JP2001245677A - Nucleic acid for assaying bacteria belonging to the genus shigella or salmonella and method for detecting the bacteria - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a means for discriminating Shigella flexneri, Shigella boydii, Shigella sonnei, Salmonella typhi, Salmonella paratyphi A, Salmonella typhimurium, Salmonella chester, Salmonella enteritidis and Salmonella oranienburg by a gene test to assay. SOLUTION: This means for discriminately assaying the above nine kinds of bacteria is provided by using a section which consists of a base sequence in the specific domain of gyrase β gene(gyr β) consisting of the structural gene of the β-subunit in these bacterial enzyme topoisomerase II and contains the different base sequence due to each bacterial species as a primer or a probe.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a nucleic acid and a method for measuring bacteria of the genus Shigella or Salmonella.

[0002]

2. Description of the Related Art Shigella flexne
ri), Shigella Boidi (Shigella boydii) and Shigella
Zonei (Shigella sonnei), etc. Shigella bacteria and Salmonella typhi (Salmonella typhi), Salmonella Parachifi A (Salmonella paratyphiA), Salmonella typhimurium (Salmonella typhimurium), Salmonella Chester (Salmonella chester), Salmonella Enteritidis ( Salmonella enteritidis ) and Salmonella
Salmonella bacteria such as Salmonella oranienburg are medically important as pathogens of infectious diseases or food poisoning, and it is necessary to identify these bacteria for diagnosis, treatment or prevention.

Hitherto, the identification of bacteria has been mainly performed by culturing the bacteria and performing biochemical tests such as a sugar assimilation test. However, this method has a drawback in that diagnosis, treatment and prevention of infectious diseases and food poisoning cannot be performed promptly because culture of the bacteria takes time.

On the other hand, a genetic test for identifying a bacterium based on the gene sequence of the bacterium is also performed. Genetic testing does not require cultivation of bacteria, and thus has the advantage that testing can be performed quickly. In order to distinguish closely related bacteria by genetic testing, 16S ribosomal RNA (rRN
The difference in the nucleotide sequence of A) is used.

In Japanese Patent Application Laid-Open No. 11-169175, Bacteroides bacteria, Mycobacterium bacteria, and Chitinofaga are disclosed due to differences in the base sequence of the gyrase β gene ( gyrB ) which is the structural gene of the β subunit of the enzyme topoisomerase II. Methods for detecting bacteria belonging to the genus Genus, Flavobacterium, Cytofaga, Synechococcus, Caulobacter, Pseudomonas, etc. are described. However, JP-A-11-169175 does not disclose any detection of Shigella genus bacteria or Salmonella bacteria.

[0006]

The above three species of Shigella and the six species of Salmonella belong to the family Enterobacteriaceae, and their gene sequences are very similar, and the base sequence of 16S rRNA is also similar. Due to their extreme similarities, the above nine bacteria cannot be identified and identified by conventional methods based on the base sequence of 16S rRNA.

[0007] Accordingly, it is an object of the present invention to provide, by genetic testing, Shigella flexneri, Shigella boidi, Shigella zonei, Salmonella typhi, Salmonella paratyphi A, Salmonella typhimurium, Salmonella chester, Salmonella enteritidis and It is to provide a means for identifying and measuring Salmonella oranienburg.

[0008]

As a result of intensive studies, the present inventors have found that the base sequence of a part of the gyrase β gene ( gyrB ), which is the structural gene of the β subunit of the enzyme topoisomerase II of these bacteria, is It was found that each strain was different enough to be distinguished, and it was found which base was different at which site.
The present invention has been completed in view of discriminatively measuring types of bacteria.

That is, the present invention relates to SEQ ID NO: 1 in the sequence listing.
A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 2 or a complementary strand of the nucleic acid or a fragment thereof, wherein the nucleic acid has the nucleotide sequence shown in SEQ ID NOs: 2 to 9 or at least a corresponding region of the complementary strand thereof in the fragment; A nucleic acid for measuring Shigella flexneri, comprising a fragment having a base different from the base described in (1). Further, the present invention relates to SEQ ID NO: 2 in the sequence listing.
A nucleic acid having the base sequence shown in SEQ ID NO: 1 or a complementary strand of the nucleic acid or a fragment thereof, wherein the nucleic acid having the base sequence shown in SEQ ID NO: 1 or 3 to 9 or a complementary region thereof has a The present invention provides a nucleic acid for Shigella Boydy assay, comprising a fragment having a base different from the base in the fragment. The present invention also relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 3 in the sequence listing, a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1 or 2 or 4 to 9 Or a fragment having a base different from the base in the fragment in at least any corresponding region of the complementary strand thereof,
Provided is a nucleic acid for zoning measurement. The present invention also relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 4 in the sequence listing, or a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 3 or 5 to 9 Or a fragment having a base different from the base in the fragment in the corresponding region of at least one of its complementary strands,
Provided is a nucleic acid for measuring Salmonella typhi. Furthermore, the present invention relates to a nucleic acid having the base sequence shown in SEQ ID NO: 5 in the sequence listing, a complementary strand of the nucleic acid, or a fragment thereof,
Salmonella paratifi A assay comprising a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1 to 4 or 6 to 9 or a fragment having a base different from the base in the fragment in at least any corresponding region of the complementary strand thereof Provide nucleic acids for use. Furthermore, the present invention relates to a nucleic acid having the base sequence shown in SEQ ID NO: 6 in the sequence listing, a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the base sequence shown in SEQ ID NOS: 1 to 5 or 7 to 9 Alternatively, there is provided a nucleic acid for measuring Salmonella typhimurium, comprising a fragment having a base different from the base in the fragment in at least any corresponding region of a complementary strand thereof. Further, the present invention provides
A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing, or a complementary strand of the nucleic acid or a fragment thereof, wherein at least the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 6, or 8 or 9, or a complementary strand thereof Provided is a nucleic acid for Salmonella-Chester measurement, comprising a fragment having a base different from a base in the fragment in any corresponding region. Furthermore, the present invention relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing, a complementary strand of the nucleic acid or a fragment thereof, and a nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 7 or 9, Provided is a nucleic acid for Salmonella enteritidis measurement comprising a fragment having a base different from the base in the fragment in at least any one of the corresponding regions of the complementary strand. Furthermore, the present invention relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing, a complementary strand of the nucleic acid or a fragment thereof, wherein
And a nucleic acid for measuring Salmonella oranienberg comprising a fragment having a base different from the base in the fragment in a corresponding region of at least one of the nucleic acids having the base sequence shown in (1) or a complementary strand thereof.

Further, the present invention relates to a nucleic acid having the base sequence shown in SEQ ID NO: 1 in the sequence listing or a fragment thereof,
Amplifying a fragment having a base different from the base in the fragment in at least any corresponding region of the nucleic acid having the base sequence shown in SEQ ID NOs: 2 to 9, and determining the base sequence of the fragment. A method for detecting Shigella flexneri is provided. The present invention also relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 2 of the sequence listing or a fragment thereof, wherein at least one of the nucleic acids having the nucleotide sequence shown in SEQ ID NO: 1 or 3 to 9 corresponds to Amplifying a fragment having a base different from the base in the fragment, and determining the base sequence of the fragment; The present invention also relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 3 or a fragment thereof, which corresponds to at least one of the nucleic acids having the nucleotide sequence shown in SEQ ID NO: 1 or 2 or 4 to 9. A method for detecting Shigella zonei, comprising amplifying a fragment having a base different from the base in the region in the region and determining the base sequence of the fragment is provided. Further, the present invention relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 4 or a fragment thereof, which corresponds to at least one of the nucleic acids having the nucleotide sequence shown in SEQ ID NOS: 1 to 3 or 5 to 9 in the Sequence Listing. Provided is a method for detecting Salmonella typhi, comprising amplifying a fragment having a base different from the base in the fragment in a region, and determining the base sequence of the fragment. Further, the present invention provides
A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 5 or a fragment thereof in the sequence listing, wherein the fragment is contained in at least a corresponding region of the nucleic acid having the nucleotide sequence shown in SEQ ID NOs: 1 to 4 or 6 to 9. A method for detecting Salmonella paratyphi A, comprising amplifying a fragment having a base different from the above base and determining the base sequence of the fragment.
Furthermore, the present invention relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 6 of the sequence listing or a fragment thereof, wherein at least one of the nucleic acids having the nucleotide sequence shown in SEQ ID NO: 1 to 5 or 7 to 9 is A method for detecting Salmonella paratyfimurium, comprising amplifying a fragment having a base different from the base in the region in the region and determining the base sequence of the fragment. Furthermore, the present invention relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing or a fragment thereof, wherein at least one of the nucleic acids having the nucleotide sequence shown in SEQ ID NO: 1 to 6 or 8 or 9 A method for detecting Salmonella Chester, comprising amplifying a fragment having a base different from the base in the region in the region and determining the base sequence of the fragment. further,
The present invention relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing or a fragment thereof, wherein the nucleic acid has the nucleotide sequence in at least one of the corresponding regions of the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 7 or 9. A method for detecting Salmonella enteritidis comprising amplifying a fragment having a base different from the base in the fragment and determining the base sequence of the fragment. Furthermore, the present invention relates to a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing or a fragment thereof, wherein the nucleic acid has the nucleotide sequence shown in SEQ ID NO: 1 to 8. A method for detecting Salmonella oranienberg comprising amplifying a fragment having a base different from the base in the fragment and determining the base sequence of the fragment. Further, the present invention is used for nucleic acid amplification in these methods of the present invention, and is used for nucleic acid amplification comprising a nucleic acid having a base sequence identical or complementary to any terminal region of the base sequence of the nucleic acid region to be amplified. Provide primers.

[0011]

DETAILED DESCRIPTION OF THE INVENTION Shigella flexneri, Shigella
Boydy, Shigella Zonay, Salmonella Tifi, Salmonella Paratifi A, Salmonella Tifimurium,
The nucleotide sequences of specific regions of the gyrB gene of Salmonella chester, Salmonella enteritidis and Salmonella oranienburg are shown in SEQ ID NOs: 1 to 9 in the sequence listing, respectively. In addition, in FIGS. 1 to 3, the base sequences shown in SEQ ID NOs: 1 to 9 are shown aligned (the base sequences shown in SEQ ID NOs: 1 to 9 are the same as those shown in FIGS. 1 to 3). However, if there is a difference, priority is given to FIGS. In FIGS. 1 to 3, only the base sequence of Shigella flexneri is shown, and for the base sequences of other bacteria, the same bases as those of Shigella flexneri are indicated by dots, and only the different bases are indicated by alphabets. Have been. Therefore, when looking at FIGS. 1 to 3, it is obvious at a glance how the base of which site of which bacteria differs. The principle of the present invention is to identify and measure the above nine types of bacteria based on the differences in the nucleotide sequences shown in SEQ ID NOS: 1 to 9 and FIGS.

