCACACA TTGAAGGCTA TGAATGTCAG CCCATCTTTC TGAATGTCCT GGAAGCCATT 1800 GAGCCAGGTG TAGTGTGTGC TGGACACGAC AACAACCAGC CCGACTCCTT TGCAGCCTTG 1860 CTCTCTAGCC TCAATGAACT GGGAGAGAGA CAGCTTGTAC ACGTGGTCAA GTGGGCCAAG 1920 GCCTTGCCTG GCTTCCGCAA CTTACACGTG GACGACCAGA TGGCTGTCAT TCAGTACTCC 1980 TGGATGGGGC TCATGGTGTT TGCCATGGGC TGGCGATCCT TCACCAATGT CAACTCCAGG 2040 ATGCTCTACT TCGCCCCTGA TCTGGTTTTC AATGAGTACC GCATGCACAA GTCCCGGATG 2100 TACAGCCAGT GTGTCCGAAT GAGGCACCTC TCTCAAGAGT TTGGATGGCT CCAAATCACC 2160 CCCCAGGAAT TCCTGTGCAT GAAAGCACTG CTACTCTTCA GCATTATTCC AGTGGATGGG 2220 CTGAAAAATC AAAAATTCTT TGATGAACTT CGAATGAACT ACATCAAGGA ACTCGATCGT 2280 ATCATTGCAT GCAAAAGAAA AAATCCCACA TCCTGCTCAA GACGCTTCTA CCAGCTCACC 2340 AAGCTCCTGG ACTCCGTGCA GCCTATTGCG AGAGAGCTGC ATCAGTTCAC TTTTGACCTG 2400 CTA ATCAAGT CACACATGGT GAGCGTGGAC TTTCCGGAAA TGATGGCAGA GATCATCTCT 2460 GTGCAAGTGC CCAAGATCCT TTCTGGGAAA GTCAAGCCCA TCTATTTCCA CACCCAG 2517

SEQ ID NO: 11 Sequence Length: 839 Sequence Type: Amino Acid Topology: Linear Sequence Type: Protein Sequence Met Lys Thr Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile L ys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn 355 360 365 Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Asp 370 375 380 Asp Asp Asp Glu V al Pro Gly Ser Glu Ala Gly Ala Val Ala Pro Tyr 385 390 395 400 Gly Tyr Thr Arg Pro Pro Gln Gly Leu Ala Gly Gln Glu Ser Asp Phe 405 410 415 Thr Ala Pro Asp Val Trp Tyr Pro Gly Gly Met Val Ser Arg Val Pro 420 425 430 Tyr Pro Ser Pro Thr Cys Val Glu Ser Lys Met Gly Pro Trp Met Asp 435 440 445 Ser Tyr Ser Gly Pro Tyr Gly Asp Met Arg Leu Glu Thr Ala Arla Asg 450 450 455 460 His Val Leu Pro Ile Asp Tyr Tyr Phe Pro Pro Gln Lys Thr Cys Leu 465 470 475 480 480 Ile Cys Gly Asp Glu Ala Ser Gly Cys His Tyr Gly Ala Leu Thr Cys 485 490 495 Gly Ser Cys Lys Val Phe Phe Lys Arg Ala Ala Glu Gly Lys Gln Lys 500 505 510 Tyr Leu Cys Ala Ser Arg Asn Asp Cys Thr Ile Asp Lys Phe Arg Arg 515 520 525 Lys Asn Cys Pro Ser Cys Arg Leu Arg Lys Cys Tyr Glu Ala Gly Met 530 535 540 Thr Leu Gly Ala Arg Lys Leu Lys Lys Leu Gly Asn Leu Lys Leu Gln 545 550 555 560 Glu Glu Gly Glu Ala Ser Ser Thr Thr Ser Pro Thr Glu Glu Thr Thr 565 570 575 Gln Lys Leu Thr Val Ser His Ile Glu Gly Tyr Glu Cys Gln Pro Ile 580 585 590 Phe Leu Asn Val L eu Glu Ala Ile Glu Pro Gly Val Val Cys Ala Gly 595 600 605 His Asp Asn Asn Gln Pro Asp Ser Phe Ala Ala Leu Leu Ser Ser Leu 610 615 620 Asn Glu Leu Gly Glu Arg Gln Leu Val His Val Val Lys Trp Ala Lys 625 630 635 640 Ala Leu Pro Gly Phe Arg Asn Leu His Val Asp Asp Gln Met Ala Val 645 650 655 Ile Gln Tyr Ser Trp Met Gly Leu Met Val Phe Ala Met Gly Trp Arg 660 665 670 Ser Phe Thr Asn Val Asn Ser Arg Met Leu Tyr Phe Ala Pro Asp Leu 675 680 685 Val Phe Asn Glu Tyr Arg Met His Lys Ser Arg Met Tyr Ser Gln Cys 690 695 700 Val Arg Met Arg His Leu Ser Gln Glu Phe Gly Trp Leu Gln Ile Thr 705 710 715 715 720 Pro Gln Glu Phe Leu Cys Met Lys Ala Leu Leu Leu Phe Ser Ile Ile 725 730 735 Pro Val Asp Gly Leu Lys Asn Gln Lys Phe Phe Asp Glu Leu Arg Met 740 745 750 Asn Tyr Ile Lys Glu Leu Asp Arg Ile Ile Ala Cys Lys Arg Lys Asn 755 760 765 Pro Thr Ser Cys Ser Arg Arg Phe Tyr Gln Leu Thr Lys Leu Leu Asp 770 775 780 Ser Val Gln Pro Ile Ala Arg Glu Leu His Gln Phe Thr Phe Asp Leu 785 790 795 800 Leu Ile Lys Ser H is Met Val Ser Val Asp Phe Pro Glu Met Met Ala 805 810 815 Glu Ile Ile Ser Val Gln Val Pro Lys Ile Leu Ser Gly Lys Val Lys 820 825 830 Pro Ile Tyr Phe His Thr Gln 835 839