The nucleic acid for detecting bacteria of the present invention includes primers and probes for nucleic acid amplification. First, the nucleic acid amplification primer will be described. A primer for measuring each bacterium is composed of a nucleic acid fragment having a nucleotide sequence identical to the nucleotide sequence of the gyrB gene of the bacterium or a part of a complementary chain thereof, preferably a DNA fragment, as shown in SEQ ID NOS: 1 to 9. . For example, a primer for detecting Shigella flexneri has the same nucleotide sequence as the nucleotide sequence shown in SEQ ID NO: 1 or a part of its complementary strand. In addition, the primer
It has at least one base different from the base in at least one corresponding region of the other eight kinds of bacteria. In other words, fragments in which the base sequences of the corresponding regions of the nine bacteria are all the same are not used as the primers herein. In this specification, the “corresponding region” is gy as shown in FIGS. 1 to 3 or FIGS.
When the base sequences of the rB gene are aligned, it means a region of a certain sequence and a region of another sequence located at the same position in the vertical direction. The measurement primer of each bacterium hybridizes efficiently because the base sequence of the bacterium is completely complementary, and the primer efficiently hybridizes for a bacterium having a different base (mismatched base) in the corresponding region. Since soybeans cannot be produced, little or no amplification can occur. Therefore, by using such a primer, it is possible to know whether or not the specimen contains the bacterium or a bacterium included in a group including the bacterium. The primer may include two or more mismatch sites. In order to ensure that the gene of another bacterium having a mismatched base is not amplified, the primer is preferably a forward primer, and the primer is preferably set so that the 3 ′ end is a mismatch site. In this way, other bacteria with mismatched bases, even if able to hybridize to the primer, will not extend further since the 3 'end of the primer is non-complementary and unpairable, and thus amplification will not be possible. Does not wake up.

The region to be set as a primer is
It is set so as to have a base mismatched with at least one corresponding region of the kind of bacteria. This is shown in FIGS.
And can be easily performed. For example, Shigella
In the case of setting a primer for distinguishing Flexneri from the other eight kinds of bacteria and measuring the same, for example, the 87th (hereinafter referred to as “87nt”) T is the 3′-terminal forward side Use primers. As is clear from FIG. 1, 87 nt of Shigella flexneri is T,
In the other eight bacteria, the corresponding bases are all C. Therefore, when amplification is performed using a forward primer having a T at the 3 'end of 87 nt, amplification occurs only when Shigella flexneri is contained in the sample, and amplification occurs when other bacteria are contained. Absent. Therefore, by using this primer, it is possible to identify whether the bacteria contained in the specimen is Shigella flexinerii or not. In this case, the amplification operation is performed in the same manner using a primer whose 3 'end is C, which is the corresponding base of the other eight kinds of bacteria, to confirm whether or not amplification occurs. The above identification can be performed.

As described above, in the case of Shigella flexneri measurement, a primer containing only a bacterium to be measured containing a base corresponding to all of the other eight kinds of bacterium is different from that described above.
In addition to the 87 nt, as can be seen from FIG.
nt A, 441 nt T, 567 nt T, 759 nt G, 786 nt T
And a primer containing T of 888 nt.

[0015] The primer of the present invention is not limited to primers containing only bases whose bases are different from those of all other eight kinds of bacteria as described above. Also included are primers in which at least one corresponding base contains a different base. For example, in the case of Shigella flexneri measurement, a forward primer containing T of 39 nt, preferably having this T as a 3 ′ end, may be mentioned. The two other bases of the genus Shigella have the corresponding base T as in Flexneri, but the five bases of the genus Salmonella have the corresponding base G. Therefore, when such a primer is used, amplification occurs when the bacteria in the sample are any of the three species of Shigella, and amplification does not occur when any of the five bacteria of the genus Salmonella. Therefore, by using such primers, the bacteria contained in the specimen can be three species of the genus Shigella or five species of the genus Salmonella.
Identification of species can be made. Similarly, by performing an assay using other appropriate primers, the bacteria can be easily identified (specified as a single species) based on the pattern of whether or not amplification occurs when each primer is used. . Thus, in this specification, for example,
The term "Flexneri measuring nucleic acid" is defined to include nucleic acids used for measuring a group of species including Shigella flexneri.

In the measurement of bacteria using the above-mentioned primers of the present invention, at least one of a pair of primers used for amplification may be a primer having the above-mentioned mismatch site, and the other primer may be of nine types. The same area can be set for all the bacteria.
As described above, a forward primer having a mismatch site at the 3 ′ end is preferable as the primer of the present invention. Therefore, such a primer is used as the forward primer, and the reverse primer is set in nine types of common regions. Is preferred.

Incidentally, nucleic acid amplification methods such as PCR are well known in the art, and kits and apparatuses therefor are commercially available. Therefore, if primers are set, nucleic acid amplification can be performed using the gene of a bacterium in a sample as a template. It can be done easily. In addition, by performing so-called real-time detection PCR using a quencher fluorescent dye and a reporter fluorescent dye, it is possible to quantify the amount of bacterial cells in the sample.
Therefore, in the present specification, “measurement” includes both detection and quantification. In addition, since a kit for real-time detection PCR is also commercially available, it can be easily performed.

The nucleic acid amplification may be performed only once for each measurement, but it is more reliable by performing a so-called nested nucleic acid amplification in which a large region is amplified in the first time and a region in the amplified region is amplified in the second time. Measurement can be performed. In this case, the first amplification primer can be set outside the sequences shown in SEQ ID NOS: 1 to 9 and FIGS. An example of a primer sequence set on the upstream side (5 'side) of the sequences shown in SEQ ID NOS: 1 to 9 and FIGS. 1 to 3 is SEQ ID NO: 10, and a primer sequence set on the downstream side (3' side). Is shown in SEQ ID NO: 11. Primers are set in these regions to first amplify fragments containing all regions of the sequences shown in SEQ ID NOS: 1 to 9 and FIGS.
Next, a second amplification using the above-described primer of the present invention can be performed.

The size of the primer is not particularly limited, but is preferably about 15 to 50 bases, more preferably about 15 to 30 bases. Further, the primer can be easily prepared by chemical synthesis.

The present invention also provides a nucleic acid probe obtained by labeling a nucleic acid, preferably DNA, used as the above-mentioned primer. Since the probe contains a mismatch site, it hybridizes with a nucleic acid having the same base sequence as the species to be measured, but does not hybridize with a nucleic acid having a mismatch base. Therefore, as in the case of the primer, the use of such a probe makes it possible to distinguish the species to be measured or a group of species including the species from other species. The description of the mismatch site is the same as in the case of the primer described above. However, unlike the primer, it is not particularly preferable that the 3 'end is a mismatch site. Rather, it is preferable to have at least one mismatch site near the center of the nucleic acid probe, preferably in the range of 3/10 to 7/10 bases from one end of the nucleic acid fragment.
Also, immobilize the unlabeled probe on a support such as a membrane, and check whether the amplified sample gene is bound to the membrane via the probe so that the amplified sample gene is labeled. Can also. As described above, an unlabeled nucleic acid that is used to determine whether or not it hybridizes with a sample gene is referred to herein as a “probe”. That is,
In this case, the above-mentioned primer is used as a nucleic acid probe as it is. The immobilization of the nucleic acid fragment on the support can be performed by a known method using a commercially available device.

The size of the nucleic acid probe is not particularly limited, but if it is too long, the homology between the bacteria is high, so that even if the specimen contains a mismatched base, it will hybridize. Therefore, the size of the probe is 8 to
About 25 bases are preferred, and 8 to 20 bases are more preferred. As the label, a well-known label used for a conventional nucleic acid probe can be used, and examples thereof include a radiolabel, a fluorescent label, an enzyme label, and a biotin label.
The probe can be used in the same manner as a conventional probe.

The above-mentioned nucleic acids for measuring bacteria of the genus Shigella or Salmonella according to the present invention are, in addition to the above-mentioned nine kinds of bacteria, furthermore Salmonella paratyphi B ( Salmonella paratyphi B).
B ), Escherichia coli O157 strain ( Escherichia coli O157), Yersinia enterocolitica ( Yersinia enterocolitica ),
Yersinia Rukeri (Yersinia ruckeri), Enterobacter cloacae (Enterobacter cloacae), Enterobacter aerogenes (Enterobacter aerogenes), Vibrio alginate Roh utility dregs (Vibrio alginolyticus), Vibrio Kamp Berry (Vibrio campbellii), Vibrio diazo Toro Ficus ( Vibrio diazotrophicus ) and Vibrio gazogenes ( Vibrio gazogenes ), at least one, preferably five or more, more preferably seven or more of the above-mentioned nine species of Shigella spp. Alternatively, it is preferable to be able to measure Salmonella bacteria. These 10 kinds of bacteria are important as causative bacteria of food poisoning like the above-mentioned 9 kinds of Shigella or Salmonella, and therefore, for the purpose of specifying the causative bacteria of food poisoning, these 10 kinds of bacteria are used. Advantageously, the nine species of Shigella or Salmonella can be distinguished from the other bacteria. These one
The nucleotide sequences of the gyrB gene of 0 bacteria are shown in SEQ ID NOs: 20 to 29, respectively. FIGS. 4 to 11 show the alignment of these sequences with the gyrB sequences of the nine species of Shigella or Salmonella. 4 to 11, as in FIGS. 1 to 3, only the base sequence of Shigella flexneri is shown. For the base sequences of other bacteria, the same base as that of Shigella flexneri is represented by a dot. , And only the portions of the different bases are indicated by alphabets. The site where the corresponding base does not exist is indicated by a hyphen. In the region where the sequence of the gyrB gene of Shigella flexneri does not exist, the sequence of a bacterium having a base sequence in this region is described. FIG.
From FIG. 11 to FIG. 11, the correspondence relationship and the mismatched site of the nucleotide sequences of a total of 19 types of gyrB genes are obvious. That is, each of the above-mentioned nine types of nucleic acids for measuring Shigella or Salmonella bacteria has the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 20 to 29 or the complementary region thereof in the corresponding region of at least any one of the fragments. It is preferable that the fragment be composed of a fragment having a base different from the base described above. Similarly to the above, only the bacteria to be measured as described above are not limited to nucleic acids containing bases having corresponding bases different from all of these 10 types of bacteria, and at least one of these 10 types of bacteria is used. Preferably, the nucleic acid may be a nucleic acid containing at least any 5 types, more preferably at least any 7 types of corresponding bases containing different bases.

According to the present invention, there is also provided a Shigella flexneri, a Shigella boidi, a Shigella zonei, wherein a plurality of nucleic acid probes among the above-mentioned nine kinds of nucleic acid probes for measuring bacteria of the present invention are immobilized on a support. , Salmonella Chifi,
A plurality of nucleic acid chips for detecting bacteria selected from the group consisting of Salmonella paratyphi A, Salmonella typhimurium, Salmonella chester, Salmonella enteritidis and Salmonella oranienburg are also provided. In such a nucleic acid chip, nucleic acid probes for detecting at least three or more, preferably six or more, and most preferably all nine of these nine types of nucleic acid probes for measuring bacteria are immobilized. It is preferable that it is formed. The nucleic acid probe to be immobilized further comprises:
The gyrB gene sequence is shown in SEQ ID NOS: 20 to 29, at least one of the above 10 kinds of bacteria,
Preferably, the nucleic acid is a nucleic acid containing at least any five, more preferably at least any seven, corresponding bases containing different bases. By doing so, it can also be determined that the bacteria in the sample are not the above 10 species. In this case, the above-mentioned 9
As in the case of identification of species Shigella or Salmonella,
Even when using a nucleic acid probe that hybridizes with a plurality of these 10 types of bacteria, the use of a combination of the nucleic acid probes makes it possible to determine whether or not the nucleic acid probe hybridizes with a plurality of other nucleic acid probes. Based on
It is possible to determine that the bacteria in the specimen are not the above 10 bacteria. An example of such a combination of nucleic acid probes is described in Example 4 below.

When a plurality of nucleic acid probes for measuring bacterial species are immobilized to form a nucleic acid chip as described above, a target nucleic acid in a specimen (in the present specification, hybridized with each nucleic acid probe of the present invention, detected). If the optimal conditions for hybridization with each nucleic acid to be referred to as “target nucleic acid” are set to be substantially the same for all immobilized nucleic acid probes, the entire nucleic acid chip is brought into contact with the amplification product solution at the same time. However, it is preferable to perform hybridization under the same conditions, since the inspection can be performed well. For this reason, the melting temperature Tm of the double-stranded nucleic acid formed by hybridization of each nucleic acid probe immobilized to the nucleic acid chip and the target nucleic acid, the difference between the highest and the lowest is within 4 ° C,
Preferably it is within 2 ° C. In addition, in order to improve the accuracy of the test, near the center of each nucleic acid probe,
Preferably, the number of bases from one end of the nucleic acid fragment is 3/10 to 7 /
10, more preferably at least 1 in the range of 4/10 to 6/10
It is preferred to have one mismatch site.