SEQ ID NO: 12 Sequence length: 51 Sequence type: Nucleic acid Number of strands: Both forms Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ATGCATCTCG GGGGCAGTGA GAGCGGCAGC AGTGGGGGGG GATCCGCGCG C 51

SEQ ID NO: 13 Sequence length: 51 Sequence type: nucleic acid Number of strands: both forms Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GCGCGCGGAT CCCCCCCCAC TGCTACTGCT CTCACTGCCC CCGAGATGCA T 51

[Brief description of the drawings]

FIG. 1 is a diagram showing the results of measuring the binding activity of AR and tritium-labeled mibolerone over time.

FIG. 2 is a diagram showing a time course up to a reaction time of 4 hours in Example 4 when compared at 7 ° C., 25 ° C., and 30 ° C.

FIG. 3 is a graph showing AR activity (%) in the presence of various concentrations of testosterone.

FIG. 4 shows AR activity (%) in the presence of various concentrations of dihydrotestosterone.

FIG. 5 is a graph showing AR activity (%) in the presence of various concentrations of mibolerone.

FIG. 6 is a graph showing AR activity (%) in the presence of various concentrations of R1881.

FIG. 7 is a graph showing AR activity (%) in the presence of various concentrations of bisphenol A.

FIG. 8: A in the presence of various concentrations of diethylstiberol
It is a figure which shows R activity (%).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12P 21/02 G01N 33/15 Z G01N 33/15 33/50 Z 33/50 33/566 33/566 ( C12N 1/21 // (C12N 1/21 C12R 1:19) C12R 1:19) (C12P 21/02 C (C12P 21/02 C12R 1:19) C12R 1:19) C12N 15/00 ZNAA F-term ( Reference) 2G045 AA34 AA40 BB20 CB21 DA12 DA13 DA14 DA36 DA77 FB02 4B024 AA11 AA20 BA63 CA04 CA05 CA07 DA06 EA04 GA11 HA01 4B064 AG01 AG20 CA02 CA19 CC24 DA13 4B065 AA26X AA93Y AB01 BA02 CA24 CA40 ACA4CA40 4A0

Claims (19)

[Claims] 1. A fused androgen receptor protein comprising an androgen receptor protein and a sugar-binding protein fused to each other. 2. The fused androgen receptor protein according to claim 1, wherein the androgen receptor protein contains at least a ligand binding region. 3. The fused androgen receptor protein according to claim 1, wherein the androgen receptor protein comprises at least a ligand binding region and a DNA binding region. 4. The fused androgen receptor protein according to claim 1, wherein the androgen receptor protein comprises a ligand binding region, a DNA binding region transcription region and a hinge region. 5. The fused androgen according to claim 1, wherein the androgen receptor protein is derived from an organism selected from the group consisting of fish, amphibians, reptiles, birds, and mammals. Receptor protein. 6. The fused androgen receptor protein according to any one of claims 1 to 4, wherein the androgen receptor protein is completely human. 7. The fusion according to claim 1, wherein the androgen receptor protein has a partial amino acid sequence change known as a genetic polymorphism or a partial amino acid sequence change due to pathological mutation. Androgen receptor protein. 8. The fused androgen receptor protein according to claim 7, wherein the androgen receptor protein is an androgen receptor protein of the following (a) or (b). (A) a protein consisting of the amino acid sequence shown in SEQ ID NO: 11; (b) an amino acid sequence consisting of an amino acid sequence (a) in which one or several amino acids are deleted, substituted or added, and androgen Protein with receptor activity 9. The androgen receptor protein reacts with endogenous androgen, a synthesized agonist, an agonist or a chemical substance having an androgenic or anti-androgenic effect.
5. The fused androgen receptor protein according to any one of the above. 10. The fused androgen receptor protein according to claim 1, wherein the sugar-binding protein is a maltose-binding protein. 11. The fused androgen receptor protein according to claim 1, which has a specific protease-resistant amino acid sequence at a linking site of the sugar-binding protein. A gene encoding the fused androgen receptor protein according to any one of claims 1 to 11. 13. The gene encoding the fused androgen receptor protein according to claim 12, which comprises the following gene (c) or (d). (C) a gene consisting of the base sequence described in SEQ ID NO: 10 (d) a base sequence in which one or several bases are deleted, substituted or added in the base sequence (c), and androgen Receptor activity-encoding gene 14. A vector carrying the gene according to claim 12 or 13. 15. A transformant obtained by introducing the vector according to claim 14 into a microorganism and expressing a gene encoding a fused androgen receptor protein. 16. The transformant according to claim 15, wherein the microorganism is Escherichia coli. 17. Escherichia coli is used for Escherichia coli (Escher).
The transformant according to claim 16, which is (ichia coli) JM109. 18. A fused androgen receptor obtained by collecting a fused androgen receptor from a culture obtained by culturing the transformant according to claim 15. Manufacturing method. 19. A method comprising: the fused androgen receptor protein according to claim 1; a solvent for dissolving a chemical substance; and a diluent of the dissolved chemical substance. A reagent for detecting the presence or absence of an interaction with a ligand to be used.