The nucleic acid chip of the present invention can be used in the same manner as a conventional DNA chip. That is, the target nucleic acid (ie, gyrB gene or a part thereof) in the sample is
Using a pair of primers capable of amplifying the target nucleic acid, P
It is amplified by a well-known nucleic acid amplification method such as CR. The primer used at this time is preferably not a species-specific primer, but a primer capable of amplifying each target nucleic acid derived from all bacteria to be detected and / or identified. Here, the bacterium to be identified means that the detected bacterium is a specific other bacterium in the case of trying to determine that it is not a specific other bacterium,
It is selected from the above 9 species of Shigella or Salmonella other than the bacteria to be detected and the above 10 kinds of Yersinia, Enterobacter, Vibrio, Escherichia coli and Salmonella paratyphi B. By amplifying each target nucleic acid from all the bacteria to be detected and / or identified, the bacteria can be identified by the positive pattern on the nucleic acid chip at the subsequent stage. The combination of primers capable of amplifying each target nucleic acid derived from all the bacteria to be detected and / or identified is a combination of two regions in which the corresponding regions of all the bacteria have the same sequence. ) May be set, and this can be easily performed based on the nucleotide sequences shown in FIGS. 4 to 11. Alternatively, even if a primer hybridizes to a region where all the corresponding regions of all bacteria do not have the same sequence, detection can also be performed by using a mixed primer containing a plurality of primers complementary to each region to be hybridized. And / or each target nucleic acid from all bacteria to be identified can be amplified. Needless to say, it is necessary that a region where each nucleic acid probe on the nucleic acid chip hybridizes exists in the region to be amplified. In amplifying the target nucleic acid, a labeled nucleotide is used as a nucleotide used as a raw material constituting the amplified nucleic acid.
Of course, the labeled nucleotide may be only one of the four nucleotides, and the other three nucleotides may be unlabeled ordinary nucleotides. By using a labeled nucleotide, the target nucleic acid to be amplified is obtained as a labeled one. This labeled amplification product was hybridized with each nucleic acid probe on the nucleic acid chip, and after washing, by measuring the label bound on the support, whether or not each target nucleic acid for each nucleic acid probe was contained in the sample You can know whether or not. Then, it is possible to identify the bacteria contained in the specimen based on the pattern of the positive spot, which of the plurality of nucleic acid probes has hybridized. The above-mentioned operations, that is, amplification of a target nucleic acid, hybridization with a nucleic acid probe, detection of a label bound on a support, and the like can all be performed by well-known conventional methods.

Further, according to the present invention, the nucleotide sequences of the gyrB genes of the above nine closely related bacteria were determined.
Amplifying a nucleic acid or a fragment thereof having a base sequence represented by any one of (a) to (c), wherein the fragment has a base different from the base in the fragment in at least one of the other eight corresponding regions, Bacteria can be identified by determining the sequence and comparing it with the nucleotide sequence shown in SEQ ID NOS: 1 to 9 (hereinafter, this method is sometimes referred to as "direct sequencing method"). As the region to be amplified,
A region that allows identification of a species by examining the nucleotide sequence of that region is preferable. Such a region may be the entire region of the sequence shown in SEQ ID NOs: 1 to 9, or may be a smaller region.

In the case of the direct sequencing method,
Since the base sequence is directly determined, it is not necessary to use a primer having a mismatch site as described above, and normal primers complementary to both ends of the amplification region can be used.

[0028]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below more specifically based on embodiments. However, the present invention is not limited to the following examples.

Example 1 Determination of base sequence of gyrB gene (1) Pretreatment of bacterial cells Shigella flexneri, Shigella boidi, Shigella zonei, Salmonella typhi, Salmonella paratyphi A, Salmonella typhimurium, Salmonella chester, Salmonella・ Entitidis or Salmonella oraniemberg, respectively, in liquid culture 3
It was subcultured in ml. Thereafter, the cells were collected by centrifugation at 12000 rpm at 4 ° C. for 10 minutes. This was dissolved in 50 μl of purified water and heated at 100 ° C. for 10 minutes. This is 15000 rpm, 4
After centrifugation at 10 ° C for 10 minutes, the supernatant was transferred to a new tube, which was used as a DNA solution.

(2) PCR Using this DNA as a template, PCR was performed. The nucleotide sequences of the forward primer UP1 and the reverse primer UP2 used are shown in SEQ ID NOs: 10 and 11, respectively. The reaction composition was 10x PCR buffer (100 mM Tris-HCl, pH 8.3, 500
mM KCl, 15mM MgCl ₂ , 0.001% (w / v) gelatin) 10μ
1, 10 μl of each 2 mM dNTP, 50 μM primer U
P1 2μl, 50μM primer UP2 2μl, AmpliTa
q Reaction was performed with 0.5 μl of Gold (manufactured by PERKIN ELMER) and 10 μl of DNA. The conditions were 96 ° C for 1 minute, 60 ° C for 1 minute, 72 ° C for 2 minutes.
The reaction was performed for 60 minutes per minute. The target product was confirmed by 3% agarose gel electrophoresis. Those for which amplification was confirmed were purified using a G-50 Sephadex column (Pharmacia). The purified product was collected by centrifugation at 3000 rpm for 1 minute.

(3) Sequencing The purified amplification product was sequenced under the following reaction conditions. Auto sequencer is ABI PRISM310 Gen
An etic Analyzer (ABI) was used. The reagent is BigDye T
erminator Cycle Sequencing, FS (manufactured by ABI) was used. Reaction conditions followed the protocol of ABI.

As a result, the nucleotide sequences shown in SEQ ID NOs: 1 to 9 were determined for the above nine bacteria.

Example 2 Identification of Bacteria Using Primers Shigella flexneri, Shigella Boyidi and Shigella
Using a DNA solution prepared from Zonay in the same manner as in Example 1, these three types were identified using the primers of the present invention.

The following six primers were used as forward primers. F-M1t: agcgtgacggcaaagaaga t ca t F-M1c: agcgtgacggcaaagaaga c ca c fl-Ma: agaacaaaacgccgatccaccc a fl-Mg: agaacaaaacgccgatccaccc g bo-Mt: acaagaacaaaacgccgatcca t bo-Mc: acaagaacaaaacgccgatcca c Further, as reverse primer the following R- 125 primers were used. R-125: ctggaaaccatcgttccact

In each forward primer sequence, the underlined portion is a mismatch site. In each case, at least the 3 'end is a mismatch site. F-M1t and F
-M1c is a region of 308 nt to 330 nt, F-M1t is 327 nt and 330 nt in the same T as 5 species of Salmonella, and F-M1c is a C-type similar to 3 species of Shigella. It is what it was. The sequence of F-M1c is completely identical to the sequences of Shigella flexneri and Shigella boidi, and differs from Shigella zonei in 312 nt. However, as shown in the results below, the mismatch site is 3 'Because it is not the end, amplification is also taking place in the case of Shigella zonei. fl-Ma and fl-Mg are regions from 377 nt to 399 nt,
-Ma is completely identical to the sequence of Shigella flexneri, and fl-Mg is completely identical to the sequences of Shigella Boydii and Shigella zonei. bo-Mt and bo-Mc are 374 nt to 3
A 96 nt region, bo-Mt is completely identical to the sequence of Shigella flexneri and Shigella zonei, and bo-Mc is completely identical to the sequence of Shigella boidi.

[0036] Six PCRs were carried out using each of the above six forward primers and the reverse primer R-125 in combination. The reagents and reaction conditions were the same as in Example 1.

The results are shown in Table 1 below. In Table 1, “○” indicates that amplification occurred, and “−” indicates that amplification did not occur. As shown in Table 1, for each species,
Since the combinations of the forward primers at which amplification occurs are different, these three types of bacteria can be identified by examining which forward primer has caused amplification.

[0038]

[Table 1]

Example 3 Identification of Bacteria Using Probes (1) Specimens Shigella flexneri, Shigella boidi, Shigella zonei, Salmonella typhi, Salmonella paratyphi A
Using a DNA solution prepared from Salmonella enteritidis in the same manner as in Example 1 as a sample, these six types were identified using the probe of the present invention.

(2) Probes The following nine types of probes were used. S1-CA: cacccaaat S1-CG: cacccgaat S1-TG: catccgaat S2-C: ccaccgaaa S2-T: ccactgaaa S3-TGT: ttggcgttg S3-TGC: ttggcgtcg S3-CGG: tcggcgtgg S3-CAC: tcggcatcg

Of these probes, S1-CA, S1-CG and S1-TG have a region of 394 nt to 402 nt, and S1-CA is Shigella
S1-CG is completely identical to the sequence of Shigella zonei, Salmonella typhi and Salmonella enteritidis, and S1-TG is the sequence of Shigella boidi and Salmonella paratyphi A. Is completely identical to S2-C and S2-T are regions from 416 nt to 424 nt, and the sequence of S2-C is completely identical to the sequences of Shigella flexneri, Shigella boidi, Salmonella typhi and Salmonella enteritidis, The sequence of S2-T is completely identical to the sequences of Shigella zonei and Salmonella paratyphi A. S3-TGT, S3-TGC, S3-CGG and
S3-CAC is a region of 434 nt to 442 nt, and the sequence of S3-TGT is completely identical to the sequence of Shigella flexneri,
Is completely identical to the sequences of Shigella boidi and Shigella zonei, the sequence of S3-CGG is completely identical to the sequence of Shigella typhi, and the sequence of S3-CAC is the same as the sequence of Shigella paratyphi A. Exactly the same.

(3) Preparation of membrane Each of the above probes was adjusted to 100 pM / μl, and then 50 μl of the solid phase was immobilized on the membrane. 12 with UV crosslinker
Irradiation was performed at 00 × 10 ⁴ μMJ / cm ² to prepare a membrane for dot blot.

(4) Radiolabeling of sample F-125: aaagcatttgttg
Radiolabeled samples were prepared by performing PCR in the presence of radiolabeled dCTP with aatat and the above-mentioned R-125 as a reverse-side primer and each sample gene as a template. PCR was performed using 10xPCR buffer (100 mM Tris-HCl,
pH 8.3, 500 mM KCl, 15 mM MgCl ₂ , 0.001% (w / v) gelatin) 5 μl, each 10 mM d (A, G, T) 0.8 μl, [α- ³² P] dCTP
(150 μCi) 30 μl, each 1 μl of 50 μM primer F-125 and R-125, AmpliTaq Gold (manufactured by PERKIN ELMER)
Reaction was performed with 0.3 μl and 5 μl of DNA. Conditions are 96 ° C
The reaction was performed for 25 cycles at 1 minute, 60 ° C. for 1 minute, and 72 ° C. for 2 minutes. After PCR labeling, the labeled product was purified using a Sephadex G-50 column.

(5) Hybridization and development A purified radiolabel was added to the membrane prepared above, and 55
The reaction was performed at 4 ° C. for 4 hours. Add 2xSSC-0.1% SDS wash solution,
Washed three times for 10 minutes at room temperature. Then 0.1xSSC-0.1% SDS
After washing three times with a washing solution, the substrate was washed with 0.1 × SSC at 50 ° C. for 10 minutes. This membrane was set in an autoradiography cassette and a film for autoradiography (Fujifilm) in a dark room. Autoradiography was performed overnight at -80 ° C. The image was developed with an automatic developing device (manufactured by Kodak).

The results are shown in Table 2 below. In Table 2, “○” indicates that the sample was bound to the membrane, and “−” indicates that the sample was not bound. As shown in Table 2, the combination of probes to be bound differs depending on each species, and therefore, these six species can be identified by the above method.

[0046]

[Table 2]

REFERENCE EXAMPLE 1 Determination of base sequence of gyrB gene Salmonella paratyphi B, Escherichia coli O157 strain, Yersinia enterocoritika, Yersinia luqueri, Enterobacter cloacae, Enterobacter aerogenes, Vibrio arginolyticus, Vibrio Campberry, Vibrio diazotrophycus and Vibrio
The same operation as in Example 1 was performed using each culture of Gazogenes, and the nucleotide sequence of the gyrB region of these 10 bacteria was determined. The determined nucleotide sequence is represented by SEQ ID NOs: 20 to 29 in the sequence listing.
Are shown below. Moreover, these 10 kinds of bacteria and the above 9
Of Shigella or Salmonella spp.
The sequence of the determined nucleotide sequence of the gyrB gene is shown in FIGS.

Example 4 Identification of Bacteria by DNA Chip (1) Preparation of DNA Chip The following eleven kinds of probes were chemically synthesized. Shi1 caagaacaaaacgcc (SEQ ID NO: 30) Shi21 attggcgttgaagtg (SEQ ID NO: 31) Shi22 cgatccatccgaata (SEQ ID NO: 32) Shi23 ttctccactgaaaaaga (SEQ ID NO: 33) Sal1 aacaagaataaaacgcc (SEQ ID NO: 34) Sal21 cggcgtcgaagta (SEQ ID NO: 35) Sal22 cggcgag tgaatatctcaacaagaat (SEQ ID NO: 37) Sal24 atcttctatttctccac (SEQ ID NO: 38) Esc1a acggtatcggcgt (SEQ ID NO: 39)

The species to which each probe hybridizes and its region (see FIGS. 4 to 11) are shown in Table 3 below.

[0050]

[Table 3]

After adjusting the above probe to 200 μM / μl, a spotting solution (trade name “Micro Spotting S
olution "(manufactured by Telechem International, Inc.) to give a final concentration of 100 µM / µl. This was dispensed into a microtiter plate and then solid-phased on a slide glass using a commercially available microarray maker. After drying overnight, it was washed with 0.2% SDS solution and distilled water. Next, the mixture was heated with distilled water at 95 ° C., and then washed with a Na ₂ BH ₄ solution. Again, SDS
After washing with the solution and distilled water, it was dried to prepare a DNA chip.

(2) Preparation of specimens Shigella flexinelli, Shigella boidi, Shigella zonei, Salmonella enteritidis, Salmonella
Chester, Salmonella oranienburg, Salmonella Paratyfi A, Salmonella Paratyfi B, Salmonella Tiffy, Salmonella Tyfimurium and Escherichia coli
A DNA solution prepared from O157 in the same manner as in Example 1 was used as a sample. Each DNA in each sample was amplified by PCR using the following pair of primers F-137 and R-137. The amplification region is 383 nt to 519 nt of Shigella flexinerii.
And the corresponding area of each bacterium. F-137: gaaggyggyatymargmrtt R-137: tcytgraarcyrtcrttcca Amplification was performed in the presence of radiolabeled dCTP, whereby the amplification product was radiolabeled. The reaction composition was 10x PCR buffer (1
00mM TrisHCl, pH8.3, 500mM KCl, 15mM MgCl 2, 0.001%
(W / V) gelatin) 5 μl, 2 mM d (A, G, T, C) 10 μl, radiolabeled dCTP (trade name FluoroLink Cy5-dCTP) (1 mM) 1 μl, 5
0 μM PrimerF-137 1 μl, PrimerR-137 1 μl, AmpliTa
q Gold (PERKIN ELMER DNA polymerase) 0.3μ
1 and 5 μl of DNA. Conditions are 96 ° C for 1 minute and 60 ° C for 1 minute.
The reaction was carried out for 60 minutes at 72 ° C. for 4 minutes. After PCR labeling, the labeled product was purified using a Sephadex G-50 column (trade name).

(3) Hybridization A purified Cy-5-labeled amplification product was added to the DNA chip prepared above and reacted at 40 ° C. for 4 to 18 hours. 2 × SSC-0.02% SDS washing solution was added and washed once at room temperature for 3 minutes. Next, 0.1 × S
Washed with SC washing solution for 3 minutes and dried. This was scanned with a microarray reader and the data was analyzed.

(4) Results The results are shown in FIGS. 12 and 13. In these figures, the circles with the probe names on the lower side indicate the spots where the probe was immobilized, and the black spots are the spots that were positive (that is, hybridized with the probe). , Open spots indicate negative (ie, did not hybridize to the probe) spots. As can be seen from these figures, the pattern of positive spots differs for each bacterium, and it can be seen that the bacterium can be identified based on this pattern. In addition,
As shown in Table 3, all of the probes other than the probe Shi21 hybridize with the gyrB gene fragment derived from a plurality of bacteria, but by combining them, the bacteria can be identified based on the pattern of the spot that becomes positive. It turns out that it is possible.

[0055]

As described above, according to the present invention, Shigella flexneri, Shigella boidi, Shigella zonei, Salmonella typhi, Salmonella paratyphi A, Salmonella typhimurium, Salmonella chester, Salmonella enteritidis and Salmonella. For the first time, genetic testing has enabled Oranienberg to be identified and measured quickly. Therefore, the present invention is expected to greatly contribute to the diagnosis, treatment and prevention of infectious diseases and food poisoning caused by these bacteria.

[0056]

[Sequence List] SEQUENCE LISTING <110> SRL, INC. <120> Nucleotides for Measuring Bacteria Belonging to Genus Shigella or Salmonera <130> 00660 <160> 39

[0057] <210> 1 <211> 1171 <212> DNA <213> Shigella flexneri <400> 1 cgataactcc tataaagtgt ccggcggtct gcacggcgtt ggtgtttcgg tagtaaacgc 60 cctgtcgcaa aaactggagc tggttattca gcgcgagggt aaaattcacc gtcagatcta 120 cgaacacggt gtaccgcagg ctccgctggc ggttaccggc gagactgaaa aaaccggcac 180 catggtgcgt ttctggccca gcctcgaaac cttcaccaat gtgaccgagt tcgaatatga 240 aattctggcg aaacgtctgc gtgagttgtc gttcctcaac tccggcgttt ccattcgtct 300 gcgcgacaag cgtgacggca aagaagacca cttccactat gaaggcggca tcaaagcgtt 360 cgttgaatat ctgaacaaga acaaaacgcc gatccaccca aatatcttct acttctccac 420 cgaaaaagac ggtattggcg ttgaagtggc gctgcagtgg aacgatggct tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgtgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgta ccctgaatgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccaccg gtgacgatgc gcgtgaaggc ctgattgcgg tcgtttccgt 660 aaaagtgccg gacccgaaat tctcctccca gaccaaagac aaactggttt cttctgaggt 720 gaaatcggcg gttgaacagc agatgaacga actgctggcg gaatacctgc tggaaaaccc 780 aactgatgcg aaaatcgtgg ttggcaaaat tatcgatgct gcccgtgccc gtgaagcggc 840 gcgtcgcgcg cgtgaaatga cccgccgtaa aggtgcgctc gacttagctg gcctgccggg 900 caaactggca gactgccagg aacgcgatcc ggcgctttcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaagggt aaaatcctta acgtcgagaa agcgcgcttc gataagatgc tctcttctca 1080 ggaagtggcg acgcttatca ccgcgcttgg ctgtggtatc ggtcgtgacg agtacaaccc 1140 ggacaaactg cgttatcaca gcatcatcat c 1171

[0058] <210> 2 <211> 1171 <212> DNA <213> Shigella boydii <400> 2 cgataactcc tataaagtgt ccggcggtct gcacggcgtt ggtgtttcgg tagtaaacgc 60 cctgtcgcaa aaactggagc tggttatcca gcgcgagggt aaaattcacc gtcagatcta 120 cgaacacggt gtaccgcagg ctccgctggc ggttaccggc gagactgaaa aaaccggcac 180 catggtgcgt ttctggccca gcctcgaaac cttcaccaat gtgaccgagt tcgaatatga 240 aattctggcg aaacgtctgc gtgagttgtc gttcctcaac tccggcgttt ccattcgtct 300 gcgcgacaag cgtgacggca aagaagacca cttccactat gaaggcggca tcaaggcgtt 360 cgttgaatat ctgaacaaga acaaaacgcc gatccatccg aatatcttct acttctccac 420 cgaaaaagac ggtattggcg tcgaagtggc gttgcagtgg aacgatggct tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgtgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgta ccctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccactg gtgacgatgc gcgtgaaggc ctgattgcgg tcgtttccgt 660 aaaagtgccg gacccgaaat tttcctccca gaccaaagac aaactggttt cttctgaggt 720 gaaatcggcg gttgaacagc agatgaacga actgctggca gaatacctgc tggaaaaccc 780 aaccgacgcg aa aatcgtgg ttggcaaaat tatcgatgct gcccgtgccc gtgaagcggc 840 gcgtcgcgcg cgtgaaatga cccgccgtaa aggtgcgctc gacttagcgg gcctgccggg 900 caaactggca gactgccagg aacgcgatcc ggcgctttcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaagggt aaaatcctca acgttgagaa agcgcgcttc gataagatgc tctcttctca 1080 ggaagtggcg acgcttatca ccgcgcttgg ctgtggtatc ggtcgtgacg agtacaaccc 1140 ggacaaactg cgttatcaca gcatcatcat c 1171

[0059] <210> 3 <211> 1171 <212> DNA <213> Shigella sonnei <400> 3 cgataactcc tataaagtgt ccggcggtct gcacggcgtt ggtgtttcgg tagtaaacgc 60 cctgtcgcaa aaactggagc tggttatcca gcgcgagggt aaaattcacc gtcagatcta 120 cgaacacggt gtaccgcagg caccgttggc ggttaccggc gagactgaaa aaaccggcac 180 catggtgcgt ttctggccca gcctcgaaac cttcaccaat gtgaccgagt tcgaatatga 240 aattctggcg aaacgtctgc gtgagttgtc gttcctcaac tccggcgttt ccattcgtct 300 gcgcgacaag cgcgacggca aagaagacca cttccactat gaaggcggca tcaaggcgtt 360 cgttgaatat ctgaacaaga acaaaacgcc gatccacccg aatatcttct acttctccac 420 tgaaaaagac ggtattggcg tcgaagtggc gttgcagtgg aacgatggct tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgtgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgta ccctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtt agcgccaccg gtgacgatgc gcgtgaaggc ctgattgcgg tcgtttccgt 660 gaaagtgccg gacccgaaat tctcctccca gaccaaagac aaactggttt cttctgaggt 720 gaaatcagcg gttgaacagc agatgaacga actgctggca gaatacctgc tggaaaaccc 780 aaccgacgcg aa aatcgtgg ttggcaaaat tatcgatgct gcccgtgccc gtgaagcggc 840 gcgtcgcgcg cgtgaaatga cccgccgtaa aggtgcgctc gacttagcgg gcctgccggg 900 caaactggca gactgccagg aacgcgatcc ggcgctttcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaagg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaagggt aaaatcctca acgttgagaa agcgcgcttc gataagatgc tctcttctca 1080 ggaagtggcg acgcttatca ccgcgcttgg ctgtggtatc ggtcgtgacg agtacaaccc 1140 ggacaaactg cgttatcaca gcatcatcat c 1171

[0060] <210> 4 <211> 1171 <212> DNA <213> Salmonella typhi <400> 4 cgataactcc tataaagtct ccggtggtct gcacggggtg ggcgtctcgg tagtcaacgc 60 tctgtcgcaa aaactggagc tggttatcca gcgagatggc aaaattcacc gtcagatcta 120 cgagcacggc gtgccgcagg cacccctggc cgtcactggc gataccgata aaaccggcac 180 gatggtacgt ttctggccga gccacgaaac cttcactaac gtcactgaat ttgaatatga 240 gatcctggcg aaacgcctgc gtgaactgtc attcctgaac tcaggcgttt ccatccgcct 300 gcgcgacaag cgcgatggca aagaagatca tttccactac gaaggcggca tcaaggcgtt 360 tgttgaatat ctcaacaaga ataaaacgcc gatccacccg aatatcttct atttctccac 420 cgaaaaagac ggtatcggcg tggaagtagc gctgcagtgg aacgatggtt tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgcgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgca cgctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccaccg gcgacgatgc ccgtgaaggt ctgattgcgg tggtttccgt 660 aaaagtgccg gacccgaaat tctcctcaca gaccaaagat aagctggtct cttccgaggt 720 gaaatcggcg gtagaacagc agatgaacga actgctgagc gaatacctgc tggaaaaccc 780 atctgacgca aaatcgtcg tcggcaaaat tatcgacgcc gcgcgtgcgc gtgaagcggc 840 gcgtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctg gatttagccg gtctgccggg 900 caaactggcg gattgtcagg aacgcgaccc ggcgctgtcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaaaggt aaaatcctta acgtcgagaa agcgcgcttc gacaagatgc tttcctccca 1080 ggaagtggcg acgctgatca ccgcgctggg ctgcggtatc ggtcgcgacg agtacaaccc 1140 ggacaagctg cgctatcaca gcatcatcat c 1171

[0061] <210> 5 <211> 1171 <212> DNA <213> Salmonella parathyphiA <400> 5 cgataactcc tataaagtct ccggtggtct gcacggcgtg ggcgtctcgg tagttaacgc 60 tctgtcgcaa aaactggaac tggttatcca gcgagatggc aaaattcacc gtcagatcta 120 cgagcacggc gtgccgcagg cacccctggc cgtcactggc gataccgata aaaccggcac 180 gatggtacgt ttctggccga gccacgaaac cttcaccaac gtcactgaat ttgaatatga 240 gatcctggcg aaacgcctgc gtgaactgtc attcctgaac tctggcgttt ccatccgcct 300 gcgcgacaag cgcgacggca aagaagatca tttccactac gaaggcggca tcaaggcatt 360 tgttgaatat ctcaacaaga ataaaacgcc gatccatccg aatatcttct acttctccac 420 tgaaaaagac ggtatcggca tcgaagtagc gctgcagtgg aacgatggtt tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgcgacggc ggtactcatc tggcaggctt 540 ccgtgcggcg atgacccgta cgctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccaccg gcgacgatgc ccgtgaaggt ctgattgcgg tggtttccgt 660 aaaagtaccg gatccgaaat tctcctcaca gaccaaagat aagctggtct cttccgaggt 720 gaaatcggcg gtggaacagc agatgaacga actgctgagc gaatacctgc tggaaaaccc 780 atctga cgcg aaaattgtcg tcggcaaaat tatcgacgcc gcgcgtgcgc gtgaagcggc 840 gcgtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctg gatttagccg gtctgccggg 900 caaactggcg gactgccagg aacgcgaccc ggcgctgtcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaaaggt aaaatcctca acgtcgagaa agcgcgcttc gacaagatgc tctcctctca 1080 ggaagtggcg acgctgatta ccgcgctggg ctgcggtatc ggtcgcgacg agtacaaccc 1140 ggacaagctg cgctatcaca gcatcatcat c 1171

[0062] <210> 6 <211> 1171 <212> DNA <213> Salmonella typhimurium <400> 6 cgataactcc tataaagtct ccggcggtct gcacggcgtg ggcgtctcgg tagtcaacgc 60 tctgtcgcaa aaactggaac tggttatcca gcgagatggc aaaattcacc gtcagatcta 120 cgagcacggc gtgccgcagg cacccctggc cgtcactggc gataccgata aaaccggcac 180 gatggtacgt ttctggccga gccacgaaac cttcaccaac gtcactgaat ttgaatatga 240 gatcctggcg aaacgcctgc gtgaactgtc attcctgaac tcaggcgtct ccatccgcct 300 gcgcgacaag cgcgatggca aagaagatca tttccactac gaaggcggca tcaaggcgtt 360 tgttgaatat ctgaacaaga ataaaacgcc gatccacccg aatatcttct atttctccac 420 cgaaaaagac ggtatcggcg tggaagtagc gctgcagtgg aacgatggtt tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgcgacggc ggtactcacc ttgcaggctt 540 ccgtgcggcg atgacccgta cgctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccaccg gcgacgatgc ccgtgaaggt ctgattgcgg tggtttccgt 660 aaaagtaccg gatccgaaat tctcctcaca gaccaaagat aagctggtct cttccgaggt 720 gaaatcggcg gtagaacagc agatgaacga actgctgagc gaatacctgc tggaaaaccc 780 atctga cgcg aaaatcgtcg tcggcaaaat tatcgacgcc gcgcgtgcgc gtgaagcggc 840 gcgtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctc gatttagccg gtctgccggg 900 caaactggcg gactgtcagg aacgcgaccc ggcgctgtcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaaaggt aaaatcctta acgtcgagaa agcgcgcttc gacaagatgc tttcctccca 1080 ggaagtggcg acgctgatca ccgcgctggg ctgcggtatc ggtcgcgacg agtacaaccc 1140 ggacaagctg cgctatcaca gcatcatcat c 1171

[0063] <210> 7 <211> 1171 <212> DNA <213> Salmonella chester <400> 7 cgataactcc tataaagtct ccggcggtct gcacggcgtg ggcgtctcgg tagtcaacgc 60 tctgtcgcaa aaactggaac tggttatcca gcgagatggc aaaattcacc gtcagatcta 120 cgagcacggc gtgccgcagg cacccctggc cgtcactggc gataccgata aaaccggcac 180 gatggtacgt ttctggccga gccacgaaac cttcaccaac gtcactgaat ttgaatatga 240 gatcctggcg aaacgcctgc gtgaactgtc attcctgaac tcaggcgtct ccatccgcct 300 gcgcgacaag cgcgatggca aagaagatca tttccactac gaaggcggca tcaaggcgtt 360 tgttgaatat ctgaacaaga ataaaacgcc gatccacccg aatatcttct acttctccac 420 cgaaaaagac ggtatcggcg tggaagtagc gctgcagtgg aacgatggtt tccaggaaaa 480 tatctactgc tttaccaaca acattccgca gcgcgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgca cgctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agctaaagtc agcgccaccg gcgatgatgc ccgtgaaggt ctgattgcgg tggtttccgt 660 aaaagtgccg gacccgaaat tctcctcaca gaccaaagat aagctggtct cttccgaggt 720 gaaatcggcg gtagaacagc agatgaacga attgctgagc gaatacctgc tggaaaaccc 780 atctgacgcg aaaattgtcg tcggcaatat tatcgatgcc gcgcgtgcgc gtgaagcggc 840 gcgtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctc gatttagccg gtctgccggg 900 caaactggcg gactgccagg aacgcgaccc ggcgctgtcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaagggt aaaatcctta acgtcgagaa agcgcgcttc gacaagatgc tctcctctca 1080 ggaagtggcg acgctgatta ccgcgctggg ctgtggtatc ggtcgtgacg agtacaaccc 1140 ggacaagctg cgctatcaca gcatcatcat c 1171

[0064] <210> 8 <211> 1171 <212> DNA <213> Salmonella enteritidis <400> 8 cgataactcc tataaagtct ctggtggtct gcacggcgtg ggcgtctcgg tagtcaacgc 60 tctgtcgcaa aaactggaac tggttatcca gcgagatggc aaaattcacc gtcagatcta 120 cgagcacggc gtgccgcagg cacccctggc cgtcactggc gataccgata aaaccggcac 180 gatggtacgt ttctggccga gccacgaaac cttcactaac gtcactgaat ttgaatatga 240 gatcctggcg aaacgcctgc gtgaactgtc attcctgaac tctggcgttt ccatccgcct 300 gcgcgacaag cgcgatggca aagaagatca tttccactac gaaggcggca tcaaggcgtt 360 tgttgaatat ctgaacaaga ataaaacgcc gatccacccg aatatcttct acttctccac 420 cgaaaaagac ggtatcggcg tcgaagtagc gctgcagtgg aacgatggtt tccaggaaaa 480 tatctactgc tttaccaaca acattccgca gcgtgacggc ggtactcacc ttgcaggctt 540 ccgtgcggcg atgacccgta cgctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccactg gcgacgatgc ccgtgaaggt ctgattgcgg tggtttccgt 660 aaaagtaccg gacccgaaat tctcctcgca gaccaaagac aagctggtct cttccgaggt 720 gaaatcggcg gtggaacagc agatgaacga actgctgagc gaatacttgc tggaaaaccc 780 atctga cgcg aaaattgtcg tcggcaaaat tatcgacgcc gcgcgtgcgc gtgaagcggc 840 gcgtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctg gatttagcgg gtctgccggg 900 caaactggcg gactgccagg aacgcgaccc ggcgctgtcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaaaggt aaaatcctca acgtcgagaa agcgcgcttc gacaagatgc tctcctctca 1080 ggaagtggcg acgctgatca ccgcgctggg ctgcggtatc ggtcgcgacg agtacaaccc 1140 ggacaagctg cgctatcaca gcatcatcat c 1171

[0065] <210> 9 <211> 1171 <212> DNA <213> Salmonella oranienburg <400> 9 cgataactcc tataaagtct ccggtggtct gcacggcgtg ggcgtctcgg tagtcaacgc 60 tctgtcgcaa aaactggaac tggttatcca gcgagatggc aaaattcacc gtcagatcta 120 cgagcacggc gtgccgcagg cacccctggc cgtcactggc gataccgata aaaccggtac 180 gatggtacgt ttctggccga gccacgaaac cttcaccaac gtcactgaat ttgaatatga 240 gatcctggcg aaacgcctgc gtgaactgtc attcctgaac tcaggcgtct ctatccgcct 300 gcgcgacaag cgcgatggca aagaagatca tttccactac gaaggcggca tcaaggcgtt 360 tgttgaatat ctcaacaaga ataaaacgcc gatccacccg aatatcttct acttctccac 420 cgaaaaagac ggtatcggcg tggaagtagc gctgcagtgg aacgatggtt tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgcgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgca cgctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccaccg gcgacgatgc ccgtgaaggt ctgattgcgg tggtttccgt 660 gaaggtgccg gacccgaaat tctcctcgca gaccaaagat aagctggtct cttccgaggt 720 gaaatcggcg gtagaacagc agatgaacga attgctgagc gaatacctgc tggaaaaccc 780 atctga cgcg aaaattgtcg tcggcaaaat tatcgacgcc gcgcgtgcgc gtgaagcggc 840 cggtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctc gatttagccg gtctgccggg 900 caaactggcg gactgccagg aacgcgaccc ggcgctgtcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaagggt aaaatcctca acgtcgagaa agcgcgcttc gacaagatgc tctcctctca 1080 ggaagtggcg actctgatca ccgcactggg ctgcggtatc ggtcgcgacg agtacaaccc 1140 ggacaagctg cgttaccaca gcatcattat c 1171

<210> 10 <211> 41 <212> DNA <213> Shigella flexneri <400> 10 gaagtcatca tgaccgttct gcaygcnggn ggnaarttyg a 41

<210> 11 <211> 44 <212> DNA <213> Shigella flexneri <400> 11 agcagggtac ggtagtgcga gccrtcnacr tcngcrtcng tcat 44

<210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220><223> Forward primer for amplifying gyrB gene of Salmonella bacteria <400> 12 agcgtgacgg caaagaagat cat 23

<210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220><223> Forward primer for amplifying gyrB gene of Shigella flexneri and S higella boydii <400> 13 agcgtgacgg caaagaagac cac 23

<210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220><223> Forward primer for amplifying gyrB gene of Shigella flexneri <400> 14 agaacaaaac gccgatccac cca 23

<210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220><223> Forward primer for amplifying gyrB gene of Shigella boydii and Shi gella sonnei <400> 15 agaacaaaac gccgatccac ccg 23

<210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220><223> Forward primer for amplifying gyrB gene of Shigella flexneri and S higella sonnei <400> 16 acaagaacaa aacgccgatc cat 23

<210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220><223> Forward primer for amplifying gyrB gene of Shigella boydii <400> 17 acaagaacaa aacgccgatc cac 23

<210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220><223> Reverse primer for amplifying gyrB gene of Shigella and Salmonell a <400> 18 ctggaaacca tcgttccact 20

<210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> 18 <223> Forward primer for amplifying gyrB gene of Shigella and Salmonell a <400> 19 aaagcatttg ttgaatat 18

[0076] <210> 20 <211> 1171 <212> DNA <213> Salmonella paratyphiB <400> 20 cgataactcc tataaagtct ccggcggtct gcacggcgtg ggcgtctcgg tagtcaacgc 60 tctgtcgcaa aaactggaac tggttatcca gcgagatggc aaaattcacc gtcagatcta 120 cgagcacggc gtgccgcagg cacccctggc cgtcactggc gataccgata aaaccggcac 180 gatggtacgt ttctggccga gccacgaaac cttcactaac gtcactgaat ttgaatatga 240 gatcctggcg aaacgcctgc gtgaactgtc attcctgaac tcaggcgtct ccatccgcct 300 gcgcgacaag cgcgacggca aagaagatca tttccactac gaaggcggca tcaaggcgtt 360 tgttgaatat ctcaacaaga ataaaacgcc gatccacccg aatatcttct acttctccac 420 cgaaaaagac ggtatcggcg tcgaagtagc gctgcagtgg aacgatggtt tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgcgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgca cgctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccaccg gcgacgatgc ccgtgaaggt ctgattgcgg tggtttccgt 660 aaaagtaccg gatccgaaat tctcctcaca gaccaaagat aagctggtct cttccgaggt 720 gaaatcggcg gtagaacagc agatgaacga actgctgagc gaatacctgc tggaaaaccc 780 atctg acgcg aaaattgtcg tcggcaaaat tatcgacgcc gcgcgtgcgc gtgaagcggc 840 gcgtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctc gatttagccg gtctgccggg 900 caaactggcg gactgccagg aacgcgaccc ggcgctgtcc gaactgtacc tggtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaaaggt aaaatcctta acgtcgagaa agcgcgcttc gacaagatgc tttcctccca 1080 ggaagtggcg acgctgatca ccgcgctggg ctgcggtatc ggtcgcgacg agtacaaccc 1140 ggacaagctg cgctatcaca gcatcatcat c 1171

[0077] <210> 21 <211> 1171 <212> DNA <213> Escherichia coli O157 <400> 21 cgataactcc tataaagtgt ccggcggtct gcacggcgtt ggtgtttcgg tagtaaacgc 60 cctgtcgcaa aaactggagc tggttattca gcgcgagggt aaaattcacc gtcagatcta 120 cgaacacggt gtaccgcagg caccgctggc ggttaccggc gagactgaaa aaaccggcac 180 catggtgcgt ttctggccca gcctcgaaac cttcaccaat gtgaccgagt tcgaatatga 240 aattctggcg aaacgtctgc gtgagttgtc gttcctcaac tccggcgttt ccattcgtct 300 gcgcgacaag cgtgacggca aagaagacca cttccactat gaaggcggca tcaaagcgtt 360 cgttgaatat ctgaacaaga acaaaacgcc gatccaccca aatatcttct acttctccac 420 cgaaaaagac ggtatcggcg ttgaagtggc gctgcagtgg aacgatggct tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgtgacggc ggtactcacc tggcaggctt 540 ccgtgcggcg atgacccgta ccctgaatgc ctacatggac aaagaaggct acagcaaaaa 600 agccaaagtc agcgccaccg gtgacgatgc gcgtgaaggc ctgattgcgg tcgtttccgt 660 aaaagtgccg gacccgaaat tctcctccca gaccaaagac aaactggttt cttctgaggt 720 gaaatcggcg gttgaacagc agatgaacga actgttggcg gaatacctgc tggaaaaccc 780 aactg acgcg aaaatcgtgg ttggcaaaat tatcgatgct gcccgtgccc gtgaagcggc 840 gcgtcgcgcg cgtgaaatga cccgccgtaa aggtgcgctc gacttagcgg gcctgccggg 900 caaactggca gactgccagg aacgcgatcc ggcgctttcc gaactgtacc ttgtggaagg 960 ggactccgcg ggcggctctg cgaagcaggg gcgtaaccgc aagaaccagg cgattctgcc 1020 gctgaagggt aaaatcctca acgtcgagaa agcgcgcttc gataagatgc tctcttctca 1080 ggaagtggcg acgcttatca ccgcgcttgg ttgtggtatc ggtcgtgacg agtacaaccc 1140 ggacaaactg cgttatcaca gcatcatcat c 1171

[0078] <210> 22 <211> 1171 <212> DNA <213> Yersinia enterocolitica <400> 22 cgataactcg tacaaagttt ccggtggttt gcacggcgta ggtgtatccg ttgttaacgc 60 cctgtctgaa aaactggagc tggtgattcg ccgtgaaggt aaagttcacg agcagactta 120 caagatgggt gtgccgcagg caccattgaa agtggtgggc gaaaccgatc aaaccgggac 180 aaccgtgcgt ttctggccga gcttccagac gttcaccaat aataccgaat tccaatatga 240 aatcctggca aaacgtctgc gtgagctatc gttcctgaac tctggggttt caatcaagct 300 gaaagacaaa cgtaatgaca aagaagacca cttccattac gaaggcggta tcaaagcgtt 360 tgttgagtat ctgaacaaaa acaaaaaccc gatccacccg aaagtgttct atttctccac 420 cgtgaaagat gatatcggtg tggaagtggc attgcagtgg aacgatggtt tccaggaaaa 480 tatttactgt ttcaccaaca acattccaca gcgcgatggg gggactcact tagtcgggtt 540 ccgtacggcg atgactcgta ccctgaatag ctacatggat aaagaaggtt acagtaaaaa 600 agcgaaaatc agtgcaaccg gtgatgatgc ccgtgaagga ttgattgctg tggtttccgt 660 gaaagtgcca gaccctaaat tctcctcaca gaccaaagat aaactggttt cttctgaggt 720 aaaaactgcg gtcgaaacgc tgatgaacga gaagctggtt gagtatttac tggaaaaccc 780 aac cgacgcc aaaatcgtgg ttggcaaaat tattgacgca gcccgtgctc gtgaagctgc 840 gcgtaaagcc cgtgaaatga cgcgccgtaa aggtgcgctg gatttggctg gcttaccagg 900 caaactggct gactgtcagg aacgtgaccc agcattgtcc gaactctact tagtggaagg 960 ggactcagcg ggcggctctg cgaaacaagg ccgtaaccgt aaaaatcagg ctattttgcc 1020 gctgaaaggt aaaattctga acgtcgagaa agcgcgtttt gacaaaatgc tttcctcgca 1080 ggaagtggca acactgatca ccgcgttggg ttgtggtatt ggacgggatg aatataaccc 1140 ggacaaattg cgttatcaca atatcattat c 1171

[0079] <210> 23 <211> 1137 <212> DNA <213> Yersinia ruckeri <400> 23 ggcgggttgc atggcgtggg tgtgtcagtt gttaacgctc tgtctgaaaa actggagttg 60 gtgattcgcc gtgaaggtaa agttcacgag cagacttaca aaatgggtgt gccgcaagca 120 ccactaaaaa tggtgggtga aaccgatcag accgggacta cggtgcgttt ctggccgagc 180 ttccagacct tcaccaataa caccgaattt caatacgaaa ttctggcgaa acgcttgcgt 240 gagctgtcgt tcctgaactc cggggtttca atcaaactga aagacaaacg taacgacaaa 300 gaagaccact tccattacga aggcggtatc aaagcgtttg ttgagtatct gaacaaaaac 360 aaaaccccga tccatccgaa agtgttctat ttctctacta tgaaagatga catcggtgtg 420 gaagtggcct tgcagtggaa tgatggtttc caagaaaata tttactgctt taccaacaac 480 attccacagc gcgatggcgg tacccatttg gttggtttcc gtacggcgat gacgcgtacg 540 ctgaacagct atatggataa agaaggctac agcaagaaag ccaagatcag tgccactggg 600 gacgatgccc gtgaaggcct gattgccgtg gtatcggtta aagtgccgga tcctaaattc 660 tcctcacaga ctaaagataa gctggtttct tccgaagtga aaaccgcggt tgaaacgctg 720 atgaacgaga agttggtcga gtatttgctg gaaaacccaa gcgacgccaa aatcgtggtc 780 ggcaagatta ttgatgcggc tcgcgctcgt gaagctgcac gcaaagcccg tgaaatgacg 840 cgtcgtaaag gggcattgga tctcgccggt ctgcctggca agttggcgga ctgtcaggaa 900 cgcgatccgg cattatctga actttaccta gtggaagggg actcggcggg cggatcggca 960 aaacaaggcc gtaaccgtaa gaatcaggcg attctaccgc tgaaaggtaa gattctgaac 1020 gttgagaaag cgcgttttga taagatgctg tcttcgcagg aagtggccac gctgattact 1080 gcgctgggct gcggtattgg ccgggatgaa tataacccgg acaagttgcg ctatcac 1137

[0080] <210> 24 <211> 1171 <212> DNA <213> Enterobacter cloacae <400> 24 cgataactcc tataaagtct ccggcggcct gcacggcgta ggtgtttccg tggtaaacgc 60 cctgtcgcag aaactggaac tggttatcca gcgcgaaggc aaaattcacc gccagatcta 120 tcagcacggt gtgcctgaag cgccgctggc cgtgaccggc gataccgaaa aaaccggtac 180 catggtgcgt ttctggccga gcctcgaaac cttcaccaac gtcaccgagt tcgagtacga 240 catcctggca aaacgcctgc gtgaactgtc gttcctgaac tccggcgtct caattcgtct 300 gcgtgacaaa cgcgacaaca aagaagacca cttccactat gaaggtggta tcaaagcgtt 360 cgttgaatac ctgaacaaga acaaaacgcc aattcaccca aatatcttct atttctctac 420 ggaaaaagac ggtatcggcg tggaagtggc tctgcagtgg aacgacggtt tccaggaaaa 480 catctactgc ttcaccaaca acattccaca gcgtgacggt ggtacgcacc ttgcgggctt 540 ccgtgcggcg atgacccgta ccctgaacgc ctacatggac aaagaaggct acagcaaaaa 600 agcgaaagtc agcgccaccg gtgatgacgc ccgtgaaggc ctgattgctg ttgtctccgt 660 gaaagtgccg gatccgaagt tctcctcaca gaccaaagac aagctggtct cctctgaggt 720 gaaatcggcg gttgaacagc agatgaacga actgctgagc gactacctgc aggaaaaccc 780 gaacga cgcg aaaatcgttg tcggtaaaat tatcgatgca gcgcgtgccc gtgaagcggc 840 gcgtaaagcc cgtgaaatga cccgccgtaa aggcgcgctg gacttagcgg gtctgccggg 900 caaactggct gactgccagg aacgcgaccc ggcgctgtcc gaactgtacc ttgtggaagg 960 ggactccgcg ggcggttctg cgaagcaggg ccgtaaccgt aagaaccagg ccatcctgcc 1020 gttgaaaggt aaaatcctca acgttgagaa agcgcgtttc gacaaaatgc tctcttctca 1080 ggaagtggcg acgctgatca ccgcgctggg ctgcggcatt ggtcgtgacg aatacaaccc 1140 ggacaagctg cgctatcaca gcatcatcat t 1171

[0081] <210> 25 <211> 1171 <212> DNA <213> Enterobacter aerogenes <400> 25 tgataactcc tataaagtgt ccggcggtct gcacggcgta ggcgtctcgg tggttaacgc 60 cctgtcgcag aagctggagc tggttatcca acgcgataac aaagttcaca aacaaattta 120 tgagcacggt gtgccgcagg caccgctggc ggtaaccggt gaaaccgaaa gcaccggtac 180 catggtgcgt ttctggccaa gcctggaaac ctttaccaac gtcactgaat tcgaatacga 240 aatcctggcg aaacgtctgc gcgagctgtc gttcctcaac tccggggtct ctatccgcct 300 gcgcgataag cgcgacggca aagaagacca tttccactac gaaggcggca tcaaggcgtt 360 tgttgagtat ctcaacaaga acaaaacgcc gatccacccg aatatcttct atttctccac 420 cgaaaaagac ggtatcggcg ttgaagtggc gctgcagtgg aacgatggtt tccaggaaaa 480 catctactgc tttaccaaca acattccgca gcgcgacggc ggtactcacc tggcgggctt 540 ccgcgcggcg atgacccgta ccctgaacgc ctacatggat aaagaaggct acagcaaaaa 600 ggcgaaagtc agcgctaccg gcgacgatgc gcgtgaaggc ctgattgccg tggtttccgt 660 aaaggtgccg gatccgaagt tctcctctca gactaaagac aagctggtct cctccgaggt 720 gaaatcggcg gttgaacagc agatgaacga actgctgagc gaatacctgc tggaaaaccc 780 gtcc gatgcg aaaatcgtgg tcggcaaaat tatcgacgcc gcgcgtgcgc gtgaagccgc 840 gcgtcgcgcc cgtgaaatga cccgtcgtaa aggcgcgctt gacctggcag gcctgccggg 900 caaactggcg gattgccagg aacgcgaccc ggcgctgtct gaactgtacc tcgtggaagg 960 ggactccgcg ggcggctctg cgaaacaggg ccgtaaccgt aagaaccagg ctatcctgcc 1020 gctgaagggt aaaatcctta acgttgagaa agcccgcttc gataaaatgc tctcttctca 1080 ggaagtagcc acgcttatca ccgcgctggg ctgcggcatc ggccgcgatg agtacaaccc 1140 ggataaactg cgttatcaca gcatcatcat c 1171

[0082] <210> 26 <211> 660 <212> DNA <213> Vibrio alginolyticus <400> 26 gataactcat acaaagtatc gggtggtctt cacggggtag gtgtttcagt agtaaacgca 60 ctatcagaga aagttgagct aacgattcat cgtggtggcc atatccatac gcaaacctac 120 cgccatggtg agcctcaagc gccactagcc gttgtgggtg atacggataa aaccggtaca 180 caaattcgtt tctggccaag tgccgagacg ttctctaaca ctgagttcca ctatgacatt 240 ctggcgaaac gcctgcgtga actgtcattc ctgaactctg gtgtgtcgat caaattggtt 300 gatgaacgtg aagcggacaa acatgatcac ttcatgtatg aaggtggtat tcaagcgttc 360 gttgatcacc taaacaccaa caaaacgcca atcatcgaaa aaatcttcca ctttaactct 420 gagcgtgaag acggcatttc agttgaagtg gcgatgcaat ggaacgatgg tttccaagag 480 aacatcttct gctttaccaa caatatccca cagcgtgatg gtggtactca ccttgctggt 540 ttccgtgctg cgctaacacg tacattgaac agctttatgg ataaagaagg tttctcgaag 600 aaagcgaaaa cagcgacttc aggcgacgat gcgcgtgaag gtctaactgc ggttgtttcg 660

[0083] <210> 27 <211> 1401 <212> DNA <213> Vibrio campbellii <400> 27 acggacgacg gcactggtct tcaccacatg gtcttcgagg tggtggataa ctcaattgat 60 gaagcgttgg caggtcactg taaagacatc gttgtgacaa ttcatgagga caactcggtt 120 tcagttacgg atgatggacg tggcattcca acagaaatgc acccagaaga aaacgtatct 180 gctgcagaag ttatcatgac ggtacttcac gctggtggta agttcgatga taattcatac 240 aaagtatcag gcggtctaca cggcgtaggt gtttcagtag taaacgcact gtctgagaaa 300 gtggttctga ctatccaccg cggcggtcat atccatacgc aaacttacca tcatggtgag 360 cctcaagcgc cactagcagt aattggtgat actgaaaaaa cgggtacaca aatccgtttc 420 tggccaagtg cagaaacatt ctcgaacaca gaatttcact acgacatcct agcgaagcgt 480 ctacgtgaac tttccttcct gaactctggt gtttcaatca aactggttga tgagcgcgaa 540 gcagacaaga gcgaccactt catgtttgaa ggtggtatcc aagcgttcgt tgagcaccta 600 aacactaaca aaacaccaat catcgagaaa atcttccact tcgactttga gcgcgaagat 660 ggcatctcgg tagaagttgc gatgcagtgg aatgacggtt tccaagagaa catctactgt 720 tttactaaca acatcccaca acgtgacggt ggtactcacc ttgccggttt ccgtgcggcg 780 ctaacgcgt a cactgaactc tttcatggac aaagaaggct tctctaagaa agcgaaaaca 840 gcaacgtctg gtgatgacgc gcgtgaaggt ctaactgcgg ttgtttcagt taaagtgcca 900 gatccgaagt tctctagcca aacgaaagac aaactggttt cttctgaagt gaagtcagcg 960 gttgaatcag caatgggtga gaaactgtct gagttcctga ttgagaaccc gacagaagcg 1020 aagatggttt gttcgaaaat catcgacgca gctcgtgctc gtgaagctgc gcgtaaagct 1080 cgtgaaatga ctcgtcgtaa aggcgctcta gacctagcag gtctaccagg caaacttgca 1140 gactgtcagg aaaaagatcc tgcactctct gaactgtaca tagtggaggg tgattcggca 1200 ggcggctccg caaaacaagg ccgtaaccgt aagaaccaag caatcctacc gctaaaaggt 1260 aagattctta acgtagaaaa agcgcgattc gacaagatgc tttcttcttctca agaggtagca 1320 acgctgatta ctgcactagg ttgtggtatc ggtcgtgacg agtacaaccc ggaca

[0084] <210> 28 <211> 1401 <212> DNA <213> Vibrio diazotrophicus <400> 28 actgatgatg gcaccggtct acaccacatg gtttttgagg tggtggataa ctcaatagat 60 gaagcgttag caggtcactg taaagacatc atcgttacta ttcacgaaga taactcagta 120 tcggttagcg atgacggccg tggtatccca actgaactgc acgaagaaga aaatgtttct 180 gcggcagaag ttatcatgac agtactgcac gctggtggta agttcgatga taactcttac 240 aaagtatcag gtggtctgca tggcgtaggt gtgtcagtgg ttaacgcact atcagaaaaa 300 gtgcttctga ctatttaccg cggtggtcac atccatactc aaacctatcg ccatggtgtg 360 cctcaagcgc cactaagcgt tgttggtgat actgaaaaaa caggtacaac ggttcgtttc 420 tggccaagtg ctgacacctt taccaatatc gaattccatt acgatattct tgctaaacgt 480 ctacgtgagc tttcattcct aaactcaggc gtatcaatca aactgattga tgagcgtgaa 540 gaagataaac aagaccactt tatgtatgaa ggtggtatcc aagcgtttgt tactcacctt 600 aaccgcaaca aaactccgat tcatgagaaa gtgttccact ttaactcaga acgtgaagac 660 ggtattagcg ttgaagtagc gatgcagtgg aacgacggtt tccaagaagg tatttactgc 720 tttaccaaca acatcccaca gcgtgatggt ggtactcact tagccggttt ccgtgcagcg 780 ttaac tcgta cgttaaacac ctacatggat aaagaaggct acagcaagaa agccaaacag 840 cgaacatctg gtgacgatgc gcgtgaaggt ttgactgcag ttgtctcggt taaagttccg 900 gatccaaaat tctcaagcca aaccaaagac aaactggttt cttctgaagt gaaatctgca 960 gttgaatctg caatgggcga gaaacttaac gagttcctag ctgagcatcc ttctgaagca 1020 aaaatggtgt gtagcaaaat tatcgatgcg gcacgtgcac gtgaagcagc gcgtaaagct 1080 cgtgagatga ctcgtcgtaa aggcgcgttg gaccttgctg gtcttccagg taaacttgct 1140 gactgtcagg aaaaagatcc tgcactgtct gaactgtaca tagtggaggg tgactctgct 1200 ggcggttcag ctaagcaggg acgtaaccga aagaaccaag caattcttcc gctgaaaggt 1260 aagattctaa acgttgaaaa agcacgtttt gataaaatgc tttcttctctca ggaagtggca 1320 acactgatta ctgcattagg ttgtggtatc ggtcgcgatcat aatacaacca cag catcat 1401

[0085] <210> 29 <211> 1389 <212> DNA <213> Vibrio gazogenes <400> 29 ggtacgggtc tgcaccacat ggtctttgag gtggtagata actcaattga tgaagcgtta 60 gcgggttact gtaaagatat catcgtgacg attcacgaag ataactccgt ctcagtcagt 120 gatgacggtc gtggtattcc gactgagctt cacgaggaag aaaatgtgtc tgcggcagaa 180 gttatcatga cagtgctgca cgcaggcggg aaatttgacg ataactcgta caaagtttcc 240 ggtggtttgc atggtgtggg tatctcggtc gtgaacgctt tgtctgaaaa ggttgccctg 300 acaatttatc gtagtggcca catttatact cagacttatc atcacggtgt gccacagtca 360 ccattggctt ccgtaggaga taccgaaaag tccggaaccc tggtccggtt ctggccgagt 420 agtgaaacct ttaccaatat tgaattccat tatgaaattc ttgccaaacg cctgcgtgag 480 ttgtctttcc ttaactccgg tgtttcaatc aaactcattg atgaacgtga tagcaaacag 540 gatcacttca ggtatgaagg cggtattcag gaattcgtat cgcacctgaa ccgcaataaa 600 acaccgatcc atgaccgtgt cttccacttt aatcaggagc gggaagatgg cattacggtt 660 gaagtcgcaa tgcagtggaa tgacagtttt caggaaagta ttttctgctt taccaataac 720 attcctcagc gtgatggcgg gacgcacatg gctggtttcc gggcggcatt gactcggacg 780 ctgaacacgt tcatggacaa agaaggcttc agcaaaaaag agaaaacatc gacatccggt 840 gatgatgccc gtgaagggtt gacggctgtt atctcagtga aagtgccgga tcctaaattc 900 tccagccaaa ctaaagacaa actggtttct tcagaagtga aatctgcggt tgaaaccgcg 960 atgggtgaaa aattatcaga gtttctgatt gagaacccga atgaagccaa aattgtttgt 1020 tcgaaaatta ttgatgcagc gcgtgctcgt gaagcggctc gtaaagcgcg cgagatgaca 1080 cgtcgtaaag gcgcgttgga tctcgcgggt ctgccgggca aactggccga ctgtcaggaa 1140 aaagacccag ccctttctga actatatatt gtggagggtg actcggctgg tggctctgcc 1200 aaacaaggcc gaaaccggaa aaatcaggct attttgccgc tgaaaggtaa gatccttaac 1260 gttgaaaaag cccgctttga caaaatgcta tcgtctcagg aagtagcaac attgattacc 1320 gcgttaggtt gcggcattgg ccgtgacgaa tataacccgg acaaactgcg ctatcacaat 1380

<210> 30 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Shigella flexneri, Shigella sonnei, Shige lla boydii, E coli O157, Enterobacter cloacae and Enterobacter aerogenes < 400> 30 caagaacaaa acgcc 15

<210> 31 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Shigella flexneri <400> 31 attggcgttg aagtg 15

<210> 32 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Shigella boydii and Salmonella paratyphiA <400> 32 cgatccatcc gaata 15

<210> 33 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Shigella sonnei and Salmonella paratyphiA <400> 33 ttctccactg aaaaaga 37

<210> 34 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Salmonella typhi, Salmonella paratyphiA, Salmonella paratyphiB, Salmonella enteritidis, Salmonella chester, Salmonella oranienburg and Salmonella typhimurium <400> 34 aacaagaata aaacgcc 17

<210> 35 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Salmonella paratyphiB and Salmonella ente ritidis <400> 35 cggcgtcgaa gta 13

<210> 36 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Salmonella typhi, Salmonella chester, Sal monella oranienburg and Salmonella typhimurium <400> 36 cggcgtggaa gta 13

<210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Salmonella typhi, Salmonella paratyphiA, Salmonella paratyphiB and Salmonella oranienburg <400> 37 tgaatatctc aacaagaat 19

<210> 38 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Salmonella typhi, Salmonella typhimurium and Salmonella aerogenes <400> 38 atcttctatt tctccac 17

<210> 39 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> DNA probe for detecting Salmonella typhi, Salmonella paratyphi B, Salmonella enteritidis, Salmonella chester, Salmonella oranienburg, Sal monella typhimurium, Escherichia coli O157 and Enterobacter aerogenes <400> 39 acggtatcgg cgt 13

[Brief description of the drawings]

BRIEF DESCRIPTION OF DRAWINGS FIG. 1 is a diagram showing aligned nucleotide sequences of regions in the gyrB gene of three species of Shigella and six species of Salmonella.

FIG. 2 is a continuation of FIG. 1;

FIG. 3 is a continuation of FIG. 3;

[Fig. 4] 3 species of Shigella, 7 species of Salmonella, Escherichia coli O15
FIG. 7 is a view showing aligned nucleotide sequences of regions in the gyrB gene of two species of Yersinia, two species of Enterobacter and four species of Vibrio.

FIG. 5 is a continuation of FIG. 4;

FIG. 6 is a continuation of FIG. 5;

FIG. 7 is a continuation of FIG. 6;

FIG. 8 is a continuation of FIG. 7;

FIG. 9 is a continuation of FIG. 8;

FIG. 10 is a continuation of FIG. 9;

FIG. 11 is a continuation of FIG. 10;

FIG. 12 is a view showing a result of a test (a pattern of a positive spot) using the DNA chip of Example 4.

FIG. 13 is a view showing a result of a test (a pattern of a positive spot) using the DNA chip of Example 4.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/566 (C12Q 1/68 A33 / 569 C12R 1:42) // (C12Q 1/68 (C12Q 1/68 A C12R 1:42) C12R 1:01) (C12Q 1/68 C12N 15/00 ZNAA C12R 1:01) F (72) Inventor Masao Fukushima 51 Komiyacho, Hachioji-shi, Tokyo SRL Hachioji Laboratory Co., Ltd. (72) Inventor Kenichi Kakinuma 51 Komiyacho, Hachioji-shi, Tokyo Inside SRL Hachioji Laboratory Co., Ltd. (72) Inventor Ryuji Kawaguchi 51 Komiyacho, Hachioji-shi, Tokyo Inside SRL Hachioji Laboratory Co., Ltd.

Claims (29)

[Claims] 1. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing or a complementary strand of the nucleic acid or a fragment thereof, wherein the nucleic acid has the nucleotide sequence shown in SEQ ID NOs: 2 to 9 or a complementary strand thereof. A Shigella flexneri measurement nucleic acid comprising a fragment having a base different from the base in the fragment in at least one of the corresponding regions. 2. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 2 in the sequence listing or a complementary strand of the nucleic acid or a fragment thereof, wherein the nucleic acid has the nucleotide sequence shown in SEQ ID NO: 1 or 3 to 9 or a complement thereof. A nucleic acid for measuring Shigella Boydii comprising a fragment having a base different from the base in the fragment in at least any corresponding region of the chain. 3. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 3 in the sequence listing, a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1 or 2 or 4 to 9, or A Shigella zonei measurement nucleic acid comprising a fragment having a base different from the base in the fragment in at least one corresponding region of the complementary strand. 4. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 4 in the sequence listing or a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 3 or 5 to 9 or A nucleic acid for Salmonella typhi determination, comprising a fragment having a base different from the base in the fragment in at least any corresponding region of the complementary strand. 5. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing, a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the nucleotide sequence shown in SEQ ID NOs: 1 to 4 or 6 to 9 or A nucleic acid for Salmonella paratyphi A measurement, comprising a fragment having a base different from a base in the fragment in at least one of the corresponding regions of the complementary strand. 6. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 6 in the sequence listing or a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 5 or 7 to 9 or A nucleic acid for Salmonella typhimurium measurement, comprising a fragment having a base different from the base in the fragment in at least any corresponding region of the complementary strand. 7. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing or a complementary strand of the nucleic acid or a fragment thereof, the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 6 or 8 or 9 or A Salmonella-Chester measurement nucleic acid comprising a fragment having a base different from the base in the fragment in at least one of the corresponding regions of the complementary strand. 8. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing or a complementary strand of the nucleic acid or a fragment thereof, wherein the nucleic acid has the nucleotide sequence shown in SEQ ID NOS: 1 to 7 or 9, or a complement thereof. A nucleic acid for Salmonella enteritidis measurement, comprising a fragment having a base different from the base in the fragment in at least any corresponding region of the chain. 9. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing or a complementary strand of the nucleic acid or a fragment thereof, wherein the nucleic acid has the nucleotide sequence shown in SEQ ID NOS: 1 to 8 or a complementary strand thereof. A nucleic acid for Salmonella oranienberg measurement, comprising a fragment having a base different from the base in the fragment in at least one of the corresponding regions. 10. A nucleic acid having a nucleotide sequence shown in SEQ ID NOs: 20 to 29 in the sequence listing or a fragment having a base different from the base in the fragment in at least any corresponding region of a complementary strand thereof. 10. The nucleic acid according to any one of 1 to 9. 11. The method according to claim 1, wherein the number of bases is 8 to 50.
0. The nucleic acid according to any one of 0. 12. The method according to claim 1, which is a primer for nucleic acid amplification.
12. The nucleic acid according to any one of claims 11 to 11. 13. The nucleic acid according to claim 12, which is a forward primer, wherein the different base is located at the 3 ′ end of the nucleic acid. 14. The nucleic acid according to any one of claims 1 to 11, which is used as a nucleic acid probe. 15. A method comprising the steps of: immobilizing a plurality of nucleic acid probes comprising a plurality of nucleic acids according to claims 1 to 9 on a support; A plurality of nucleic acid chips for detecting bacteria selected from the group consisting of Salmonella typhi, Salmonella paratyphi A, Salmonella typhimurium, Salmonella chester, Salmonella enteritidis, and Salmonella oranienburg. 16. The nucleic acid chip according to claim 15, wherein a plurality of nucleic acids among the nucleic acids having the nucleotide sequences shown in SEQ ID NOs: 30 to 39 are immobilized on the support as the nucleic acid probes. 17. Shigella flexneri, Shigella boidi, Shigella zonei, Salmonella chifi, wherein at least 9 kinds of nucleic acids according to any one of claims 1 to 9 are immobilized on a support. A nucleic acid chip for detecting Salmonella paratyphi A, Salmonella typhimurium, Salmonella chester, Salmonella enteritidis and Salmonella oranienberg. 18. The nucleic acid chip according to claim 17, wherein a nucleic acid having a base sequence shown in SEQ ID NOS: 30 to 39 is immobilized on a support as the nucleic acid probe. 19. The nucleic acid probe having a base number of 8 to 25.
The nucleic acid chip according to any one of claims 15 to 18, wherein 20. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1 of the sequence listing or a fragment thereof, wherein the fragment is contained in at least one of the corresponding regions of the nucleic acid having the nucleotide sequence shown in SEQ ID NOs: 2 to 9. A method for detecting Shigella flexneri, comprising amplifying a fragment having a base different from the base therein and determining the base sequence of the fragment. 21. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 2 in the sequence listing or a fragment thereof, which is contained in at least a corresponding region of the nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1 or 3 to 9. A method for detecting Shigella boidi comprising amplifying a fragment having a base different from the base in the fragment and determining the base sequence of the fragment. 22. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 3 of the sequence listing or a fragment thereof, which corresponds to at least any one of the nucleic acids having the nucleotide sequence shown in SEQ ID NO: 1 or 2 or 4 to 9 A method for detecting Shigella zonei, comprising amplifying a fragment having a base different from the base in the fragment and determining the base sequence of the fragment. 23. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 4 or a fragment thereof, which corresponds to at least any one of the nucleic acids having the nucleotide sequence shown in SEQ ID NOS: 1 to 3 or 5 to 9 in the sequence listing A method for detecting Salmonella typhi, comprising amplifying a fragment having a base different from the base in the fragment, and determining the base sequence of the fragment. 24. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 5 of the sequence listing or a fragment thereof, which corresponds to at least any one of the nucleic acids having the nucleotide sequence shown in SEQ ID NOS: 1 to 4 or 6 to 9 A method for detecting Salmonella paratyphi A, comprising amplifying a fragment having a base different from the base in the fragment, and determining the base sequence of the fragment. 25. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 6 or a fragment thereof, which corresponds to at least any one of the nucleic acids having the nucleotide sequence shown in SEQ ID NOs: 1 to 5 or 7 to 9 in the sequence listing A method for detecting Salmonella paratyphimurium, comprising: amplifying a fragment having a base different from the base in the fragment, and determining the base sequence of the fragment. 26. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing or a fragment thereof, which corresponds to at least any one of the nucleic acids having the nucleotide sequence shown in SEQ ID NOS: 1 to 6 or 8 or 9. A method for detecting Salmonella Chester, comprising amplifying a fragment having a base different from the base in the fragment, and determining the base sequence of the fragment. 27. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing or a fragment thereof, which is contained in at least one of the corresponding regions of the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 7 or 9. A method for detecting Salmonella enteritidis, comprising amplifying a fragment having a base different from the base in the fragment and determining the base sequence of the fragment. 28. A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing or a fragment thereof, wherein the fragment is present in at least one of the corresponding regions of the nucleic acid having the nucleotide sequence shown in SEQ ID NOS: 1 to 8. A method for detecting Salmonella oranienberg, comprising amplifying a fragment having a base different from that in the base and determining the base sequence of the fragment. 29. A nucleic acid used for amplifying the nucleic acid according to any one of claims 20 to 28, which has a nucleotide sequence identical or complementary to any terminal region of the nucleotide sequence of the nucleic acid region to be amplified. Primer for nucleic acid amplification consisting of nucleic acid.